Tubulin Acetylation: a Novel Functional Avenue for CDYL in Sperm

Received: 3 January 2017 | Revised: 8 June 2017 | Accepted: 28 June 2017 DOI: 10.1002/cm.21381

RESEARCH ARTICLE

Tubulin acetylation: A novel functional avenue for CDYL in sperm

1Department of Gamete Immunobiology, National Institute for Research in Abstract Reproductive Health (ICMR), Mumbai Motility in sperm is driven by the flagella, the principal component of which is the axoneme. The 400012, India microtubules which make up the 9 1 2 axoneme are composed of heterodimers of alpha and beta 2 Biomedical Informatics Centre, National tubulins and undergo several post-translational modifications. We have earlier reported that Institute for Research in Reproductive HDAC6 functions as tubulin deacetylase in sperm and has a role in sperm movement. While Health(ICMR), Mumbai 400012, India exploring the specific tubulin acetyltransferase (TAT) in sperm, we observed the presence of Chro- 3Department of Neuroendocrinology and Confocal Microscopy Lab, National Institute modomain Y-Like (CDYL), on the principal piece of rat spermatozoa which compelled us to explore for Research in Reproductive Health(ICMR), its function in sperm. CDYL was observed to be colocalized with acetylated alpha-tubulin (Ac a Mumbai 400012, India Tubulin) in sperm flagella. Sperm axonemal fraction showed the presence of CDYL protein indicating its strong association with flagellar microtubules. Sequence alignment of CDYL chromo domain Correspondence Priyanka Parte, Department of Gamete and Alpha tubulin acetyltransferase (aTAT1) revealed that of the 10 residues of aTAT1 known to Immunobiology, National Institute for be involved in a-tubulin binding, 5 residues were identical and 1 was conserved between the two Research in Reproductive Health (ICMR), proteins. Docking of CDYL chromo domain and a-tubulin showed that 6 of the 11 important bind- Mumbai 400012, India. ing residues of a-tubulin showed an interaction with CDYL chromo domain. The putative CDYL Email: [email protected] chromodomain –a-tubulin interaction was further confirmed by Microscale Thermophoresis. We Funding information further asserted the ability of recombinant CDYL and Sperm CDYL to acetylate soluble tubulin Department of Science and Technology and microtubules in vitro. Acetylation of tubulin was increased over twofold in cells overexpress- Grant / Award Number: (D.O. No. SR/SO/ HS/112/2007), India; Indian Council of ing CDYL. Thus, our studies convincingly demonstrate the ability of CDYL to moonlight as a Medical Research (NIRRH - RA/390/06- tubulin acetyltransferase. 2016); Indian Council of Medical Research (Senior Research Fellowship to S.P.); DST KEYWORDS (JRF and SRF to S.P.) alpha-tubulin, Chromodomain Y-Like, microtubules, sperm, tubulin acetyltransferase

1 | INTRODUCTION and a C-terminal catalytic domain (Lahn & Page, 1999). A significant association has been demonstrated between testicular impairment/ Chromodomain Y like (CDYL) gene is an autosomal gene mapped on spermatogenic failure and the expression of CDY1 and CDY2 tran- human chromosome 6. Chromodomain Y (CDY) gene in the course of scripts in infertile men with DAZ deletions (Ferlin, Moro, Rossi, & For- primate evolution ascended by retropositioning of an mRNA from the esta, 2001; Kleiman et al., 2003), Potash (2006) in his thesis CDYL gene. Autosomal CDYL is ubiquitously expressed while CDY is demonstrated that mice lacking Cdyl produce spermatozoa with mis- testis specific and located on the Y chromosome and implicated in shapen heads and show significant germ cell death which in turn male infertility (Kuroda-Kawaguchi et al., 2001; Lahn et al., 2002). In affects spermatogonia, spermatocytes and spermatid number is mouse, where Y-linked CDY homologs are absent, Cdyl gene is exp- observed. ressed as 2 transcripts: a ubiquitous transcript, and a highly expressed Human CDY and mouse CDYL proteins have been reported to testis-specific transcript. Human CDYL shares 93% and 63% protein exhibit HAT activity in vitro and their expression during spermatogene- sequence identity with mouse Cdyl and human CDY, respectively. sis correlates with the occurrence of H4 hyperacetylation (Akella et al., CDYL protein has an N-terminal chromodomain (DNA binding domain) 2010). However, histone H4 hyperacetylation was detected equally in

