Frequent Homozygous Deletions in the FRA3B Region in Tumor Cell Lines Still Leave the FHIT Exons Intact

Frequent homozygous deletions in the FRA3B region in tumor cell lines still leave the FHIT exons intact

Liang Wang1, John Darling1, Jin-San Zhang1, Chi-Ping Qian1, Lynn Hartmann2, Cheryl Conover2, Robert Jenkins1 and David I Smith1

1Division of Experimental Pathology, Department of Laboratory Medicine and Pathology; and 2Department of Medical Oncology, Mayo Clinic/Foundation, 200 First Street, SW, Rochester, Maine 55902, USA

FRA3B at human chromosomal band 3p14.2 is the most Soreng, 1984). However, whether or not fragile sites active common fragile site in the human genome. The play a causative role in these structural chromosome molecular mechanism of fragility at this region remains alterations has yet to be determined. unknown but does not involve expansion of a trinucleo- FRA3B, at chromosome band 3p14.2, is the most tide or minisatellite repeat as has been observed for highly inducible fragile site in the human genome several of the cloned rare fragile sites. Deletions and (Smeets et al., 1986). The constitutive familial renal cell rearrangements at FRA3B have been observed in a carcinoma-associated translocation t(3;8)(p14.2;q24) number of distinct tumors. The recently identi®ed (hRCC) (Cohen et al., 1979) was localized immedi- putative tumor suppressor gene FHIT spans FRA3B, ately centromeric of FRA3B (Paradee et al., 1995; and various groups have reported identifying deletions in Boldog et al., 1993). Structural rearrangements and this gene in dierent tumors. Using a high density of deletions at FRA3B were reported in a variety of PCR ampli®able markers within FRA3B searching for histologically dierent cancers including lung (Todd et deletions in the FRA3B region, we have analysed 21 al., 1997), breast (Panagopoulos et al., 1996), tumor cell lines derived from renal cell, pancreatic, and esophageal (Wang et al., 1996), ovarian (Ehlen et al., ovarian carcinomas. We found a commonly deleted 1990), and renal cell carcinoma (RCC) (Druck et al., region in the renal cell and ovarian carcinoma cell lines 1995; van den Berg et al., 1997). located in the middle of an HPV16 viral integration site. We previously reported frequent breakage at Despite the presence of deletions in the FRA3B region in FRA3B in renal cell carcinoma and pancreatic cancer most of the cell lines, we did not detect alterations in (Shridhar et al., 1996, 1997). Limited polymorphic FHIT exons in any of the cell lines examined. Thus, microsatellite markers in this region and normal cell deletions of 3p14.2 in these carcinoma cell lines may contamination in tumor tissues restricted our further simply re¯ect instability of the FRA3B region during allelotype analysis in paired tumor tissues. The tumor progression. advantage of working with tumor cell lines is that they are free of normal cell contamination and can Keywords: deletions; tumor cell lines; FRA3B; FHIT thus be used for the analysis of homozygous deletions even with markers that are not polymorphic. We analysed deletions in the FRA3B region using 27 STS markers to delineate the deleted fragments along this Introduction region in 21 tumor cell lines (eight RCCs, eight pancreatic, and ®ve ovarian carcinomas). The high Fragile sites on chromosomes are regions susceptible to density of STS markers allowed us to map small breakage when cells are exposed to speci®c experi- deletions in these tumors. A frequent deletion/breakage mental conditions. Some chemicals such as inhibitors region was detected in the center of the FRA3B region, of the folic acid pathway, ¯uorodeoxyuridine, caeine, de®ned by FISH analysis (Wilke et al., 1996) in RCCs and aphidicolin, can induce the expression of fragile and ovarian cancers. Unlike the changes that have been sites during metaphase. The fragile sites can be reported in some human tumors (Ohta et al., 1996; classi®ed as common or rare, based upon the Sozzi et al., 1996), the RCCs, pancreatic and ovarian frequency of their occurrence in the human population carcinomas had no apparent FHIT gene alterations. (Sutherland and Hecht, 1985). Expression of the known cloned rare fragile sites is associated with the expansion of trinucleotide or minisatellite sequences Results (Fu et al., 1991; Knight et al., 1993; Parrish et al., 1994; Jones et al., 1994; Yu et al., 1997). Common Positions of STS markers, repetitive sequences and fragile sites appear to be present in all individuals and restriction sites on the FRA3B cosmid contig most are induced by the DNA polymerase a inhibitor aphidicolin (Glover et al., 1984). The biological We previously described the isolation of a contig of signi®cance of the common fragile sites is that they overlapping cosmid clones which extended distally from are localized to chromosomal bands that are frequently the hRCC and covered the majority of the FRA3B rearranged in various types of cancers (Yunis and region (Paradee et al., 1995). The landmarks in this region are the hRCC breakpoint (Boldog et al., 1993), Correspondence: DI Smith two distinct clusters of aphidicolin-induced breakpoints Received 16 July 1997; revised 16 September 1997; accepted 16 (one 100 Kb and the other 300 Kb distal to the hRCC) September 1997 (Paradee et al., 1995), an HPV16 viral integration site Homozygous deletions in FRA3B in tumor cell lines LWanget al 636 (Wilke et al., 1996), and a pSV2neo integration site between D3S1480 and D3S1300, 19 were positioned in (Rassool et al., 1996). STS markers were assigned to a one or more cosmids in the FRA3B contig (Figure 1a). particular cosmid based upon PCR ampli®cation With three of the tested markers (D3S4489, spc-F/R, against the cosmids in the contig. Of 22 markers and spc-DNA1), we could not detect positive PCR

