Effect of Bimatoprost on Intraocular Pressure in Prostaglandin FP Receptor Knockout Mice

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Effect of Bimatoprost on Intraocular Pressure in Prostaglandin FP Receptor Knockout Mice Jonathan G. Crowston,1 James D. Lindsey,1 Christy A. Morris,1 Larry Wheeler,2 Felipe A. Medeiros,1 and Robert N. Weinreb1 PURPOSE. To determine the effect of bimatoprost on intraocular ing are not known, it has been suggested that bimatoprost pressure in the prostaglandin FP receptor knockout mouse. fundamentally differs from latanoprost, by lowering IOP ETHODS ␮ ␮ through mechanisms that are independent of FP receptor sig- M . The IOP response to a single 1.2- g(4 L) dose of 5 bimatoprost was measured in the treated and untreated fellow naling. However, there is considerable controversy regarding eyes of homozygote (FPϩ/ϩ, n ϭ 9) and heterozygote (FPϮ, n the role of FP receptor signaling, because bimatoprost has ϭ been shown to bind and activate the FP receptor in cultured 10) FP-knockout mice, as well as in wild-type C57BL/6 mice 6 (FPϩ/ϩ, n ϭ 20). Serial IOP measurements were also per- human trabecular meshwork and human ciliary muscle cells. Measurement of aqueous humor dynamics in the mouse eye formed after topical bimatoprost in a separate generation of 7 homozygous FP-knockout mice and wild-type littermate con- has been detailed recently. The FP knockout mouse, gener- trol animals (n ϭ 4 per group). Aqueous humor protein ated by homologous translocation with a target vector that ␤ concentrations were measured to establish the state of the replaces the second exon of the FP gene with the -galactosi- blood–aqueous barrier. Tissue, aqueous humor and vitreous dase and neomycin-resistance gene, was produced to demon- strate the critical role of the interaction of PGF2␣ with FP concentrations of bimatoprost, latanoprost, and their C-1 free 8 acids were determined by liquid chromatography and tandem receptors in the initiation of parturition in pregnant mice. We mass spectrometry. recently demonstrated that a single application of latanoprost had no effect on IOP in the FP homozygous knockout mice and RESULTS. A significant reduction in IOP was observed in the a diminished effect in the heterozygous knockout mice, com- bimatoprost-treated eye of wild-type mice at 2 hours, with a pared with C57 BL/6 background control mice.9 This indicates mean difference and 95% confidence interval (CI) of the dif- Ϫ Ϫ Ϫ that the FP receptor is necessary for the acute IOP response to ference in means of 1.33 mm Hg ( 0.81 to 1.84). Bimato- latanoprost. The FP-knockout mouse also provides the oppor- prost did not lead to a significant reduction in IOP in either the Ϫ Ϫ ϩ tunity to determine whether bimatoprost lowers IOP in the heterozygous knockout 0.36 mm Hg ( 0.82 to 0.09) or absence of the FP receptor. homozygous FP-knockout mice 0.25 mm Hg (Ϫ0.38 to ϩ0.89). The lack of an IOP response in the FP-knockout mice was not a consequence of blood–aqueous barrier breakdown, as there was no significant difference in aqueous humor protein con- METHODS centration between treated and fellow eyes. Tissue and aque- ous humor concentrations of bimatoprost, latanoprost, and Animal Husbandry their C-1 free acids indicate that latanoprost, but not bimato- All experiments were performed in compliance with the ARVO State- prost, is hydrolyzed in the mouse eye after topical administra- ment for the Use of Animals in Ophthalmic and Vision Research. Mice tion. lacking the gene encoding the FP receptor were obtained as a gift from CONCLUSIONS. An intact FP receptor gene is critical to the IOP Shuh Narumiya (Kyoto University, Japan). Homozygous knockout fe- response to bimatoprost in the mouse eye. (Invest Ophthalmol males fail to initiate parturition.8 For this reason, heterozygous (female) Vis Sci. 2005;46:4571–4577) DOI:10.1167/iovs.05-0723 and homozygous (male) mating pairs were used to generate an F1 generation. C57BL/6 mice constitute the founder species of the FP- knockout mice and were used as wild-type control subjects. Mice were opically administered prostaglandin (PG) F and its ana- 2␣ bred and housed in clear cages covered loosely with air filters and logues lower IOP in humans and nonhuman primates1,2 by T containing white pine shavings for bedding. The environment was increasing the uveoscleral outflow of aqueous humor.3 Bimato- kept at 21°C in a 12-hour light–dark cycle (light, 6:00 AM to 6:00 PM). prost, the C-1 ethyl amide of 17-phenyl-prostaglandin F ,a 2␣ All mice were fed ad libitum. Animal ages ranged from 6 to 9 months. structural analogue, is also a potent ocular hypotensive.4 Al- though the molecular mechanisms responsible for IOP lower- Drug Application To facilitate administration of eye drops, mice were restrained in a From the 1Hamilton Glaucoma Center and Department of Oph- conical plastic sleeve (Decapicone; Braintree Scientific