Cytoskeleton.2017;1–12. wileyonlinelibrary.com/journal/cm VC 2017 Wiley Periodicals, Inc. | 1 2 | PARAB ET AL. spermatids of both wild type and Cdyl knockout mice (Potash, 2006). epididymis of the adult male rat, CDYL expression is seen in the princi- These observations question its role as a histone acetyltransferase. We pal epithelial cells of caput and caudal region of epididymis. The pres- observed the localization of CDYL in the principal piece of rat caudal ence of CDYL is also observed in the luminal sperm of the caput and sperm flagella. CDYL co-localized with acetyl alpha tubulin (Ac a-Tubu- caudal region indicating its presence in mature sperm (Figure 1b). The lin). This encouraged us to explore whether it acted as a tubulin acetyl expression of the transcript for Cdyl in rat testicular- and caudal-sperm transferase (TAT) in light of its controversial role as a histone acetyl- was investigated by RT-PCR using primers to the full length (1.9 kb) transferase. MEC-17, a protein related to Gcn5 has also been identified and partial cDNA (214 bp). Our observations demonstrate prominent as a TAT in Tetrahymena, C. elegans and Zebrafish. However, in Zebra- presence of the CDYL transcript in testicular- and caudal sperm. ‘Rea- fish ablation of MEC-17 displays lack of a-tubulin acetylation in the gent’ control as well as ‘No RT’ control showed no contamination from neurons but not in the cilia (Akella et al., 2010). Interestingly, mec17or- reagents used or from genomic DNA (Figure 1c). Western blot analysis tholog atat1knockout mice show defect in sperm morphology, and for CDYL and AC a-tubulin in rat testicular- and caudal- sperm motility and litter size suggesting that tubulin acetylation is involved in revealed a 70 kDa band for CDYL and 55 kDa for Ac a-tubulin in regulating sperm fertility. Surprisingly, development of brain which is both (Figure 1d). known to have high amounts of acetylated a tubulin, and neurological behaviour are not affected, neither are any other ciliated organelles. 2.2 | Co-localization of CDYL and Ac a-tubulin However, these mice show increased microtubule stability (Kalebic, in sperm Sorrentino, et al., 2013). Studies around the same time by Kim, Gor- bani, You, and Yang (2013) have observed that atat1 KO mice are via- Co-localization of CDYL and Ac a-tubulin was investigated in ble, testicular function and fertility of these mice is normal, but display testicular-, caput- and caudal-sperm. CDYL was localized mainly on the a-tubulin acetylation deficiency and abnormal dentate gyrus Kim et al. head region in testicular-, caput- and caudal-sperm. Flagellar localiza- (2013). They conclude that atat1 is not required for normal develop- tion of CDYL seen along the complete length of testicular- and caput- ment but may regulate more advanced functions such as memory and sperm flagella differs from the localization in caudal sperm where it is learning. Whilst both these authors agree that atat1 is the tubulin ace- restricted to the principal piece. Ac a-tubulin was observed to be local- tyltransferase, there is a disagreement on its significance in sperm func- ized throughout the sperm flagella of testicular-, caput- and caudal tion. Interestingly, the fraction shown by Maruta, Greer, and sperm (Figure 2a). Statistical analysis of signal intensities for CDYL and Rosenbaum (1986) to possess tubulin acetyltransferase activity impli- Ac a-tubulin along the length of sperm flagella demonstrates an cates a protein with a molecular weight of 67 kDa. This prompted us increase in the levels of Ac a-tubulin in caput- and caudal- sperm with to investigate the possibility that there may be another protein with respect to testicular sperm whereas no change was observed in the tubulin acetyltransferase activity on the sperm flagella. levels of CDYL protein from testicular- to epididymal-sperm (Figure 2b) The molecular size of Cdyl, its controversial role as a HAT and its although as can be appreciated from Figure 2a, its distribution along expression in the principal piece region of the rat sperm flagella the flagella is altered. CDYL and Ac a-tubulin are co-localized along the prompted us to investigate whether Cdyl had a role beyond spermato- length of the flagella. The overlap coefficient of CDYL and Ac a-tubulin genesis and possessed a-tubulin acetyltransferase activity. The present show a significant increase in the caudal sperm as compared to testicu- study was undertaken to explore this possibility. We observed a co- lar- and caput sperm indicating increased co-localization of the two localization of CDYL with Ac a-tubulin in sperm flagella. Enrichment of proteins in mature sperm flagella (Figure 2c). Similar observations were CDYL in sperm flagellar axoneme fraction strengthens the possibility of reported by us for the tubulin deacetylase HDAC6 and Ac a-tubulin its interaction with flagellar microtubules. The sequence and structural (Parab et al., 2015). Whereas there HDAC6 expression was predomi- alignment of CDYL and aTAT1 and molecular docking analysis sug- nantly on midpiece, for CDYL we see it strongly on the principal piece. gested that CDYL chromo domain can potentially bind to a-tubulin. We had earlier reported significant colocalization of HDAC6 and Ac This interaction was further confirmed by Microscale thermophoresis a-tubulin predominantly in the mid piece region of caudal sperm (MST). We also demonstrated that Recombinant-and sperm- CDYL can flagella. acetylate soluble- and polymerized- tubulin in vitro. Overexpression of CDYL in HEK293T cells also led to increased tubulin acetylation further 2.3 | Detection of CDYL in sperm axonemal fraction ascribing the role for CDYL as a tubulin acetyltransferase. Isolation of axonemal fraction was carried out by processing rat caudal sperm flagellar pellet which was largely devoid of sperm head (>90% 2 | RESULTS pure; Figure 3a,b). The Ponceau’s profile of axonemal protein lysate shows few bands enriched at around 90–50 kDa and 35–25 kDa as 2.1 | Expression pattern of CDYL compared to whole sperm protein (Figure 3c). Western Blot analysis of in testis and epididymis the axonemal fraction demonstrated a 3.5 fold increase in the signal Immunohistochemistry performed on adult rat testicular sections intensities for a-tubulin as compared to that in whole sperm protein exhibit the distribution of CDYL in round spermatids present during indicating enrichment of axonemal proteins (Figure 3d). This can be the early stages of spermatogenesis (Stage IV-VIII) (Figure 1a). In the better appreciated when compared to its respective Ponceau profile. In PARAB ET AL. | 3

FIGURE 1 Expression pattern of CDYL in testis, epididymis and sperm. (a) Immunohistochemical localization of CDYL in testis. CDYL expression is observed in round spermatids at stage IV–VI and Stage VIII. The inset shows the negative control probed with respective pre- immune sera. (b) Immunohistochemical localization of CDYL in epididymis. The top panel shows expression of CDYL in Caput region of the epididymis while the lower panel shows the expression of CDYL in caudal region. The presence of CDYL is seen in the principal epithelial cells and in lumen of the caput and caudal region. The negative controls probed with respective pre-immune sera are shown in the inset. (c) RT-PCR. A band of full length 1.9 Kb and 214 bp (partial region) of CDYL is observed in testicular- and caudal- sperm. ‘Reagent’ control (RC) as well as ‘No Reverse Transcriptase’ (NRT) control were incorporated to account for non-specific amplification, if any. The lower panel is the b-actin (200 bp) used as the housekeeping gene. Lane 1 shows the 1,000bp DNA ladder in the top panel and a 100bp ladder in the middle and lower panel. (d) Western blot analysis. A band of CDYL is observed at 70̴ kDa in testicular- and caudal- sperm. A band of Ac a-tubulin and a-tubulin at 55 kDa is observed in Tsp and Cd sp. -ve: Negative controls (‘no primary control’ for Ac a-tubulin and a-tubulin and ‘pre-immune sera control’ for CDYL) show no band in the 70 kDa and 55 kDa region. T sp: Testicular sperm; Cd sp: Caudal sperm [Color figure can be viewed at wileyonlinelibrary.com] the same axonemal fraction, CDYL was detected at 70 kDa with a Marmorstein, 2012), five residues (K37, D43, D44, E47 and E49) were fivefold increase in axonemal fraction as compared to intact sperm identical and one was conserved between the two proteins (Figure 4a). lysate (Figure 3d). Occurrence of CDYL protein in the axonemal fraction suggests its putative interaction with flagellar microtubules. 2.4.2 | Molecular docking analysis Molecular docking analysis was done using the structural coordinates a 2.4 | CDYL binds a–tubulin in silico of -tubulin for docking with CDYL chromo domain using Z-DOCK algorithm. The poses obtained from the ZDOCK algorithm were ana- 2.4.1 | Sequence and structure alignment lysed and further refined using the RDOCK protocol. The best pose The structures and sequences of CDYL chromo domain and aTAT1 had RDOCK energy of 213.41 kcal/mol. The intermolecular interac- were aligned to determine whether the residues in aTAT1 known to tions were analysed and it was observed that six (D39, T41, I42, G43, be critical for a-tubulin binding are conserved in CDYL chromo domain. G44 and G45) of the eleven important binding residues of a-tubulin Sequence alignment revealed that of the 10 residues of aTAT1 known which constituted the restricted search space for docking, showed to be involved in tubulin binding(Friedmann, Aguilar, Fan, Nachury, & interactions with CDYL chromo domain (Figure 4b). 4 | PARAB ET AL.