Figure 1 (a) Map of the telomeric region of YAC 850A6. Included on this map is the cosmid contig across this region and the precise position of the 22 PCR ampli®able markers used to analyse this region. Also included on this ®gure is a partial restriction map for this region, the position of the localized THE-1 elements, and the locations of the hRCC, the proximal and distal aphidicolin-induced breakpoint clusters, the HPV16 viral integration site, and the pSV2neo integration site. The region where aphidicolin-induced decondensation/breakage is detected by FISH analysis begins at the proximal and ends at the distal breakpoint cluster and is indicated above the restriction map. Also included on this map is the relative sizes of each of the various regions. The question mark in the middle of the proximal cluster of breakpoints re¯ects the fact that we are not sure of the precise size of the gap in this region. (b) Map of the region surrounding the HPV16 viral integration site. Shown on this map is the precise position of the 5 PCR ampli®able markers from this region, the HPV16 viral integration sequence, two Alu elements, the (ttttg)5 microsatellite, and the psCyclophilin pseudogene. Also shown is the commonly deleted region detected in the RCC and ovarian cell lines Homozygous deletions in FRA3B in tumor cell lines LWanget al 637 signals with any of the 14 cosmids. However, based on boundary of the HPV16 viral integration site and an the published sequence (GenBank Accession Number Alu repetitive sequence. Immediately distal to the

U66722) for much of this region (Boldog et al., 1997) frequently deleted marker was a perfect (ttttg)5 they were assigned to a gap between cosmids 1A6 and microsatellite, an Alu repeat, and a cyclophilin 1C4, and ordered relative to each other. The cosmid pseudogene (Figure 1b). Another frequently deleted 4B4 which linked 1A6 and 1C4 in our previous report marker was D3S4483, which was homozygously (Paradee et al., 1996) was moved to a more distal region deleted in 5/8 pancreatic cancers, 1/5 ovarian cancers, on our contig since it shares the pSV2neo integration and heterozygously deleted in 4/8 RCCs. To con®rm site, exon 5 of the FHIT gene, and D3S1300 with 3C3. that these markers were actually homozygously deleted, For most cosmids in this contig, we positioned we performed multiplex PCR using D3S1312. Figure 2 restriction sites along the cosmids and this enabled us shows the results of this analysis which demonstrated to determine relative distances between the various homozygous and apparently hemizygous deletions of landmarks, the microsatellites, and STSs from this marker U39804-3 in the cell lines examined. To make region, especially in areas that were not part of the sure that the absence of ampli®cation of these markers, region that was sequenced by Boldog et al. (1997). which was scored by us as homozygous deletions, was However, only relative positions of selected restriction not caused by insertion/deletion polymorphisms or fragments are presented. Figure 1a does not represent sequence variations that would prevent priming we an actual map with precise sizes of all the fragments. analysed 100 normal individuals for ampli®cation of Three repetitive sequence elements (Alu, LINE, and the markers in the HPV16 viral integration site. This THE) were hybridized to DNA from the 14 cosmids analysis revealed that none of the PCR primers using Southern hybridizations. Unfortunately, the detected deletions in the normal individuals demon- normal density of Alu and LINE sequences along strating that the homozygous and heterozygous this region made it dicult for us to precisely localize deletions detected were not the result of sequence these two kinds of sequences in the cosmid contig by polymorphisms in this region. Southern blot analysis. However, the THE element is relatively rare in the human genome (occurring once Number of deletions/breaks in FRA3B region every 300 Kb in human DNA). Southern blot analysis determined there were three THE elements in the We scored each of the samples for the number of cosmid contig, one in cosmid 1A6 at the proximal end breakpoints in the FRA3B region. Breakpoints were of the FRA3B region and the remaining two at the ascertained between two markers if one marker was intersection of cosmids 3F1 and 7A1. Figure 1a shows present and the immediately adjacent marker was a map of the cosmid contig and its position relative to deleted (either homozygously or heterozygously). For YAC YC850A6. Included on this ®gure are the example, RCC HTB-44 had 11 breakpoints while locations of the hRCC translocation breakpoint, the HTB-45 only had two breakpoints within the 1 Mb FRA3B region, the restriction map constructed from region bordered by D3S1234 and D3S1600 (Table 1). some of the cosmids in the contig, and the precise Of the 21 cell lines examined, 20 showed deletions/ position of the various PCR ampli®able markers breaks in the region. The RCC sample HTB-46 had the derived from this region. highest number of breakpoints (total 13). Only one cell line (pancreatic cell line CAPAN-1) had no breakpoints in the FRA3B region. Of the 27 markers tested, the Distribution of deletions/breaks in FRA3B marker U39804-5 within the HPV16 integration site The PCR-ampli®able markers used in this study span had the highest frequency of deletions as well as the region from D3S1600 (proximal to FRA3B) to breakpoints in the region surrounding it. Most of the D3S1234 (distal to FRA3B). This region extends for cell lines had multiple breakpoints in the FRA3B about 1 Mb within 3p14.2 and covered the hRCC region. In the RCC and ovarian cell lines, these breakpoint, the proximal and distal cluster of breakpoints were centered on the HPV16 viral aphidicolin-induced breakpoints, the HPV16 viral integration site. In contrast, the breakpoints in the integration site, and the two pSV2neo insertions. pancreatic cell lines were more frequently observed Deletions at the more proximal markers which either proximal or distal to the HPV16 integration site. included D3S1600, D3S1312, D3S1480, T23-t, 1A6E6 and D3S4260 were infrequently observed (Table 1). Deletions of the FHIT gene Similarly, deletions at a distal marker (D3S1313) were also infrequently observed. D3S1234, the most distal Recently, the FHIT gene was shown to span the marker, did not show any deletions in any of the cell hereditary RCC translocation breakpoint and FRA3B lines examined. PCR markers (U39804-1 through -5) (Ohta et al., 1996). Using nested RT ± PCR analysis, came from a 3.5 Kb DNA sequence (accession partial deletions of this gene were shown in a variety of no. U39804) which covered an HPV16 integration site cancer tissues and cancer cell lines (Fong et al., 1997; and seemed to be within the center of the FRA3B Druck et al., 1997; Kastury et al., 1996; Panagopoulos region as determined by FISH analysis (Wilke et al., et al., 1996; Negrini et al., 1996; Yamagisawa et al., 1996). These ®ve markers showed a very high 1996; Mao et al., 1996; Virgilio et al., 1996; Sozzi et al., frequency of deletions in the RCC and ovarian cancer 1996). We analysed the FHIT exons using non-nested cell lines (Table 1). One marker, U39804-5, was deleted RT ± PCR in each of the 21 tumor cell lines. A single, in 16 of 21 samples and was homozygously deleted in prominent RT ± PCR product with no major aberrant 8/8 RCC samples, 4/5 ovarian cancers, 1/8 pancreatic transcription products was observed in all the cell lines cancers, and heterozygously deleted in three of eight (data not shown). This clearly indicated that there were pancreatic cancers. This marker covered the distal no homozygous FHIT exon alterations in any of these Homozygous deletions in FRA3B in tumor cell lines LWanget al 638 tumor cell lines. This can also be clearly seen in Table lines had a heterozygous exon-4 deletion. We still 1 where we examined LOH for exon 4 and 5 of the found a predominance of full length RT ± PCR FHIT FHIT gene. None of the cell lines examined had products in all of the cell lines examined. We detected homozygous deletions in either exon 4 or exon 5 of the some smaller RT ± PCR products from some of the cell FHIT gene, but 4/8 of the RCC cell lines and 1/8 of lines, but these were always only present at a very low the pancreatic cell lines had what appeared to be a abundance suggesting that we had selectively ampli®ed heterozygous exon-5 deletion and 4/8 of the RCC cell infrequent alternatively spliced transcripts.