Inc., Braintree, thalmology, University of California San Diego, La Jolla, California; and MA). Four microliters bimatoprost 0.03% (Allergan, Irvine, CA) was 2Allergan USA, Irvine, California. applied topically to the right eye. Dose–response curve and time Supported in part by the National Eye Institute EY05990 (RNW). course were performed in C57BL/6 mice to determine the optimum Submitted for publication June 8, 2005; revised July 21, 2005; dose of drug and the time of maximum IOP lowering. accepted October 13, 2005. Disclosure: J.G. Crowston, Alcon Inc. and Pfizer, Inc. (R); J.D. Lindsey, None; C.A. Morris, None; L. Wheeler, Allergan USA (E); Anesthesia F.A. Medeiros, None; R.N. Weinreb, Allergan USA (C) The mice were anesthetized by intraperitoneal injection of a mixture of The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertise- ketamine (100 mg/kg, Ketaset; Fort Dodge Animal Health, Fort Dodge, ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. IA) and xylazine (9 mg/kg, TranquiVed; Vedco Inc., St. Joseph, MO), as 10 Corresponding author: Robert N. Weinreb, Hamilton Glaucoma previously described. Each mouse was monitored carefully to assess Center, University of California San Diego, 9500 Gilman Drive, La Jolla, the state of anesthesia. If the mouse did not respond to pinching of the CA 92093-0946; [email protected]. back skin, it was placed on the platform for IOP measurement. Investigative Ophthalmology & Visual Science, December 2005, Vol. 46, No. 12 Copyright © Association for Research in Vision and Ophthalmology 4571 Downloaded from iovs.arvojournals.org on 10/02/2021 4572 Crowston et al. IOVS, December 2005, Vol. 46, No. 12 Determination of Mouse Genotype by PCR aqueous humor was aspirated through a microneedle attached to a 10-␮L syringe-equipped micropump (Hamilton, Reno, NV; and Micro 4, DNA was extracted from 8-mm tail biopsy specimens of anesthetized World Precision Instruments). The Bradford protein assay (Bio-Rad adult mice using a kit (69504; Qiagen, Valencia, CA) according to the Laboratories, Hercules, CA) was used according to the manufacturer’s manufacturer’s guidelines. The oligonucleotide primers used to detect guidelines. Aqueous humor samples (3 ␮L) were diluted in 97 ␮L homologous translocation were 5F (GCCCATCCTTGGACACCGAGA), phosphate-buffered saline. Eighty microliters of this solution was then 6R (AGAGTCGGCAAGCTGTGACTT) and NeoII (TGATATTGCTGAA- mixed with 20 ␮L assay solution (Bio-Rad) in separate wells of a 96-well GAGCTTGG). Amplification was performed over 35 cycles of 94°C for microtiter plate. Absorption was measured at 595 nm with a microtiter 30 seconds, 65°C for 30 seconds, and 75°C for 10 minutes. PCR plate reader (SpectraMax 250). Aqueous protein concentration was products were analyzed by electrophoresis in 1% agarose gels. The determined from linear regression curves derived from bovine serum PCR product sizes were 700 bp for the FP receptor gene and 450 bp, albumin standards. corresponding to the LacZ/neo(r) cassette. DNA from the heterozygote Ϫ Ϫ Fp / mice therefore produces two bands (700 and 450 bp) and DNA Tissue Drug Concentrations from a homozygous FPϩ/ϩ-knockout mouse producing a single band (450 bp). To understand the contribution of 17-phenyl trinor PGF2␣, the C-1 acid of bimatoprost and a potent FP agonist, to lowering IOP in the mouse, we sought to determine the hydrolysis of bimatoprost in ocular tissues Measurement of IOP of C57BL/6J mice killed 2 hours after a single dose. A further group of Cannulation Technique. IOP measurements were performed mice treated with latanoprost was included for comparison. between 2 and 6 PM to reduce the effect of circadian variation in Both eyes of 20 mice were treated topically with 4 ␮L of 0.03% IOP.11 Measurements were performed by cannulation of the anterior bimatoprost (1.2 ␮g) per eye. Another 20 mice were treated with 4 ␮L chamber, as described in detail previously.7 Beveled microneedles of 0.005% latanoprost in the same manner. Untreated mice (n ϭ 32) were made of borosilicate glass with a tip diameter between 75 and were used as the negative control. Mice were killed with CO2 gas at 2 100 ␮m. The microneedle was mounted on a micromanipulator to hours after treatment and weighed. The eyes were enucleated, and enable accurate positioning. It was connected to a pressure transducer bimatoprost or latanoprost and the corresponding C-1 acid concentra- (Model BLPR; World Precision Instruments, Sarasota, FL) which was tions were determined by liquid chromatography and tandem mass calibrated against a manometer over the range of 0 to 30 mm Hg, as spectrometry (LC-MS/MS). described previously.10 IOP was measured in both eyes within 7 Eyes were briefly rinsed in Dulbecco’s phosphate-buffered saline.
Recommended publications
  • Eyelash Growth Induced by Topical Prostaglandin Analogues, Bimatoprost, Tafluprost, Travoprost, and Latanoprost in Rabbits

