Characterization of Two Kinds of Subgenomic Rnas Produced by Citrus Leaf Blotch Virus

Virology 295, 328–336 (2002) doi:10.1006/viro.2001.1349, available online at http://www.idealibrary.com on

CORE Metadata, citation and similar papers at core.ac.uk

Provided by Elsevier - Publisher Connector Characterization of Two Kinds of Subgenomic RNAs Produced by Citrus Leaf Blotch Virus

Marı´a C. Vives, Luis Galipienso, Luis Navarro, Pedro Moreno, and Jose´Guerri1

Instituto Valenciano de Investigaciones Agrarias (IVIA), 46113 Moncada, Valencia, Spain Received October 26, 2001; returned to author for revision November 21, 2001; accepted January 7, 2002

Citrus leaf blotch virus (CLBV) has a single-stranded, positive-sense, genomic RNA (gRNA) organized in three ORFs, which encode a polyprotein involved in replication (RP), a potential movement protein (MP), and coat protein (CP). Northern blot hybridization of total, virion, or double-stranded RNA with probes of different gRNA regions revealed that CLBV produces two 3Ј-coterminal and two 5Ј-coterminal subgenomic RNAs (sgRNAs). The 3Ј-coterminal sgRNAs contain the MP (3ЈMP sgRNA) and CP (3ЈCP sgRNA) genes and untranslated regions (UTRs) of 123 and 284 nt, respectively, at their 5Ј end. These sgRNAs start with a hexanucleotide which is also present at the 5Ј terminus of the gRNA. The 5Ј-coterminal sgRNAs have 6795 and 5798 nt, colinear with the gRNA, and contain ORF1 and most MP gene (5ЈRPMP sgRNA) and most ORF1 (5ЈRP sgRNA), respectively. Their 3Ј termini map 35 and 40 nt upstream of the transcription initiation of the 3ЈCP and 3ЈMP sgRNAs, respectively, next to a potential promoter element. Our results suggest that, as in alphaviruses, CLBV internal genes are expressed via 3Ј-coterminal sgRNAs transcribed from the minus gRNA strand. The 5Ј-coterminal sgRNAs may result from early termination of the gRNA during the plus-strand synthesis. © 2002 Elsevier Science (USA)

INTRODUCTION resembles that of members of genus Trichovirus, but considering biological, structural, and molecular differ- Citrus leaf blotch virus (CLBV) was first detected in a ences with known trichoviruses, it has been proposed Nagami kumquat (Fortunella margarita (Lour) Swing), that CLBV should be included in a new virus genus clone SRA-153 from Corsica (France), which showed bud (Vives et al., 2001). union crease when propagated on Troyer citrange (Cit- Synthesis of 3Ј-coterminal subgenomic RNAs (sgRNAs) rus sinensis (L.) Osb. ϫ Poncirus trifoliata (L.) Raf.) (Na- is used by many positive-stranded RNA viruses to express varro et al., 1984; Galipienso et al., 2000). Later, it was internal ORFs (Miller and Koev, 2000). In most cases the also detected in several citrus cultivars from Australia, mechanism by which sgRNAs are produced has not Japan, USA, and Spain, usually associated with bud been experimentally established, but it is believed to union crease on citrange or citrumelo (C. paradisi involve internal initiation of RNA synthesis by the viral (Macf.) ϫ P. trifoliata), which indicated that CLBV may be replicase on the minus gRNA strand (Miller et al., 1985; widespread (Galipienso et al., 2001). Gargouri et al., 1989; Adkins et al., 1997; Wang and CLBV virions are filamentous particles about 960 ϫ 14 Simon, 1997). However, for some viruses it has been nm in size, containing a single-stranded (ss), positive- sense, genomicRNA (gRNA), encapsidatedby a 42-kDa suggested that the negative-stranded sgRNAs could be Ј coat protein (Galipienso et al., 2001). The gRNA has 8747 initiated at the 3 terminus and internally terminated, and nt organized in three open reading frames (ORFs) and then they would serve as templates for the positive- untranslated regions (UTR) of 73 and 541 nt at the 5Ј and strand replication (Sit et al., 1998; Choi et al., 2001; 3Ј termini, respectively. ORF1 potentially encodes a Sawicki et al., 2001). Viruses of different families also Ј 227.4-kDa polyprotein containing methyltransferase, pa- produce 5 -coterminal sgRNAs (German et al., 1992; pain-like protease, helicase, and RNA-dependent RNA MacBeth and Patterson, 1995; Mawassi et al., 1995; Wiel- polymerase motifs (RP). ORF2 encodes a 40.2-kDa gosz and Huang, 1997; Rubio et al., 2000; Che et al., 2001; polypeptide containing a motif characteristic of the 30K Gowda et al., 2001), but the role of these sgRNAs in viral superfamily of cell-to-cell movement proteins (MP). The replication is still unknown. 40.7-kDa polypeptide encoded by ORF3 was identified as CLBV-infected tissue contains a set of double-stranded the coat protein (CP). The genome organization of CLBV RNAs (dsRNAs), which include a full-genome-sized dsRNA (ϳ8.5 kb) and two less-than-full-genome-size dsRNAs of ϳ6.5 and ϳ5.5 kb, the ϳ6.5 kb species being the most Ј 1 abundant. A cDNA probe located in the 5 half of gRNA To whom correspondence and reprint requests should be ad- hybridized in Northern blot with the three dsRNAs, suggest- dressed at Instituto Valenciano de Investigaciones Agrarias, Ctra. ϳ ϳ Ј Moncada-Na´quera Km.4.5, 46113 Moncada, Valencia, Spain. Fax: 34- ing that the 6.5 and the 5.5 kb dsRNAs are 5 coterminal 96-1390240. E-mail: [email protected]. with the gRNA (Galipienso et al., 2001).

