Tnr8, a Foldback Transposable Element from Rice

Total Page:16

File Type:pdf, Size:1020Kb

Tnr8, a Foldback Transposable Element from Rice Genes Genet. Syst. (2000) 75, p. 327–333 Tnr8, a foldback transposable element from rice Chaoyang Cheng, Suguru Tsuchimoto, Hisako Ohtsubo, and Eiichi Ohtsubo* Institute of Molecular and Cellular Biosciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-0032, Japan (Received 19 December 2000, accepted 4 Junuary 2001) An insertion sequence 418 bp in length was found in one member of rice retroposon p-SINE1 in Oryza glaberrima. This sequence had long terminal inverted repeats (TIRs) and is flanked by direct repeats of a 9-bp sequence at the target site, indicative that the insertion sequence is a rice transposable element, which we named Tnr8. Interestingly, each TIR sequence consisted of a unique 9-bp terminal sequence and six tandem repeats of a sequence about 30 bp in length, like the foldback transposable element first identified in Drosophila. A homology search of databases and analysis by PCR revealed that a large number of Tnr8 members with sequence variations were present in the rice genome. Some of these members were not present at given loci in several rice species with the AA ge- nome. These findings suggest that the Tnr8 family members transposed long ago, but some appear to have mobilized after rice strains with the AA genome diverged. The Tnr8 members are thought to be involved in rearrangements of the rice genome. in sea urchin (Hoffman-Liebermann et al., 1985), TFB1 in INTRODUCTION Chiromomus thummi (Hankeln and Schmidt, 1990), and Numerous kinds of transposable elements have been SoFT in Solanaceae plants (Rebatchouk and Narita, described in plants, animals and other organisms (for 1997). review, see Berg and Howe, 1989). Based on their trans- In this report, we show that a member of the rice position mechanisms, they are divided into two classes. retroposon p-SINE1 family (Umeda et al., 1991) in O. One is the DNA-type transposable element which moves glaberrima contains an FB-like element, named Tnr8, via a DNA form using a cut-and-paste mechanism and is which has TIRs that contain tandem repeats of a sequence characterized by the presence of terminal inverted repeats about 30 bp in length. This element is distinct from other (TIRs). The other is the retroelement, which moves via rice transposable elements. No sequence similarity was an RNA intermediate using a mechanism involving re- found between Tnr8 and the foldback transposable ele- verse transcription of the intermediate and integration of ments identified in other organisms. Tnr8 appears to cDNA into another location in the genome. All of these constitute a large family in the rice genome, whose mem- elements, however, generate a duplication of the target bers have a variation(s) in their sequences. We discuss site sequence of several bp long upon their transposition. the possibility that the Tnr8 members are involved in re- The Drosophila FB (foldback) element is a transposable arrangements of the rice genome. element with long TIRs, which contain tandem repeats of a conserved sequence (Potter et al., 1980). These TIRs MATERIALS AND METHODS vary in the length from several hundred bp to several kb due to a variation in the number of the tandem repeats Plant materials. Rice strains with the AA genome, (Levis et al., 1982; Potter, 1982a; 1982b; Trutt et al., 1981). Oryza sativa (Nipponbare and IR36), O. glaberrima About 10% of the FB element members carry a well-con- (GMS1), O. longistaminata (W1451), O. meridionalis served 4-kb internal sequence between TIRs, whereas the (W1625), and O. glumaepatula (W1192) were obtained other members have no or a very short internal sequence from the Genetic Strains Research Center of National (Brierley and Potter, 1985). The FB element is supposed Institute of Genetics, Japan. Total genomic DNAs were to be a DNA-type transposable element (Potter, 1982a). isolated from these strains as described previously FB-like transposable elements with TIRs consisting of tan- (Ohtsubo et al., 1991). dem repeats have been identified in other organisms: TU Computer analysis. Primary nucleotide sequences Edited by Takashi Endo were analyzed with the program HarrPlot 1.2.2 and the * Corresponding author. E-mail: [email protected] GENETYX-Mac 10.1 system. The computer-assisted 328 C. CHENG et al. Table 1. Primers used for PCR Primera Sequence (5' to 3') dTnr8-P GAGTAAATTTCACAAACTACA G23-46-3F ATTGGCCTGAATGATTGGGT Try1 GAGAACCAATGAAAAGAGTG AQ365837-2F GACGAACGGGATCAGCGTGT AQ365837-2R ATCTTTTTACCTTGGACCAATTAAC AP000391-F ATGTGTAGGGTGACTGGATG AP000391-R CAACTCGGTGGGCCACGTTG AC051633-F CTGCAGATCGTCAATAACGG AC051633-R ATGTGCTAAGCCAATTTCGG AC027133-F CCACATGCATGGCGCAGTAG AC027133-R TATGTGCACACGCTTAGCAT a Primer dTnr8-P was used to isolate the fragment with Tnr8-21, and others were used to