    Eyelash Growth Induced by Topical Prostaglandin Analogues, Bimatoprost, Tafluprost, Travoprost, and Latanoprost in Rabbits

    JOURNAL OF OCULAR PHARMACOLOGY AND THERAPEUTICS ORIGINAL ARTICLE Volume 00, Number 0, 2013 ª Mary Ann Liebert, Inc. DOI: 10.1089/jop.2013.0075 Eyelash Growth Induced by Topical Prostaglandin Analogues, Bimatoprost, Tafluprost, Travoprost, and Latanoprost in Rabbits Ama´lia Turner Giannico,1 Leandro Lima,1 Heloisa Helena Abil Russ,2 and Fabiano Montiani-Ferreira1 Abstract Purpose: Prostaglandin analogues (PGA) are ocular hypotensive agents used for the treatment of glaucoma. Hypertrichosis of the eyelashes has been reported in humans as a side effect. Eyelash growth was investigated with clinical trials in people using bimatoprost. Scattered reports of eyelash growth during the treatment of glaucoma with other PGA are also found in the literature. We investigated the effect of 4 different topical PGA on eyelash length. Methods: Forty New Zealand white rabbits were divided into 4 groups and received daily topical application of bimatoprost, tafluprost, travoprost, and latanoprost in the left eye for 4 weeks. The right eye received no treatment. Eyelash length was measured in both eyes before and after treatment using a stainless steel digital caliper. Results: Bimatoprost and tafluprost groups had significant increases in eyelash length. We did not observe significant eyelash growth in rabbits receiving travoprost and latanoprost after 1 month of treatment. Conclusions: Today, only bimatoprost is approved for growing eyelashes, and our research shows that ta- fluprost could be further explored by the cosmetic and pharmaceutical industry. Additional research using travoprost and latanoprost as agents for eyelash growth should be performed in the future using prolonged treatment periods to determinate whether or not these PGA induce eyelash growth, and investigate other possible side effects.
  • New Zealand Data Sheet 1. Product Name 2. Qualitative