FIG. 1. Northern blot hybridization of denatured dsRNAs obtained from 5 g CLBV-infected (right lane of each membrane) or healthy (left lane) plant tissue, with digoxigenin-labeled cDNA probes 5ЈT, rp, mp, cp, and 3ЈT, corresponding to the genomic regions marked with horizontal lines. An outline of the CLBV genomic RNA is shown at the top: boxes indicate the three ORFs and the size and potential function of the protein products encoded by each ORF (replicase, RP; movement protein, MP; and coat protein, CP) are given. Arrowheads show the positions of the genomic RNA (gRNA), 5Ј-coterminal subgenomic RNAs (5ЈRPMP and 5ЈRP), 3Ј-coterminal subgenomic RNAs (3ЈMP and 3ЈCP), defective RNA (D-RNA), and unidentified RNAs (?), reacting with each probe. Sizes (bp) of marker RNAs are at the left.

Here we have identified and characterized the pected for CLBV gRNA and sgRNAs, as estimated from sgRNAs produced by CLBV in total RNA extracts, in the gRNA sequence (Vives et al., 2001). Five major partially purified virions and in dsRNA-rich preparations dsRNAs of ϳ8.5, ϳ6.5, ϳ5.5, ϳ3.0, and ϳ2.0 kb were using probes derived from different regions of CLBV consistently detected (gRNA, 5ЈRPMP,5ЈRP,3ЈMP, and gRNA. We have found that, in addition to the gRNA, 3ЈCP in Fig. 1). The ϳ8.5-kb dsRNA hybridized with the CLBV-infected plants contain four smaller RNAs species five probes and its size was equal to that of the RNA of ϳ6.5, ϳ5.5, ϳ3, and ϳ2 kb. The ϳ3- and ϳ2-kb RNAs extracted from partially purified virions (see Fig. 3); there- were not detected previously and have been identified as fore, this dsRNA is likely the replicative form of the gRNA. 3Ј-coterminal sgRNAs which contain at their 5Ј end the The sizes of the ϳ3- and ϳ2-kb dsRNAs correspond to MP and CP gene, respectively. These sgRNAs may be sg messenger RNAs involved in expression of the MP encapsidated. The ϳ6.5- and ϳ5.5-kb RNAs have been and CP genes, respectively. The ϳ3-kb dsRNA hybrid- identified as 5Ј-coterminal sgRNAs. In an effort to under- ized with the probes mp, cp, and 3ЈT, and the ϳ2-kb stand the CLBV transcriptional strategy, the 5Ј terminus dsRNA with probes cp and 3ЈT. These two RNAs did not of the 3Ј-coterminal sgRNAs, and the 3Ј terminus of the hybridize with the probes 5ЈT or rp. Therefore, these 5Ј-coterminal sgRNAs, were cloned and sequenced. dsRNAs are likely double-stranded forms of 3Ј-coterminal sgRNAs synthesized to express the MP (3ЈMP RESULTS sgRNA) and the CP (3ЈCP sgRNA) genes (Fig. 1). The ϳ6.5-kb dsRNA hybridized with the probes 5ЈT, rp, and Characterization of CLBV subgenomic RNAs mp, but not with the probes cp and 3ЈT, and the ϳ5.5-kb To characterize the different dsRNA molecules de- dsRNA only reacted with the probes 5ЈT and rp. These tected in infected tissues, denatured dsRNA was hybrid- dsRNAs could be double-stranded forms of potential ized in a Northern blot format with five cDNA probes from 5Ј-coterminal sgRNAs, one of them comprising the RP different regions of the CLBV gRNA (Fig. 1). The size of and at least part of the MP ORFs (5ЈRPMP sgRNA), and these RNAs was estimated by regression analysis of the the other, at least part of the RP ORF (5ЈRP sgRNA) (Fig. electrophoretic mobility measured in Northern-blotted 1). In addition to the five major dsRNAs, an ϳ1-kb dsRNA membranes in comparison with known RNA size mark- was found which hybridized with the probes 3ЈT and 5ЈT, ers (Fig. 1). Sizes were then compared with those ex- but not with the probes of the central region, suggesting 330 VIVES ET AL.

