The Role of DEPTOR in Intrauterine Growth Restriction
A THESIS SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAI’I AT MĀNOA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
IN
Developmental and Reproductive Biology
May 2021
by
Lance Gregory Nunes
Thesis Committee:
Johann Urschitz, Chairperson Peter Hoffmann Jesse Owens
Keywords: Placenta, DEPTOR, mTOR, sonoporation, Acknowledgements
I would like to take the opportunity to thank the many people who have helped me along the way and made this thesis research come to fruition.
I would like to express my deepest appreciation to my thesis committee chairperson, mentor, and friend, Dr. Johann Urschitz, for his thoughtful insight, guidance, patience, and support throughout this Master’s degree. Words can’t express how thankful I am for everything you have helped me with over the last four and a half years. Thank you to my thesis committee members, Dr. Peter Hoffmann and Dr. Jesse Owens, for their time, patience, expertise, and support throughout this research. Both of you have helped me in too many ways to detail here, but please know that I am very grateful for it all.
Thank you to all of my colleagues and classmates at the Mānoa Institute of Biogenesis
Research and at the John A. Burns School of Medicine, who have provided their kindest assistance when I needed it most. To my past and current lab mates, thank you for all the great memories and invaluable support in many aspects of this thesis research.
I would like to acknowledge my family – my mom, dad, and sister – whose continued love and support in countless ways have made all my life accomplishments a possibility. I cannot thank you three enough for everything you do and continue to do for me.
Last, but most certainly not least, I would like to thank my loving fiancée, Sara, who has been there for me through it all. Your unending love and support continues to help push me to be the best version of myself and for that I am eternally thankful.
2 Abstract
Maternal obesity or insufficient nutrient supply during pregnancy can result in fetal overgrowth and fetal growth restriction, respectively, and cause serious health problems for both the mother and the fetus. Dysregulated placental nutrient transport is believed to be a mediator for both conditions. The mammalian target of rapamycin (mTOR) is thought to be the nutrient sensor of the placenta. mTOR is comprised of two complexes, mTORC1 and mTORC2. Both mTORC1 and mTORC2 have downstream targets that regulate cell growth, proliferation, ion transport, cytoskeletal remodeling, and more. Intrauterine Growth Restriction (IUGR) is associated with decreased nutrient transport and restricted nutrient availability for the fetus. It has been shown that mTOR is downregulated in placentas of pregnancies complicated by IUGR. The DEP-domain containing mTOR interacting protein (DEPTOR) has recently been shown to be an endogenous inhibitor of mTOR. We hypothesized that placenta-specific DEPTOR knockdown (KD) results in restoration of mTOTRC1/2 signaling, normalizing placental amino acid transport capacity and preventing IUGR. In the first part of this thesis, we generated a transgenic mouse model that expressed a placenta-specific DEPTOR KD cassette to study the in vivo effects of placental
DEPTOR KD. Results showed that trophoblastic DEPTOR inhibition leads to increased expression of mTORC1/2 signaling, increased activity of the two main placental amino acid transport systems, and a marked increase in birth weight. In the second part of this thesis, we aimed to optimize parameters for placental sonoporation, a minimally invasive in vivo gene delivery technique that utilizes ultrasound and DNA conjugated lipid microbubbles. We observed successful placental transgene expression after sonoporation following intravenous injection of
DNA conjugated lipid microbubbles. Taken together, this thesis has elucidated the role of
3 placental DEPTOR in the regulation of mTORC1/2 signaling and fetal nutrient transport, providing insight into the molecular mechanisms that govern fetal growth and, ultimately, health.
Furthermore, the successful sonoporation trials illustrate the possibility for this technique to be used as an alternative to transgenics for studying in vivo gene modulation, as well as a potential adaptable technique for the treatment of complications due to placental dysregulation.
4 Table of Contents
CHAPTER 1 – LITERATURE REVIEW ...... 9
1.1 MATERNAL NUTRITION AND FETAL PROGRAMMING ...... 9 1.2 THE PLACENTA - STRUCTURE ...... 10 1.3 THE PLACENTA - FUNCTION ...... 12 1.4 COMPARISON OF HUMAN AND MOUSE PLACENTA ...... 15 1.5 INTRAUTERINE GROWTH RESTRICTION ...... 17 1.6 MECHANISTIC TARGET OF RAPAMYCIN (MTOR) IN INTRAUTERINE GROWTH RESTRICTION ...... 19 1.7 MTOR AND THE DEP-DOMAIN CONTAINING MTOR INTERACTING PROTEIN (DEPTOR) ...... 21 CHAPTER 2 IN VIVO PLACENTAL DEPTOR KD – TRANSGENIC MOUSE MODEL ...... 22