    New Zealand Data Sheet 1. Product Name 2. Qualitative

    NEW ZEALAND DATA SHEET BIMATOPROST MULTICHEM 1. PRODUCT NAME Bimatoprost multichem 0.3 mg/mL eye drops 2. QUALITATIVE AND QUANTITATIVE COMPOSITION Each mL contains 0.3 mg bimatoprost. For the full list of excipients, see section 6.1. 3. PHARMACEUTICAL FORM Bimatoprost multichem eye drops are a clear, isotonic, colourless, sterile ophthalmic solution. 4. CLINICAL PARTICULARS 4.1 Therapeutic indications Bimatoprost multichem is indicated as monotherapy for the reduction of elevated intraocular pressure (IOP) in patients with chronic glaucoma or ocular hypertension; or as adjunctive therapy in patients not adequately controlled on other agents. 4.2 Dose and method of administration Monotherapy The recommended dose is one drop of Bimatoprost multichem in the affected eye(s) once daily, administered in the evening. Adjunctive therapy The recommended dose is one drop of Bimatoprost multichem in the affected eye(s) once daily, administered in the evening. More frequent administration has not been shown to provide increased efficacy. If more than one topical ophthalmic medication is to be used, the other medication should not be used within 5 minutes of using Bimatoprost multichem eye drops. In order to minimise systemic absorption of Bimatoprost multichem eye drops, patients should be instructed to apply pressure to the tear duct immediately following administration of the drug. Paediatric use Safety and effectiveness in patients below 18 years of age has not been established. Use in elderly No dosage adjustment in elderly patients is necessary. 4.3 Contraindications Bimatoprost multichem eye drops are contraindicated in patients with hypersensitivity to bimatoprost or to any component of the medication.
  • Treatment of Eyebrow Hypotrichosis Using Bimatoprost: a Randomized, Double-Blind, Vehicle-Controlled Pilot Study

    Treatment of Eyebrow Hypotrichosis Using Bimatoprost: a Randomized, Double-Blind, Vehicle-Controlled Pilot Study

    ORIGINAL ARTICLE Treatment of Eyebrow Hypotrichosis Using Bimatoprost: A Randomized, Double-Blind, Vehicle-Controlled Pilot Study † KENNETH R. BEER, MD,* HILLARY JULIUS, PA,* MONICA DUNN, RN,* AND FRED WILSON,MS BACKGROUND The Food and Drug Administration has approved bimatoprost ophthalmic solution (0.03%) for the treatment of eyelash hypotrichosis. Previous reports of its efficacy in eyebrow hypotrichosis are anecdotal. OBJECTIVE To assess the efficacy and safety of bimatoprost 0.03% ophthalmic solution applied to the eyebrows in a randomized, double-blind, vehicle-controlled study. METHODS Subjects (n = 20) with mild to moderate eyebrow hypotrichosis enrolled in the study. One group (Bim) applied bimatoprost to each eyebrow daily for 9 months, and another applied vehicle nightly to each eyebrow for 5 months. Subjects in the latter group were re-randomized to apply bimatoprost (Veh-Bim Group) or vehicle (Veh Group) daily to each eyebrow for 4 months. The primary end point was investigator-assessed eyebrow appearance; secondary end points were subject-reported outcomes. RESULTS Investigator assessments showed significant improvements from baseline to 6 (p = .002) and 7 (p = .005) months for the eyebrows treated with bimatoprost. p-Values for the Veh-Bim and Veh groups were not significant at any time point. End-of-study subject satisfaction with eyebrow fullness or thickness and darkness or color was greater in the Bim group than in the Veh group. Adverse effects were not observed. CONCLUSION Bimatoprost 0.03% ophthalmic solution applied daily for 9 months improves the appearance of eyebrows noticeably more than vehicle, without side effects. This study was funded with a research grant by Allergan, Inc.
  • API Manufacturing