amplify the fragments with each of Tnr8-1 - Tnr8-5. nucleotide sequence searches for Tnr8 homologs in the DDBJ/Genbank/EMBL databases were done using the programs BLAST (Altschul et al., 1990) and Smith- Waterman search (Smith and Waterman, 1981). Mul- tiple sequences were aligned using the program CLUSTAL W (version 1.7) with some manual modifications. Polymerase chain reaction (PCR), cloning, and DNA sequencing. The primers used are listed in Table 1. The PCR was carried out in a reaction mixture (20 µl) con- taining 100 to 200 ng total rice DNA and Ex Taq DNA polymerase (Takara). Thirty repeats of thermal cycling, consisting of denaturation at 94°C for 30 sec, annealing at 60–65°C for 30 sec and extension at 72°C for 1 min, were Fig. 1. (A) The structure of Tnr8. Tnr8 has TIRs, each consist- done. The PCR products were analyzed by electrophore- ing of a terminal 9-bp sequence (TSL or TSR; solid short arrows) sis in a 1.8 % agarose gel, and directly sequenced by using and tandem repeats (1L -6L or 1R - 6R; open arrows), in which tandem repeat units in the left and right TIR are numbered with a BigDye Terminator kit (PE Biosystem) and an ABI377 L and R in the order from each end of Tnr8, respectively. The sequencing apparatus. Some PCR products were cloned two TIRs flank a 40-bp internal sequence (a thin line). The un- into pGEM-T Easy Vector (Promega) and sequenced as derlined 9-bp sequences in the regions flanking Tnr8 represent described above. the target site sequence duplicated upon insertion. (B) The nucleotide sequence of Tnr8. The terminal 9-bp sequence and the tandem repeats are indicated. The 40-bp internal region is Accessions. Nucleotide sequence data appear in the shown in boldface. DDBJ/EMBL/GenBank International Nucleotide Se- quence Databases under the accession numbers AB052632 - AB052634. indicates that the insertion sequence in p-SINE1-r32 is a transposable element, and we therefore named it Tnr8 (Transposable element of rice No. 8). Tnr8 had long ter- RESULTS ―― ― ― minal inverted repeats (TIRs), 189 bp in length, which An insertion sequence (named Tnr8) in p-SINE1- flank an internal 40-bp sequence. Each TIR consisted of r32. A PCR-amplified fragment containing a p-SINE1 a 9-bp unique terminal sequence and six tandem repeats member (p-SINE1-r32) at a locus in the O. glaberrima ge- of a sequence about 30 bp in length (Fig. 1). These struc- nome was found to be larger than that from O. sativa. tural features in Tnr8 are distinct from those in other rice Nucleotide sequencing revealed that the fragment con- transposable elements, but are reminiscent of foldback tained an insertion of a 418-bp sequence which was not transposable elements such as FB of Drosophila, TU of sea present in p-SINE1-r32 at the same locus in the O. sativa urchin, and SoFT of Solanaceae plants, all of which have genome (Fig. 1). This insertion sequence was flanked by TIRs with tandem repeats. Tnr8, however, did not show direct repeats of a 9-bp sequence in p-SINE1-r32, which any sequence homology with the foldback transposable has been duplicated by the insertion event (Fig. 1). This elements. A foldback transposable element from rice 329 Tnr8-homologous members in the rice genome. than rice. Fig. 2 shows schematic structures of 35 mem- A homology search in databases using Tnr8 as the query bers that we characterized, in which the Tnr8-1 is the first sequence revealed that many Tnr8 homologous members one found in p-SINE1-r32 of O. glaberrima. Although the were present in the O. sativa genome. No Tnr8 homolo- Tnr8 members showed high variations both in size and in gous members were, however, found in plant species other sequence, these members were essentially similar in struc- Fig. 2. Structures of Tnr8-homolog members. Tnr8-1 is the first element found in O. glaberrima. Tnr8-21 is a member isolated as a PCR-amplified fragment from O. sativa using a primer hybridizing to two terminal regions of the TIRs in Tnr8. The other Tnr8 mem- bers were identified by a homology search of databases. The terminal 9-bp sequences (solid arrowheads), tandem repeats (open ar- rows), and conserved internal region (short thick lines) are shown. Broken lines indicate the absence of Tnr8 sequences. Deleted regions of length more than 4 bp are shown by blank spaces. Non-Tnr8 chromosomal sequences are shown by thin solid lines. Sizes of Tnr8 members are shown in bp. Note that structures of 14 members (Tnr8-22 - Tnr8-35) are not fully drawn, because sequence data are not available. Sizes of the duplicated target site sequences are shown in bp. Some Tnr8 members appear to be truncated in either of the two end regions, and thus the duplicated target site sequences in these members could not be assigned. Homology with the consen- sus sequence of Tnr8 is shown in percentage. The accession numbers to the sequences containing Tnr8 members are given.