2.1 INTRODUCTION ...... 22 2.2 BACKGROUND INFORMATION ...... 23 2.2.1 Transgenesis and Transposases ...... 23 2.2.2 RNA Interference ...... 26 2.2.3 Plasmid Cloning ...... 28 2.3 METHODS ...... 31 2.3.1 Construction of plasmid DNA ...... 31 2.3.2 Animals ...... 32 2.3.3 Oocyte Collection ...... 32 2.3.4 Sperm Collection ...... 33 2.3.5 Transposase-Enhanced Pronuclear Injection ...... 33 2.3.6 Embryo culture and embryo transfer ...... 34 2.3.7 Genotyping ...... 34 2.3.8 Germline Transgenic Assay ...... 34 2.3.9 Transgene copy number assays ...... 35 2.3.10 Breeding ...... 35 2.3.11 Fetus and Placenta Collection ...... 36 2.3.12 Trophoblast Plasma Membrane (TPM) Isolation ...... 36 2.3.13 Western Blot mTOR signaling ...... 37 2.3.14 Amino Acid System Transporter Uptake Assay ...... 37 2.4 RESULTS ...... 39 2.4.1 Clone Validation in Cells ...... 39 2.4.2 Detection of Transgene in Founding Transgenic Mice ...... 40 2.4.3 Validation of Germline Transgenesis in DEPTOR KD Mouse Line ...... 40 2.4.3 Generation of Mice for Experimental Analysis ...... 42 2.4.4 Evaluation of Fetal and Placental Weight ...... 42 2.4.5 Validation of DEPTOR KD in Transgenic Mouse Line ...... 43 2.4.6 Evaluation of the Effect of DEPTOR Knockdown on mTOR signaling in the TPM ...... 44 2.4.7 Evaluation of the Effect of DEPTOR Knockdown on Nutrient Transporters in TPM .... 46 CHAPTER 3 – PLACENTAL GENE DELIVERY - SONOPORATION ...... 49
5 3.3.1 INTRODUCTION ...... 49 3.2 BACKGROUND INFORMATION ...... 50 3.2.2 Ultrasound Gene Delivery - Sonoporation ...... 50 3.2.3 Ultrasound Transducers ...... 52 3.2.4 Microbubbles and Cavitation ...... 55 3.2.5 Bioeffects of Ultrasound ...... 58 3.2.6 Properties and Parameters of Ultrasound Waves ...... 60 3.3 MATERIALS AND METHODS ...... 64 3.3.1 Transducer Characterization ...... 64 3.3.2 Microbubble Preparation ...... 67 3.3.3 Mouse Preparation ...... 67 3.3.4 Ultrasound Equipment Setup ...... 68 3.3.5 Intravenous Administration of Microbubbles ...... 68 3.3.6 Heart Injection ...... 69 3.3.7 Retroorbital Injection ...... 69 3.3.8 Sonoporation ...... 70 3.3.9 Bioluminescence Verification of Sonoporation ...... 70 3.3.10 Placenta and Fetus Collection ...... 70 3.2.11 DNA Extraction from Sonoporation Treated Placentas ...... 71 3.2.12 Quantitative Polymerase Chain Reaction for Plasmid Detection ...... 71 3.4 RESULTS ...... 72 3.4.1 Sonoporation Equipment Validation in Liver ...... 72 3.4.2 Sonoporation in Placentas ...... 73 3.4.3 Success Rate of Placental Sonoporation ...... 75 3.4.4 Parameters for Placental Sonoporation ...... 75 CHAPTER 4 - DISCUSSION ...... 77 CHAPTER 5 – CONCLUSION ...... 88 REFERENCES ...... 89
6 List of Figures
Figure 1.1 Blastocyst Implantation in Humans…………………………………………………………………….…….10 Figure 1.2 The Human Placenta…………………………………………………………………………………….………….11 Figure 1.3 Nutrient Transporters of the Syncytium……………………………………………………….….………13 Figure 1.4 Comparison of Mouse and Human Placentas……………………………………………….………….16 Figure 1.5 Maternal and Environmental Factors in Intrauterine Growth Restriction……..………….18 Figure 1.6 mTOR signaling pathway.………………………….………………………….……………………….…….…..20 Figure 2.1 Class I and Class II Transposases. ………………………….………………………….…………….…….…24 Figure 2.2 RNA Interference.………………………….………………………….…………………………………….……….27 Figure 2.3 DEPTOR Knockdown Plasmid.………………………….……………………………………………….…..….30 Figure 2.4 DEPTOR Knockdown Clone Validation………………………….…………………………….…….………39 Figure 2.5 Transgenic Mouse Line Founders Genotyping.………………………………………………….……..40 Figure 2.6 Transgenic Mouse Line F1 Copy Number.……………………………………………………..….………41 Figure 2.7 Fetal and Placental Weights in DEPTOR KD Mouse Line.…………………………………..………43 Figure 2.8 DEPTOR Protein Levels in the TPM of DEPTOR KD Mouse Line.……………………...………..44 Figure 2.9 mTORC1 and mTORC2 signaling in the TPM of DEPTOR KD Mouse Line.………….……….45 Figure 2.10 SNAT2 and LAT1 Protein Levels in the TPM of DEPTOR KD Mouse Line………….……….47 Figure 2.11 System A and System L Activity in DEPTOR KD Mouse Line………………………………...….48 Figure 3.1 Sonoporation Gene Delivery.………………………….………………………………………………….…….52 Figure 3.2 High Intensity Focused Ultrasound Transducer.…………………………………………………...….53 Figure 3.3 Unfocused Ultrasound Transducer.………………………….…………………………………………..….54 Figure 3.4 Mechanisms of Microbubble Attachment.………………………….………………………………..….56 Figure 3.5 Mechanisms of Microbubble Cavitation.………………………….……………………………………...58 Figure 3.6 Properties of Pulsed Ultrasound Waves.………………………….…………………………………..…..60 Figure 3.7 Transducer Characterization Setup.………………………….………………………………………….…..65 Figure 3.8 Luciferase Expression in the Livers of Treated Mice.………………………….……………………..72 Figure 3.9 Luciferase Expression in Placentas of Treated Mice.………………………….………………….….73 Figure 3.10 Fold-Change Values of Treated and Untreated Placentas and Fetuses……………………74
7 List of Tables
Table 1: Litter Size and Parental Copy Number……………………………………………………………………..…..41 Table 2: Percentage of Luciferase Positive Placentas……………………………………………………….………..75 Table 3: Final Placental Ultrasound Parameters………………………………………………………………..……..76
8 Chapter 1 – Literature Review
1.1 Maternal Nutrition and Fetal Programming
Obesity is an increasing problem worldwide, especially in America and Western Europe.
In the United States alone, the prevalence of morbidly obese adults went from 1 in 200 (1986) to
1 in 50 (2014) to 1 in 5 (2017), and is continuing to increase in frequency (Agha & Agha, 2017).
