Effect of Bimatoprost on Intraocular Pressure in Prostaglandin FP Receptor Knockout Mice

Jonathan G. Crowston,1 James D. Lindsey,1 Christy A. Morris,1 Larry Wheeler,2 Felipe A. Medeiros,1 and Robert N. Weinreb1

PURPOSE. To determine the effect of bimatoprost on intraocular ing are not known, it has been suggested that bimatoprost pressure in the prostaglandin FP receptor knockout mouse. fundamentally differs from latanoprost, by lowering IOP ETHODS ␮ ␮ through mechanisms that are independent of FP receptor sig- M . The IOP response to a single 1.2- g(4 L) dose of 5 bimatoprost was measured in the treated and untreated fellow naling. However, there is considerable controversy regarding eyes of homozygote (FPϩ/ϩ, n ϭ 9) and heterozygote (FPϮ, n the role of FP receptor signaling, because bimatoprost has ϭ been shown to bind and activate the FP receptor in cultured 10) FP-knockout mice, as well as in wild-type C57BL/6 mice 6 (FPϩ/ϩ, n ϭ 20). Serial IOP measurements were also per- human trabecular meshwork and human ciliary muscle cells. Measurement of aqueous humor dynamics in the mouse eye formed after topical bimatoprost in a separate generation of 7 homozygous FP-knockout mice and wild-type littermate con- has been detailed recently. The FP knockout mouse, gener- trol animals (n ϭ 4 per group). Aqueous humor protein ated by homologous translocation with a target vector that ␤ concentrations were measured to establish the state of the replaces the second exon of the FP gene with the -galactosi- blood–aqueous barrier. Tissue, aqueous humor and vitreous dase and neomycin-resistance gene, was produced to demonstrate the critical role of the interaction of PGF2␣ with FP concentrations of bimatoprost, latanoprost, and their C-1 free 8 acids were determined by liquid chromatography and tandem receptors in the initiation of parturition in pregnant mice. We mass spectrometry. recently demonstrated that a single application of latanoprost had no effect on IOP in the FP homozygous knockout mice and RESULTS. A significant reduction in IOP was observed in the a diminished effect in the heterozygous knockout mice, com- bimatoprost-treated eye of wild-type mice at 2 hours, with a pared with C57 BL/6 background control mice.9 This indicates mean difference and 95% confidence interval (CI) of the dif- Ϫ Ϫ Ϫ that the FP receptor is necessary for the acute IOP response to ference in means of 1.33 mm Hg ( 0.81 to 1.84). Bimato- latanoprost. The FP-knockout mouse also provides the oppor- prost did not lead to a significant reduction in IOP in either the Ϫ Ϫ ϩ tunity to determine whether bimatoprost lowers IOP in the heterozygous knockout 0.36 mm Hg ( 0.82 to 0.09) or absence of the FP receptor. homozygous FP-knockout mice 0.25 mm Hg (Ϫ0.38 to ϩ0.89). The lack of an IOP response in the FP-knockout mice was not a consequence of blood–aqueous barrier breakdown, as there was no significant difference in aqueous humor protein con- METHODS centration between treated and fellow eyes. Tissue and aqueous humor concentrations of bimatoprost, latanoprost, and Animal Husbandry their C-1 free acids indicate that latanoprost, but not bimato- All experiments were performed in compliance with the ARVO State- prost, is hydrolyzed in the mouse eye after topical administra- ment for the Use of Animals in Ophthalmic and Vision Research. Mice tion. lacking the gene encoding the FP receptor were obtained as a gift from CONCLUSIONS. An intact FP receptor gene is critical to the IOP Shuh Narumiya (Kyoto University, Japan). Homozygous knockout fe- response to bimatoprost in the mouse eye. (Invest Ophthalmol males fail to initiate parturition.8 For this reason, heterozygous (female) Vis Sci. 2005;46:4571–4577) DOI:10.1167/iovs.05-0723 and homozygous (male) mating pairs were used to generate an F1 generation. C57BL/6 mice constitute the founder species of the FP- knockout mice and were used as wild-type control subjects. Mice were opically administered prostaglandin (PG) F and its ana- 2␣ bred and housed in clear cages covered loosely with air filters and logues lower IOP in humans and nonhuman primates1,2 by T containing white pine shavings for bedding. The environment was increasing the uveoscleral outflow of aqueous humor.3 Bimato- kept at 21°C in a 12-hour light–dark cycle (light, 6:00 AM to 6:00 PM). prost, the C-1 ethyl amide of 17-phenyl-prostaglandin F ,a 2␣ All mice were fed ad libitum. Animal ages ranged from 6 to 9 months. structural analogue, is also a potent ocular hypotensive.4 Al- though the molecular mechanisms responsible for IOP lower- Drug Application To facilitate administration of eye drops, mice were restrained in a From the 1Hamilton Glaucoma Center and Department of Oph- conical plastic sleeve (Decapicone; Braintree Scientific Inc., Braintree, thalmology, University of California San Diego, La Jolla, California; and MA). Four microliters bimatoprost 0.03% (Allergan, Irvine, CA) was 2Allergan USA, Irvine, California. applied topically to the right eye. Dose–response curve and time Supported in part by the National Eye Institute EY05990 (RNW). course were performed in C57BL/6 mice to determine the optimum Submitted for publication June 8, 2005; revised July 21, 2005; dose of drug and the time of maximum IOP lowering. accepted October 13, 2005. Disclosure: J.G. Crowston, Alcon Inc. and Pfizer, Inc. (R); J.D. Lindsey, None; C.A. Morris, None; L. Wheeler, Allergan USA (E); Anesthesia F.A. Medeiros, None; R.N. Weinreb, Allergan USA (C) The mice were anesthetized by intraperitoneal injection of a mixture of The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertise- ketamine (100 mg/kg, Ketaset; Fort Dodge Animal Health, Fort Dodge, ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. IA) and xylazine (9 mg/kg, TranquiVed; Vedco Inc., St. Joseph, MO), as 10 Corresponding author: Robert N. Weinreb, Hamilton Glaucoma previously described. Each mouse was monitored carefully to assess Center, University of California San Diego, 9500 Gilman Drive, La Jolla, the state of anesthesia. If the mouse did not respond to pinching of the CA 92093-0946; [email protected]. back skin, it was placed on the platform for IOP measurement.