Recommended publications
  • Identification of a Non-LTR Retrotransposon from the Gypsy Moth
    Insect Molecular Biology (1999) 8(2), 231-242 Identification of a non-L TR retrotransposon from the gypsy moth K. J. Garner and J. M. Siavicek sposons (Boeke & Corces, 1989), or retroposons USDA Forest Service, Northeastern Research Station, (McClure, 1991). Many non-L TR retrotransposons Delaware, Ohio, U.S.A. have been described in insects, including the Doc (O'Hare et al., 1991), F (Di Nocera & Casari, 1987), I (Fawcett et al., 1986) and jockey (Priimiigi et al., 1988) Abstract elements of Drosophila melanogaster, the T1Ag A family of highly repetitive elements, named LDT1, (Besansky, 1990) and Q (Besansky et al., 1994) ele- has been identified in the gypsy moth, Lymantria ments of Anopheles gambiae, and the R1Bm (Xiong & dispar. The complete element is 5.4 kb in length and Eickbush, 1988a) and R2Bm (Burke et al., 1987) lacks long-terminal repeats, The element contains two families of ribosomal DNA insertions in Bombyx mori. open reading frames with a significant amino acid Gypsy moths (Lymantria dispar) are currently wide- sequence similarity to several non-L TR retrotrans- spread forest pests in the north-eastern United States posons. The first open reading frame contains a and the adjacent regions of Canada. Population region that potentially encodes a polypeptide similar markers have been sought to distinguish the North to DNA-binding GAG-like proteins. The second American gypsy moths introduced from Europe in 1869 encodes a polypeptide resembling both endonuclease from those recently introduced from Asia (Bogdano- and reverse transcriptase sequences. A" members of wicz et al., 1993; Pfeifer et al., 1995; Garner & Siavicek, the LDT1 element family sequenced thus far have poly- 1996; Schreiber et al., 1997).
    [Show full text]
  • The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease
    The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease by Sepehr Ehsani A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Sepehr Ehsani 2012 The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease Sepehr Ehsani Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2012 Abstract The cellular prion protein (PrPC) is unique amongst mammalian proteins in that it not only has the capacity to aggregate (in the form of scrapie PrP; PrPSc) and cause neuronal degeneration, but can also act as an independent vector for the transmission of disease from one individual to another of the same or, in some instances, other species. Since the discovery of PrPC nearly thirty years ago, two salient questions have remained largely unanswered, namely, (i) what is the normal function of the cellular protein in the central nervous system, and (ii) what is/are the factor(s) involved in the misfolding of PrPC into PrPSc? To shed light on aspects of these questions, we undertook a discovery-based interactome investigation of PrPC in mouse neuroblastoma cells (Chapter 2), and among the candidate interactors, identified two members of the ZIP family of zinc transporters (ZIP6 and ZIP10) as possessing a PrP-like domain. Detailed analyses revealed that the LIV-1 subfamily of ZIP transporters (to which ZIPs 6 and 10 belong) are in fact the evolutionary ancestors of prions (Chapter 3).