Conversely, in low-income and medium-income countries and communities (such as sub-Saharan
Africa, south-central and southeastern Asia, Yemen and considerably India, Bangladesh, and
Eritrea, as well as in women of non-Hispanic black and Asian/Pacific Islander decent), maternal and child undernutrition is highly prevalent (Black et al., n.d.; Khan et al., 2017; Swaminathan et al., 2019).
Maternal nutrition plays an important role in not only the intrauterine development and growth of the fetus, but also in its development into adulthood (Eriksson, 2005; Gluckman et al.,
2008). The Barker hypothesis suggests that embryonic and fetal organs and functions are influenced by its environment, which can result in disease predisposition in childhood and adulthood (Gillman, 1995; J. Wilson & Wilson, 1999). Maternal nutritional imbalances and metabolic disturbances often lead to an increased risk for the offspring to develop obesity, diabetes mellitus, , hypertension, dyslipidemia, cardiovascular diseases, and metabolic syndrome
(Eckel et al., 2005; Kwon & Kim, 2017; Marciniak et al., 2017). The Barker hypothesis is the basis behind the research of fetal origins of adult disease. The molecular mechanisms that govern this hypothesis can provide insight into the intervention and prevention of the phenomenon.
9 1.2 The Placenta - Structure
For proper fetal development to occur, it is necessary for the fetus to be able to obtain the appropriate types and amounts of nutrients. The developing fetus receives its nutrients from the maternal diet by way of the maternal bloodstream. Transfer of nutrients from the maternal to fetal bloodstream relies on one essential organ, the placenta. The placenta is pertinent to the survival and health of a developing fetus. The placenta originates from trophoblast cells of the developing blastocyst (Norwitz et al., 2001). Figure 1.1 shows the location of cytotrophoblasts and the multinucleated syncytiotrophoblasts. As development progresses, an increase in demand for nutrients and other molecules triggers a response in the trophoblast to signal for and undergo some structural changes. Cell proliferation, reorganization, and differentiation in both the syncytiotrophoblast cells and stromal and endometrial cells of the uterine wall (maternal origin)
Figure 1.1 Blastocyst Implantation in Humans. The diagram shows human blastocyst implantation into the uterus, approximately 10 days after fertilization. Arrows indicate processes necessary for trophoblast invasion. Image from (Norwitz et al., 2001).
10 occur over the course of placental development to increase surface area to match the increased nutrient and waste exchange (Sadler, 2019). Maternal stroma and endometrium undergo decidualization in preparation for the invasion of the syncytiotrophoblast (Figure 1.1).
After major reorganization, the placenta now has a specified structure that allows it to perform its function as optimally as possible (Figure 1.2). At the maternal portion of the placenta, the stromal and endometrial cells have decidualized and formed the decidua basalis. Maternal spiral arteries have now invaded fetal chorionic tissue, allowing maternal blood to fill the intervillous space, or the lacunae. In the fetal portion of the placenta, stem villi and free villi have formed, creating the chorionic villi that have branched out from the chorionic plate. The cytotrophoblasts and connective tissue have mostly degenerated and the syncytium, which is in direct contact with the maternal bloodstream, and endothelial cells, lining the fetal blood vessels, are the only layers separating maternal and fetal blood (Sadler, 2019).
Fetal Portion
Maternal Portion
Figure 1.2 The Human Placenta. Diagram of a fully developed human placenta. Image from (Svensson-Arvelund, 2015)
11 1.3 The Placenta - Function
The placenta is the site where nutrients, gases, and antibodies are transferred from the mother to the fetus during development. It is also the site of production of key hormones that aid in the retention and health of the fetus (Garnica & Chan, 1996; Sadler, 2019). The syncytiotrophoblast layer, the syncytium, is the major transporting epithelium of the placenta.
One of its main functions is the uptake and transfer of nutrients from the maternal to the fetal bloodstream, and its function is essential to normal fetal development (Kidima, 2015).
The syncytium has many different transport proteins at its interface with the maternal bloodstream. The syncytium is polarized, with its microvillous membrane (MVM) at its apical domain oriented toward the lacunae and its basal membrane (BM) at its basolateral domain oriented toward the fetal capillary. Both the MVM and BM express a multitude of nutrient transporters that are responsible for the uptake of major macromolecules such as amino acids, fatty acids, glucose.
There are three main groups of transporters: amino acid, fatty acid and glucose transporters (Figure 1.3). Several amino acid transporters are expressed in the syncytium. They can be characterized by substrate specificity (system), sequence homology (family), or physiological function (accumulative or exchangers). System transporters such as System A, which non-essential amino acids glycine and alanine, and System b, which transports taurine, are accumulative because they increase the intracellular concentration of amino acids. System A consists of transporter isoforms SNAT1 and SNAT2. System L is an exchanger, which substitutes non-essential amino acids for essential amino acids (Gaccioli & Lager, 2016). System L consists of transporter isoforms LAT1 and LAT2. There are at least 20 identified amino acid transporters in
12 the human placenta (Cleal & Lewis, 2008). One of the primary areas of research in our laboratory is centered around the regulation of amino acid transport. The mechanistic target of rapamycin
(mTOR) and the perioxisome proliferator activated receptor-gamma (PPARγ) and -delta (PPARδ) have been shown to be key regulators of post-implantation embryo growth and development
(Roberti et al., 2018).