Downloaded from iovs.arvojournals.org on 10/02/2021 4572 Crowston et al. IOVS, December 2005, Vol. 46, No. 12

Determination of Mouse Genotype by PCR aqueous humor was aspirated through a microneedle attached to a 10-␮L syringe-equipped micropump (Hamilton, Reno, NV; and Micro 4, DNA was extracted from 8-mm tail biopsy specimens of anesthetized World Precision Instruments). The Bradford protein assay (Bio-Rad adult mice using a kit (69504; Qiagen, Valencia, CA) according to the Laboratories, Hercules, CA) was used according to the manufacturer’s manufacturer’s guidelines. The oligonucleotide primers used to detect guidelines. Aqueous humor samples (3 ␮L) were diluted in 97 ␮L homologous translocation were 5F (GCCCATCCTTGGACACCGAGA), phosphate-buffered saline. Eighty microliters of this solution was then 6R (AGAGTCGGCAAGCTGTGACTT) and NeoII (TGATATTGCTGAA- mixed with 20 ␮L assay solution (Bio-Rad) in separate wells of a 96-well GAGCTTGG). Ampliﬁcation was performed over 35 cycles of 94°C for microtiter plate. Absorption was measured at 595 nm with a microtiter 30 seconds, 65°C for 30 seconds, and 75°C for 10 minutes. PCR plate reader (SpectraMax 250). Aqueous protein concentration was products were analyzed by electrophoresis in 1% agarose gels. The determined from linear regression curves derived from bovine serum PCR product sizes were 700 bp for the FP receptor gene and 450 bp, albumin standards. corresponding to the LacZ/neo(r) cassette. DNA from the heterozygote Ϫ Ϫ Fp / mice therefore produces two bands (700 and 450 bp) and DNA Tissue Drug Concentrations from a homozygous FPϩ/ϩ-knockout mouse producing a single band (450 bp). To understand the contribution of 17-phenyl trinor PGF2␣, the C-1 acid of bimatoprost and a potent FP agonist, to lowering IOP in the mouse, we sought to determine the hydrolysis of bimatoprost in ocular tissues Measurement of IOP of C57BL/6J mice killed 2 hours after a single dose. A further group of Cannulation Technique. IOP measurements were performed mice treated with latanoprost was included for comparison. between 2 and 6 PM to reduce the effect of circadian variation in Both eyes of 20 mice were treated topically with 4 ␮L of 0.03% IOP.11 Measurements were performed by cannulation of the anterior bimatoprost (1.2 ␮g) per eye. Another 20 mice were treated with 4 ␮L chamber, as described in detail previously.7 Beveled microneedles of 0.005% latanoprost in the same manner. Untreated mice (n ϭ 32)