    [Show full text]
  • Using Rnai to Elucidate Mechanisms of Human Disease
    Cell Death and Differentiation (2008) 15, 809–819 & 2008 Nature Publishing Group All rights reserved 1350-9047/08 $30.00 www.nature.com/cdd Review From sequence to function: using RNAi to elucidate mechanisms of human disease NM Wolters1 and JP MacKeigan*,1 RNA interference (RNAi) has emerged as one of the most powerful tools for functionally characterizing large sets of genomic data. Capabilities of RNAi place it at the forefront of high-throughput screens, which are able to span the human genome in search of novel targets. Although RNAi screens have been used to elucidate pathway components and discover potential drug targets in lower organisms, including Caenorhabditis elegans and Drosophila, only recently has the technology been advanced to a state in which large-scale screens can be performed in mammalian cells. In this review, we will evaluate the major advancements in the field of mammalian RNAi, specifically in terms of high-throughput assays. Crucial points of experimental design will be highlighted, as well as suggestions as to how to interpret and follow-up on potential cell death targets. Finally, we assess the prospective applications of high-throughput screens, the data they are capable of generating, and the potential for this technique to further our understanding of human disease. Cell Death and Differentiation (2008) 15, 809–819; doi:10.1038/sj.cdd.4402311; published online 18 January 2008 The sequencing of the human genome ushered a new era into maintaining the balance between cell survival, cell death, the field of modern biology; it is now possible to elucidate and autophagy represents a crucial regulatory point in human molecular pathways relevant to development and disease health and that when this balance is tipped, a variety of with a breadth never before seen.
    [Show full text]
  • The Beaver's Phylogenetic Lineage Illuminated by Retroposon Reads
    www.nature.com/scientificreports OPEN The Beaver’s Phylogenetic Lineage Illuminated by Retroposon Reads Liliya Doronina1,*, Andreas Matzke1,*, Gennady Churakov1,2, Monika Stoll3, Andreas Huge3 & Jürgen Schmitz1 Received: 13 October 2016 Solving problematic phylogenetic relationships often requires high quality genome data. However, Accepted: 25 January 2017 for many organisms such data are still not available. Among rodents, the phylogenetic position of the Published: 03 March 2017 beaver has always attracted special interest. The arrangement of the beaver’s masseter (jaw-closer) muscle once suggested a strong affinity to some sciurid rodents (e.g., squirrels), placing them in the Sciuromorpha suborder. Modern molecular data, however, suggested a closer relationship of beaver to the representatives of the mouse-related clade, but significant data from virtually homoplasy- free markers (for example retroposon insertions) for the exact position of the beaver have not been available. We derived a gross genome assembly from deposited genomic Illumina paired-end reads and extracted thousands of potential phylogenetically informative retroposon markers using the new bioinformatics coordinate extractor fastCOEX, enabling us to evaluate different hypotheses for the phylogenetic position of the beaver. Comparative results provided significant support for a clear relationship between beavers (Castoridae) and kangaroo rat-related species (Geomyoidea) (p < 0.0015, six markers, no conflicting data) within a significantly supported mouse-related clade (including Myodonta, Anomaluromorpha, and Castorimorpha) (p < 0.0015, six markers, no conflicting data). Most of an organism’s phylogenetic history is fossilized in their heritable genomic material. Using data from genome sequencing projects, particularly informative regions of this material can be extracted in sufficient num- bers to resolve the deepest history of speciation.
    [Show full text]
  • A Field Guide to Eukaryotic Transposable Elements
    GE54CH23_Feschotte ARjats.cls September 12, 2020 7:34 Annual Review of Genetics A Field Guide to Eukaryotic Transposable Elements Jonathan N. Wells and Cédric Feschotte Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York 14850; email: [email protected], [email protected] Annu. Rev. Genet. 2020. 54:23.1–23.23 Keywords The Annual Review of Genetics is online at transposons, retrotransposons, transposition mechanisms, transposable genet.annualreviews.org element origins, genome evolution https://doi.org/10.1146/annurev-genet-040620- 022145 Abstract Annu. Rev. Genet. 2020.54. Downloaded from www.annualreviews.org Access provided by Cornell University on 09/26/20. For personal use only. Copyright © 2020 by Annual Reviews. Transposable elements (TEs) are mobile DNA sequences that propagate All rights reserved within genomes. Through diverse invasion strategies, TEs have come to oc- cupy a substantial fraction of nearly all eukaryotic genomes, and they rep- resent a major source of genetic variation and novelty. Here we review the defining features of each major group of eukaryotic TEs and explore their evolutionary origins and relationships. We discuss how the unique biology of different TEs influences their propagation and distribution within and across genomes. Environmental and genetic factors acting at the level of the host species further modulate the activity, diversification, and fate of TEs, producing the dramatic variation in TE content observed across eukaryotes. We argue that cataloging TE diversity and dissecting the idiosyncratic be- havior of individual elements are crucial to expanding our comprehension of their impact on the biology of genomes and the evolution of species. 23.1 Review in Advance first posted on , September 21, 2020.