FIG. 2. Northern blot hybridization analysis of dsRNA (from 5 g CLBV-infected tissue) and total RNA (from 50 mg infected tissue), using digoxigenin-labeled riboprobes genome-sense (ϩ) or complementary (Ϫ) to the 5ЈT (A) or to the 3ЈT (B) terminal regions of the CLBV gRNA. Arrowheads indicate the gRNA and sgRNAs reacting with each probe (see Fig. 1). that it could be a defective RNA (D-RNA). Other minor gRNA, whereas the (Ϫ) mp riboprobe additionally hybrid- bands hybridizing with the probes cp and 3ЈT, whose size ized with the 3ЈMP sgRNA, and the (Ϫ)3ЈT riboprobe did not correspond to any predictable sgRNA, were additionally hybridized with both the 3ЈMP and the 3ЈCP sometimes observed in Northern blots. However, their sgRNAs. The gRNA yielded the most intense hybridiza- presence and intensity were not consistent even in dif- tion signal. These results suggest that the positive strand ferent extracts from the same plant, and they were con- of the 3Ј-coterminal sgRNAs, but not the 5Ј-coterminal sidered RNA degradation products. sgRNAs, may be encapsidated. They also suggest that To assess the ratio of plus and minus strand of the the origin for coat protein assembly is preserved in the gRNA and sgRNAs, we compared the Northern blot hy- two 3Ј-coterminal sgRNAs and is probably located in the bridization patterns of total RNA and dsRNA-rich prepa- 3Ј-terminal region of the CLBV gRNA. rations using 5ЈT and 3ЈT riboprobes of both polarities. With dsRNA-rich preparations, riboprobes of both polar- Identification of the 5Ј end of the 3Ј-coterminal ities reacted with similar intensity with gRNA and with sgRNAs and their potential promoters the corresponding type of sgRNAs (Fig. 2). In contrast, with total RNA preparations, the (Ϫ) riboprobes 5ЈT and To clone the 5ЈUTR of the 3ЈMP and 3ЈCP sgRNAs, 3ЈT hybridized with the gRNA and with the 5Ј-coterminal denatured dsRNA was polyadenylated, reverse tran- Ј and 3Ј-coterminal sgRNAs, respectively, whereas the (ϩ) scribed using primer PM1, which contains (dT)17 at its 3 riboprobes did not react with either gRNA or sgRNAs. end, and then the cDNA complementary to the negative This indicates that most of the viral RNA detected in total RNA strand was PCR amplified with the pair of primers RNA extracts were single-stranded and that the plus PM1/KU-21 or PM1/KU-43 (Fig. 4). Primer KU-21 is lo- strand accumulates in infected tissues to a much higher cated 930 nt downstream of the CP initiation codon, and level than the minus strand, as it has been reported for primer KU-43 is located 231 nt downstream of the MP many other plant RNA viruses (Ishikawa et al., 1991; initiation codon. Amplification with primers PM1/KU-21 Marsh et al., 1991; Navas-Castillo et al., 1997). yielded two cDNA fragments (f1 and f2 in Fig. 4) of 2206 Finally, to determine whether the sgRNAs are encap- and 1214 nt, which included the 5Ј-terminal region of the sidated, RNA from gradient-purified virions was com- 3ЈMP and 3ЈCP sgRNAs, respectively. Amplification with pared with dsRNA-rich extracts in Northern blot hybrid- primers PM1/KU-43 yielded a unique cDNA fragment of ization using 5ЈT, mp, and 3ЈT riboprobes of the two 336 nt (f3 in Fig. 4), which corresponded to the 5Ј termi- polarities. As with total RNA extracts, virion RNA hybrid- nus of the 3ЈMP sgRNA. Five to ten clones from each ized only with the (Ϫ) riboprobes (Fig. 3 and data not cDNA fragment, obtained from two different cloning shown). The (Ϫ)5ЈT riboprobe reacted only with the events, were sequenced. Sequence alignments showed SUBGENOMIC RNAs OF CITRUS LEAF BLOTCH VIRUS 331

FIG. 3. Northern blot hybridization analysis of RNA from partially purified virions or dsRNA (5 g infected tissue), using digoxigenin-labeled riboprobes 5ЈT (A), mp (B), and 3ЈT (C), complementary to the positive gRNA strand. that transcription of the 3ЈMP and 3ЈCP sgRNAs start ties over 99%. Interestingly, the sequence GAAAAG, that 123- and 284-nt upstream of the start codon of MP and was present at the 5Ј terminus of the gRNA (Vives et al., CP genes, respectively. Sequence comparison between 2001), was also present at the 5Ј end of the 3ЈMP and the clones obtained and the corresponding regions in 3ЈCP sgRNAs. the gRNA (Vives et al., 2001) showed nucleotide identi- The presence of cis-acting elements required for

FIG. 4. Outline of the strategy followed to clone and sequence the 3Ј termini of the genomic(gRNA) and 5Ј-coterminal subgenomic RNAs (5ЈRPMP and 5ЈRP sgRNAs), and the 5Ј termini of the 3Ј-coterminal subgenomic RNAs (3ЈMP and 3ЈCP sgRNAs). Polyadenylated RNA was reverse transcribed with primer PM1, which contains (dT)17 at its 3Ј end, and then cDNA was PCR amplified with the pairs of primers PM1/KU-42, PM1/KU-46, PM1/KU-43, or PM1/KU-21. Arrows indicate position and sense of each primer in the CLBV gRNA, and segments f1 through f8 indicate the cDNA fragments amplified with the different primer sets. 332 VIVES ET AL.