were made of borosilicate glass with a tip diameter between 75 and were used as the negative control. Mice were killed with CO2 gas at 2 100 ␮m. The microneedle was mounted on a micromanipulator to hours after treatment and weighed. The eyes were enucleated, and enable accurate positioning. It was connected to a pressure transducer bimatoprost or latanoprost and the corresponding C-1 acid concentra- (Model BLPR; World Precision Instruments, Sarasota, FL) which was tions were determined by liquid chromatography and tandem mass calibrated against a manometer over the range of 0 to 30 mm Hg, as spectrometry (LC-MS/MS). described previously.10 IOP was measured in both eyes within 7 Eyes were briefly rinsed in Dulbecco’s phosphate-buffered saline. minutes of the anesthetic injection. The second IOP was measured Each eye was dissected into anterior and posterior segments and the within 1 minute of the first eye recording. The investigator was masked lens, vitreous humor, and aqueous humor were removed. Eyes were to the genotype of the FP-knockout mice at the time of IOP measure- bisected, and each anterior and posterior segment was cut in half and ment. The IOP response to bimatoprost was measured on three sepa- placed directly into preweighed microcentrifuge tubes cooled on dry rate occasions in the FP-knockout mice, as small IOP alterations could ice. Segments were pooled (eight anterior or eight posterior) from four have been masked by physiological intermouse and intereye differ- animals. Five pooled samples were obtained for each test material. ences in IOP. As a larger reduction in IOP was obtained for bimatoprost Tissues from untreated mice were processed in the same manner. The in preliminary experiments, the response to bimatoprost in C57BL/6 untreated tissues from 16 mice were collected as four pooled samples mice was only measured once. A 1-week washout period was used for each segment (eight anterior or eight posterior) at the time of the between repeat IOP measurements. bimatoprost study. Another 16 mice were used to provide untreated Induction-Impact (Rebound) Tonometry. Longitudinal tissues for the latanoprost study. The tissue weight of each pooled IOP measurement became feasible with the induction impact tonom- sample was determined. One milliliter acetonitrile-methanol (1:1 vol/ eter described by Danias et al.12 To confirm the initial findings, IOP vol) was added to each sample and then incubated at 5°C overnight response to a single 4-␮L application of bimatoprost 0.03% in one eye (ϳ18 hours). The samples were centrifuged at 10,000g for 2 minutes. was compared longitudinally with the fellow eye in a different gener- The supernatant was removed and evaporated to dryness at 37°C ation of homozygous knockout (n ϭ 4) and wild-type (n ϭ 4) litter- with a stream of nitrogen gas. The residues were stored at Ϫ20°C mate control mice. IOP was recorded before and hourly after treatment until assayed. by an observer who was masked to both mouse genotype and also to the eye that had been treated. Measurement of the IOP response to Aqueous Humor Drug Concentrations unilateral instillation of topical latanoprost in Swiss white mice with In a further set of experiments, eyes were treated with a 4-␮L drop of the induction-impact and cannulation tonometer revealed similar mean bimatoprost or latanoprost or no treatment (10 eyes of 5 mice per IOP reductions with both measurement techniques (data not shown). group). After 2 hours, aqueous humor was aspirated as described This noninvasive tonometer permits IOP measurement in awake earlier, and samples for each treatment group were pooled. Levels of 12 mice. The tonometer was calibrated in vivo. A C57BL/6 mouse eye bimatoprost, latanoprost, and their C-1 free acids were determined by was cannulated close to the limbus with a needle connected to a fluid LC-MS/MS. Masked aqueous humor samples where split and run in a column and a pressure transducer. This permitted the eye pressure to masked fashion to determine levels of bimatoprost-bimatoprost acid be set by raising and lowering the fluid column. IOP measurements and latanoprost-latanoprost acid separately. with the rebound tonometer were taken at intervals between 0 and 30 mm Hg. Longitudinal IOP measurement was performed in awake mice Liquid Chromatography and Tandem that were gently restrained to ensure no mechanical Valsalva effect that Mass Spectrometry would elevate IOP. The tonometer probe was mounted on a microma- ␮ nipulator and measurements were recorded from a distance of 3.0 The dry residue was reconstituted with 200 L of 100% acetonitrile. ␮ mm Ϯ 0.1 mm from the center of the cornea. A dissecting microscope The reconstituted samples were injected (80 L) and analyzed by was used to ensure good centration on the cornea. LC-MS/MS using a mass spectrometer (PE Sciex API 3000; Applied Biosystems, Foster City, CA), with a Shimadzu autosampler and HPLC Aqueous Humor Protein Concentration pumps (Shimadzu Scientific Instruments, Columbia, MD) using an APS-2 column (3 ␮m, 2 ϫ 150 mm; Keystone Scientific, Bellefonte, Aqueous protein concentration was measured to determine whether PA). The extracts were analyzed for parent compounds and the corre- topical application of bimatoprost led to a significant breakdown in the sponding C-1 acid metabolites using multiple reaction monitoring blood–aqueous barrier, which could result in secondary changes in (MRM) and deuterated compounds as internal standards. The results IOP. Two hours after administration of bimatoprost, (1.2 ␮gin4␮L), were expressed as concentration of analytes in nanograms per gram of

Downloaded from iovs.arvojournals.org on 10/02/2021 IOVS, December 2005, Vol. 46, No. 12 Bimatoprost and Prostaglandin FP Receptor Signaling 4573

tissue and ratio of C-1 acid concentration to parent compound concentration.