    [Show full text]
  • Mg-SINE: a Short Interspersed Nuclear Element from the Rice Blast Fungus, Magnaporthe Grisea (Transposon/Repeated DNA) PRADEEP KACHROO*, SALLY A
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 11125-11129, November 1995 Genetics Mg-SINE: A short interspersed nuclear element from the rice blast fungus, Magnaporthe grisea (transposon/repeated DNA) PRADEEP KACHROO*, SALLY A. LEONGt, AND BHARAT B. CHATTOO*t *Department of Microbiology and Biotechnology Center, Faculty of Science, M. S. University of Baroda, Baroda 390 002, India; and tU.S. Department of Agriculture-Agricultural Research Service Plant Disease Research Unit, 1630 Linden Drive, University of Wisconsin, Madison, WI 53706 Communicated by M. S. Swaminathan, M. S. Swaminathan Research Foundation, Madras, India, June 28, 1995 ABSTRACT A short interspersed nuclear element, Mg- Magnaporthe grisea, an ascomycetous fungus responsible for SINE, was isolated and characterized from the genome of the the blast disease of rice (Oryza sativa), is known to generate rice blast fungus, Magnaporthe grisea. Mg-SINE was isolated new pathogenic variants at a high frequency (15). Various as an insertion element within Pot2, an inverted-repeat trans- mechanisms have been postulated to explain pathogenic vari- poson from M. grisea and shows typical features of a mam- ability in this fungus (15-17), although its molecular basis malian SINE. Mg-SINE is present as a 0.47-kb interspersed remains elusive. We initiated an analysis of repeated DNA sequence at "100 copies per haploid genome in both rice and sequences of M. grisea in order to delineate their role in non-rice isolates of M. grisea, indicating a common evolution- genome organization and generation of variability. We report ary origin. Secondary structure analysis ofMg-SINE revealed here the presence of a SINE sequence in the genome of M.
    [Show full text]
  • 5' Exonuclease ERL1 in Chloroplast Ribosomal RNA
    Dissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) im Fachbereich 18 - Naturwissenschaften der Universität Kassel vorgelegt von: Heiko Tobias Schumacher Kassel im Mai 2009 Datum der Disputation: 16. Juli 2009 Die Natur ist aller Meister Meister, sie zeigt uns erst den Geist der Geister Johann Wolfgang v. Goethe Erklärung Hiermit versichere ich, dass ich die vorliegende Dissertation selbständig und ohne unerlaubte Hilfe angefertigt und andere als die in der Dissertation angegebenen Hilfsmittel nicht benutzt habe. Alle Stellen, die wörtlich oder sinngemäß aus veröffentlichten oder unveröffentlichten Schriften entnommen sind, habe ich als solche kenntlich gemacht. Kein Teil dieser Arbeit ist in einem anderen Promotions- oder Habilitationsverfahren verwendet worden. Kassel, den 03. Mai 2009 __________________________________ Heiko Tobias Schumacher Zusätzliche Erklärung über kooperative Arbeiten und Publikation Teile der in dieser Dissertation präsentierten Resultate sind das Ergebnis kooperativer Arbeiten von Heiko Tobias Schumacher (Universität Kassel) und Jutta Maria Helm (Universität für Bodenkultur Wien) am Institut für Molekularbiologie und Biotech- nologie in Heraklion, Griechenland. Die folgenden Arbeiten wurden von Jutta Maria Helm durchgeführt: • Herstellung transgener Nicotiana benthamiana-Pflanzen zur Überexpression bzw. Suppression von ERL1 (vergl. Abschnitt 2.2.6.). • Herstellung doppelt-homozygoter Kreuzungen zwischen der GFP-exprimieren- den Nicotiana benthamiana-Linie GFP 6.4 mit ERL1-überexprimierenden Pflan- zen (vergl. Abschnitt 3.3.2.). • Chlorophyll a Fluoreszenz-Messungen zur Charakterisierung grundlegender bioenergetischer Parameter in ERL1-überexprimierenden Pflanzen (vergl. Ab- schnitt 3.4.3.). • Klonierung kleiner ribosomaler RNAs zur Analyse der 3’-Enden pflanzlicher 5.8S, 5S und 4.5S rRNAs (vergl. Abschnitte 2.2.11. und 3.6.1.). Der Elektronenmikroskop-Service wurde von Eva Papadogiorgaki geleitet.