FIG. 5. Identification of the potential promoter elements for transcription of the 3Ј-coterminal subgenomic RNAs (sgRNAs) of CLBV. The upper part of the figure outlines the positions of the sgRNAs 5Ј coterminal (5ЈRP and 5ЈRPMP) and 3Ј coterminal (3ЈMP and 3ЈCP) in the CLBV genomicRNA (gRNA). The two hairpins indicate the gRNA regions analyzed. The lower part of the figure shows an alignment of the potential promoter elements for transcription of sgRNAs 3ЈMP (A) and 3ЈCP (B) of CLBV and elements (**) of subgenomic core promoters conserved in the alphavirus-like superfamily (Siegel et al., 1997). (*) indicates a conserved motif involved in production of positive-sense strands of sgRNAs in potex- and carlaviruses (Bancroft et al., 1991; White et al., 1992). This sequence is shown on the positive strand. Identical nucleotides are in bold. The 3Ј terminus of the 5Ј-coterminal sgRNAs and the 5Ј terminus of the 3Ј-coterminal sgRNAs are indicated on the sequence of regions A and B.

sgRNA synthesis have been studied in other plant vi- tary to the positive RNA strand was PCR amplified with ruses. Adkins et al. (1997) found that a 20-nt promoter the pairs of primers PM1/KU-42 or PM1/KU-46 (Fig. 4). element was sufficient for a basal level of sgRNA syn- Primer KU-42 is located 408 nt upstream of the TGA stop thesis in Brome mosaic virus (BMV). Site-directed mu- codon of the RP, and primer KU-46 is 571 nt upstream of tagenesis showed that only bases at positions Ϫ17, Ϫ14, the TGA stop codon of the MP gene. Amplification with Ϫ13, and Ϫ11 relative to the transcription start site were primers PM1/KU-42 yielded three cDNA fragments of critical (Siegel et al., 1997). These are part of a consen- 3193, 1241, and 244 nt (f4, f5, and f6 in Fig. 4), which Ј Ј sus sequence AGA(N)2C(N)0–2G(N)5A(N)3–6A shared by included the 3 termini of the gRNA and of the 5 RPMP sgRNA promoters of viruses in the alphavirus-like super- and 5ЈRP sgRNAs, respectively. Amplification with prim- family (Siegel et al., 1997). Alignment with the CLBV ers PM1/KU-46 yielded two cDNAs of 2268 and 316 nt (f7 gRNA showed that this consensus sequence was also and f8 in Fig. 4), which corresponded to the 3Ј termini of present upstream of the transcription initiation of the the gRNA and of the 5ЈRPMP sgRNA, respectively. Eight 3ЈMP and 3ЈCP sgRNAs (Fig. 5). Furthermore, a hexa- to ten clones of each fragment, obtained from two sep- nucleotide motif (5Ј-ACUUAA), postulated to be a cis arate cloning events, were sequenced. Alignment of element essential for the synthesis of full-length minus these sequences with that of the gRNA showed that the strand of the gRNA and of the plus strand of sgRNAs in 3Ј terminus of the 5ЈRPMP sgRNA is located 255 nt various potex- and carlaviruses (Bancroft et al., 1991; upstream of the stop codon of the MP gene, and the 3Ј White et al., 1992), was also found in the 3ЈUTR of the terminus of the 5ЈRP sgRNA is 164 nt upstream of the CLBV gRNA (data not shown), and in the minus gRNA stop codon of the RP gene (Fig. 5). Therefore, the strand, 20 and 16 nt upstream of the transcription initia- 5ЈRPMP and 5ЈRP sgRNAs have a length of 6795 and tion of the 3ЈMP and 3ЈCP sgRNAs, respectively (Fig. 5, 5798 nt, respectively. Sequence identity between the sequence shown on the positive strand). This hexanucle- cDNAs obtained and the corresponding regions in the otide was not found in any other site of the positive or gRNA was about 99%. negative strands of the gRNA. DISCUSSION Identification of the 3Ј end of the 5Ј-coterminal Our results show that CLBV-infected plants contain sgRNAs four sgRNAs, two of which are 3Ј coterminal and the To clone the 3Ј termini of the 5ЈRPMP and 5ЈRP other two 5Ј coterminal with the gRNA. The plus strand of sgRNAs, polyadenylated RNA was reverse transcribed all of them accumulates in infected tissues, whereas the using primer PM1 as before, and the cDNA complemen- minus strand could not be detected in total RNA extracts. SUBGENOMIC RNAs OF CITRUS LEAF BLOTCH VIRUS 333