Statistical Analysis Paired student t-tests were used to compare the IOP in treated and untreated-fellow eyes of mice of the same genotype. The average reduction in IOP (mean IOP in treated eyes Ϫ mean IOP in fellow eyes) was expressed as the mean difference and 95% confidence interval (CI) for the difference between means. A significant reduction in IOP was defined by a 95% CI range that was less than zero. Analysis of variance was used to compare the mean difference in IOP between strains. For comparison of 2-means, a P Ͻ 0.05 was considered to be statistically significant. A Tukey-Kramer post hoc modification of the ANOVA was performed to adjust for comparison between multiple groups. For serial IOP analysis, generalized estimating equations were used to determine the association of IOP difference between treated and untreated eyes and genotype. For determination of tissue levels a com- puter (Analyst software ver. 1.3; Applied Biosystems) was used for peak integration, construction of calibration curves from peak areas of analyte and internal standard, and the calculation of analyte concentrations in unknown samples.

RESULTS IOP Response to Bimatoprost in C57BL/6 Mice Dose–response and time course of IOP response to bimatoprost was determined in C57BL/6 mice, which constitute the founder strain used for the generation of the FP-knockout mice.8 The IOP response was expressed as the mean reduction in IOP in the treated eye compared with the untreated fellow eye. The largest IOP reduction at 2 hours (Ϫ1.50 mm Hg) was obtained with a 1.2-␮L dose (4 ␮L drop; Fig. 1). Subsequently, IOP was measured at 1, 2, and 4 hours after a single 1.2-␮g dose. The largest reduction in IOP was observed at 4 hours. However, this was not significantly lower than the pressure reduction observed at 2 hours (P ϭ 0.71, student t-test). IOP Response in FP-Knockout Mice The average difference in IOP (Ϯ95% CI of the mean IOP difference) between the bimatoprost-treated and untreated fellow eyes was Ϫ0.36 mm Hg (Ϫ0.82 to ϩ0.09) for the heterozygote FP-knockout mice and ϩ0.25 mm Hg (Ϫ0.74 to ϩ0.64) for the homozygous FP-knockout mice (Fig. 2, Table 1). This indicates that bimatoprost does not lower IOP in the FP-knockout mice because the 95% CI of the mean difference crosses zero for both genotypes. In contrast, the mean difference in IOP and 95% CI for the C57BL/6 mice was Ϫ1.33 (Ϫ1.84 to Ϫ0.81) indicating that the same treatment reduced IOP in the treated eye compared with the untreated fellow eye. Analysis of variance was performed to compare the IOP reduction in treated eyes with that in fellow untreated eyes for the three genotypes. There was no statistically significant difference in mean IOP reduction in the heterozygous compared with the FIGURE 1. IOP response to bimatoprost in C57BL/6 mice. (A) The homozygous mice (P Ͼ 0.05). The mean reduction in IOP in difference in IOP between treated and fellow eyes was measured 2 hours after a single application of bimatoprost, by using the cannula- the C57BL/6 mice was significantly greater than the difference tion technique (n ϭ 8 per treatment group). (B) The mean difference in IOP for the heterozygous and homozygous FP knockout in IOP between treated and untreated eyes at 1, 2, and 4 hours after a mice (P ϭ 0.024, comparison of all group means with single application of bimatoprost (4 ␮L, n ϭ 4 per treatment group). ANOVA). Serial IOP Measurements with the which in turn permitted serial IOP measurement in individual mice. IOP measurement performed hourly for 3 hours after Induction-Impact Tonometer drop installation in awake mice, with a noninvasive rebound During the course of the study, it became apparent that the tonometer, revealed a reduction in IOP in the treated eye of magnitude of the IOP response to prostaglandin analogues is wild-type control mice but insignificant IOP alteration in the larger when measured in the evening than in the midafternoon. homozygous FP-knockout mice (Fig. 3). Mean reduction in IOP The larger IOP reduction in the evening permitted evaluation (untreated fellow eye IOP Ϫ treated eye IOP) in wild-type mice of drug effect with a noninvasive induction impact tonometer, at 2 and 3 hours (corrected for pretreatment baseline differ-