Maternal Bloodstream
Amino Fatty Glucose Acids Acids
MVM SNAT FATPs GLUTs s LAT Syncytium BM FABP s s
Fetal Capillary
Figure 1.3 Nutrient Transporters of the Syncytium. Schematic representation of nutrient transport across the placenta, including the syncytiotrophoblasts, fetal endothelium, and key macronutrient transporter classes and families. Nutrients from the maternal blood are transported across the syncytium and into the fetal capillary. Image adapted from (Brett et al., 2014)
Fatty acids are transported across the placenta in a series of steps. Lipases in the membrane hydrolyze triglycerides non-esterified fatty acids. The fatty acid is then transported by one of five membrane-bound fatty acid transport proteins (FATPs) (Figure 1.3) and facilitated by CD36, fatty acid translocase receptor (Biron-Shental et al., 2007; Campbell et al., 1998; Herrera
13 & Ortega-Senovilla, 2014; Kazantzis & Stahl, 2012). Fatty acids are also transported to intracellular compartments by one of four placental fatty acid binding proteins (FABPs). FATPs and CD36 are expressed on the MVM and BM, but FABPs are only expressed in the MVM (Biron-
Shental et al., 2007; Campbell et al., 1998).
Glucose is transported across the syncytium by glucose transporter proteins (GLUTs)
(Figure 1.3), expressed in both the MVM and BM (Baumann et al., 2002). Glucose transport is gradient dependent and is consistently transporting glucose toward the fetus. There are a total of 14 GLUT family members, several of which are expressed exclusively in the placenta; GLUT1 being the most abundant, followed by GLUT3 (Lager & Powell, 2012; Mueckler & Thorens, 2013).
14 1.4 Comparison of Human and Mouse Placenta
To develop new technologies, techniques, or medications, an animal model proves useful to uncover complexities not apparent in in vitro experimentation. The laboratory mouse is a common animal model used in research due to its known genetic make-up, fast generational time, and ease to manipulate. Additionally, murine studies are significantly cheaper to conduct than those in larger animals, such as non-human primates. Since animal models have been pertinent to the advancement of knowledge in many biological fields, it is important to understand the comparison of the organ or organ system of choice between the choice of animal model and humans.
Placenta development in the mouse differs slightly from that of humans. Implantation of a developed murine blastocyst occurs with the trophectoderm invasion into maternal endometrium, as it does in humans. Following implantation, invasion by mouse trophoblast giant cells (TGCs) peak at between 7.5 and 9.5 dpc (Woods et al., 2018). This process allows the TGCs to erode smooth muscle and endothelial lining of the maternal artery, making contact with maternal blood to set up for the following developmental step. Further structural reorganization occurs with the chorio-allantoic fusion which marks the beginning of the labyrinth formation, the site of nutrient exchange in the murine placenta. In this process, extraembryonic mesodermal cells come into direct contact with the chorionic ectoderm, which start to invaginate and form finger-like projections. At this point, trophoblast cells begin to fuse to form the syncytiotrophoblast layers. The final major structural formation is the junctional zone (JZ). Th JZ is located between the labyrinth and maternal decidua and is comprised of three main cell types, the spongiotrophoblast, glycogen cells, and TGCs. The glycogen cells associate with the maternal
15 blood structures and become part of maternal blood spaces. From about 12.5 dpc onward, the placenta begins functioning as a mature organ (Woods et al., 2018).
The mouse placenta and human placenta share similarities as well. Mouse and human placentas both share a haemochorial type of placentation, where the fetal trophoblasts are in direct contact with maternal blood. Both mouse and human trophoblasts are invasive and penetrate into the endometrium in both species, though invasion occurs deeper in humans into the myometrium. In the mouse placenta, the labyrinth is the structure that is most analogous to the placental microvilli (fetal blood capillaries in Fig. 1.4) in humans. Syncytiotrophoblast derived cells are exposed to the maternal blood in both species, however humans have just one layer of syncytium. Murine placentas have two layers of syncytiotrophoblast and a single layer of fetal endothelial cells (Fig. 1.4).
Figure 1.4 Comparison of Mouse and Human Placentas. Top Left: Structure of mouse placenta. Bottom Left: Cross section of maternal-fetal interface in the labyrinth. Top Right: Structure of human placenta. Bottom Right: Cross section of a chorionic villus. Image from (Shibata et al., 2020).
16 1.5 Intrauterine Growth Restriction
Intrauterine Growth Restriction (IUGR) complicates 5-10% of all pregnancies and is associated with higher risk of perinatal morbidity and mortality, neurodevelopmental disorders and development of obesity, diabetes and cardiovascular disease later in life (Barker et al., 1993;
Zeitlin et al., 2010). IUGR refers to the inability of the fetus to reach its full growth potential that may be due to environmental or genetic factors. Infants developing under conditions of IGUR are small for gestational age (SGA), where their birth weight is below the 10th percentile for the appropriate gestational age. As its name suggests, IUGR is the prenatal finding of growth restriction. It is usually diagnosed upon documentation of confirmed low fetal growth rate, morphological or genetic abnormalities, or impaired blood flow measured during ultrasound prenatal doctor visits. At <32 weeks of, fetal growth restriction can be defined by being positive of one of the following parameters: an abdominal circumference <3rd percentile, an estimated fetal weight <3rd percentile, no end-diastolic flow in the umbilical artery, an abdominal circumference/estimated weight ratio <10th percentile in addition to a pulsatility index of >95th percentile (Priante et al., 2019).
IUGR has often been associated with impaired placental development, structure, and morphology. Impairment in any of these results in reduced placental function and , thus, reduced ability to deliver nutrients to the developing fetus (Baschat & Hecher, 2004). Several environmental, maternal, and fetal causes of IUGR have been identified (Figure 1.5). These include high altitude pregnancies, altered uteroplacental blood flow, young maternal age, undernutrition, placental infection and inflammation, smoking and drug use, fetal genetics, and malformations. Decreased maternal nutrient availability has been associated with the
17 development of IUGR and delivery of SGA fetuses. SGA infants have mortality risk that is 2 to 4 times higher than infants born at term (Priante et al., 2019). The effects of maternal undernutrition have first been studied in the case of the Dutch Famine, during the winter of 1944-
1945. During this time, it became evident that maternal undermatron in the third trimester inhibits placental growth (Stein & Susser, 1975). Furthermore, additional studies have shown that maternal undernutrition that results in IUGR has long-term consequences that include metabolic syndrome, diabetes mellitus, cardiovascular diseases, and much more as the offspring develop into adulthood (Ma & Hardy, 2012; Neitzke et al., 2011).