FIGURE 2 Co-localization of CDYL and Ac a-tubulin in sperm. (a) The panel shows localization of CDYL and Ac a-tubulin along with com- posite- and the cutmask- images indicating the co-localization of the two proteins. The column on the extreme right shows the respective negative controls. The corresponding DIC images are shown in the inset. The nucleus has been stained with DAPI. CDYL and Ac a-tubulin are co-localized although not uniformly across the length of the flagellum. The co-localization of CDYL and Ac a-tubulin can be best appreciated in the cut-mask images of the respective sperm. The co-localization is prominently seen in the Principal-piece of caudal-sperm flagella. Scale bar: 20lm. (b) Graphical representation of total signal intensities of CDYL and Ac a-tubulin shows no difference in CDYL expression in flagellar region between testicular-, caput- and caudal sperm (T sp, Cp sp and Cd sp) whereas Ac a-tubulin in Cp sp and Cd sp is significantly increased as compared to T sp. (c) Graphical representation of overlap coefficient showing a significant increase in the degree of overlap of CDYL and acetyl a-tubulin in Cd sp as compared to T sp and Cp sp. The experiment was performed twice on duplicate slides. Ten each of T sp, Cpsp and Cd sp were analysed for quantification of intensities. Statistical significance was determined using one-way ANOVA with significance level set at p .05. ‘**’ and ‘***’ indicate significance of p .01, and p .001, respectively. Values are mean 6 SEM; T sp: Testicular sperm; Cp sp: Caput sperm; Cd sp: Caudal sperm [Color figure can be viewed at wileyonlinelibrary.com]

2.4.3 | CDYL specifically interacts with tubulin seen upto 120 min (Figure 6a). We therefore studied the activity using – l MST binding assay was performed to determine and quantify biomo- lower concentrations of CDYL (0 6 M) and observed a concentration dependent increase in a-tubulin acetylation (Figure 6b). Microtubules lecular interactions between CDYL and Tubulin. Evaluation of the Kd a fitbinding curve forCDYL-tubulin protein demonstrates a steady inter- demonstrated an exponential increase in band intensity of Ac -tubulin action between the two proteins. MST analysis using BSA as a negative as a function of increased duration of incubation with CDYL. This tem- control shows no interaction between BSA and CDYL, thus confirming poral increase in Ac a-tubulin expression was not observed when specificity of the CDYL-tubulin interaction (Figure 5a,b). The CDYL- microtubules were incubated without CDYL (Figure 6c). Likewise, tubulin binding demonstrated a Kd value of 318 6 165 nM. incremental concentrations of CDYL also brought about a steady increase in a-tubulin acetylation (Figure 6d). These results demonstrate | a 2.4.4 CDYL acetylates -tubulin in vitro the ability of CDYL to acetylate tubulin dimers as well as microtubules. Encouraged by the observations of colocalization, in silico and MST This is unlike ATAT1 which has been reported to acetylate only poly- analysis of CDYL-tubulin interaction, we investigated if CDYL was able merized tubulin and not the soluble tubulin (Kalebic, Martinez, et al., to acetylate a-tubulin which is expected if CDYL indeed interacts with 2013). a-tubulin and has acetyltransferase activity. An in vitro assay was designed wherein recombinant CDYL was tested for its ability to acety- 2.5 | CDYL over expression increases a-tubulin late tubulin dimers and microtubules in the presence of Ac CoA. Acety- acetylation in HEK cells lation of a-tubulin was determined by Western blot analysis. At 6 lM CDYL, tubulin dimers exhibited acetylation which was too high com- CDYL acetylated soluble and polymerized tubulin. In order to deter- pared to basal level observed in the absence of CDYL and this was mine whether CDYL is able to similarly induce acetylation in situ, PARAB ET AL. | 5

FIGURE 3 Presence of CDYL in sperm axonemal fraction. (a and b) Bright field images of purified flagella fraction of sperm stained by Papanicolaou’s method. Scale bar 20 lm. (c) Ponceau’s stained protein profile of caudal sperm (Cd-sp) lysate and axonemal fraction (a–f) resolved by SDS-PAGE and transblotted on nitrocellulose membrane. Axonemal fraction shows enrichment of few proteins in the region of 90–50 kDa and 35–25 kDa. (d) Western blot analysis demonstrates enrichment of a-tubulin (55 kDa) in a–fascomparedtoCd-sp.The 70 kDa CDYL protein was detected in Cd-sp as well as a–f. -ve: Negative controls (‘no primary control’ for Ac a-tubulin and a-tubulin and ‘pre-immune sera control’ for CDYL) show no band in the 70 kDa and 55 kDa region [Color figure can be viewed at wileyonlinelibrary.com] a-tubulin acetylation was studied in CDYL-overexpressing HEK293T 3 | DISCUSSION cell line. The protein lysate of cells overexpressing CDYL showed abun- dant CDYL expression as expected. The band of Ac a-tubulin although Lysine acetylation of proteins at specific residues has surfaced as a cru- appears more intense in lysate of mock transfected cells as compared cial posttranslational modification. As opposed to acetylation of histo- to CDYL overexpressing lysate, this when normalized to its respective nes which is well-studied, non-histone protein acetylation and its a-tubulin band, demonstrates a significant increase in the proportion of importance are not very well defined. a-tubulin, a cytoskeletal protein Ac a-tubulin in CDYL overexpressing lysate as compared to mock undergoes conserved acetylation at N-terminal on lysine 40 (Fried- lysate. (Figure 7a,b). This implies a direct correlation between CDYL mann et al., 2012; Piperno, LeDizet, & Chang, 1987). Whilst HDAC6 overexpression and Ac a-tubulin levels. further validating the novel was indentified as the tubulin deacetylase (Hubbert et al., 2002), the function of CDYL as a probable TAT. tubulin specific acetyltransferase has been a debate ever since two protein fractions having TAT activity were isolated from Chlamydomo- nas flagellar extract as early as 1986 (Maruta et al., 1986). Major tubu- | a 2.6 CDYL from sperm acetylates -tubulin lin aceytltransferase activity was obtained from a fraction containing a We immunoprecipitated CDYL from sperm lysates and determined its 67 kDa protein. Several candidates namely ELP3, ARD1-NAT1 com- ability to acetylate soluble tubulin dimers or microtubules. Acetylation plex and NAT10 have been considered as putative a-tubulin specific of a-tubulin was seen in tubulin dimers and microtubules incubated acetyltransferase (Creppe et al., 2009; Ohkawa et al., 2008; Shen et al., with the CDYL antibody- pulled down immunoprecipitates but not 2009). MEC17 or its ortholog atat1 has been demonstrated as the with IgG- pulled down immunoprecipitates. The intensities for major tubulin acetyltransferase (Kalebic, Sorrentino, et al., 2013; Kale- a-tubulin used as a loading control for tubulin dimers and microtubules bic, Martinez, et al., 2013). Interestingly, atat1 knockout mice show in the acetylation assay were almost the same indicating equal load in defect in sperm morphology, and motility and litter size suggesting that respective CDYL and IgG pull-down lanes. These results endorse the tubulin acetylation is involved in regulating sperm fertility. Surprisingly, ability of CDYL as a TAT in sperm (Figure 7c). development of brain which is physiologically rich in acetylated 6 | PARAB ET AL.