Table 1 Homozygous deletions of chromosome 3P14.2 and FRA3B in renal cell carcinomas, pancreatic cancers and ovarian cancers

Deletion analysis in the 21 tumor cell lines. Listed across the top are the eight RCC cell lines, the eight pancreatic cell lines, and the ®ve ovarian cell lines. Listed down the side are the 27 PCR ampli®able markers used in the analysis. The markers are listed from the most telomeric marker, D3S1234, to the most centromeric marker, D3S1600. A+ denotes good PCR ampli®cation with a tested marker (scored as allele retention); a black box represents homozygous deletion of a tested marker, and a gray box with a + denotes heterozygous deletion of a tested marker. Shown on the bottom is the number of detectable breakpoints in the region analysed in each of the tumor cell lines. Note that only one cell line, CAPAN-1, had no breakpoints in this region

RENAL CELL CARCINOMA PANCREATIC CANCER OVARIAN CANCER MARKER PLACENTA HTB–45 HTB–44 HTB–46 HTB–47 HTB–49 CRL–1611 CRL–1933 CRL–1932 MARKER PLACENTA CFPAC–1 SU–86 BXPC–3 ASPC–1 MIA CAPAN–1 CAPAN–2 HS–766T MARKER PLACENTA OV167 OV177 OV202 OV207 OV266