Figure 1.5 Maternal and Environmental Factors in Intrauterine Growth Restriction. Schematic of several maternal and environmental conditions that are associated with placental insufficiency and decreased nutrient transport for the developing fetus. Image from (Gaccioli & Lager, 2016)
18 1.6 Mechanistic Target of Rapamycin in Intrauterine Growth Restriction
Abnormal fetal development is associated with aberrant placental nutrient transporters activity. Nutrient transporters are upregulated in macrosomic pregnancies, resulting in large for gestational age (LGA) fetuses. A reduced number of transporters in IUGR pregnancies result in
SGA fetuses (Howell & Powell, 2018). Reports have shown that mTOR, a serine/threonine kinase, is a master regulator of the processes involved in cell growth, proliferation, and metabolism (Díaz et al., 2014; T. Jansson et al., 2012). In the placenta, mTOR is thought to function as a nutrient sensor and is a positive regulator for key amino acid transporters (S. Roos et al., 2009). Further evidence suggests that dysregulation of placental nutrient transport is a cause rather than an effect of altered fetal growth (N. Jansson et al., 2006). For example, placental mTOR has been shown to be upregulated and downregulated in fetal overgrowth and IUGR, respectively
(Pantham et al., 2015; Sara Roos et al., 2007).
mTOR is a component of two complexes, mTORC1 and mTORC2 (Meng et al., 2018).
Figure 1.6 shows mTOR involvement in the phosphoinositide 3-kinase pathway (PI3K). Upstream,
PI3K serves as an activator of mTORC2 signaling. PI3K and mTORC2 activate Protein kinase B (AKT) signaling, which in turn activates mTORC1 signaling. mTORC1 is a positive regulator of ribosomal protein S6 (S6) and ribosomal protein S6 kinase beta-1 (S6K1), an indirect positive regulator of
Eukaryotic Translation Initiation Factor 4E (eIF4E), and a negative regulator of Eukaryotic
Translation Initiation Factor 4E Binding Protein 1 (4EBP1). mTORC1 signaling activates signaling in pathways associated with protein synthesis, ribosome biogenesis, proliferation, angiogenesis, migration, and more (Figure 1.6). mTORC2 is a positive regulator for SGK1, protein kinase Ca
19 (PKCa), and AKT, which activates signaling in pathways involved in cell survival, cell-cycle progression, and actin remodeling (Figure 1.6) (Gao et al., 2012).
Figure 1.6 mTOR signaling pathway. Schematic representation of mTOR complexes 1 and 2, their regulators, and downstream targets. PI3K: phosphatidylinositol-3-kinase; mTOR: mammalian target of rapamycin; mTORC1: mTOR complex 1; mTORC2: mTOR complex 2; Raptor: regulatory- associated protein of mTOR; Rictor: rapamycin-insensitive companion of mTOR; mSIN1: mammalian stress-activated protein kinase interacting protein; eIF4E: eukaryotic initiation factor 4E; 4EBP1: eIF4E -binding protein 1; S6K1: S6 kinase 1; PKCα: protein kinase Cα; SGK1: glucocorticoid-induced protein kinase 1. Image from (Gao et al., 2012)
20 In a baboon model for maternal nutrient restriction (MNR), reduced fetal and placental weight was observed (Gaccioli & Lager, 2016; Schlabritz-Loutsevitch et al., 2007). MVM expression of nutrient transporters GLUT1, TAUT, SNAT2, LAT1, and LAT2 was downregulated in late gestation compared to controls (Kavitha et al., 2014). Additionally, lower System A and
System L activity in the MVM was observed, supporting the previous findings (Pantham et al.,
2015).
1.7 mTOR and the DEP-domain Containing mTOR Interacting Protein (DEPTOR)
Inhibition of placental mTOR signaling is associated with decreased activity of placental nutrient transporters (Chen et al., 2015; Glazier et al., 1997; T. Jansson et al., 2002; Thomas
Jansson et al., 1998a; Norberg et al., 1998; Sara Roos et al., 2007). mTOR expression has also been demonstrated to be negatively regulated by the DEP-domain containing mTOR-interacting protein, DEPTOR (Jewell et al., 2013). DEPTOR has been shown to be overexpressed in placentas of maternal nutrient restriction (MNR) induced IUGR baboon model (Jansson, unpublished).
Furthermore, preliminary data from in vitro DEPTOR knock-down showed increased mTOR signaling in cultured primary trophoblasts isolated from baboon MNR IUGR model (unpublished).
21 Chapter 2 In vivo Placental DEPTOR KD – Transgenic Mouse Model
2.1 Introduction
Transgenic animals are a useful tool to study the effects of a gene knock-in, knock-out, or knock-down in a whole animal system. Given the role of mTOR signaling on nutrient sensing and regulation of placental amino acid transport, we aimed to develop a transgenic mouse line that would normalize mTOR signaling. Since inhibition of placental mTOR signaling through DEPTOR activation is associated with decreased activity of placental nutrient transporters, we hypothesized that the restoration of placental mTOR signaling would improve placental function and fetal growth in IUGR. Collectively, the aforementioned data provides the rationale behind
DEPTOR knock-down to normalize mTORC1 and mTORC2 signaling and placental nutrient transport. Both mTORC1 and mTORC2 are responsible for the phosphorylation of downstream targets to activate cellular processes such as protein and lipid synthesis, autophagy, lysosome biogenesis, growth factor signaling, cytoskeletal remodeling, cell growth and proliferation, and ion transport and cell survival. Assessing the downstream targets of each mTOR complexes will enable us to verify the activation state of mTOR signaling. In this specific aim, we generated a transgenic mouse line to study the in vivo effects of DEPTOR knock-down in the placenta. To this end, we designed and constructed a GENIE 3-based plasmid with DEPTOR shRNAmir as a part of the transgene. We established and confirmed the transgenic mouse line, collected fetuses and placentas, and evaluated molecular readouts to investigate the role of DEPTOR in the regulation of mTORC1/C2 signaling.