on its significance in sperm function. This prompted us to explore our search for other probable tubulin acetyltransferase in sperm. CDYL is reported to acetylate histones in vitro (Lahn et al., 2002). However, histone acetylation is normal in CDYL knockout mice. But these mice produce sperm with mishappen heads and show significant germ cell death (Potash, 2006). We observed CDYL protein expression in the principal piece of mature sperm flagella. CDYL, a 66 kDa protein has been implicated in testicular impairment/spermatogenic failure (Ferlin et al., 2001; Kleiman et al., 2003). We therefore explored the relevance of its presence in the mature sperm. We investigated whether Cdyl may moonlight as a-tubulin acetyltransferase in sperm. In this study, we have successfully demonstrated the ability of CDYL to function as a putative tubulin acetlytransferase in sperm. The FIGURE 4 In silico analysis of a putative CDYL and a–tubulin interaction (a) Sequence alignment of aTAT1 with CDYL distribution of CDYL in rat testicular tissue demonstrates the presence chromodomain. The identical and the conserved residues are of CDYL mainly in the round spermatids. The observation of CDYL in coloured in dark grey and light grey, respectively. The tubulin the lumen of caput- and caudal- region of the epididymis and the a binding residues identified in TAT1 and their corresponding detection of itstranscript and the protein in rat testicular- and caudal residues in CDYL are represented in black boxes. (b) Molecular sperm confirms its presence on the sperm (Figure 1a–d). The testicular- dockingofCDYLchromodomainanda-tubulin. Snapshot of the docked complex of a-tubulin (grey) and CDYL chromo domain and caput sperm showed the expression of CDYL along the length of (red). The zoomed image shows the six residues of a-tubulin flagella whereas in case of caudal sperm the signal was observed pre- (labelled and represented as green sticks) interacting with four resi- dominantly in the principal piece of sperm the flagella (Figure 2a). The dues of CDYL chromo domain labelled in blue colour, represented increase in Ac a-tubulin observed in epididymal sperm as compared to as cyan sticks) through hydrogen bonds displayed as dotted lines testicular sperm was not emulated by similar changes in CDYL expres- [Color figure can be viewed at wileyonlinelibrary.com] sion of the respective sperm (Figure 2b). This can be explained by the decreased levels of HDAC6 in epididymal sperm vis-a-vis testicular sperm that we observed earlier (Parab et al., 2015). Co-localization of a-tubulin and neurological behaviour were not affected in these KO CDYL and Ac a-tubulin along the length of sperm flagella suggested mice, neither were any other ciliated organelles. However these mice that the two proteins may interact. Detection of CDYL in sperm axone- show increased microtubule stability (Kalebic, Sorrentino, et al., 2013). mal fraction indicates its strong association with flagellar microtubules Studies around the same time by Kim et al. (2013) have observed that (Figure 3). To further validate this possibility, we did sequence analysis a tat1 KO mice are viable, testicular function and fertility of these mice and structure alignment between CDYL and aTAT1 to determine if the is normal, but display a-tubulin acetylation deficiency and abnormal residues critical for aTAT1 and a-tubulin binding were present in dentate gyrus(Kim et al., 2013). The authors conclude that atat1 is not CDYL. We also did the molecular docking analysis of CDYL chromodo- required for normal development but may regulate more advanced main and a-tubulin. The sequence analysis and docking results sug- functions such as memory and learning. Although both these papers gested that CDYL chromo domain can potentially bind to a-tubulin agree that atat1 is the tubulin acetyltransferase, there is a controversy (Figure 4a,b). MST analysis used as a biophysical approach to validate

FIGURE 5 MST analysis of CDYL – tubulin interaction. (a) Binding of tubulin to fluorescently labelled CDYL was quantified using Microscale thermophoresis (MST). Sixteen dilutions of Tubulin protein ranging from 1.37 nM to 45 mM were titrated against a constant amount of labelled CDYL protein (10 nM). The Kd fit graph of CDYL-Tubulin interaction demonstrates a steady interaction between the two proteins with a Kd value of 318 6 165 nM. (b) Binding of BSA to fluorescently labelled CDYL was performed as a Negative control. Six- teen dilutions of BSA protein was similarly titrated against a constant amount of labelled CDYL protein (10 nM). The Kd fit graph of CDYL- BSA interaction indicates lack of interaction between the two proteins thus confirming specificity of the CDYL-tubulin interaction [Color figure can be viewed at wileyonlinelibrary.com] PARAB ET AL. | 7

FIGURE 6 CDYL mediated acetylation of soluble- and polymerized tubulin in vitro. Western blot analysis was performed to detect the temporal and concentration dependent changes in acetylation of soluble and polymerized tubulin on incubation without or with rec CDYL. (a and c) The upper panel shows the bands for Ac a-tubulin and a-tubulin for soluble- (a) and polymerized tubulin (c). The Lower panel shows graphical representation of the same. An instant increase in a-tubulin acetylation is seen and is consistent from 0 to 120 min on incubation with rec CDYL in case of soluble tubulin while a steady increase with time is noted for microtubules. (b and d) Upper panel shows the bands for Ac a-tubulin and a-tubulin in soluble tubulin (b) and microtubules (d) incubated with increasing concentrations of CDYL. Graphical representation of the same is shown in the lower panel which demonstrates an increase in a-tubulin acetylation with increasing CDYL concentrations. Values are mean 6 SEM of three independent experiments

CDYL-tubulin interaction demonstrates a significant interaction microtubules (Figure 6a–d). These evidences indicate that CDYL can between the two proteins with a Kd value of 318 6 165 nM (Figure 5). interact withand acetylate a-tubulin in vitro. Soluble tubulin appears to In vitro activity assay using recombinant CDYL as a probable TAT to be a much preferred substrate compared to polymerized tubulin. Inc- acetylate soluble and polymerized tubulin in presence of Ac CoA reased acetylation was also obvious in CDYL-overexpressing HEK293T showed an instant increase in a-tubulin acetylation of soluble tubulin cell lysate (Figure 7a,b). The CDYL isolated from sperm lysate demon- immediately on addition of 6 mM CDYL and this was maintained strates the ability to acetylate soluble tubulin as well as microtubules throughout the period of incubation. At the same concentration, micro- (Figure 7c) thus strongly substantiating its role as a TAT. It would be tubules demonstrated temporal increase in acetylation with similar interesting to determine whether CDYL acetylates a tubulin in vivo or intensities being achieved after 2.5–3 h incubation. CDYL when incu- if the levels of acetylated microtubules decrease upon a depletion or bated in incremental concentrations, revealed a concentration depend- loss of CDYL. However, performing in vivo experiments for CDYL in ent increase in a-tubulin acetylation of both soluble tubulin as well as sperm is a challenge because (a) ATAT1 is the major tubulin 8 | PARAB ET AL.