Downloaded from iovs.arvojournals.org on 10/02/2021 4574 Crowston et al. IOVS, December 2005, Vol. 46, No. 12

TABLE 1. Mean Difference in IOP between Bimatoprost-Treated and Untreated Fellow Eyes

Mean Difference 95% CI for in IOP Difference Genotype n (mm Hg) in Means

C57BL/6 20 Ϫ1.33 Ϫ1.84 to Ϫ0.81 Heterozygote FPϩ/Ϫ 10 Ϫ0.36 Ϫ0.82 to ϩ0.09 Homozygote 8 ϩ0.25 Ϫ0.38 to ϩ0.89

ences) was Ϫ4.6 and Ϫ4.8 mm Hg, respectively. The equiva- lent mean reduction in IOP at 2 and 3 hours in homozygous FP-knockout mice was ϩ0.9 and Ϫ0.2 mm Hg, respectively. Generalized estimation equations were used to analyze the association with genotype of serial changes in the difference in IOP between treated and untreated eyes. The calculations revealed that, after treatment, the FP genotype was signiﬁ- cantly associated with the intraocular difference in IOP over time (P Ͻ 0.032). Aqueous Humor Protein Concentration A single 1.2-␮g application of bimatoprost had no effect on aqueous humor protein levels at 2 hours in either the homozygous FP-knockout (P ϭ 0.1, paired t-test) or the C57BL/6 (P ϭ 0.12) mice (Fig. 4). Aqueous humor protein levels were between 0.2 and 0.3 mg/mL, which was similar to the levels recorded previously in Swiss white mice.7 Protein levels tended to be higher in the FP-knockout mice compared with wild-type mice but this difference was not statistically signiﬁcant. Tissue Levels of Bimatoprost, Latanoprost, and Their Free Acids Bimatoprost eluted at approximately 2.2 minutes and 17-phe-

nyl trinor PGF2␣ eluted at approximately 4.2 minutes in the HPLC system. Blank samples showed no detectable concentrations indicating assay speciﬁcity. Standards were used to quan-

tify bimatoprost and 17-phenyl trinor PGF2␣ in anterior and posterior ocular tissues and lower limit of quantitation (LOQ) was 2 pg on column injection for both bimatoprost and 17-

phenyl trinor PGF2␣. Linear standard curves were achieved

FIGURE 2. Difference in IOP between treated and untreated eyes, 2 hours after a single dose (4 ␮L) of bimatoprost. Group mean values (solid line) and 95% CI (dashed lines) of the means are shown. FIGURE 3. Difference in IOP between treated and untreated eyes in C57BL/6 (n ϭ 20), heterozygous FP-knockout (n ϭ 10), homozygous wild-type (n ϭ 4) and homozygous FP-knockout (n ϭ 4) mice mea- FP-knockout mice (n ϭ 8). sured just before (t ϭ 0) and hourly for 3 hours after a single application of bimatoprost (4 ␮L). The observer was masked to mouse genotype and which eye had been treated. Data show mean IOP difference, corrected for difference in IOP between fellow eyes before treatment at t ϭ 0(ϮSEM).

Downloaded from iovs.arvojournals.org on 10/02/2021 IOVS, December 2005, Vol. 46, No. 12 Bimatoprost and Prostaglandin FP Receptor Signaling 4575

latanoprost and latanoprost free acid. Linear standard curves were achieved from 2 pg to 10 ng on column injection with correlation coefﬁcient values of 0.99 for both latanoprost and latanoprost free acid. The accuracy of the quality control samples in mouse anterior and posterior ocular tissues for the range of 2.5 pg to 1 ng on column injection ranged from 71.6% to 115% and 78.5% to 108% for latanoprost and latanoprost free acid, respectively. The amount of latanoprost did not differ greatly from the anterior to the posterior tissues; however, latanoprost free acid was three times higher in the anterior samples than in the posterior samples. Speciﬁcally, the latanoprost concentration was 3.5 Ϯ 1.4 ng/g in the anterior samples and 4.2 Ϯ 2.1 ng/g in the posterior samples. C-1 acid concentration was higher with 20.1 Ϯ 7.9 and 6.6 Ϯ 3.2 ng/g in the anterior and posterior samples, respectively.