The two 3Ј-coterminal sgRNAs are ϳ3 and ϳ2 kb in size transcription initiation of the 3ЈCP sgRNA, and the 3Ј and have at their 5Ј end the MP and CP genes, respec- terminus of the 5ЈRP sgRNA is 40 nt upstream of the tively. This suggests that, as with other single-stranded transcription initiation of the 3ЈMP sgRNA. positive-sense RNA viruses (Miller and Koev, 2000), in- A simple explanation for the origin of the double- ternal ORFs of CLBV are likely expressed via synthesis of stranded form of the 5Ј-coterminal sgRNAs is that, during a set of 3Ј-coterminal sgRNAs. The sequence GAAAAG generation of new gRNA positive strands, the polymer- was found at the 5Ј terminus of both the 3Ј-coterminal ase could sometimes prematurely stop RNA synthesis. sgRNAs and the gRNA (Vives et al., 2001). This sequence The nascent positive strand would be released from the might be required for efficient transcription of CLBV negative gRNA template. However, during RNA extrac- RNAs, perhaps assisting the viral replicase in recognition, part of the positively stranded molecules could tion of, and adequate interaction with, the minus strand hybridize with the negative gRNA strand, leaving a pro- for plus-strand RNA synthesis. The presence of identical truding single-stranded region, which would be elimi- sequences at the 5Ј ends of the gRNA and sgRNAs has nated by exonucleases. This is supported by the finding also been found in other viruses such as BMV (Marsh that denatured dsRNA had the same size as the ssRNA and Hall, 1987; Marsh et al., 1989), Cucumber mosaic form detected in total RNA extracts. The positive strand virus (Boccard and Baulcombe, 1993), Alfalfa mosaic vi- of 5Ј-coterminal sgRNAs could also contain some pro- rus (van der Kuyl et al., 1990), Red clover necrotic mottle moter element and serve as template for minus-strand virus (Zavriev et al., 1996), Maize chlorotic mottle virus synthesis; however, no conserved sequence or second- (Lommel et al., 1991), Turnip crinkle virus (Wang and ary structure was found in the 3Ј-terminal region of those Simon, 1997), and Mushroom bacilliform virus (Revill et sgRNAs that could act as promoter. al., 1999). Interruption in the synthesis of gRNA positive strand The 5ЈUTR of the 3ЈMP and 3ЈCP sgRNAs consisted of could be induced by conformational elements pausing 123 and 284 nt, respectively, and were colinear with the the polymerase. However, examination of the predicted corresponding gRNA sequence, including the 5Ј-terminal secondary structure of minimum energy of the regions motif GAAAAG. This finding suggests that RNA transcrip- downstream the 3Ј termini of 5ЈRPMP and 5ЈRP sgRNAs tion of CLBV follows the mechanism of alphaviruses, in with MFOLD did not reveal any conserved element that which the minus strand is used as template for internal could explain this precise RNA synthesis termination. initiation of sgRNA synthesis, yielding messenger RNAs Premature interruption of gRNA transcription could be whose 5Ј terminus is colinear with the corresponding associated with the presence of cis elements acting as gRNA sequence (Miller and Koev, 2000). The sgRNAs of transcription promoters for the 3Ј-coterminal sgRNAs. coronaviruses also contain a common sequence at their This hypothesis is supported by the finding that all 5Ј termini, but contrasting with alphaviruses, this se- clones of the 3Ј end of each 5Ј-coterminal sgRNA that quence derives from the 5Ј terminus of the gRNA by a were sequenced had identical termini, and this was discontinuous transcription process, and therefore, their precisely located next to the putative promoter of the 5ЈUTR is not colinear with the gRNA (Miller and Koev, corresponding 3Ј-coterminal sgRNA (Fig. 5). During the 2000). synthesis of the positive gRNA strand, the replicative We found that CLBV-infected plants also contain two complex might sometimes stop at either promoter of the 5Ј-coterminal sgRNAs of ϳ6.5 (5ЈRPMP) and ϳ5.5 (5ЈRP) 3Ј-coterminal sgRNAs, if other polymerase molecules kb. Northern blot hybridizations with riboprobes of the were occupying this region to initiate synthesis of the two polarities revealed that, as with Sindbis virus (SIN) corresponding sgRNA. A similar mechanism was sug- (Wielgosz and Huang, 1997) or Citrus tristeza virus (CTV) gested for the synthesis of 5Ј-coterminal sgRNAs of (Che et al., 2001; Gowda et al., 2001), the 5Ј-coterminal Apple chlorotic leaf spot virus (ACLSV) (German et al., sgRNAs detected in total RNA extracts were positively 1992). Wielgosz and Huang (1997) observed that during stranded. The negative strand of these sgRNAs was SIN replication, formation of a 5Ј-coterminal RNA (RNA II) detected only in dsRNA-rich extracts. was correlated with transcription initiation of the sub- The 3Ј terminus of the 5Ј-coterminal sgRNAs of other genomicmRNA, and that strong or activepromoters viruses has not been determined. In CLBV, we cloned the increased the amount of RNA II in comparison with less 3Ј-terminal region of the 5ЈRPMP and 5ЈRP sgRNAs and active promoters. Gowda et al. (2001) reported that CTV found that in both of them, the nucleotide sequence of 10 produces 5Ј-coterminal sgRNAs whose 3Ј end would be cDNA clones was identical, which indicates that they do close to the controller elements of the 3Ј-coterminal not result from random breakage of the gRNA. These sgRNAs. The 5Ј-coterminal sgRNA production was cor- sgRNAs might have resulted from specific cleavage of related with the ability of the controller element to pro- the ss- or dsRNA form of the gRNA. However, the added duce 3Ј-coterminal sgRNA, and the level of production of length of 5ЈRPMP and 3ЈCP,or5ЈRP and 3ЈMP sgRNAs, 5Ј-coterminal sgRNA was correlated with the amount of is smaller than the full-length gRNA. The 3Ј terminus of 3Ј-coterminal sgRNA. the 5ЈRPMP sgRNA is located 35 nt upstream of the The biological function of the 5Ј-coterminal sgRNAs of 334 VIVES ET AL.