    [Show full text]
  • Sva Elements: Hominid Specific Retrotransposons
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2006 SVA elements: hominid specific etrr otransposons Hui Wang Louisiana State University and Agricultural and Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Recommended Citation Wang, Hui, "SVA elements: hominid specific er trotransposons" (2006). LSU Doctoral Dissertations. 2016. https://digitalcommons.lsu.edu/gradschool_dissertations/2016 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. SVA ELEMENTS: HOMINID SPECIFIC RETROTRANSPOSONS A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Biological Sciences By Hui Wang B.S., Shanghai Jiao Tong University, P.R.China, 2000 M.S., Shanghai Jiao Tong University, P.R.China, 2003 December 2006 ACKNOWLEDGEMENTS I would like to thank Dr. Mark A. Batzer, my advisor, for his continuous guidance, constant encouragement, and financial support during my Ph.D study at LSU. It is my great pleasure to learn from and work with such a knowledgeable, considerate, and helpful scholar. I want to express my sincere gratitude to my committee members, Dr. David Donze, Dr. Joomyeong Kim, Dr. Stephania Cormier and Dr. Karin Peterson. I would like to thank all of them for kindly serving on my committee. Also I want to thank members in the Batzer’s laboratory for their scientific guidance and friendship, especially to Dr.
    [Show full text]
  • Retroposon Analysis and Recent Geological Data Suggest Near-Simultaneous Divergence of the Three Superorders of Mammals
    Retroposon analysis and recent geological data suggest near-simultaneous divergence of the three superorders of mammals Hidenori Nishiharaa, Shigenori Maruyamab, and Norihiro Okadaa,1 aDepartment of Biological Sciences, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259-B-21 Nagatsuta-cho, Midori-ku, Yokohama 226-8501, Japan; and bDepartment of Earth and Planetary Sciences, Graduate School of Science and Engineering, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro-ku, Tokyo 152-8551, Japan Edited by Masatoshi Nei, Pennsylvania State University, University Park, PA, and approved February 13, 2009 (received for review September 17, 2008) As a consequence of recent developments in molecular phylog- (9). They estimated molecular divergence times among many enomics, all extant orders of placental mammals have been mammalian orders to be Ϸ100 Ma, which is inconsistent with grouped into 3 lineages: Afrotheria, Xenarthra, and Boreotheria, fossil records suggesting that most mammals had diverged after which originated in Africa, South America, and Laurasia, respec- 65 Ma. One of their interpretations was that the early divergence tively. Despite this advancement, the order of divergence of these of mammals occurred because of several continental fissions. 3 lineages remains unresolved. Here, we performed extensive This hypothesis prompted many biologists to consider available retroposon analysis with mammalian genomic data. Surprisingly, geological data when estimating lineage divergence. One of the we identified a similar number of informative retroposon loci that outcomes of this idea is Afrotheria, which is a good represen- support each of 3 possible phylogenetic hypotheses: the basal tative case for the association between continental drift and position for Afrotheria (22 loci), Xenarthra (25 loci), and Boreoth- mammalian evolution (10, 11).
