Effect of Bimatoprost on Intraocular Pressure in Prostaglandin FP Receptor Knockout Mice
Total Page：16
File Type：pdf, Size：1020Kb
Effect of Bimatoprost on Intraocular Pressure in Prostaglandin FP Receptor Knockout Mice Jonathan G. Crowston,1 James D. Lindsey,1 Christy A. Morris,1 Larry Wheeler,2 Felipe A. Medeiros,1 and Robert N. Weinreb1 PURPOSE. To determine the effect of bimatoprost on intraocular ing are not known, it has been suggested that bimatoprost pressure in the prostaglandin FP receptor knockout mouse. fundamentally differs from latanoprost, by lowering IOP ETHODS through mechanisms that are independent of FP receptor sig- M . The IOP response to a single 1.2- g(4 L) dose of 5 bimatoprost was measured in the treated and untreated fellow naling. However, there is considerable controversy regarding eyes of homozygote (FPϩ/ϩ, n ϭ 9) and heterozygote (FPϮ, n the role of FP receptor signaling, because bimatoprost has ϭ been shown to bind and activate the FP receptor in cultured 10) FP-knockout mice, as well as in wild-type C57BL/6 mice 6 (FPϩ/ϩ, n ϭ 20). Serial IOP measurements were also per- human trabecular meshwork and human ciliary muscle cells. Measurement of aqueous humor dynamics in the mouse eye formed after topical bimatoprost in a separate generation of 7 homozygous FP-knockout mice and wild-type littermate con- has been detailed recently. The FP knockout mouse, gener- trol animals (n ϭ 4 per group). Aqueous humor protein ated by homologous translocation with a target vector that  concentrations were measured to establish the state of the replaces the second exon of the FP gene with the -galactosi- blood–aqueous barrier. Tissue, aqueous humor and vitreous dase and neomycin-resistance gene, was produced to demon- strate the critical role of the interaction of PGF2␣ with FP concentrations of bimatoprost, latanoprost, and their C-1 free 8 acids were determined by liquid chromatography and tandem receptors in the initiation of parturition in pregnant mice. We mass spectrometry. recently demonstrated that a single application of latanoprost had no effect on IOP in the FP homozygous knockout mice and RESULTS. A significant reduction in IOP was observed in the a diminished effect in the heterozygous knockout mice, com- bimatoprost-treated eye of wild-type mice at 2 hours, with a pared with C57 BL/6 background control mice.9 This indicates mean difference and 95% confidence interval (CI) of the dif- Ϫ Ϫ Ϫ that the FP receptor is necessary for the acute IOP response to ference in means of 1.33 mm Hg ( 0.81 to 1.84). Bimato- latanoprost. The FP-knockout mouse also provides the oppor- prost did not lead to a significant reduction in IOP in either the Ϫ Ϫ ϩ tunity to determine whether bimatoprost lowers IOP in the heterozygous knockout 0.36 mm Hg ( 0.82 to 0.09) or absence of the FP receptor. homozygous FP-knockout mice 0.25 mm Hg (Ϫ0.38 to ϩ0.89). The lack of an IOP response in the FP-knockout mice was not a consequence of blood–aqueous barrier breakdown, as there was no significant difference in aqueous humor protein con- METHODS centration between treated and fellow eyes. Tissue and aque- ous humor concentrations of bimatoprost, latanoprost, and Animal Husbandry their C-1 free acids indicate that latanoprost, but not bimato- All experiments were performed in compliance with the ARVO State- prost, is hydrolyzed in the mouse eye after topical administra- ment for the Use of Animals in Ophthalmic and Vision Research. Mice tion. lacking the gene encoding the FP receptor were obtained as a gift from CONCLUSIONS. An intact FP receptor gene is critical to the IOP Shuh Narumiya (Kyoto University, Japan). Homozygous knockout fe- response to bimatoprost in the mouse eye. (Invest Ophthalmol males fail to initiate parturition.8 For this reason, heterozygous (female) Vis Sci. 2005;46:4571–4577) DOI:10.1167/iovs.05-0723 and homozygous (male) mating pairs were used to generate an F1 generation. C57BL/6 mice constitute the founder species of the FP- knockout mice and were used as wild-type control subjects. Mice were opically administered prostaglandin (PG) F and its ana- 2␣ bred and housed in clear cages covered loosely with air filters and logues lower IOP in humans and nonhuman primates1,2 by T containing white pine shavings for bedding. The environment was increasing the uveoscleral outflow of aqueous humor.3 Bimato- kept at 21°C in a 12-hour light–dark cycle (light, 6:00 AM to 6:00 PM). prost, the C-1 ethyl amide of 17-phenyl-prostaglandin F ,a 2␣ All mice were fed ad libitum. Animal ages ranged from 6 to 9 months. structural analogue, is also a potent ocular hypotensive.4 Al- though the molecular mechanisms responsible for IOP lower- Drug Application To facilitate administration of eye drops, mice were restrained in a From the 1Hamilton Glaucoma Center and Department