CLBV is presently unknown. One possibility would be RT-PCR using dsRNA as template and CLBV-specific that they were messenger RNAs. However, the 3Ј termini primers (Vives et al., 2001), as described in Ayllo´n et al. of the 5ЈRPMP and 5ЈRP sgRNAs were located 255 nt (1999), and ligated to the linearized and thymidylated upstream of the stop codon of the MP gene and 164 nt pGEM-T plasmid vector (Promega). Cloned cDNA was upstream of the stop codon of ORF1, respectively, which PCR-labeled with digoxigenin using the same primers indicated that at least the 5ЈRP sgRNA does not contain and the PCR DIG-labeling and detection kit (Roche). a complete ORF. Alternatively, both 5Ј-coterminal DIG-labeled RNA transcripts of the two polarities were sgRNAs could be just byproducts of the transcription synthesized from the same cDNA clones by incorpora- process. Their presence at high titer in the infected cells tion of DIG-UTP using T7 and SP6 RNA polymerases would facilitate recombination with gRNA, thus providing according to the manufacturer’s instructions (Roche). opportunities to repair lethal or biologically disadvanta- For Northern blot hybridization, encapsidated or total geous mutations occurred in the gRNA. The potential RNA, or dsRNA-rich preparations, were denatured at implication of sgRNAs in gRNA repairing has been sug- 94°C for 5 min in 50% formamide, chilled on ice, sepa- gested for other viruses (Bar-Joseph et al., 1997). rated by electrophoresis in formamide-formaldehyde de- naturing 1.2% agarose gels in MOPS buffer, and then MATERIALS AND METHODS transferred by capillarity to nylon membranes (Hy- bond-N, Amersham) using 20ϫ SSC, pH 7.0, as the trans- Virus source fer buffer (Sambrook et al., 1989). The DIG-labeled RNA The CLBV isolate SRA-153 (Navarro et al., 1984) used molecular weight marker II (Roche) was included in each in this work was maintained in plants of Nagami kum- gel. Prehybridization, hybridization, and washing steps quat grafted on rough lemon (C. jambhiri Lush), grown in were carried out according to Narva´ez et al. (2000). an artificial potting mix (50% sand and 50% peat moss) in Reaction was developed with the chemiluminescent sub- a temperature-controlled (18–26°C) greenhouse, and fer- strate CSPD (Roche) following the manufacturer’s in- tilized by a standard procedure (Arregui et al., 1982). The structions. biological characteristics and nucleotide sequence of the gRNA of this isolate have been described (Galipienso cDNA synthesis, cloning, sequencing, and nucleotide et al., 2000; Vives et al., 2001). sequence analysis