400 bp— —U39804–3 300 bp— —D3S1312 200 bp—

Figure 2 Multiplex analysis of marker U39804-3 in the 21 tumor cell lines. This marker was multiplexed with D3S1312, which ampli®ed in all the tested cell lines. Included on this Figure are the various cell lines tested, a 100 bp ladder (marker), and placenta controls. In samples HTB-46, HTB-47, HTB-49, CRL-1933, OV167, OV177, and OV207, note the absence of ampli®cation of U39804-3 (thus delineated as homozygous deletions). In sample HTB-44, CRL-1611, OV202, and OV266, note the diminished ampli®cation of U39804-3 which by scanning analysis was less than 50% of the signal observed in the ampli®cation of placental DNA Homozygous deletions in FRA3B in tumor cell lines LWanget al 639 Discussion lines for the presence of HPV16 sequences and performing FISH-based analyses to determine where Chromosome 3p14.2 is the most active of the common HPV16 resides in those cell lines that contain HPV16 fragile sites in the human genome. Frequent deletions/ sequences. breaks at 3p14 were reported in a large variety of The FHIT exons represent about 1.1 Kb of mRNA human cancers including renal cell carcinoma, breast spread out over 1 Mb of genomic DNA which includes cancer, pancreatic cancer, esophageal cancer, and lung FRA3B and the hRCC (Zimonjic et al., 1997). The cancer as mentioned above. However, the molecular gene is believed to be a potential tumor suppressor basis of the genomic instability at this region, either in gene in a variety of human tumors based upon the the presence of aphidicolin or during cancer progres- observation of aberrant nested RT ± PCR products sion, was not clear. Another important unresolved (Ohta et al., 1996; Virgilio et al., 1996; Sozzi et al., issue is the precise relationship between FRA3B 1996). However, the biological function of FHIT is still sequences and chromosomal deletions in 3p14.2 in unclear in tumor progression. Fong et al. (1997) found tumor cells. Most of the previous studies analysing that FHIT gene/FRA3B allele loss was common in deletions in this region were based on loss of lung cancer and associated with cancer-related cDNA heterozygosity. Since only a few markers from this splicing aberrations. The simultaneous presence and region were polymorphic, it was impossible to precisely relative abundance of wild type transcripts as well as localize the deletion/breakage within and relative to aberrant transcripts in several tumor and even normal FRA3B. samples (Fong et al., 1997; Boldog et al., 1997) implies In previous reports, we found frequent breakpoints that FHIT is dierent from most other known tumor in the FRA3B region in primary pancreatic cancer and suppressor genes. Since the gene spans the most active renal cell carcinoma (Shridhar et al., 1996, 1997). These common fragile site, the alteration of the gene in reports demonstrated that many tumors had deletions human tumors may only re¯ect the fragility of FRA3B. and multiple breakpoints in the FRA3B region. In this Consistent with this data, the RT ± PCR products from report, we analysed a number of tumor cell lines. The our 21 tumor cell lines showed normal size with only a absence of normal cell contamination in these cell lines few faint aberrant PCR products detectable. This enabled us to use non-polymorphic STS markers in supports the contention that the FHIT gene is not addition to known microsatellites from this region, and involved in the progression of RCC and ovarian cancer thus we could precisely localize the breakpoints (Bugert et al., 1997; Hendricks et al., 1997). We did between these markers and position the breakpoints ®nd some smaller RT ± PCR products in the pancreatic relative to the FRA3B region. The partial restriction carcinoma cell lines (data not shown) but the majority map for the FRA3B region and the sequence data for of the products were still the normal size. The LOH much of the FRA3B region from Boldog et al. (1997) data with the markers analysed also support the enabled us to know the precise distance between many contention that FHIT is not a target of mutations, at of the markers and microsatellites used in this study. least in the cell lines examined. Whereas 19 of 21 cell We found the most common deletion occurred in the lines had homozygous deletions of at least one of the HPV16 integration site represented by the markers tested markers, none of the cell lines had homozygous U39804-1 through 5, especially between U39804-3 and deletions of either exon 4 or exon 5 of FHIT. Allele U39804-5; these two markers cover about 0.9 Kb DNA loss was detected in ®ve cell lines at exon 5 and in four sequences including an HPV16 viral integration site cell lines at exon 4 but the dramatic loss of sequences and an Alu sequence. Immediately distal to the throughout the rest of the region raises the possibility common deletion region are a (ttttg)5 microsatellite that selection has resulted in speci®c retention of FHIT sequence and another Alu sequence (Figure 1b). exons in several of the cell lines. Our results However, it is not clear if the Alu sequence or the demonstrating homozygous deletions in this region