Aqueous Humor Levels of Bimatoprost, Latanoprost, and Their Free Acids The bimatoprost concentration in aqueous humor, 2 hours after topical administration of a single 4-␮L dose, which gave maximum IOP reduction, was 1.6ng/mL (4 nM; Table 3). Bi- matoprost acid levels were below the limit of quantitation for aqueous humor samples (LOQ, 1 ng/mL). In comparison, 2 hours after a single 4-␮L application of latanoprost, the concentration of latanoprost acid was 98 ng/mL (245 nM). Latano- prost was not detected (LOQ 5 ng/mL). These data suggest that the distribution of bimatoprost and its free acid into mouse aqueous humor are different from latanoprost. FIGURE 4. Aqueous humor protein concentration 2 hours after bimatoprost (4 ␮L) compared with untreated fellow eyes. Data points represent the mean Ϯ SEM with n ϭ 6 mice per treatment group. DISCUSSION The results demonstrate that a single application of bimato- from 2 pg to 10 ng on column injection with correlation prost does not reduce IOP in FP receptor knockout mice. A coefﬁcient values of 0.99 for both bimatoprost and 17-phenyl signiﬁcant reduction in IOP was observed, however, in bimato-

trinor PGF2␣. The accuracy of the quality control samples in prost-treated wild-type littermate control mice as well as the anterior and posterior ocular tissues for the range of 2.5 pg C57BL/6 mice, which are the founder species for the FP- to 1 ng on column injection ranged from 79% to 108% and 84% knockout mice and have normal FP receptor expression. Fur-

to 127% for bimatoprost and 17-phenyl trinor PGF2␣, respec- ther, bimatoprost is not efficiently hydrolyzed to 17-phenyl tively. The mean bimatoprost concentrations and C-1 acid trinor PGF2␣ in the mouse eye, although trace levels of the free concentrations did not differ greatly from the anterior to pos- acid were detectable in the ocular tissues of the anterior and terior tissues (Table 2). The bimatoprost concentration was posterior segment 2 hours after a single treatment. These data 15.9 Ϯ 4.1 ng/g in the anterior samples and 10.6 Ϯ 2.9 ng/g in indicate that the early IOP response to a single application of the posterior samples. The C-1 acid concentration of bimato- bimatoprost is critically dependent on FP receptor expression prost was much lower, with 0.32 Ϯ 0.16 and 0.23 Ϯ 1.01 ng/g in the mouse eye. in the anterior and posterior samples, respectively. Two of Several potential limitations of this study should be consid- the five posterior samples had amounts below the limit of ered. First, the data were generated in the mouse, and extrap- quantitation. olation to the human should be made with caution. We have In comparison, latanoprost eluted at approximately 3.5 min- shown that aqueous humor dynamics in the mouse have sev- utes, and latanoprost free acid eluted at approximately 3.0 eral similarities to those of the human.7 In addition, a close minutes in the HPLC system. Blank samples showed no detect- correlation has been reported in the relative potencies of able concentrations, indicating assay specificity. The neat stan- several of FP agonists in functional agonist assays of cultured dards were used to quantify latanoprost and latanoprost free human trabecular meshwork compared with mouse fibroblast acid in anterior and posterior ocular tissues, and the lower limit lines.6,13,14 This supports the existence of homology in the of quantitation (LOQ) was 2 pg on column injection for both amino acid structure of the FP receptors of the two species.

TABLE 2. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost, and Latanoprost C-1 Acid Levels in Ocular Tissues

Bimatoprost Bimatoprost C-1 Acid Latanoprost Latanoprost C-1 Acid (ng/g) (ng/g) Ratio Parent/C-1 (ng/g) (ng/g) Ratio Parent/C-1

Anterior segment 15.9 Ϯ 4.1 0.32 Ϯ 0.2 49.7 3.5 Ϯ 1.4 20.1 Ϯ 7.9 0.176 (39.8 nM) (0.8 nM) (8.8 nM) (50.3 nM) Posterior segment 10.6 Ϯ 2.9 0.23 Ϯ 1.0 46.1 4.2 Ϯ 2.1 6.6 Ϯ 3.2 0.641 (26.5 nM) (0.6 nM) (10.5 nM) (16.5 nM)

Data were obtained 2 hours after administration of 4 ␮L topical bimatoprost or 4 ␮L latanoprost in wild-type C57 Bl/6 mice and are expressed as micrograms per gram tissue Ϯ SD (molar values).

Downloaded from iovs.arvojournals.org on 10/02/2021 4576 Crowston et al. IOVS, December 2005, Vol. 46, No. 12

TABLE 3. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost and Latanoprost C-1 Acid Levels in Aqueous Humor

Bimatoprost Latanoprost Bimatoprost C-1 acid Latanoprost C-1 Acid

Concentration 1.6 (4 nM) Ͻ1 Ͻ5 98 (245 nM) LOQ 0.25 1 5 5

Data were acquired and are expressed as described in Table 2.