RNA extraction To determine the 5Ј termini of the 3Ј-coterminal sgRNAs, and the 3Ј termini of the 5Ј-coterminal sgRNAs, Total RNA extracts were obtained from1gofthor- denatured dsRNA from infected plants was polyadenyl- oughly trimmed leaves or bark from infected plants, us- ated using yeast poly(A) polymerase (U.S. Biochemical) ing TRIzol reagent (Life Technologies). RNA was further and, after phenol-chloroform extraction and ethanol pre- purified following the manufacturer’s instructions for cipitation, the polyadenylated RNAs were reverse tran- samples with high sugar content and finally resus- scribed at 60°C using primer PM1, which has (dT) at its ␮ 17 pended in 100 l DEPC-treated distilled water. Encapsi- 3Ј end and the ThermoScript RT-PCR System (Life Tech- dated RNA was extracted from partially purified virion nologies). PCR amplification was done in the conditions preparations obtained according to Galipienso et al. described (Vives et al., 1999), using primers PM1 and (2001). KU-21 (5ЈTATCAGTCTAACGCTCCCATC3Ј) or KU-43 (5ЈT- Preparations enriched in dsRNA were obtained from CTTATTGACTGCAATCTGTCAGCGGTCAGAATATTTGCT- total nucleic acid extracts by nonionic cellulose column TGC3Ј) to amplify the 5Ј termini of the 3Ј-coterminal chromatography in the presence of 16% (v/v) ethanol sgRNAs, and PM1 and KU-42 (5ЈGCATTCGCAGGAGAT- ␮ (Moreno et al., 1990), using 20 g/ml glycogen (Roche) GATATGTGTGCATTAAACAATTTGGC3Ј) or KU-46 (5ЈTG- as coprecipitant. TAGCAGCAATCATCACTGGC3Ј) to amplify the 3Ј termini of the 5Ј-coterminal sgRNAs (Fig. 4). Primers KU-21 and Preparation of probes and Northern blot analysis KU-43 are complementary to bases 8044–8024 and 6174– The following cDNA probes were prepared from se- 6132, respectively, and primers KU-42 and KU-46 include lected CLBV gRNA regions: (i) the 5Ј-terminal (5ЈT) probe, bases 5555–5595 and 6480–6501, respectively, of the which includes nucleotides 74–484 from the 5Ј terminus; CLBV gRNA (Vives et al., 2001). The PCR products were (ii) the rp probe, including nt 5321–5776, which contains examined in 1% agarose gels and cDNA fragments of the motifs characteristic of RNA-dependent RNA poly- expected size were gel-purified and cloned in the merases; (iii) the mp probe, spanning between nt 6480 pGEM-T plasmid using standard protocols (Sambrook et and 6718 of the potential MP gene; (iv) the cp probe, al., 1989). The nucleotide sequence of the inserts was which includes nt 7685–8044 of the CP gene; and (v) the determined with an ABI PRISM DNA sequencer 377 (PE 3Ј-terminal (3ЈT) probe, which includes the last 374 nt of Biosystems) using primers T7 and SP6 from the plasmid the gRNA. These cDNA fragments were synthesized by sequence. Sequence alignment and estimation of nucle- SUBGENOMIC RNAs OF CITRUS LEAF BLOTCH VIRUS 335 otide identity were done with the GAP program, search stranded 3Ј-terminal and positive-stranded 5Ј-terminal RNAs. Virol- for conserved sequences with FINDPATTERNS, and ogy 286, 134–151. search for predicted secondary structure of minimum Ishikawa, M., Meshi, T., Ohno, T., and Okada, Y. (1991). Specific cessa- tion of minus-strand RNA accumulation at an early stage of tobacco energy with MFOLD, from the Wisconsin GCG software mosaicvirus infection. J. Virol. 65, 861–868. package (Devereux et al., 1984). Lommel, S. A., Kendall, T. L., Xiong, Z., and Nutter, R. C. (1991). Identi- fication of the maize chlorotic mottle virus capsid protein cistron and characterization of its subgenomic messenger RNA. Virology 181, ACKNOWLEDGMENTS 382–385. MacBeth, K. J., and Patterson, J. L. (1995). The short transcript of We thank Marıá Boil for excellent lab assistance and to Dr. Luis Rubio for critically reading this manuscript. The first and second au- Leishmania RNA virus is generated by RNA cleavage. J. Virol. 69, thors were recipients of doctoral and postdoctoral fellowships, respec- 3458–3464. tively, from the INIA. This work was funded by the INIA Projects Marsh, L. E., and Hall, T. C. (1987). Evidence implicating a tRNA ϩ SC93-110 and SC97-103. heritage for the promoters of ( ) strand RNA synthesis in brome mosaicvirus and related viruses. The Evolution of CatalyticFunction. Cold Spring Harbor Symp. Quant. Biol. 52, 331–341. REFERENCES Marsh, L. E., Huntley, C. C., Pogue, G. P., Connell, J. P., and Hall, T. C. (1991). Regulation of (ϩ):(Ϫ)-strand asymmetry in replication of Adkins, S., Siegel, R. W., Sun, J. H., and Kao, C. C. (1997). Minimal brome mosaicvirus RNA. Virology 182, 76–83. templates directing accurate initiation of subgenomic RNA synthesis Marsh, L. E., Pogue, G. P., and Hall, T. C. (1989). Similarities among plant in vitro by the brome mosaicvirus RNA-dependent RNA polymerase. virus (ϩ) and (Ϫ) RNA termini imply a common ancestry with pro- RNA 3, 634–647. moters of eucaryotic tRNAs. Virology 172, 415–427. Arregui, J. M., Ballester, J. F., Pina, J. A., and Navarro, L. (1982). Mawassi, M., Gafny, R., Gagliardi, D., and Bar-Joseph, M. (1995). Pop- Influencia del sustrato y de la fertilizacioń en el crecimiento ulations of citrus tristeza virus contain smaller-than-full-length parti- de plantas de lima Mejicana (Citrus aurantifolia (Chritm.) cles which encapsidate sub-genomic RNA molecules. J. Gen. Virol. Swing) cultivadas en invernadero. An. INIA Ser. Tecnol. Agric. 19, 76, 651–659. 61–82. Miller, W. A., Dreher, T. W., and Hall, T. C. (1985). Synthesis of brome Aylloń, M. A., Lo´pez, C., Navas-Castillo, J., Mawassi, M., Dawson, W. O., mosaicvirus subgenomicRNA in vitro by internal initiation on Guerri, J., Flores, R., and Moreno, P. (1999). New defective RNAs from (Ϫ)sense genomicRNA. Nature 313, 68–70. citrus tristeza virus: Evidence for a replicase-driven template switch- Miller, W. A., and Koev, G. (2000). Synthesis of subgenomicRNAs by ing mechanism in their generation. J. Gen. Virol. 80, 817–821. positive-strand RNA viruses. Virology 273, 1–8. Bar-Joseph, M., Yang, G., Gafny, R., and Mawassi, M. (1997). Sub- Moreno, P., Guerri, J., and Munõz, N. (1990). Identification of Spanish genomic RNAs: The possible building blocks for modular recombi- strains of citrus tristeza virus (CTV) by analysis of double-stranded nation of Closteroviridae genomes. Sem. Virol. 8, 113–119. RNAs (dsRNA). Phytopathology 80, 477–482. Bancroft, J. B., Rouleau, M., Johnston, R., Prins, L., and Mackie, G. A. Narvaéz, G., Skander, B. S., Aylloń, M. A., Rubio, L., Guerri, J., and (1991). The entire nucleotide sequence of foxtail mosaic virus RNA. Moreno, P. (2000). A new procedure to differentiate citrus tristeza J. Gen. Virol. 72, 2173–2181. virus isolates by hybridisation with digoxigenin-labelled cDNA Boccard, F., and Baulcombe, D. (1993). Mutational analysis of cis-acting probes. J. Virol. Methods 85, 83–92. sequences and gene function in RNA3 of cucumber mosaic virus. Navarro, L., Pina, J. A., Ballester-Olmos, J. F., Moreno, P., and Cambra, Virology 193, 563–578. M. (1984). A new graft transmissible disease found in Nagami kum- Che, X., Piestun, D., Mawassi, M., Yang, G., Satyanarayana, T., Gowda, quat. In “Proceedings of the 9th Conference of the International S., Dawson, W. O., and Bar-Joseph, M. (2001). 5Ј-coterminal sub- Organization of Citrus Virologists” (L. W. Timmer and J. A. Dodds, genomic RNAs in citrus tristeza virus-infected cells. Virology 283, 374–381. Eds.), pp. 234–240. IOCV, Riverside, CA. Choi, I. R., Ostrovsky, M., Zhang, G., and White, K. A. (2001). Regulatory Navas-Castillo, J., Albiach-Martı´, M. R., Gowda, S., Hilf, M. E., Garnsey, activity of distal and core RNA elements in tombusvirus subgenomic S. M., and Dawson, W. O. (1997). Kinetics of accumulation of citrus mRNA2 transcription. J. Biol. Chem. 276, 41761–41768. tristeza virus RNAs. Virology 228, 92–97. Devereux, J., Haeberli, P., and Smithies, O. (1984). A comprehensive set Revill, P. A., Davidson, A. D., and Wright, P. J. (1999). Identification of a of sequence analysis programs for the VAX. Nucleic Acids Res. 12, subgenomic mRNA encoding the capsid protein of mushroom bacil- 387–395. liform virus, a single-stranded RNA mycovirus. Virology 260, 273– Galipienso, L., Navarro, L., Ballester-Olmos, J. A., Pina, P., Moreno, P., 276. and Guerri, J. (2000). Host range and sympomatology of a graft- Rubio, L., Yeh, H.-H., Tian, T., and Falk, B. W. (2000). A heterogeneous transmissible pathogen causing bud union crease of citrus on trifo- population of defective RNAs is associated with lettuce infectious liate rootstocks. Plant Pathol. 49, 308–314. yellows virus. Virology 271, 205–212. Galipienso, L., Vives, M. C., Moreno, P., Milne, R. G., Navarro, L., and Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular Cloning: Guerri, J. (2001). Partial characterisation of citrus leaf blotch virus, a A Laboratory Manual.” Cold Spring Harbor Laboratory, Cold Spring new virus from Nagami kumquat. Arch. Virol. 146, 357–368. Harbor, NY. Gargouri, R., Joshi, R. L., Bol, J. F., Astier-Manifacier, S., and Haenni, A. L. Sawicki, D. L., Wang, T., and Sawicki, S. G. (2001). The RNA structures (1989). Mechanism of synthesis of turnip yellow mosaic virus coat engaged in replication and transcription of the A59 strain of mouse protein subgenomicRNA in vivo. Virology 171, 386–393. hepatitis virus. J. Gen. Virol. 82, 385–396. German, S., Candresse, T., Le Gall, O., Lanneau, M., and Dunez, J. Siegel, R. W., Adkins, S., and Kao, C. C. (1997). Sequence-specific (1992). Analysis of the dsRNAs of apple chlorotic leaf spot virus. recognition of a subgenomic RNA promoter by a viral RNA polymer- J. Gen. Virol 73, 767–773. ase. Proc. Natl. Acad. Sci. USA 94, 11238–11243. Gowda, S., Satyanarayana, S., Aylloń, M. A., Albiach-Martı´, M. R., Ma- Sit, T. L., Waewhongs, A. A., and Lommel, S. A. (1998). RNA mediated wasi, M., Rabindran, S., Garnsey, S. M., and Dawson, W. O. (2001). transactivation of transcription from a viral RNA. Science 281, 829– Characterization of the cis-acting elements controlling subgenomic 832. mRNAs of Citrus tristeza virus: Production of positive- and negative- van der Kuyl, A. C., Langereis, K., Houwing, C. J., Jaspars, E. M., and Bol, 336 VIVES ET AL.