FIGURE 7 a-tubulin acetylation in CDYL overexpressing HEK293T cells and in rat sperm. Western blot analysis was performed to examine the levels of Ac a-tubulin in HEK293T cells overexpressing CDYL. (a) The upper panel shows CDYL overexpression in HEK293T Cells as determined using an anti FLAG antibody. The centre and lower panel shows the bands for Ac a-tubulin and a-tubulin at 55 kDa in CDYL overexpressed-and mock transfected cell lysates, respectively. -ve: Negative controls (‘no primary control’ for FLAG, Ac a-tubulin and a-tubulin). (b) Graphical representation of Ac a-tubulin normalized to a-tubulin in CDYL overexpressed cell lysate and the mock lysate demonstrates a significant increase in CDYL overexpressed cell lysate as compared to mock lysate; Statistical significance was determined using t-test with significance level set at p .05. ** indicate significance of p .01. Values are mean 6 SEM of three independent experiments. (c) CDYL IP assay to determine ability of sperm CDYL to acetylate soluble and polymerized tubulin. CDYL immunoprecipitation was performed to pull down CDYL protein from sperm using anti CDYL antibody (postimmune sera). IgG (Preimmune sera) was used as isotype control for the IP reaction. This was used to check the ability of the bound CDYL to acetylate a-tubulin on tubulin dimers and purified microtubules. On western blot analysis, band for Ac a-tubulin is seen only with CDYL immunoprecipitates and not with IgG immunoprecipitates in case of both soluble and polymerized tubulin. a-tubulin used as the loading control for the assay shows equal intensities in the respective CDYL and IgG control lanes of soluble tubulin and purified microtubules acetyltransferase, and, (b) there are no inhibitors for CDYL and ATAT1. acetyl transferase. This role of CDYL may not be exclusive to sperm or Potash (2006) in his thesis demonstrated that mice lacking Cdyl pro- rather it may be seen in other cell types as is evident from our observa- duce spermatozoa with misshapen heads and show significant germ tions with rec CDYL and CDYL overexpressing HEK cells. cell death which in turn affects spermatogonia, spermatocytes and In conclusion, this study demonstrates a novel functional avenue spermatid number. Potash did not investigate the effect of CDYL KO for CDYL—that as a putative tubulin acetyl transferase. However, fur- on tubulin acetylation although. With these evidences from literature, ther in depth studies would be required to understand the physiological the possibility of being able to study sperm from CDYL null mice is context of this interaction between CDYL and a-tubulin, the players meagre. involved and its implications to sperm function. ATAT1 is undoubtedly a major a-tubulin acetyltransferase as the lack of detectable K40 a-tubulin acetylation in aTAT1 knockout mice 4 | MATERIALS AND METHODS suggest that other candidates for tubulin acetyltransferase activity are notabletorescuedeficiencyofaTAT1, and therefore probably do not 4.1 | Animal ethics approval acetylate a-tubulin directly in vivo (Kalebic, Sorrentino, et al., 2013). But then the status of HDAC6 or CDYL in the aTAT1 KO mice is not Adult male Holtzman rats of 2.5 to 3-month old were used. Food and known. Nor do we know the status of a-tubulin acetylation in CDYL water was provided ad libitum. Rats were housed in groups of four/ KO mice. This however does not undermine our observations which cage under conditions of 12 h light and 12 h dark. Two adult Belgium clearly demonstrate the ability of CDYL which moonlights as a tubulin White female rabbits were used for raising polyclonal antibodies to PARAB ET AL. | 9

CDYL. All animal care practices and experimental procedures complied 4.4 | Immunohistochemistry with the guidelines of the Care and Prevention Society against Cruelty Five micron sections of Bouins fixed and paraffin embedded testis of Experimental Animals (CPCSEA) and were approved by the Institu- (transverse sections) and epididymis (sagittal sections to cover the tional Animal Ethics Committee (IAEC) of National Institute for caput, corpus and cauda) were used to study the expression of CDYL Research in Reproductive Health. protein in the respective tissues. The sections were deparaffinized, rehydrated and the endogenous peroxidase activity was quenched with

4.2 | Chemicals and reagents 0.3% H2O2 in 70% methanol for 30 min at RT followed by 3 washes with 0.1 M Phosphate Buffered Saline (PBS; pH 7.4). Heat induced anti- Freund’s Complete Adjuvant(Sigma-Aldrich), Freund’s Incomplete Adju- gen retrieval of the sections was done in10 mM sodium citrate buffer, vant (Sigma-Aldrich), Swine anti-rabbit IgG, Rabbit anti-mouse antibody pH 6.0, followed by three washes in 0.1 M PBS. Non-specific sites (Dako, Denmark), TMB/H2O2 (Bangalore Genei, India), VECTASTAIN were blocked by incubating the sections in 0.1 M PBS containing 3% ABC System (Vector Laboratories), Ac a-tubulin antibody, a-tubulin normal goat serum for 30 min. The sections were then incubated with antibody (Sigma-Aldrich, ECL plus Western blotting detection kit (GE 1:100 dilution of either the CDYL antibody or the pre-immune serum healthcare, UK), Rodamine labelled Goat anti Mouse (Invitrogen, Carls- which served as the negative control to account for non-specific bind- bad, CA), Tubulin protein (bovine brain; Cytoskeleton Inc, CO), microtu- ing of the antibody. Following overnight incubations at 4 8C, sections bules (bovine brain; Cytoskeleton Inc, CO), Acetyl coenzymeA (Sigma- were washed thrice and incubated with 1:50 diluted biotinylated goat Aldrich), Human CDYL plasmid pDP1662 (ATCC® 99634TM), Human anti rabbit antibody and the signal was developed using the VECTAS- CDYL overexpression lysate (OriGene Technologies, Inc, MD), Anti- TAIN ABC System (Vector Laboratories) as per the manufacturer’spro- FLAG antibody (Sigma-Aldrich), Protein G sepharose beads (GE health- tocol. Sections were counterstained with haematoxylin. care, UK). 4.5 | Isolation of rat testicular- and epididymal- sperm 4.3 | Raising antibody to CDYL Testicular-, caput- and caudal-sperm were isolated from the respective Polyclonal antibodies were raised in rabbit to the chimeric peptide tissues by making 2–3 incisions and allowing the release of sperm by comprising of a B-cell epitope and a T-cell epitope of CDYL designed incubating the teased tissue in 0.1 M PBS at 34 8C for 30 min. The using EMBOSS:Antigenic software (Rice, Longden, & Bleasby, 2000). supernatant was collected and washed thrice with 0.1 M PBS by cen- Towards this, after collecting the pre-immune sera, rabbits were immu- trifugation at 800 3 g for 20 min at 4 8C. The sperm pellet thus nized with 200 lg of the peptide in 1 ml of Freund’s Complete Adju- obtained was used for all the analyses performed in this study. Where vant (Sigma-Aldrich) followed by three booster doses each of 100 lg testicular sperm were used for Western blot analysis or RT-PCR, they of the peptide in Freund’s Incomplete Adjuvant (Sigma-Aldrich) at 10 were first purified from the other testicular cell types by Percoll gradi- days interval. The final bleed was collected at the end of immunization ent centrifugation (Parab et al., 2015). However, testicular sperm were period. Antibody titres for the sera collected after every booster were not Percoll purified whenever they were used for immunofluorescence monitored by Indirect ELISA by titrating serial dilutions of the pre- and localization studies. post-immune sera against 1 lg of the chimeric peptide coated onto the microtitre plate. The binding was detected using HRP conjugated 4.6 | Reverse transcription-PCR