(ttttg)5 microsatellite play an important role in the that only involve sequences in the FHIT introns are frequent deletion within the HPV16 integration site in similar to results reported by Boldog et al. (1997) and RCCs and ovarian cancers. van den Berg et al. (1997). The pancreatic cancer cell lines did not have such a An important question is why we did not detect high frequency of homozygous deletions in the HPV16 smaller FHIT RT ± PCR products in the cell lines with integration site. Instead, we de®ned a more proximal heterozygous deletions in FHIT exons. A similar marker D3S4483 with homozygous deletions. This observation was made by Druck et al. (1997). They marker was localized in intron 3 of FHIT gene and found that cell line HKI was deleted for exon 5 by was found homozygously deleted in 5/8 pancreatic PCR analysis and RT ± PCR failed to detect any FHIT cancers (Table 1). Since the deletions in the RCC and transcript. Thus, the deletion of that exon might cause ovarian cell lines occurred in the middle of FRA3B in the cell to rapidly degrade the smaller aberrant the HPV16 viral integration site, whereas the deletions transcript. In cell lines that we examined with were found to be more centromeric in the pancreatic heterozygous FHIT exon deletions the smaller FHIT cell lines, this may re¯ect dierent sequence fragility in transcripts might be degraded leaving only intact FHIT dierent tissues. However, the hypothesis we favor is transcripts to be ampli®ed by RT ± PCR. Samples were that tumors which have an HPV16 involvement may scored as having heterozygous deletions based on show greater instability at the HPV16 viral integration showing 5 ± 50% of the expected signal. However, site. HPV infection was reported to be related to the several of the markers had ampli®cation that was etiology of various human tumors including renal cell signi®cantly less than 50%. This would imply that the (Kamel et al., 1994) and cervical carcinoma (Wagat- tumor cell lines were heterogeneous for loss of FHIT suma et al., 1990). However, this is not known for exon or intron markers. This was also similar to results ovarian cancer. We are currently analysing the cell reported by Druck et al. (1997). Homozygous deletions in FRA3B in tumor cell lines LWanget al 640 The FHIT gene has been proven to have huge including 5/5 deletions in ovarian cancers (Table 1). In intronic sequences (especially introns 4 and 5) which contrast, the marker spc-F/R, which is within the could be the potential location of many other genes. spcDNA homologous sequence, did not show any We have identi®ed homozygous/heterozygous deletions deletion in all 21 tumor samples. Thus it seems that in within intron 4 in all eight RCC cell lines, seven of the cell lines examined the spcDNA sequences are not eight pancreatic cell lines, and all ®ve ovarian cancer playing a role in the deletions in this region. cell lines, including discontinuous deletions in at least In summary, we have mapped the STS markers on 16 cell lines. There may, therefore, be another gene the FRA3B cosmid contig. Deletion mapping in 21 within FHIT intron 4 which is the actual target in these tumor cell lines showed that frequent deletion/breaks cancers. Alternatively, this may only re¯ect the occur within the HPV16 viral integration site. The genomic instability in the FRA3B region. frequent homozygous and heterozygous deletion in A number of studies have shown a statistical 3p14.2 may only re¯ect the fragility of the FRA3B association between the integration of transforming region during tumor progression rather than deletions DNA viruses and chromosomal fragile sites (Popescu in an important tumor suppressor gene from this et al., 1990). Smith et al. (1992) reported that HPV region. integration sites were consistent with integration near or within known fragile sites in ®ve of six HPV- immortalized keratinocyte cell lines. Wilke et al. (1996) have shown that a region of frequent breakage within Materials and methods FRA3B coincided with a previously characterized site of HPV16 integration in a primary cervical carcinoma. Tumor cell lines and cell culture Frequent deletions in the HPV16 integration site in the Eight renal cell carcinoma cell lines (HTB-44, HTB-45, RCC and ovarian cell lines suggest that this viral HTB-46, HTB-47, HTB-49, CRL-1611, CRL-1932 and integration site in the human genome may be CRL-1933) and eight pancreatic cell lines (CFPAC, SU- particularly unstable. However, whether these tumor 86, BXPC-3, ASPC-1, MIA, CAPAN-1, CAPAN-2 and cell lines have HPV infection and whether the frequent HS-766T) were obtained from ATCC. The ®ve ovarian deletions in FRA3B are caused by an HPV16 cancer cell lines were from the Mayo Foundation. Cell integration remain unclear. culture was performed based on conditions described by Repetitive sequences such as THE-1, LINE, and Alu ATCC (for the RCC and pancreatic cell lines) or may be responsible for rearrangements and deletions in conditions described in Jenkins et al. (1993) for the many human diseases and cancers (Reiter et al., 1996; ovarian cell lines. Mauillon et al., 1996; Puget et al., 1997). The repetitive elements could cause misalignment during meiosis and DNA, RNA extraction and reverse transcription mitosis through the formation of loop structures of the Cells were grown to con¯uency on ¯asks and were then inverted repeats. In an attempt to map these repeat washed twice in PBS and submerged in DNA extraction sequences in the FRA3B contig, we hybridized the buer (10 mM Tris, 1 mM EDTA, 100 mM NaCl, 0.05% digested cosmid DNA with the labeled repetitive SDS and 100 mg/ml proteinase K) for 10 min. The mixed sequences. As the human genome is rich in LINE solutions were then transferred to test tubes for further and Alu sequences, numerous positive signals were digestion overnight at 378C. After standard phenol/chloro- observed in all of the cosmids (data not shown). The form extraction, the DNA was precipitated in ethanol, Alu repeats tend to distribute on the proximal part of dried, and redissolved in TE buer. Total RNA was extracted from these cell lines using Trizol the contig including 6H8, 1C12, and 1C6 while LINEs reagent (Life Technologies, Inc.) according to the manufac- more heavily distribute on the distal part of the contig turer's instructions. Reverse transcription was performed in a including 1C4, 3F1, 1D10, 3C3, 4B4, and 3C8 (data 20 ml ®nal volume containing 50 mM Tris-HCl, pH 8.3,