Although non-FP mechanisms are not significant in the early References response in the mouse, it is possible that alternative FP- independent mechanisms are relevant in the human. Sec- 1. Giuffre G. The effects of prostaglandin F2 alpha in the human eye. ond, the effect of repeated exposure to bimatoprost in the Graefes Arch Clin Exp Ophthalmol. 1985;222:139–141. FP-knockout or wild-type mice has not yet been investi- 2. Camras CB, Bito LZ. Reduction of intraocular pressure in nor- gated. With these limitations in mind, it is clear that the FP mal and glaucomatous primate (Aotus trivirgatus) eyes by top- receptor plays a critical role in the early IOP response to ically applied prostaglandin F2 alpha. Curr Eye Res. 1981;1: bimatoprost in the mouse. The similarities in aqueous hu- 205–209. mor dynamics in the mouse and human, coupled with ho- 3. Toris CB, Camras CB, Yablonski ME. Effects of PhXA41, a new prostaglandin F2 alpha analog, on aqueous humor dynamics in mology in the cellular response to FP agonists and the human eyes. Ophthalmology. 1993;100:1297–1304. availability of genetically engineered mice support the value 4. Brubaker RF. Mechanism of action of bimatoprost (Lumigan). Surv of this model for studying the mechanisms of IOP-lowering Ophthalmol. 2001;45(suppl 4):S347–S351. by prostaglandin analogues. 5. Woodward DF, Krauss AH, Chen J, et al. Pharmacological charac- It has been suggested that bimatoprost reduces IOP by an as 5,15–19 terization of a novel antiglaucoma agent, bimatoprost (AGN yet uncharacterized prostamide receptor. There are con- 192024). J Pharmacol Exp Ther. 2003;305:772–785. flicting reports on what concentration of bimatoprost free acid 6. Sharif NA, Kelly CR, Crider JY. Human trabecular meshwork cell is needed in the aqueous humor to activate FP receptor signal- responses induced by bimatoprost, travoprost, unoprostone, and ing and to lower IOP. Studies of FP receptor signaling using other FP prostaglandin receptor agonist analogues. Invest Oph- cultured human trabecular meshwork or human ciliary muscle thalmol Vis Sci. 2003;44:715–721. cells as well as mouse fibroblasts and rat aortic smooth muscle 7. Aihara M, Lindsey JD, Weinreb RN. Aqueous humor dynamics in showed that bimatoprost acid has a relatively high affinity for mice. Invest Ophthalmol Vis Sci. 2003;44:5168–5173. ϭ the FP receptor (Ki 83 nM) and an EC50 of 2.8 to 3.8 nM in 8. Sugimoto Y, Yamasaki A, Segi E, et al. Failure of parturition in most cells as measured by equilibrium phosphoinositide (PI) mice lacking the prostaglandin F receptor. Science. 1997;277: turnover assays.20 Bimatoprost also exhibited functional ac- 681–683. tivity at the FP receptor in human trabecular meshwork cells 9. Crowston JG, Lindsey JD, Aihara M, Weinreb RN. Effect of latano- ϭ 20 (EC50 3245 nM). In contrast to latanoprost, bimatoprost prost on intraocular pressure in mice lacking the prostaglandin FP is only slowly hydrolyzed to its free acid form by corneal and receptor. Invest Ophthalmol Vis Sci. 2004;45:3555–3559. other ocular tissues.21,22 Levels of bimatoprost free acid (22 10. Aihara M, Lindsey JD, Weinreb RN. Reduction of intraocular pres- Ϯ7.0 nM, 2 hours after the last dose after 7 days of treat- sure in mouse eyes treated with latanoprost. Invest Ophthalmol ment) have recently been reported in the aqueous humor of Vis Sci. 2002;43:146–150. patients undergoing cataract surgery.23 Finally, the selective 11. Aihara M, Lindsey JD, Weinreb RN. Twenty-four-hour pattern FP antagonist AL-8810 (11␤-fluoro-15-epi-15-indanyl prosta- of mouse intraocular pressure. Exp Eye Res. 2003;77:681– glandin F2␣) inhibited the agonist activity of bimatoprost 686. and bimatoprost acid, further suggesting a role for the FP 12. Danias J, Kontiola AI, Filippopoulos T, Mittag T. Method for the receptor.24–26 noninvasive measurement of intraocular pressure in mice. Invest Because bimatoprost C-1 free acid levels were largely unde- Ophthalmol Vis Sci. 2003;44:1138–1141. tected in aqueous humor and ocular tissues 2 hours after 13. Griffin BW, Williams GW, Crider JY, Sharif NA. FP prostaglandin topical application, it is unlikely that bimatoprost C-1 acid, receptors mediating inositol phosphates generation and calcium which is known to be a potent FP receptor agonist, plays a mobilization in Swiss 3T3 cells: a pharmacological study. J Phar- major contribution to the acute IOP reduction in the mouse. macol Exp Ther. 1997;281:845–854. ϩ The levels of bimatoprost in tissue and aqueous were well 14. Kelly CR, Williams GW, Sharif NA. Real-time intracellular Ca2 below the EC documented in vitro by a calcium-mobilization mobilization by travoprost acid, bimatoprost, unoprostone, and 50 other analogs via endogenous mouse, rat, and cloned human FP assay in the transformed Swiss 3T3 murine cell line (3120 nM prostaglandin receptors. J Pharmacol Exp Ther. 2003;304:238– for bimatoprost and 49 nM for bimatoprost acid). This raises 245. the possibility that primary ocular tissues may have different 15. Woodward DF, Krauss AH, Chen J, et al. The pharmacology of binding affinities in vivo. Another possible explanation is bimatoprost (Lumigan). Surv Ophthalmol. 2001;45(suppl 4): that spliced variants of the FP receptor could have different S337–S345. agonist affinities and explain our data. Our finding that no 16. Liang Y, Li C, Guzman VM, et al. Comparison of prostaglandin significant IOP lowering occurs in the absence of intact FP F2alpha, bimatoprost (prostamide), and butaprost (EP2 agonist) on receptor gene strongly supports the view that FP signaling, Cyr61 and connective tissue growth factor gene expression. J Biol at least in the mouse, is critical for the early IOP response to Chem. 2003;278:27267–27277. bimatoprost. 17. Spada CS, Krauss AH, Woodward DF, et al. Bimatoprost and prostaglandin F(2 alpha) selectively stimulate intracellular calcium sig- Acknowledgments naling in different cat iris sphincter cells. Exp Eye Res. 2005;80: 135–145. The authors thank Jinsong Ni and June Chen (Allergan USA) for their 18. Chen J, Senior J, Marshall K, et al. Studies using isolated uterine assistance in measuring tissue prostaglandin concentrations. and other preparations show bimatoprost and prostanoid FP ago-