Swine anti-rabbit IgG (Dako, Denmark) and TMB/H2O2 (Bangalore The presence of CDYL transcript in testicular- and caudal- sperm was Genei, India) as substrate. Absorbance was determined at 450 nm. The determined by Reverse Transcription (RT)-PCR. Sperm from the testis antibody titers as determined by ELISA were 1:500. Specificity of the and caudal region of epididymis were isolated and pelleted as described antibody was determined by competitive ELISA by preincubating the above. RNA extraction was carried using guanidinium thiocyanate- l antisera (1:500) with 0, 1, 2, 4, 8 and 10 g of peptide or unrelated chloroform extraction. The purity and concentration of the RNA was peptide and then using the preincubated mixtures to probe the peptide determined spectrophotometrically at 260 and 280 nm. One lgofthe immobilized on to microtitre plates. Preimmune sera preincubated with respective RNA was reverse transcribed to cDNA and 250 ng of this peptide served as a control (Supporting Information S1 A and B). West- cDNA was amplified by PCR using two sets of forward and reverse pri- ern blot analysis was performed using the preabsorbed antibody to mers; one for the full length CDYL (AGCAGGTGGCGATCAGAG and confirm the specificity of the antipeptide antibody. Caudal sperm pro- TGTCCTGCTCAGCCTGCC, respectively) and the other being the inter- teins resolved by 10% SDS polyacrylamide gel electrophoresis (SDS- nal set (GTCATCTGTGAGGCGTCGTA and TGTCGTCAGGAAGCAA PAGE) and transblotted onto nitrocellulose membrane were probed GATG) of primers. AGAGGGAAATCGTGCGTGAC and GCCGGACTCA with either the antipeptide (CDYL) antibody (1:500), or with a 1:500 TCGTACTCCT were the forward and reverse primers used for b-actin dilution of the antipeptide antibody pre-absorbed with 10 lgblocking (housekeeping gene). The reactions were set for denaturation at 94 8C peptide. Blots probed with 1:500 diluted pre-immune sera served as for 1 min, annealing temperature of 64 8CforCDYLand628Cfor negative control. Beta-actin was used as a loading control (Supporting b-actin for 1 min followed by extension at 72 8Cfor1min.Finalexten- Information C). sion was at 72 8C for 10 min. ‘Reagent’ control as well as ‘No Reverse 10 | PARAB ET AL.

Transcriptase’ controls were incorporated to account for any contami- also determined and cut-mask images showing only the co-localized nation from reagents used, or, genomic DNA, respectively. regions were obtained. The experiment was performed in duplicates and the significance of the differences in the signal intensities and 4.7 | Western blot analysis overlap coefficient between testicular-, caput- and caudal epididymal sperm was determined by one-way analysis of variance (ANOVA) with CDYL protein expression in sperm derived from the testis and caudal Bonferroni’s post-test correction. The level of significance was set at region of the epididymis was studied by Western blot Analysis. Rat tes- p .05. Analyses were performed using Graphpad Prism software ticular- and caudal- sperm pellets were lysed in 15 mM Tris-HCl buffer, (Version 5.0). pH 7.4, containing 0.34 M sucrose, 60 mM KCl, 15 mM NaCl, 0.65 mM spermidine, 2 mM EDTA, 0.5 mM EGTA, 0.05% Triton X- 4.9 | Axoneme extraction 100, 1 mM dithiothreitol, 0.5 mM PMSF as described previously (Parab et al., 2015; Seidel et al., 2012). The protein concentration was deter- Rat Caudal sperm were isolated as per the protocol mentioned previ- mined using Bradford’s method (Bradford, 1976). Total proteins of 40 ously. The sperm flagella were isolated following a published protocol lg were loaded for CDYL analysis and 10lgfora- and Ac a-tubulin. (Suryawanshi, Khan, Gajbhiye, Gurav, & Khole, 2011) and further proc- Protein lysates were resolved by electrophoresis on 10% SDS- essed for axoneme extraction. The sperm flagellar pellet was subjected polyacrylamide gels using the standard protocol (Laemmli, 1970) and to 1% Triton X-100 treatment to solubilize the membrane and enrich transblotted to nitrocellulose membranes in duplicates. These blots the axoneme fraction as per the protocol described (Yenjerla, Lopus, & were further incubated with blocking buffer (0.1 M PBS containing 5% Wilson, 2010). Briefly, following Triton X-100 treatment, sperm flagella NFDM) at R.T. for 1 h. One blot was probed with either the polyclonal were centrifuged at 1,500 3 g for 10 min and the supernatant was col- antibody to CDYL (1:500) or monoclonal antibodies to Ac a-tubulin lected which was further subjected to ultracentrifugation at 47,800 3 (Sigma-Aldrich; 1:10,000) or a-tubulin (Sigma-Aldrich; 1:10,000), g for 20 min to pellet out the axonemal proteins. The axonemal pro- respectively, at R.T. for 1 h. The corresponding other blot was used as teins were reconstituted in PME buffer containing 87 mM PIPES, negative control which was incubated with only the antibody diluent 36 mM MES, 1.4 mM MgCl2, 1 mM EGTA, pH 6.8. Rat caudal for Ac a-tubulin and a-tubulin, and preimmune-sera in the case of sperm and axonemal protein lysates were resolved on10% SDS- CDYL antibody. These were incorporated to account for any non- polyacrylamide gels using the standard protocol (Laemmli, 1970) and specific binding. The blots were washed thrice with 0.1 M PBS contain- transblotted to nitrocellulose membranes. The blots were probed with a ing 0.1% Tween 20 (0.1% PBST) and incubated with 1 in 3,000 dilution antibodies to CDYL and -tubulin as mentioned previously. of HRP labelled -swine anti-rabbit antibody for CDYL and -rabbit anti- mouse antibody (Dako, Denmark) in case of Ac a-anda-tubulin fol- 4.10 | In silico analysis of a putative CDYL lowed by 3 washes with 0.1% PBST. Chemiluminescent based detec- and a–tubulin interaction tion of the proteins of interest was done using ECL plus Western 4.10.1 | sequence and structure alignment of CDYL blotting detection kit (GE healthcare, UK). chromo domain with atat1 The PDB database was used to retrieve structures of CDYL chromo 4.8 | Indirect immunofluorescence domain (PDB ID: 2DNT) and aTAT1 (PDB ID: 4GS4). aTAT1 is a To study the distribution of CDYL and status of its localization with known tubulin acetyl transferase(Akella et al., 2010; Friedmann et al., respect to Ac a-tubulin in rat testicular-, caput- and caudal epididymal 2012; Kalebic, Sorrentino, et al., 2013). These two protein structures sperm, the sperm were isolated from respective tissues as described were aligned using Align and Superimpose Proteins protocol of earlier and fixed with chilled 95% ethanol and permeabilized using Accelrys Discovery studio 3.5 (Acc. DS 3.5). 0.1% Triton X-100 and probed with 1:100 diluted Rabbit polyclonal anti-rat CDYL antibody and 1:100 dilution of monoclonal Ac a-tubulin 4.11 | Molecular docking antibody (Sigma-Aldrich). The secondary antibodies FITC conjugated The structural co-ordinates of a-tubulin (PDB ID: 4I4T) were used for Swine anti-rabbit (Dako, Denmark) and Rodamine labelled goat anti- docking with CDYL chromo domain (PDB ID: 2DNT) using ZDOCK mouse (Invitrogen, Carlsbad, CA), respectively were used at 1:100 dilu- algorithm (Acc. DS 3.5). The water molecules and hetero atoms were tion. DAPI (Sigma-Aldrich) was used to stain the sperm nuclei. Co- removed. As the 35–45 residue stretch of a-tubulin is known to be localization was studied using the LSM 510 Meta Confocal microscope. critical for binding to a-TAT(Friedmann et al., 2012), docking was Z stack images were obtained to construct three-dimensional (3D) restricted to this region. The poses were refined using the RDOCK pro- images which were analysed using LSM 510 Meta software. Average tocol. The best pose was selected based on the RDOCK energy. signal intensities of CDYL and Ac a-tubulin and their overlap coefficient was determined and analysed as described by us earlier (Parab 4.12 | MST binding assay et al., 2015). Briefly, average signal intensities of CDYL and Ac a-tubulin expression along the length of the sperm flagella were measured for MST binding assay was performed using NanoTemper Monolith Instru- 10 sperm per group. The overlap coefficient for the two proteins was ment (NT.115)(Jerabek-Willemsen, Wienken, Braun, Baaske, & Duhr, PARAB ET AL. | 11