    [Show full text]
  • Downloads/Repeatmaskedgenomes
    Kojima Mobile DNA (2018) 9:2 DOI 10.1186/s13100-017-0107-y REVIEW Open Access Human transposable elements in Repbase: genomic footprints from fish to humans Kenji K. Kojima1,2 Abstract Repbase is a comprehensive database of eukaryotic transposable elements (TEs) and repeat sequences, containing over 1300 human repeat sequences. Recent analyses of these repeat sequences have accumulated evidences for their contribution to human evolution through becoming functional elements, such as protein-coding regions or binding sites of transcriptional regulators. However, resolving the origins of repeat sequences is a challenge, due to their age, divergence, and degradation. Ancient repeats have been continuously classified as TEs by finding similar TEs from other organisms. Here, the most comprehensive picture of human repeat sequences is presented. The human genome contains traces of 10 clades (L1, CR1, L2, Crack, RTE, RTEX, R4, Vingi, Tx1 and Penelope) of non-long terminal repeat (non-LTR) retrotransposons (long interspersed elements, LINEs), 3 types (SINE1/7SL, SINE2/tRNA, and SINE3/5S) of short interspersed elements (SINEs), 1 composite retrotransposon (SVA) family, 5 classes (ERV1, ERV2, ERV3, Gypsy and DIRS) of LTR retrotransposons, and 12 superfamilies (Crypton, Ginger1, Harbinger, hAT, Helitron, Kolobok, Mariner, Merlin, MuDR, P, piggyBac and Transib) of DNA transposons. These TE footprints demonstrate an evolutionary continuum of the human genome. Keywords: Human repeat, Transposable elements, Repbase, Non-LTR retrotransposons, LTR retrotransposons, DNA transposons, SINE, Crypton, MER, UCON Background contrast, MER4 was revealed to be comprised of LTRs of Repbase and conserved noncoding elements endogenous retroviruses (ERVs) [1]. Right now, Repbase Repbase is now one of the most comprehensive data- keeps MER1 to MER136, some of which are further bases of eukaryotic transposable elements and repeats divided into several subfamilies.
    [Show full text]
  • 1 an ABBA-BABA Test for Introgression Using Retroposon
    bioRxiv preprint doi: https://doi.org/10.1101/709477; this version posted July 20, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. An ABBA-BABA Test for Introgression Using Retroposon Insertion Data Mark S. Springer and John Gatesy From the Department of Evolution, Ecology, and Organismal Biology, University of California, Riverside, CA 92521 (Springer); Division of Vertebrate Zoology and Sackler Institute for Comparative Genomics, American Museum of Natural History, New York, NY 10024 (Gatesy). Address correspondence to Mark S. Springer or J. Gatesy at the above addresses, or e- mail: [email protected] (Springer); [email protected] (Gatesy). Abstract DNA sequence alignments provide the majority of data for inferring phylogenetic relationships with both concatenation and coalescence methods. However, DNA sequences are susceptible to extensive homoplasy, especially for deep divergences in the Tree of Life. Retroposon insertions have emerged as a powerful alternative to sequences for deciphering evolutionary relationships because these data are nearly homoplasy-free. In addition, retroposon insertions satisfy the 'no intralocus recombination' assumption of summary coalescence methods because they are singular events and better approximate neutrality relative to DNA sequences commonly applied in phylogenomic work. Retroposons have traditionally been analyzed with phylogenetic methods that ignore incomplete lineage sorting (ILS). Here, we analyze three retroposon data sets for mammals (Placentalia, Laurasiatheria, Balaenopteroidea) with two different ILS-aware methods. The first approach constructs a species tree from retroposon bipartitions with ASTRAL, and the second is a modification of SVD-Quartets. We also develop a χ2 Quartet-Asymmetry Test to detect hybridization using retroposon data.
    [Show full text]
  • Transposable Elements in Cancer and Other Human Diseases Benoît Chénais
    Transposable Elements in Cancer and Other Human Diseases Benoît Chénais To cite this version: Benoît Chénais. Transposable Elements in Cancer and Other Human Diseases. Cur- rent Cancer Drug Targets, Bentham Science Publishers, 2015, 15 (3), pp.227 - 242. 10.2174/1568009615666150317122506. hal-01905441 HAL Id: hal-01905441 https://hal.archives-ouvertes.fr/hal-01905441 Submitted on 25 Oct 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Mini review: Transposable Elements in Cancer and other Human Diseases Benoît Chénais* Mer Molécules Santé EA2160, UFR Sciences et Techniques, Université du Maine, Le Mans, France. *Corresponding Author: Chénais B., Mer Molécules Santé, UFR Sciences et Techniques, Université du Maine, Avenue Olivier Messiaen, F-72085 Le Mans Cedex, France, Tel:+33- 243-833-25; fax +33-243-833-917; Email: [email protected] Abstract: Transposable elements (TEs) are mobile DNA sequences representing a substantial fraction of most genomes. Through the creation of new genes and functions, TEs are important elements of genome plasticity and evolution. However TE insertion in human genomes may be the cause of genetic dysfunction and alteration of gene expression contributing to cancer and other human diseases.
    [Show full text]