not shown). The THE1 sequence is sparsely distributed 75 mM KCl, 3 mM MgCl2,10mM DTT, 0.125 mM each throughout the human genome, occurring once every dNTP, 0.5 mg of oligo-dT, 2.5 mM hexamer, 200 units of 300 Kb. We found three positive signals in cosmid Superscript II reverse transcriptase (Life Technologies, Inc.), 1A6, 3F1 and 7A1, respectively. One THE1 element 20 units of RNase inhibitor (Boehringer Mannheim), and was localized in the aphidicolin-induced proximal 1 mg of total RNA. The reaction was incubated at 388C for breakpoint cluster (Wang et al., 1997); the other two 90 min and 958C for 5 min. were positioned just distal to cosmid c55 which is believed to be the center of the FRA3B region STS markers for deletion mapping of genomic DNA (Paradee et al., 1995). Thus, these three THE1 A total of 27 STS markers within 3p14.2/FRA3B were elements were located within a 150 Kb region. The selected to map potential deletions in this region. relative abundance of THE1 elements in FRA3B may Microsatellite PCR primers (D3S1234, D3S1313, be one of the factors that contribute to the fragility at D3S2977, D3S1300, D3S4482, D3S4474, D3S2757, this fragile site. D3S4480, D3S4483, D3S4489, D3S4260, D3S1480, Small polydispersed circular DNA (spcDNA) was D3S1312 and D3S1600) were obtained from Research suggested to be associated with genetically unstable Genetics or synthesized based on the Genome Database. cells (Cohen et al., 1997). Boldog et al. (1997) reported Primers FHIT-EX5, FHIT-EX,4 and U39799 came from a sequences with signi®cant similarity to spcDNA in a published paper on the structure of the FHIT gene, and the conditions for their ampli®cation were exactly as described 600 bp region at the centromeric end of the 110 Kb of in the paper (Druck et al., 1997). Other primers con- FRA3B sequences that they generated (GenBank structed are listed below (5' to 3'): U39804-1F/R: Accession Number U66722). The marker spcDNA1, CTGGCCTTATCATTCCTG / TCCAGGGTGGTGACTT- which was 4 Kb telomeric to the spcDNA homologous CA (588C) U39804-2F/R: GCCACTAGGAATTCAGG- sequences, was found deleted in 12/21 tumor samples CA/ATCTGTCAGCTCACTGGCCT (618C) U39804-3F/ Homozygous deletions in FRA3B in tumor cell lines LWanget al 641 R : AGGGTTAATCAACCAATCCA/TTTGCTATGTGA - deleted. The comparative primer pairs were chosen based TGAGGCTG (588C) U39804-4F/R:TGTGCTAGCAT- upon the similarity between their reannealing temperature GCATTCCTC/AAGGCGCCATGTTATAATGC (568C) and that of the primer pair being tested, and also analysed U39804-5F/R:TAGAGTTGGCATGAGAGCTG /TGTTG- to be sure that no potential pairing was possible between GTATCACTGCACTCC (588C) C5EX-F/R:CCTGGA- the dierent primer sets that were multiplexed. All the gels TGAATCCTTCTTGG/ACGTGTGAATGAGGCAGAGA from the multiplex analysis were also analysed and (588C) spc-DNA1F/R : TGTCAATGCTGCACTAAGGC/ quantitated on the Gel-Doc 1000 gel documentation GGGAGAGAATCAGAGGAGCC (588C) spc-F/R:GAC- system and similarly scored. TTCCTTCTGTCCCAT/ATATAATCCCTGTGGTAACT (588C) 1A6E6-F/R : ATCTGATGGGTTTATCAGGG / C- Mapping of STS markers in the FRA3B cosmid contig ATGTTACCCAGCCTGGTCT (598C) T23-t F/R:GGC- TAAGAGATCAAGAGTG /GGACTCCATCATACCGTT Single colonies of each of the 14 cosmids in the FRA3B (608C). cosmid contig (Paradee et al., 1996) were selected for Primers for FHIT gene RT ± PCR (608C reannealing mapping of STS markers in this region. The cosmid DNA temperature), were: FHIT-231(F): AAGGGAGAGAAAGA- was extracted by using the QIAGEN-DNA Extraction Kit. GAAAGAAG; FHIT-954(R): TCACTGGTTGAAGAATA- PCR ampli®cation was performed as described above CAGGA. except that we used 1 pg of cosmid DNA, as compared to 100 ng genomic DNA. The position of each STS marker relative to the cosmid contig was determined according to a PCR ampli®cation positive or negative signal with a particular cosmid. PCR was performed in a DNA Thermal Cycler 480 (Perkin Elmer Cetus). The reactions consisted of 100 ng genomic Southern blot analysis of repetitive sequences DNA (or 1 ml RT product), 6.25 pmol of each forward and reverse primer, 100 mM of each dNTP, 1.5 mM MgCl2, Cosmid DNAs in FRA3B cosmid contig were digested 16Taq DNA polymerase buer and 0.5 unit of Taq DNA using restriction enzymes (HindIII and PstI) and subjected polymerase (Promega). The ampli®cation mixtures (12.5 ml) to electrophoresis in 0.8% agarose gels. The digested were denatured at 948C for 3 min and then subjected to 35 cosmid DNAs were transferred onto Hybond-N (Amer- cycles of 948C for 20 s, 55 ± 628C for 30 s (the precise sham) membranes and hybridized with probes (human reannealing temperature for each primer pair is listed ALU, LINE and THE1 repetitive sequences) labeled with above after the sequence of each primer pair) and 728Cfor 32P-dCTP using random hexamer primers. 30±60s. Restriction map of the FRA3B cosmid contig Determination of homozygous and heterozygous deletions Four restriction enzymes (XhoI, SalI, S®IandSacII) were All PCRs were performed at least twice; inconsistent PCR used for restriction mapping of this contig. The digested results were repeated one more time. Only completely DNAs were run on a 0.5% agarose gel and analysed. The negative signals were counted as homozygous deletions. All restriction site was positioned according to the relative size gels were analysed on the Gel-Doc 1000 gel documentation of the fragmented DNA using dierent enzyme combina- system (Bio-Rad). PCR reactions that consistently yielded tions. less than 5% of the expected signal were scored as homozygous deletions. In most instances, markers scored as being homozygously deleted showed absolutely no PCR product with the tested marker. Markers that yielded Acknowledgements between 5 ± 50% of the expected signal were scored as This work was supported by NIH Grant CA48031 (DIS). heterozygously deleted. Markers that were suspected to be The authors would like to acknowledge the excellent homozygously or heterozygously deleted were con®rmed technical assistance of Chadwick Mullins who constructed using multiplex PCR with another primer pair that was not the restriction map of the cosmid contig.