2011). Human CDYL plasmid pDP1662 (ATCC® 99634TM)clonedina 4.14 | Effect of CDYL overexpression on a-tubulin prokaryotic expression vector was procured. Recombinant CDYL pro- acetylation tein was expressed, extracted and purified from Escherichia coli strain Ac a-tubulin was studied in cells overexpressing CDYL. Towards this, BL21(DE3) as per the protocol described by (Lahn et al., 2002). transient overexpression lysate of FLAG-tagged chromodomain pro- Recombinant CDYL protein was first labelled with NT-647 dye using tein, Y-like (CDYL), transcript variant 2 in Human HEK293T cell line the vendor’s protocol. Sixteen dilutions of Tubulin protein (Cytoskele- was obtained (OriGene Technologies, Inc, MD). Acetylated a-tubulin ton Inc, CO) ranging from 1.37 nM to 45 mM were titrated against a m constant amount of labelled CDYL protein (10 nM) in 200 mM Tris (pH was determined in these cells by resolving 20 goftheCDYLoverex- 7.4) buffer containing 200 mM NaCl, 2 mM DTT and 0.05% Tween-20. pressed lysate and the empty vector control (mock) lysate on 10% BSA concentrations of 1.37 nM–45 mM were also similarly titrated SDS-polyacrylamide gels followed by Western blot analysis for Ac a a against labelled CDYL. The samples were then loaded into MST Pre- -tubulin and -tubulin as per the protocol mentioned above. The sig- a a mium coated glass capillaries and analysis was performed using 40% nal intensities of Ac -tubulin were normalized to that of -tubulin to determine the precise extent of a-tubulin acetylation. The blots were LED power and 60% MST. Kd values were calculated using Nano Tem- per software. also probed with1:1,000 diluted anti-FLAG antibody (Sigma-Aldrich) to confirm the overexpression of CDYL protein in these cells. 4.13 | In vitro tubulin acetyltransferase activity assay 4.15 | CDYL immunoprecipitation assay Human CDYL plasmid pDP1662 (ATCC® 99634TM) cloned in a prokaryotic expression vector was procured. Recombinant CDYL protein The ability of sperm CDYL to acetylate tubulin was determined by was expressed, extracted and purified from Escherichia coli strain BL21 immunoprecipitating CDYL from sperm lysates and studying the ability (DE3) as per the protocol described by (Lahn et al., 2002). The purified of the immunoprecipitates to acetylate soluble tubulin and microtu- recombinant CDYL protein was tested for its tubulin acetyltransferase bules in presence of Ac CoA. Briefly, rat caudal sperm protein lysate activity using tubulin dimers (soluble tubulin) and purified microtubules was prepared as described earlier. Sperm lysate of 200 mg was incu- (polymerized tubulin) as the substrate. The in vitro tubulin acetyltrans- bated with 50 mg of eitherCDYL antibody (postimmune sera) or its iso- ferase activity was determined by analysing the Ac a-tubulin expres- type control (preimmune sera) at 4 8Cfor4h.50mlofProteinGbeads sion with respect to time or enzyme concentration. The assay was (GE healthcare, UK) were added to each tube and were further incu- performed in 50 mM Tris-HCL buffer containing 10 mM glycerol, bated at 4 8C for 2 h. The protein G bound antigen-antibody complex 0.1 mM EDTA and 1 mM DTT (Akella et al., 2010) in 25 mlofreaction was separated by centrifugation at 12,000 3 g for 5 min and then volume that included 0.25 mlof180mM soluble tubulin or 2.5 mlof18 washed thrice in 50 mM TrisHCl buffer, pH 7.4 containing 150 mM mM purified microtubules (Cytoskeleton Inc, CO), 0.25 ml of 1 mM ace- NaCl, 0.5% Nonidet P40, 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, tyl coenzyme A (Ac CoA; Sigma-Aldrich) and 10 mlof6mM recombi- 0.2 mM PMSF and 0.2 mM sodium orthovanadate (NP40 lysis buffer) nant CDYL. The reactions were incubated at R.T. for 0, 30, 60, 90 and followed by a last wash with TAT assay buffer. The complex was incu- 120 min for tubulin dimers and for 0, 30, 60, 90, 120, 150, 180, 210 bated with 1 mg of either soluble tubulin or microtubules in presence of and 240 min in case of microtubules. Similar incubations but without Ac CoA at R.T. for 1 h. The tubes were then centrifuged at 12,000 3 g CDYL served as respective controls. In vitro assay was also performed for 5 min. The supernatants containing the soluble tubulin or microtu- with increasing CDYL concentrations in which 0.25 ml of soluble tubu- bules were resolved on 10% SDS polyacrylamide gels followed by lin or 2.5 ml of purified microtubules or, were incubated with 0.25 mlof Western blot analysis for Ac a-tubulin and a-tubulin as per the proto- Ac CoA and 0, 0.18, 0.37, 0.75, 1.5, 3. and 6 mMrecombinantCDYL col mentioned above. for soluble tubulin and 0, 1.5, 23, 6, 9 and 12 mM for microtubules in a reaction volume of 25 ml at R.T. for 60 min. In case of soluble tubulin, 4.16 | Statistical analysis the reactions were incubated for 5 min. In either case, the reactions All the experiments were performed 3 times and the significance of were stopped by addition of Laemilli buffer followed by heating at the differences between the groups was determined by one way analy- 95 8C for 5 min. The proteins were resolved by electrophoresis on 10% sis of variance (ANOVA) with Bonferroni’s post-test correction. The SDS-polyacrylamide gels and transblotted to nitrocellulose membranes. level of significance was set at p .05. Analyses were performed using The blots were probed with Ac a-tubulin antibody (Sigma-Aldrich) Graphpad Prism software (Version 5.0). using the protocol mentioned above. Same blots were stripped using 0.2 M glycine, 1% SDS and 0.05% Tween 20, pH 2.5 at 80 8Cfor20 min and reprobed with a-tubulin antibody. The band intensities for Ac ACKNOWLEDGMENTS a-tubulin were normalized to their respective intensities of a-tubulin. The authors acknowledge with gratitude the assistance of Ms G. The normalized intensities of 0 h (time as variable) and no enzyme con- Bhonde in peptide designing for antibody generation, Mr. D. Gaik- trol (enzyme concentration as the variable) were subtracted from the wad for his help in animal handling, R. Padwal for her help with respective set of readings in case of microtubules but not for soluble generation of recombinant CDYL protein, Ms R. Gaonkar for her tubulin. assistance with Confocal microscopy. The assistance of Mr P. 12 | PARAB ET AL.