    API Manufacturing

    API Manufacturing The Importance of Process Understanding When it comes to process understanding and commercial manufacturing, no other manufacturer can match Cayman’s knowledge of prostaglandin chemistry. We are the industry leaders in prostaglandin synthesis with over 30 years of experience. Our expert chemists use this knowledge daily to synthesize commercially available eicosanoids as active pharmaceutical ingredients (APIs). Our talented team of scientists in Ann Arbor, Michigan, USA and Neratovice, Czech Republic has filed numerous patents for the complex synthesis and commercial manufacture of over seven APIs with additional compounds currently under development. OPH Cayman’s Center of Excellence in Ann Arbor focuses primarily on the synthesis, scale-up, and registration of new API manufacturing processes. Once registration batches have been completed, the GMP portion of the process and all supporting documentation are transferred to our commercial manufacturing Center of Excellence in Neratovice. The facility at Cayman Pharma has over 30 years of commercial prostaglandin and eicosanoid registration and manufacturing experience, is ISO certified, and has an excellent track record with customers and regulatory authorities VA S worldwide, including being US FDA and EMA compliant. Commercial API production We currently manufacture the following APIs according to the latest ICH and CGMP requirements for commercial distribution. Contact our sales department for more information about pricing and availability. VET · CGMP Bimatoprost · CGMP Latanoprost · CGMP Tafluprost · CGMP Travoprost · CGMP Epoprostenol (sodium salt) CS · CGMP (+)-Cloprostenol (sodium salt) · CGMP (±)-Cloprostenol (sodium salt) Development API production · Alfaprostol · Latanoprostene Bunod · Treprostinil (sodium salt) Cayman Pharma s.r.o. Phone: (+420) 315 664 381 [email protected] 2019 CAYMAN PHARMA S.R.O.
  • Review Article Analysis of the Responsiveness of Latanoprost, Travoprost, Bimatoprost, and Tafluprost in the Treatment of OAG/OHT Patients

    Review Article Analysis of the Responsiveness of Latanoprost, Travoprost, Bimatoprost, and Tafluprost in the Treatment of OAG/OHT Patients

    Hindawi Journal of Ophthalmology Volume 2021, Article ID 5586719, 12 pages https://doi.org/10.1155/2021/5586719 Review Article Analysis of the Responsiveness of Latanoprost, Travoprost, Bimatoprost, and Tafluprost in the Treatment of OAG/OHT Patients Ziyan Cai ,1 Mengdan Cao,1 Ke Liu,1 and Xuanchu Duan 2 1Department of Ophthalmology, e Second Xiangya Hospital of Central South University, Changsha, Hunan, China 2Department of Ophthalmology, Changsha Aier Eye Hospital, Changsha, Hunan, China Correspondence should be addressed to Xuanchu Duan; [email protected] Received 22 February 2021; Accepted 18 May 2021; Published 25 May 2021 Academic Editor: Enrique Menc´ıa-Gutie´rrez Copyright © 2021 Ziyan Cai et al. -is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Aim. Within the clinical setting, some patients have been identified as lacking in response to PGAs. -is meta-analysis study aimed to evaluate the responsiveness of latanoprost, travoprost, bimatoprost, and tafluprost in OAG/OHT patients, latanoprost nonresponders (LNRs), and the IOP-reducing efficacy and safety. Methods. A literature search was conducted on PubMed, Embase, and the Cochrane Controlled Trials Register. -e primary clinical endpoint was the number of responders at the end of the study. -e secondary clinical endpoint was the IOP reduction at the endpoint from baseline. Safety evaluation included five common adverse events: conjunctival hyperemia, hypertrichosis, ocular burning, ocular itching, and foreign-body sensation. Results. Eleven articles containing ten RCTs were included in this meta-analysis study. -e results highlighted that, in the OAG/ OHT population, there was no statistically significant difference in the responsiveness of the four PGAs.
  • High Performance Liquid Chromatography Tandem Mass Spectrometry Measurement of Bimatoprost, Latanoprost and Travoprost in Eyelash Enhancing Cosmetic Serums

    High Performance Liquid Chromatography Tandem Mass Spectrometry Measurement of Bimatoprost, Latanoprost and Travoprost in Eyelash Enhancing Cosmetic Serums