J. F. (1990). Cis-acting elements involved in replication of alfalfa Wang, J., and Simon, A. E. (1997). Analysis of the two subgenomicRNA mosaicvirus RNAs in vitro. Virology 253, 327–336. promoters for turnip crinkle virus in vivo and in vitro. Virology 232, Vives, M. C., Rubio, L., Lo´pez, C., Navas-Castillo, J., Albiach-Martı´, M. R., 174–186. Dawson, W. O., Guerri, J., Flores, R., and Moreno, P. (1999). The White, K. A., Bancroft, J. B., and Mackie, G. A. (1992). Mutagenesis of a complete genome sequence of the major component of a mild citrus hexanucleotide sequence conserved in potexvirus RNAs. Virology tristeza virus isolate. J. Gen. Virol. 80, 811–816. 189, 817–820. Vives, M. C., Galipienso, L., Navarro, L., Moreno, P., and Guerri, J. (2001). Wielgosz, M. M., and Huang, H. V. (1997). A novel viral RNA species in The nucleotide sequence and genomic organization of citrus leaf Sindbis virus-infected cells. J. Virol. 71, 9108–9117. blotch virus: A candidate member of a new virus genus. Virology 287, Zavriev, S. K., Hickey, C. M., and Lommel, S. A. (1996). Mapping of the red 225–233. clovernecroticmosaicvirussubgenomicRNA. Virology 216, 407–410.