Salunkhe, and Mr M. Ghosalkar in Histological tissue processing and Laemmli, U. K. (1970). Cleavage of structural proteins during the assem- sectioning is gratefully acknowledged. We thank Mr Vaibhav Shinde bly of the head of bacteriophage T4. Nature, 227, 680–685. for his assistance with the layout of the figures. We acknowledge Lahn, B. T., & Page, D. C. (1999). Retroposition of autosomal mRNA yielded testis-specific gene family on human Y chromosome. Nature Dr Sivaramaiah Nallapeta, Dr Amit Gupta and Saji Menon from Genetics, 21, 429–433. NanoTemper Technologies, India, for their assistance with Micro- Lahn, B. T., Tang, Z. L., Zhou, J., Barndt, R. J., Parvinen, M., Allis, C. D., & Page, scale Thermophoresis analysis. This work was supported by grants D. C. (2002). Previously uncharacterized histone acetyltransferases impli- from the Department of Science and Technology (D.O. No. SR/SO/ cated in mammalian spermatogenesis. Proceedings of the National Acad- HS/112/2007), India and the Indian Council of Medical Research. emy of Sciences of the United States of America, 99, 8707–8712. Senior Research (NIRRH - RA/390/06-2016) Fellowship provided to Maruta, H., Greer, K., & Rosenbaum, J. L. (1986). The acetylation of Sweta Parab by Indian Council of Medical Research and JRF and alpha-tubulin and its relationship to the assembly and disassembly of – SRF by DST, India is gratefully acknowledged. microtubules. The Journal of Cell Biology, 103, 571 579. Ohkawa, N., Sugisaki, S., Tokunaga, E., Fujitani, K., Hayasaka, T., Setou, M., & Inokuchi, K. (2008). N-acetyltransferase ARD1-NAT1 regulates REFERENCES neuronal dendritic development. Genes to Cells: Devoted to Molecular Akella, J. S., Wloga, D., Kim, J., Starostina, N. G., Lyons-Abbott, S., & Cellular Mechanisms, 13, 1171–1183. Morrissette, N. S., ... Gaertig, J. (2010). MEC-17 is an alpha-tubulin Parab, S., Shetty, O., Gaonkar, R., Balasinor, N., Khole, V., & Parte, P. acetyltransferase. Nature, 467, 218–222. (2015). HDAC6 deacetylates alpha tubulin in sperm and modulates Bradford, M. M. (1976). A rapid and sensitive method for the quantita- sperm motility in Holtzman rat. Cell and Tissue Research, 359, 665–678. tion of microgram quantities of protein utilizing the principle of Piperno, G., LeDizet, M., & Chang, X. J. (1987). Microtubules containing – protein-dye binding. Analytical Biochemistry, 72, 248 254. acetylated alpha-tubulin in mammalian cells in culture. The Journal of Creppe, C., Malinouskaya, L., Volvert, M. L., Gillard, M., Close, P., Cell Biology, 104, 289–302. ... Malaise, O., Nguyen, L. (2009). Elongator controls the migration Potash, J. (2006). The role of Cdyl and CDY in mammalian spermatogenesis and differentiation of cortical neurons through acetylation of alpha- (PhD thesis). Massachusetts Institute of Technology. http://hdl.han- – tubulin. Cell, 136, 551 564. dle.net/1721.1/34579. Ferlin, A., Moro, E., Rossi, A., & Foresta, C. (2001). CDY1 analysis in Rice, P., Longden, I., & Bleasby, A. (2000). EMBOSS: The European infertile patients with DAZ deletions. Journal of Endocrinological Inves- Molecular Biology Open Software Suite. Trends in Genetics: TIG, 16, – tigation, 24, RC4 RC6. 276–277. Friedmann, D. R., Aguilar, A., Fan, J., Nachury, M. V., & Marmorstein, R. Seidel, S. A., Wienken, C. J., Geissler, S., Jerabek-Willemsen, M., Duhr, S., (2012). Structure of the alpha-tubulin acetyltransferase, alphaTAT1, Reiter, A., ... Baaske, P. (2012). Label-free microscale thermophoresis and implications for tubulin-specific acetylation. Proceedings of the discriminates sites and affinity of protein-ligand binding. Angewandte National Academy of Sciences of the United States of America, 109, Chemie International Edition in English, 51, 10656–10659. 19655–19660. Shen, Q., Zheng, X., McNutt, M. A., Guang, L., Sun, Y., Wang, J., ... Hubbert, C., Guardiola, A., Shao, R., Kawaguchi, Y., Ito, A., Nixon, A., ... Zhang, B. (2009). NAT10, a nucleolar protein, localizes to the mid- Yao, T. P. (2002). HDAC6 is a microtubule-associated deacetylase. body and regulates cytokinesis and acetylation of microtubules. Nature, 417, 455–458. Experimental Cell Research, 315, 1653–1667. Jerabek-Willemsen, M., Wienken, C. J., Braun, D., Baaske, P., & Duhr, S. Suryawanshi, A. R., Khan, S. A., Gajbhiye, R. K., Gurav, M. Y., & Khole, V. (2011). Molecular interaction studies using microscale thermophore- V. (2011). Differential proteomics leads to identification of domain- sis. Assay and Drug Development Technologies, 9, 342–353. specific epididymal sperm proteins. Journal of Andrology, 32, 240– Kalebic, N., Martinez, C., Perlas, E., Hublitz, P., Bilbao-Cortes, D., Fiedorczuk, 259. K., ... Heppenstall, P. A. (2013). Tubulin acetyltransferase alphaTAT1 Yenjerla, M., Lopus, M., & Wilson, L. (2010). Analysis of dynamic instabil- destabilizes microtubules independently of its acetylation activity. ity of steady-state microtubules in vitro by video-enhanced differen- Molecular and Cellular Biology, 33,1114–1123. tial interference contrast microscopy with an appendix by Emin Kalebic, N., Sorrentino, S., Perlas, E., Bolasco, G., Martinez, C., & Hep- Oroudjev. Methods in Cell Biology, 95, 189–206. penstall, P. A. (2013). alphaTAT1 is the major alpha-tubulin acetyltransferase in mice. Nature Communications, 4, 1962. Kim, G. W., Li, L., Gorbani, M., You, L., & Yang, X. J. (2013). Mice lacking SUPPORTING INFORMATION alpha-tubulin acetyltransferase 1 are viable but display alpha-tubulin Additional Supporting Information may be found in the online ver- acetylation deficiency and dentate gyrus distortion. The Journal of Biological Chemistry, 288, 20334–20350. sion of this article. Kleiman, S. E., Yogev, L., Hauser, R., Botchan, A., Bar-Shira Maymon, B., Schreiber, L., ... Yavetz, H. (2003). Members of the CDY family have different expression patterns: CDY1 transcripts have the best correla- How to cite this article: Parab S, Dalvi V, Mylavaram S, et al. tion with complete spermatogenesis. Human Genetics, 113, 486–492. Tubulin acetylation: A novel functional avenue for CDYL in Kuroda-Kawaguchi, T., Skaletsky, H., Brown, L. G., Minx, P. J., Cordum, sperm. Cytoskeleton. 2017;00:1–12. https://doi.org/10.1002/cm. H. S., Waterston, R. H., ... Page, D. C. (2001). The AZFc region of the Y chromosome features massive palindromes and uniform recur- 21381 rent deletions in infertile men. Nature Genetics, 29, 279–286. 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具