    Article High Performance Liquid Chromatography Tandem Mass Spectrometry Measurement of Bimatoprost, Latanoprost and Travoprost in Eyelash Enhancing Cosmetic Serums Emilia Marchei 1, Daniela De Orsi 2, Carmine Guarino 2, Maria Concetta Rotolo 1, Silvia Graziano 1 and Simona Pichini 1,* 1 Department of Therapeutic Research and Medicines Evaluation, National Institute of Health, Viale Regina Elena 299, 00161 Rome, Italy; [email protected] (E.M.); [email protected] (M.C.R.); [email protected] (S.G.) 2 Centro Nazionale Organismo Notificato Dispositivi e Cosmetici (ONDICO), National Institute of Health, Viale Regina Elena 299, 00161 Rome, Italy; [email protected] (D.D.O.); [email protected] (C.G.) * Correspondence: [email protected]; Tel.: +39-06-4990-3682; Fax: +39-06-4990-2016 Academic Editors: Lidia Sautebin and Immacolata Caputo Received: 11 December 2015; Accepted: 4 February 2016; Published: 6 February 2016 Abstract: Most common prostaglandin analogs, bimatoprost, latanoprost and travoprost, are licensed for the reduction of elevated intraocular pressure in patients with open angle glaucoma and ocular hypertension, but their non approved use as eyelash enhancers is becoming popular, especially in patients with eyelashes hypotrichosis. A fast and sensitive high performance liquid chromatography tandem mass spectrometry method was developed for the measurement of bimatoprost, latanoprost and travoprost in cosmetic serums freely web-sold to increase eyelash length, thickness and darkness. The analytes and the internal standard (reserpine) were separated by reversed phase chromatography with 5 mM ammonium acetate with 0.02% formic acid (mobile phase A) and 5 mM ammonium acetate in acetonitrile/water (95/5; v/v) with 0.02% formic acid (mobile phase B) by gradient elution and detected with tandem mass spectrometry operated in multiple reaction monitoring mode.
  • Prostaglandin Analogs for Glaucoma

    Prostaglandin Analogs for Glaucoma

    Prostaglandin Analogs Company Brand Generic Name Name Akorn Inc. Zioptan™ Tafluprost ophthalmic solution 0.0015% (PF) Allergan Inc. Durysta™ Bimatoprost 10 mcg implant Allergan Inc. Lumigan® Bimatoprost 0.01%, 0.03% Bausch & Lomb, Vyzulta™ Latanoprostene bunod 0.024% Inc. Novartis Travatan® Z Travaprost 0.004% Pfizer Inc. Xalatan® Latanoprost 0.005% Sun Ophthalmics Xelpros™ Latanoprost ophthalmic emulsion 0.005% Prostaglandin analogs work by increasing the outflow of intraocular fluid from the eye. They have few systemic side effects but are associated with changes to the eye itself, including change in iris color and growth of eyelashes. Depending on the individual, one brand of this type of medication may be more effective and produce fewer side effects. Prostaglandin analogs are taken as eye drops (except Durysta™ which is an implant). They are effective at reducing intraocular pressure in people who have open-angle glaucoma. Latanoprost and some formulations of bimatoprost and travoprost are available in generic form. Tafluprost is a preservative-free prostaglandin analog. Side Effects Side effects can include eye color change, darkening of eyelid skin, eyelash growth, droopy eyelids, sunken eyes, stinging, eye redness, and itching. Follow these steps to make it easier to put in eye drops: Preparing the Drops ● Always wash your hands before handling your eye drops or touching your eyes. ● If you’re wearing contact lenses, take them out — unless your ophthalmologist has ​ ​ told you to leave them in. ● Shake the drops vigorously before using them. ● Remove the cap of the eye drop medication. ○ Do not touch the dropper tip. Putting in Eye Drops ● Tilt your head back slightly and look up.
  • Uveitis and Cystoid Macular Oedema Secondary to Topical Prostaglandin