Downloaded from iovs.arvojournals.org on 10/02/2021 IOVS, December 2005, Vol. 46, No. 12 Bimatoprost and Prostaglandin FP Receptor Signaling 4577

nists have different activity proﬁles. Br J Pharmacol. 2005;144: 23. Camras CB, Toris CB, Sjoquist B, et al. Detection of the free acid of 493–501. bimatoprost in aqueous humor samples from human eyes treated 19. Matias I, Chen J, De Petrocellis L, et al. Prostaglandin ethanol- with bimatoprost before cataract surgery. Ophthalmology. 2004; amides (prostamides): in vitro pharmacology and metabolism. 111:2193–2198. J Pharmacol Exp Ther. 2004;309:745–757. 24. Sharif NA, Kelly CR, Crider JY. Agonist activity of bimatoprost, 20. Sharif NA, Kelly CR, Crider JY, Williams GW, Xu SX. Ocular travoprost, latanoprost, unoprostone isopropyl ester and other hypotensive FP prostaglandin (PG) analogs: PG receptor subtype prostaglandin analogs at the cloned human ciliary body FP binding afﬁnities and selectivities, and agonist potencies at FP and prostaglandin receptor. J Ocul Pharmacol Ther. 2002;18:313– other PG receptors in cultured cells. J Ocul Pharmacol Ther. 324. 2003;19:501–515. 25. Sharif NA, Kelly CR, Williams GW. Bimatoprost (Lumigan(R)) is an 21. Maxey KM, Johnson JL, LaBrecque J. The hydrolysis of bimatoprost agonist at the cloned human ocular FP prostaglandin receptor: in corneal tissue generates a potent prostanoid FP receptor ago- real-time FLIPR-based intracellular Ca(2ϩ) mobilization studies. nist. Surv Ophthalmol. 2002;47(suppl 1):S34–S40. Prostaglandins Leukot Essent Fatty Acids. 2003;68:27–33. 22. Davies SS, Ju WK, Neufeld AH, Abran D, Chemtob S, Roberts LJ II. 26. Sharif NA, Williams GW, Kelly CR. Bimatoprost and its free acid are Hydrolysis of bimatoprost (Lumigan) to its free acid by ocular prostaglandin FP receptor agonists. Eur J Pharmacol. 2001;432: tissue in vitro. J Ocul Pharmacol Ther. 2003;19:45–54. 211–213.

Downloaded from iovs.arvojournals.org on 10/02/2021