22 2.2 Background Information
2.2.1 Transgenesis and Transposases
Transgenic animals are a valuable tool in biology to study the effect of genes in a whole organism. Several methods are presently used for transgenesis. The first method described is
DNA microinjection. In this method, linear DNA is injected into the pronucleus of a fertilized embryo. This method relies on host cell internal mechanisms to perform homologous recombination for genome insertion. However, with this method, the success rate for transgenesis is low - only about 10 to 15% of injected embryos develop into transgenic offspring
(Schilit et al., 2016).
Gene transfer using embryonic stem cells provides a way to increase the efficiency of the
DNA microinjection technique. Murine embryonic stem cells predominantly use homologous recombination to repair double-stranded breaks. CRISPR/Cas9, Zink finger nuclease, and transcription activator-like effector nuclease (TALEN) introduce site-specific, double-stranded
DNA breaks into the host genome, allowing for the induction of homologous recombination.
Since embryonic stem cells have higher levels of homologous recombination, they are an excellent tool for creating transgenic mice (Tichy et al., 2010). Edited embryonic stem are used to form chimeras, which are then bred to generate the transgenic mouse strain.
Another method of transgenesis is the use of viral vectors. Viral vectors such as retroviruses, lentiviruses, adeno-associated viruses, alphaviruses, flaviviruses, and other viral vectors have high transgene integration efficiency. Due to this high insertional activity of viral vectors such as these, interruption of key host genome genes often lead to insertional mutagenesis (Knight et al., 2013). Additionally, viral vectors are limited in their cargo carrying
23 capacity; the highest cargo capacity for viral vectors is only 8 kb, seen in lentiviruses and retroviruses (Slade, 2001).
The use of transposases for transgenesis has greatly improved its efficiency in generating transgenic animals. Transposases are enzymes that bind to a transposon and catalyze its insertion into another part of the genome. Transposable elements are divided into two categories (Figure
2.1, (Zhao et al., 2016)). Class I are retrotransposons, which use a “copy and paste” method of transposition. In this process, an RNA intermediate is reverse transcribed into cDNA, which is then inserted into the genome.
Class II transposable elements are DNA transposons, which utilize a “cut and paste” method. In this process, the Class II transposase binds to the flanking regions of the transposon, excises the transposon, and then reintegrates it into the genome (Bourque et al., 2018; Zhao et al., 2016).
Figure 2.1 Class I and Class II Transposases. A: Class I Retrotransposons make an RNA copy of the transgene, reverse transcribe the RNA to cDNA, and insert the cDNA into the genome in a “copy and paste” mechanism. B: Class II DNA transposons excise DNA and insert it into the genome in a “cut and paste” mechanism. Image from (Zhao et al., 2016).
24 There are several Class II transposases that have been studied in terms of their activity and efficiency. Three of the most common Class II transposases are Sleeping Beauty, Tol2, and
PiggyBac. Comparison of transposases in Chinese hamster ovary (CHO) cell line showed that
Sleeping Beauty and PiggyBac resulted in highest transgene insertion (Balasubramanian et al.,
2016). Another study in human embryonic kidney (HEK)-293 cells compared Sleeping Beauty and
PiggyBac in identical plasmid constructs showed that PiggyBac transposase had a 2- to 4-fold higher transposition rate than Sleeping Beauty (M. H. Wilson et al., 2007). In addition to the higher efficiency in PiggyBac when compared to other transposases, PiggyBac also is desirable for transgenesis due to its large cargo carrying capacity. Reports have shown PiggyBac is able to transpose cargo as large as 100Kb (Ding et al., 2005), which is more than 12-times greater than the cargo capacity of the most commonly used viral vectors. PiggyBac recognizes the transposon at its flanking 5’ and 3’ terminal repeat elements (TREs), cuts at these sites, and inserts the transposon at a at TTAA sites randomly dispersed in the genome (Li et al., 2013).
The desirable traits in piggyBac described above prompted the development of the pmhyGENIE plasmid system. This system utilizes the piggyBac transposase and transposon in a single plasmid (Urschitz et al., 2010), a significant improvement in comparison to its previous version that consisted of two plasmids (which meant successful transfection of two independent plasmids were needed to accomplish transposon integration). The pmhyGENIE plasmid system can be used to stably transfect cell lines, for gene therapy, and for active transgenesis. The
Transgenic Mouse, IVF, and ICSI Core at the University of Hawaii at Manoa to utilizes this piggyBac based approach to generate transgenic mouse lines in a method coined transposase-enhanced pronuclear injection (te-PNI) to achieve active transgenesis in mouse embryos (Marh et al.,
25 2012a). Studies conducted by the core facility showed that te-PNI using the pmhyGENIE system resulted in 85% survival rate in microinjected embryos and a 45.5% transgenesis rate (Urschitz &
Moisyadi, 2013). This method was employed to generate the mouse line in this chapter.