References

Boldog FL, Gemmill RM, Wilke CM, Glover TW, Nilsson Ehlen T and Dubeau L. (1990). Oncogene, 5, 219 ± 223. AS, Chandrasekharappa SC, Brown RS, Li FP and Fong KM, Biesterveld EJ, Vkrmank A, Wistuba I, Sekido Y, Drabkin HA. (1993). Proc. Natl. Acad. Sci. USA, 90, Bader SA, Ahmadian M, Ong ST, Rassool FV, Zimmer- 8509 ± 8513. man PV, Fiaccone G, Gazdar AF and Minna JD. (1997). Boldog F, Gemmill RM, West J, Robinson M, Robinson L, Cancer Res., 57, 2256 ± 2257. Li E, Roche J, Todd S, Waggoner B, Lundstrom R, FuYH,KuhlDP,PizzutiA,PierettiM,SutclieJS, Jacobson J, Mullokandow MR, Klinger H and Drabkin Richards S, Verkerk AJ, Holden JJ, Fenwick RG Jr and HA. (1997). Hum. Mol. Genet., 6, 193 ± 203. Warren ST. (1991). Cell, 67, 1047 ± 1058. Cohen AJ, Li FP, Berg S, Marchetto DJ, Tsai S, Jacobs SC Glover TW, Berger C, Coyle J and Echo B. (1984). Hum. and Brown RS. (1979). New Engl. J. Med., 301, 592 ± 595. Genet., 67, 136 ± 142. Cohen S, Regev A and Lavi S. (1997). Oncogene, 14, 977 ± Hendricks DT, Taylor R, Reed M and Birrer M. (1997). 985. Cancer Res., 57, 2112 ± 2115. Druck T, Kastury K, Hadaczek P, Podolski J, Toloczko A, Jenkins RB, Bartelt D Jr, Stalboerger P, Persons D, Dahl R, SikorskiA,OhtaM,LaForgiaS,LasotaJ,McCueP, Keeney G and Hartmann L. (1993). Cancer Genet. Lubinski J and Huebner K. (1995). Cancer Res., 55, 5348 ± Cytogenet., 71, 76 ± 86. 5353. Jones C, Slijepcevic P, Marsh S, Baker E, Langdon WY, Druck T, Hadaczek P, Fu T-B, Ohta M, Siprashvili Z, Baa Richards RI and Tunnaclie A. (1994). Hum. Mol. Genet., R, Negrini M, Kastury K, Veronese ML, Roosen D, 3, 2123 ± 2130. Rothstein J, McCue P, Cotticelli MG, Inoue H, Croce CM Kamel D, Turpeenniemi-Hujanen T, Vahakangas K, Paakko and Huebner K. (1997). Cancer Res., 57, 504 ± 512. P and Soini Y. (1994). Histopathol., 225, 339 ± 347. Homozygous deletions in FRA3B in tumor cell lines LWanget al 642 Kastury K, Baa R, Druck T, Ohta M, Cotticelli MG, Inoue Smeets DFCM, Scheres JMJC and Hustinx TWJ. (1986). H, Negrini M, Rugge M, Huang D, Croce CM, Palazzo J Hum. Genet., 72, 215 ± 220. and Huebner K. (1996). Cancer Res., 56, 978 ± 983. Smith PP, Friedman CL, Bryant EM and McDougall JK. KnightSJ,FlanneryAV,HirstMC,CampbellL,Christo- (1992). Genes Chromosom. Cancer, 5, 150 ± 157. doulou Z, Phelps SR, Pointon J, Middleton-Price HR, Sozzi G, Veronese ML, Negrini M, Baa R, Cotticelli MG, Barnicoat A and Pembrey ME. (1993). Cell, 74, 127 ± 134. Inoue H, Tornielli S, Pilotti S, DeGregorio L, Pastorino Mao L, Fan YH, Lotan R and Hong WK. (1996). Cancer U, Pierotti MA, Ohta M, Huebner K and Croce CM. Res., 56, 5128 ± 5131. (1996). Cell, 85, 17 ± 26. Mauillon JL, Michel P, Limacher JM, Latouche JB, Sutherland GR and Hecht F. (1985). In: Oxford University Dechelotte P, Charbonnier F, Martin C, Moreau V, Monographs on Medical Genetics,no.13,OxfordUni- Metayer J, Paillot B and Frebourg T. (1996). Cancer versity Press, New York. Res., 56, 5728 ± 5733. Todd S, Franklin WA, Varella-Garcia M, Kennedy T, NegriniM,MonacoC,VorechovskyI,OhtaM,DruckT, Killiker CE Jr, Hahner L, Anderson M, Wiest JS, Baa R, Huebner K and Croce CM. (1996). Cancer Res., Drabkin HA and Gemmill RM. (1997). Cancer Res., 57, 56, 3173 ± 3179. 