of Oph- conical plastic sleeve (Decapicone; Braintree Scientific Inc., Braintree, thalmology, University of California San Diego, La Jolla, California; and MA). Four microliters bimatoprost 0.03% (Allergan, Irvine, CA) was 2Allergan USA, Irvine, California. applied topically to the right eye. Dose–response curve and time Supported in part by the National Eye Institute EY05990 (RNW). course were performed in C57BL/6 mice to determine the optimum Submitted for publication June 8, 2005; revised July 21, 2005; dose of drug and the time of maximum IOP lowering. accepted October 13, 2005. Disclosure: J.G. Crowston, Alcon Inc. and Pfizer, Inc. (R); J.D. Lindsey, None; C.A. Morris, None; L. Wheeler, Allergan USA (E); Anesthesia F.A. Medeiros, None; R.N. Weinreb, Allergan USA (C) The mice were anesthetized by intraperitoneal injection of a mixture of The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertise- ketamine (100 mg/kg, Ketaset; Fort Dodge Animal Health, Fort Dodge, ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. IA) and xylazine (9 mg/kg, TranquiVed; Vedco Inc., St. Joseph, MO), as 10 Corresponding author: Robert N. Weinreb, Hamilton Glaucoma previously described. Each mouse was monitored carefully to assess Center, University of California San Diego, 9500 Gilman Drive, La Jolla, the state of anesthesia. If the mouse did not respond to pinching of the CA 92093-0946; [email protected]. back skin, it was placed on the platform for IOP measurement. Investigative Ophthalmology & Visual Science, December 2005, Vol. 46, No. 12 Copyright © Association for Research in Vision and Ophthalmology 4571 Downloaded from iovs.arvojournals.org on 10/02/2021 4572 Crowston et al. IOVS, December 2005, Vol. 46, No. 12 Determination of Mouse Genotype by PCR aqueous humor was aspirated through a microneedle attached to a 10-L syringe-equipped micropump (Hamilton, Reno, NV; and Micro 4, DNA was extracted from 8-mm tail biopsy specimens of anesthetized World Precision Instruments). The Bradford protein assay (Bio-Rad adult mice using a kit (69504; Qiagen, Valencia, CA) according to the Laboratories, Hercules, CA) was used according to the manufacturer’s manufacturer’s guidelines. The oligonucleotide primers used to detect guidelines. Aqueous humor samples (3 L) were diluted in 97 L homologous translocation were 5F (GCCCATCCTTGGACACCGAGA), phosphate-buffered saline. Eighty microliters of this solution was then 6R (AGAGTCGGCAAGCTGTGACTT) and NeoII (TGATATTGCTGAA- mixed with 20 L assay solution (Bio-Rad) in separate wells of a 96-well GAGCTTGG). Amplification was performed over 35 cycles of 94°C for microtiter plate. Absorption was measured at 595 nm with a microtiter 30 seconds, 65°C for 30 seconds, and 75°C for 10 minutes. PCR plate reader (SpectraMax 250). Aqueous protein concentration was products were analyzed by electrophoresis in 1% agarose gels. The determined from linear regression curves derived from bovine serum PCR product sizes were 700 bp for the FP receptor gene and 450 bp, albumin standards. corresponding to the LacZ/neo(r) cassette. DNA from the heterozygote Ϫ Ϫ Fp / mice therefore produces two bands (700 and 450 bp) and DNA Tissue Drug Concentrations from a homozygous FPϩ/ϩ-knockout mouse producing a single band (450 bp). To understand the contribution of 17-phenyl trinor PGF2␣, the C-1 acid of bimatoprost and a potent FP agonist, to lowering IOP in the mouse, we sought to determine the hydrolysis of bimatoprost in ocular tissues Measurement of IOP of C57BL/6J mice killed 2 hours after a single dose. A further group of Cannulation Technique. IOP measurements were performed mice treated with latanoprost was included for comparison. between 2 and 6 PM to reduce the effect of circadian variation in Both eyes of 20 mice were treated topically with 4 L of 0.03% IOP.11 Measurements were performed by cannulation of the anterior bimatoprost (1.2 g) per eye. Another 20 mice were treated with 4 L chamber, as described in detail previously.7 Beveled microneedles of 0.005% latanoprost in the same manner. Untreated mice (n ϭ 32) were made of borosilicate glass with a tip diameter between 75 and were used as the negative control. Mice were killed with CO2 gas at 2 100 m. The microneedle was mounted on a micromanipulator to hours after treatment and weighed. The eyes were enucleated, and enable accurate positioning. It was connected to a pressure transducer bimatoprost or latanoprost and the corresponding C-1 acid concentra- (Model BLPR; World Precision Instruments, Sarasota, FL) which was tions were determined by liquid chromatography and tandem mass calibrated against a manometer over the range of 0 to 30 mm Hg, as spectrometry (LC-MS/MS). described previously.10 IOP was measured in both eyes within 7 Eyes were briefly rinsed in Dulbecco’s phosphate-buffered saline.