2.2.2 RNA Interference
RNA interference (RNAi) an evolutionarily conserved biological mechanism in which double-stranded RNA molecules induce the degradation of complementary mRNA molecules
(Figure 2.2) and thereby regulate mRNA levels of protein-coding sequences. Among the most characterized endogenous triggers of RNAi are microRNAs (miRNAs), which express hairpin-like structures known as primary transcripts (pri-miRNAs). These pri-miRNAs are processed by the
Drosha/DGCR8 microprocessor complex in the nucleus and then released as pre-miRNAs. The pre-miRNAs are then transported out of the nucleus by Exportin 5. The Dicer/TRBP complex binds to the pre-miRNAs and processes it in the cytoplasm into small double-stranded RNA molecules called siRNAs. siRNAs are then utilized by the RNA-induced silencing complex (RISC), where one of the strands from the siRNA is used as a template to recognize and cleave complementary RNA strands in the cytoplasm (Hannon & Rossi, 2004; Mohr & Perrimon, 2012).
26
Figure 2.2 RNA Interference. Precursor microRNA (miRNA) in the nucleus, pri-miRNA, is processed by Drosha into pre-miRNA, exported out of the nucleus by Exportin 5, processed by Dicer into miRNA, and used as a template by the RNA induced silencing complex (RISC) for RNA degradation. Cytoplasmic double-stranded RNA (dsRNA) is cleaved by Dicer into siRNA and is used as a template by RISC for RNA degradation. Image from (Merritt et al., 2008).
The endogenous mechanism of RNAi has been adapted as a tool for inducing loss-of- function of genes in in vitro and in vivo research models. Short hairpin RNAs (shRNAs) can be expressed from DNA vectors to enable stable loss-of-function studies. From DNA vectors, stem- loop shRNAs enter the RNAi mechanism when they are recognized by Dicer. Used in this way,
27 shRNAs have been shown to result in severe toxicity and fatality in mice (Grimm et al., 2006).
Additionally, studies have shown that Dicer has decreased fidelity when processing shRNAs that are nullified when containing a bulge or loop (Gu et al., 2012). Interestingly, this bulge is found in approximately 1/3 of miRNAs. An approach to avoid mistakes made by Dicer activity is to embed the synthetic shRNA stems into the context of endogenous miRNAs. The resulting shRNAmir has been shown to induce targeted knockdown in a number of miRNA contexts (Liu et al., 2008; Zeng et al., 2002). In order to optimize RNAi for gene silencing, several studies have designed synthetic miR backbones that optimize single-copy shRNA processing, one of which is mir-E (Fellmann et al., 2013).
2.2.3 Plasmid Cloning
To employ transgenesis using a single-plasmid approach, a DNA construct with the
PiggyBac transposase and a transposon is required. The components of the plasmid to achieve placenta specific DEPTOR KD were determined and are outlined below.
A tissue-specific promoter can be utilized to restrict transgene expression to a given organ, tissue, or cell type in the transgenic mouse. Placenta-specific expression in this project is restricted by the promoter Cyp19I.1. Cyp19i.1 is a section of the promotor for the human Cyp19 gene, exon I.1, which restricts transgene expression to the syncytiotrophoblast layer of the placenta (Kamat & Mendelson, 2001). Cyp19I.1 is expressed as early as 6.5 dpc (Wenzel & Leone,
2007), which was determined to be a suitable starting point for transgene expression considering placenta functionality beings at 12.5 dpc. Thus, Cyp19I.1 was selected as a promoter to drive placenta-specific expression.
28 To induce DEPTOR KD, target sequences complementary to DEPTOR were identified using
Broad Institute’s Gene Perturbation website for insertion into the miR-E context (Fellmann et al.,
2013). To facilitate the detection of transgene expression in vivo, a bioluminescent reporter gene, luciferase, was added to the transgene. The luciferase gene is a common reporter gene originally detected in the easter firefly, Photinus pyralis. The gene encodes a 61-kDa enzyme, luciferase, that oxidizes D-luciferin in the presence of ATP, oxygen, and magnesium ions. The resulting luminescence can be quantified by measuring the light released (Smale, 2010).
The pmhyGENIE DEPTOR Knockdown Vector (Figure 2.3) consisted of the piggyBac (pB) transposase and the transposon flanked by the 5’ TRE and 3’ TRE. The DEPTOR knockdown cassette, a part of the transposon, is comprised of the Cyp19I.1 promoter to restrict expression of DEPTOR shRNAmir and luciferase reporter gene. The synthetic promotor CAG (containing with an enhancer from cytomegalovirus, a promotor from chicken beta-Actin, and a splice acceptor of the rabbit beta-Globin gene) that drives the expression of piggyBac is also located within the transposon. The 3’ TRE was placed in an intron of piggyBac in order to inactivate PiggyBac expression once the transposon is excised.
29
pmGENIE3 DEPTOR KD Vector
transposon
5’TR DEPTOR KD CAG pB 3’TRE pB cont. E Cassette
CYP19I.1--- DEPTOR shRNAmir---Luciferase
Figure 2.3 DEPTOR Knockdown Plasmid. Schematic representation of the DEPTOR knockdown (KD) plasmid featuring the piggyBac gene under the synthetic CAG promoter and the DEPTOR KD cassette comprised of placenta-specific promoter, Cyp19I.1, DEPTOR shRNAmir, and reporter gene, luciferase. The piggyBac recognition sequences, 5’ and 3’ TRE mark the flanking regions of the transposon. The 3’ TRE is embedded in an intron of piggyBac that inactivates its transcription after transposition.
30 2.3 Methods
2.3.1 Construction of plasmid DNA
The hyperactive piggyBac plasmid pmhyGENIE-3 was kindly provided by Dr. Stefan
Moisyadi, University of Hawaii.
Prior to plasmid construction we identified five different DEPTOR knockdown target sequences using the Broad Institute’s Gene Perturbation website as DEPTOR-specific and obtained them from Sigma Aldrich. We tested KD efficiency in vitro by transfection (unpublished) and determined that one of the constructs (DEPTOR 155) with the targeting sequence
CCGTCCCTACATGGATGAAAT had mediated the most significant reduction in DEPTOR RNA and consequently protein decrease in transfected cells.