    Uveitis and Cystoid Macular Oedema Secondary to Topical Prostaglandin

    Review Br J Ophthalmol: first published as 10.1136/bjophthalmol-2019-315280 on 12 June 2020. Downloaded from Uveitis and cystoid macular oedema secondary to topical prostaglandin analogue use in ocular hypertension and open angle glaucoma Jason Hu,1 James Thinh Vu ,1 Brian Hong,1 Chloe Gottlieb1,2,3 ► Additional material is ABSTRact complications and PGAs became popular due to published online only. To view, Background Of the side effects of prostaglandin having once- daily administration and few side please visit the journal online (http:// dx. doi. org/ 10. 1136/ analogues (PGAs), uveitis and cystoid macular oedema effects. PGAs have emerged as the most potent bjophthalmol- 2019- 315280). (CME) have significant potential for vision loss based IOP- lowering topical medication with bimatoprost on postmarket reports. Caution has been advised due reported as the most effective and unoprostone as 1 University of Ottawa, Faculty to concerns of macular oedema and uveitis. In this the least effective.3 of Medicine, Ottawa, Ontario, report, we researched and summarised the original data Canada The specific mechanism of action of PGAs is 2University of Ottawa Eye suggesting these effects and determined their incidence. not completely understood. It is known that they Institute, Ottawa, Ontario, Methods Preferred Reporting Items for Systematic increase uveoscleral outflow and there is growing Canada review and Meta- Analyses guidelines were followed. 3 evidence that they also increase conventional Ottawa Hospital Research Studies evaluating topical PGAs in patients with ocular 4 Institute, Ottawa, Ontario, outflow through Schlemm’s canal. The proposed Canada hypertension or open angle glaucoma were included. mechanism is that PGAs bind to E- type prostanoid MEDLINE, PubMed, EMBASE, CINAHL, Web of Science, receptors and prostaglandin F receptors in ‘the Cochrane Library, LILACS and ClinicalTrials.
  • Adverse Periocular Reactions to Five Types of Prostaglandin Analogs

    Adverse Periocular Reactions to Five Types of Prostaglandin Analogs

    Eye (2012) 26, 1465–1472 & 2012 Macmillan Publishers Limited All rights reserved 0950-222X/12 www.nature.com/eye 1 1 1 1 Adverse periocular K Inoue , M Shiokawa , R Higa , M Sugahara , CLINICAL STUDY T Soga1, M Wakakura1 and G Tomita2 reactions to five types of prostaglandin analogs Abstract Purpose We investigated the appearance explained to patients before PG frequency of eyelid pigmentation and administration. eyelash bristles after the use of five types of Eye (2012) 26, 1465–1472; doi:10.1038/eye.2012.195; prostaglandin (PG) analogs. published online 5 October 2012 Methods This study included 250 eyes from 250 patients diagnosed with primary open- Keywords: prostaglandin analogs; adverse angle glaucoma or ocular hypertension who reactions; eyelid pigmentation; eyelash bristles; were treated with either latanoprost, patient’s subjective evaluation; physician’s travoprost, tafluprost, bimatoprost, or subjective evaluation isopropyl unoprostone for 43 months in only one eye. Photographs of both eyes were obtained, and the images were assessed by Introduction three ophthalmologists who were masked to treatment type. The existence of eyelid Prostaglandin (PG) analogs are the primary pigmentation and eyelash bristles was treatment for glaucoma because of their judged, and images of the left and right eyes powerful intraocular pressure (IOP) decreasing were compared. Subjective symptoms effect, few systematic adverse reactions, and regarding the existence of eyelid convenience of once a day administration (other pigmentation and eyelash bristles were than isopropyl unoprostone (unoprostone)).1 Five types of PG analogs (latanoprost, investigated through a questionnaire. 1Inouye Eye Hospital, Tokyo, Results There was no significant difference travoprost, tafluprost, bimatoprost, and Japan between the five types of medications with unoprostone) are currently available in Japan.
  • Comparison of Travoprost and Bimatoprost Plus Timolol Fixed

    Comparison of Travoprost and Bimatoprost Plus Timolol Fixed

    Comparison of Travoprost and Bimatoprost plus Timolol Fixed Combinations in Open-Angle Glaucoma Patients Previously Treated with Latanoprost plus Timolol Fixed Combination MARCO CENTOFANTI, FRANCESCO ODDONE, STEFANO GANDOLFI, ANTON HOMMER, ANDREAS BOEHM, LUCIA TANGA, CHIARA SANGERMANI, VITO SPORTELLI, MICHAEL HAUSTEIN, GIANLUCA MANNI, AND LUCA ROSSETTI ● PURPOSE: To compare the ocular hypotensive effect of ● CONCLUSIONS: Bimatoprost plus timolol and tra- bimatoprost plus timolol and travoprost plus timolol fixed voprost plus timolol can provide additional IOP-lowering combinations in glaucoma patients whose disease was effect in patients not fully controlled with latanoprost controlled but had not reached their target intraocular plus timolol. The observed additional IOP reduction was pressure (IOP) with the fixed combination of latanoprost greater with bimatoprost plus timolol with a similar plus timolol. tolerability profile. (Am J Ophthalmol 2010;150: (.DESIGN: A2؋ 3-month, multicenter, prospective, 575–580. © 2010 by Elsevier Inc. All rights reserved ● randomized, double-masked, cross-over clinical trial. ● METHODS: Eighty-nine open-angle glaucoma (OAG) OWERING INTRAOCULAR PRESSURE (IOP) IS THE patients were included. After a 6-week run-in period only evidence-based method for treating glaucoma1–3 with latanoprost plus timolol, patients were randomized and has been shown to reduce risk of visual field to either travoprost plus timolol or bimatoprost plus L progression from 13% to 19% per 1 mm Hg of IOP timolol for 3 months. Patients then switched to the lowering.2–4 According to the European Glaucoma Soci- opposite therapy for 3 additional months. The primary ety Guidelines, topical monotherapy is the first step in the end point was the comparison of mean daily IOP after 3 medical management5 and prostaglandin analogs are the months of each treatment.
  • Evidence Review D