1344 ± 1352. Ohta M, Inoue H, Cotticelli MG, Kastury K, Baa R, Virgilio L, Shuster M, Gollin SM, Veronese ML, Ohta M, Palazzo J, Siprashvili Z, Mori M, McCue P, Druck T, Huebner K and Croce CM. (1996). Proc. Natl. Acad. Sci. Croce CM and Huebner K. (1996). Cell, 84, 587 ± 597. USA, 93, 9770 ± 9775. Panagopoulos I, Pandis N, Thelin S, Petersson C, Mertens F, van den Berg A, Draaijers TG, Kok K, Timmer T, Van der Borg A, Kristooersson U, Mitelman F and Aman P. Veen AY, Veldhuis MJF, de Leij L, Gerhartz CD, Naylor (1996). Cancer Res., 56, 4871 ± 4875. SL, Smith DI and Buys CH. (1997). Genes Chromosom. Paradee W, Mullins C, He Z, Glover T, Wilke C, Opalka B, Cancer, 19, 59 ± 76. Schutte J and Smith DI. (1995). Genomics, 27, 358 ± 361. Wagatsuma M, Hashimoto K and Matsukura T. (1990). J. Paradee W, Wilke CM, Wang L, Shridhar R, Mullins CM, Virol., 64, 813 ± 821. Hooge A, Glover TW and Smith DI. (1996). Genomics, 35, Wang L, Li W, Wang X, Zhang C, Zhang T, Mao X and Wu 87 ± 93. M. (1996). Oncogene, 12, 699 ± 703. Parrish JE, Oostra BA, Verkerk AJ, Richards CS, Reynolds Wang L, Paradee W, Mullins C, Shridhar R, Rosati R, Wilke J, Spikes AS, Shaer LG and Nelson DL. (1994). Nature CM, Glover TW and Smith DI. (1997). Genomics, 41, Genet., 8, 229 ± 235. 485 ± 488. Popescu NC, Zimonjic D and Dipaolo JA. (1990). Hum. Wilke CM, Hall BK, Hoge A, Paradee W, Smith DI and Genet., 84, 383 ± 386. Glover TW. (1996). Hum. Mol. Genet., 5, 187 ± 195. Puget N, Torchard D, Serova-Sinilnikova OM, Lynch HT, Yamagisawa K, Kondo M, Osada H, Uchida K, Takagi K, Feunteun J, Lenoir GM and Mazoyer S. (1997). Cancer Masuda A, Takahashi T and Takahashi T. (1996). Cancer Res., 57, 828 ± 831. Res., 56, 5579 ± 5582. Rassool FV, Le Beau MM, Shen ML, Neilly ME, Espinosa Yu S, Mangelsdorf M, Hewett D, Hobson L, Baker E, Eyre R, Ong ST, Boldog F, Drabkin H, McCarroll R, HJ, Lapsys N, Le Paslier D, Dogget NA, Sutherland GR McKeithan TW. (1996). Genomics, 35, 109 ± 117. and Richards RI. (1997). Cell, 88, 367 ± 374. Reiter L, Murakami T, Koeuth T, Pentao L, Muzny DM, Yunis JJ and Soreng AL. (1984). Science (Washington DC), Giggs RA and Lupski JR. (1996). Nature Genet., 12, 288 ± 266, 1199 ± 1204. 297. Zimonjic DB, Druck T, Ohta M, Kastury K, Croce CM, Shridhar R, Shridhar V, Wang X, Paradee W, Dugan M, Popescu NC and Huebner K. (1997). Cancer Res., 57, Sarkar F, Wilke C, Glover TW, Vaitkevicius VK and 1166 ± 1170. Smith DI. (1996). Cancer Res., 56, 4347 ± 4350. Shridhar V, Wang L, Rosati R, Paradee W, Shridhar R, Mullins C, Sakr W, Grignon D, Miller OJ, Sun QC, Petros J and Smith DI. (1997). Oncogene, 14, 1269 ± 1277.