    Evidence Review D

    National Institute for Health and Care Excellence Draft for consultation Intrapartum care for women with existing medical conditions or obstetric complications and their babies [D] Evidence reviews for asthma NICE guideline <TBC at publication> Evidence reviews for women at high risk of adverse outcomes for themselves and/or their baby because of existing maternal medical conditions September 2018 Draft for consultation Developed by the National Guideline Alliance hosted by the Royal College of Obstetricians and Gynaecologists DRAFT FOR CONSULTATION Disclaimer The recommendations in this guideline represent the view of NICE, arrived at after careful consideration of the evidence available. When exercising their judgement, professionals are expected to take this guideline fully into account, alongside the individual needs, preferences and values of their patients or service users. The recommendations in this guideline are not mandatory and the guideline does not override the responsibility of healthcare professionals to make decisions appropriate to the circumstances of the individual patient, in consultation with the patient and/or their carer or guardian. Local commissioners and/or providers have a responsibility to enable the guideline to be applied when individual health professionals and their patients or service users wish to use it. They should do so in the context of local and national priorities for funding and developing services, and in light of their duties to have due regard to the need to eliminate unlawful discrimination, to advance equality of opportunity and to reduce health inequalities. Nothing in this guideline should be interpreted in a way that would be inconsistent with compliance with those duties. NICE guidelines cover health and care in England.
  • Bimatoprost 0.03%/Timolol 0.5% Preservative-Free Ophthalmic

    Bimatoprost 0.03%/Timolol 0.5% Preservative-Free Ophthalmic

    BJO Online First, published on March 25, 2014 as 10.1136/bjophthalmol-2013-304064 Clinical science Br J Ophthalmol: first published as 10.1136/bjophthalmol-2013-304064 on 25 March 2014. Downloaded from Bimatoprost 0.03%/timolol 0.5% preservative-free ophthalmic solution versus bimatoprost 0.03%/timolol 0.5% ophthalmic solution (Ganfort) for glaucoma or ocular hypertension: a 12-week randomised controlled trial Ivan Goldberg,1 Rafael Gil Pina,2 Aitor Lanzagorta-Aresti,3 Rhett M Schiffman,4 Charlie Liu,4 Marina Bejanian4 ▸ Additional material is ABSTRACT As topical medications are normally dispensed published online only. To view Aim To compare the efficacy and safety of single-dose from multiuse bottles, preservative (typically ben- please visit the journal online (http://dx.doi.org/10.1136/ bimatoprost 0.03%/timolol 0.5% preservative-free (PF) zalkonium chloride, BAK) is employed to maintain bjophthalmol-2013-304064). ophthalmic solution with bimatoprost 0.03%/timolol sterility. Although many patients use preservative- 0.5% ophthalmic solution in patients with open-angle containing medications without adverse effects,10 11 1Department of Ophthalmology, University of glaucoma or ocular hypertension. some become sensitive to ophthalmic preserva- 12 13 Sydney, Sydney Eye Hospital, Methods In this multicentre, randomised, parallel- tives. A single-dose, preservative-free (PF) oph- Sydney, Australia group study, patients were randomised to bimatoprost/ thalmic fixed combination would benefit this patient 2 Clinica Oftalmologica Rafael timolol