The basis for the final transgene of plasmid used in te-PNI transgenesis was a commercially obtained TET-ON micro-RNA (miR30) adapted shRNA vector targeting the RNA of mouse glucose transporter 1 (V3THS_321626, Open Biosystems). This V3THS_321626 plasmid encoded turboRFP under the TRE-3G promoter, with the reverse tetracycline-controlled transactivator 3 (rTTA3) driven by a ubiquitin C gene (UBC) promoter. The shRNAmir was situated in the 3’UTR of turboRFP. We replaced turboRFP with the luciferase reporter gene to enable in vivo assessment of transgene expression. The UBC promoter was replaced with the trophoblast- specific Cyp19I.1 promoter to limit the transgene expression to these cells. The miR-30 context was replaced by the miR-E context as described by Fellmann et al. Finally, we exchanged the shRNA target sequence of Glut1 with that of DEPTOR 155 (CCGTCCCTACATGGATGAAAT). These three steps were performed by restriction and insertion cloning. The transgene was then cloned
31 into a pENTR vector to facilitate the last step, the recombination of this Mtor KD pENTR vector with our pmGENIE-3 piggyBac vector (PMID: 20404201 & 23093669).
The pENTR DEPTOR KD vector described above was mixed at equimolar (150 ng/µL) amounts with the pmGENIE-3 constructs in an 8.0 µL LR Clonase II recombination reaction mixture, according to the manufacturer’s instructions. Correct assemblies of the plasmids were verified by restriction digestion and sequencing analysis. The correct constructs were then expanded with Macherey-Nagel NucleoBond PC 500 Maxi gravity-flow columns and used for transgenesis experiments.
2.3.2 Animals
B6D2F1 (B57BL/6 x DBA/2) and CD1 mice were purchased from Jackson Laboratories. All males and females (B6D2F1) were 6-8 weeks old, respectively, when used. Surrogate mothers
(CD1) were 8-16 weeks old. All animals were maintained in temperature and light-controlled rooms (14 light/10 dark, light on from 5:00 a.m.). Germline transgenesis was assayed by breeding
F1 transgenic mice with wild type individuals. The protocol of animal handling and treatment was reviewed and approved by the Animal Care and Use Committee of the University of Hawaii.
2.3.3 Oocyte Collection
B6D2F1 female mice underwent ovulation induction by intraperitoneal (i.p.) injection of
5 IU pregnant mare's serum gonadotrophin (Calbiochem, San Diego, CA), followed by i.p. injection of 5 IU human chorionic gonadotropin (hCG; Calbiochem) 48 h later. Oocytes were
32 collected from oviducts 14-16 h after the hCG injection and were then freed from cumulus cells by a 3-5 min treatment of 0.1% hyaluronidase (Sigma) dissolved in HEPES-CZB medium.
2.3.4 Sperm Collection
Caudae epididymides were excised from B6D2F1 male mice. A droplet of sperm isolated from the caudae epididymides was transferred to a 1.5 ml Eppendorf tube containing HEPES-CZB medium and incubated for 15-30 min at room temperature for sperm activation.
2.3.5 Transposase-Enhanced Pronuclear Injection
The Transgenic Mouse, IVF, and ICSI (TMII) Core at the University of Hawaii Institute for
Biogenesis Research use Transposase-enhanced pronuclear injection as a method to establish transgenic mouse lines. With the help of the TMII Core, the GENIE3 DEPTOR 155 plasmid constructed in the previous section was injected in the male pronucleus of single-cell embryos.
The embryos were cultured in vitro until blastocyst stage and then assessed health morphologically. Suitable embryos were implanted into the oviduct of a previously prepared surrogate mouse.
Vector solutions (5 ng/µL) were injected into the male pronucleus of a pronuclear B6D2F2 embryo employing a 2 µm internal diameter modified blunt ended microinjection pipette using the Piezo actuator (Prime Tech, Japan). The injected volume calculated with the following equations: π r2 length. For an injection of 65 µm this equals to 2.04 x 10-7 microliters (µL). At a concentration of 10 ng/µL per plasmid solution the total amount of DNA injected is 1.02 fg or about 65 copies of plasmid with the used constructs.
33 2.3.6 Embryo culture and embryo transfer
Oocytes with two well-developed pronuclei and a distinct second polar body 5 to 6 h after te-PNI, were recorded as having survived microinjection, and cultured in CZB medium until the
2-cell stage (20-24 h after microinjection). They were then transferred into the oviducts of surrogate CD-1 females which were mated with vasectomized males of the same strain on the day before embryo transfer. Pregnant females were allowed to deliver and raise their pups.
2.3.7 Genotyping
Genomic DNA was isolated using the DNeasy kit (Qiagen, Valencia CA) following the manufacturer’s protocol. Genotyping PCR was performed using the Platinum PCR SuperMix High
Fidelity (Invitrogen), primer 1 (GTGCCTTCACTATACAGCTTTTCA) and primer 2: Genie-
1_direct_2417-F (AGCGAGATCGTGAAGTGGAC) and the following PCR parameters: initial denaturation at 94°C for 2 min followed by 35 cycles of 20s denaturation at 94°C, 15s annealing at 58°C, and 1 min elongation at 72°C, with a final elongation for 20 min.
2.3.8 Germline Transgenic Assay
Eight-week-old C57BL/6 transgenic founders (F0) were back-crossed with wildtype
B6D2F1 (Jackson Laboratory). Dams were isolated after breeding to deliver and raise their young.
At weaning, all offspring’s tails were clipped and genomic DNA was extracted and then analyzed for transgene copy number. Germline transgenic F0 were identified by the ability of transgene transmission to their offspring and were kept for colony growth and maintenance. Transgenic F1 mice were crossed with each other to generate the F2 generation.
34
2.3.9 Transgene copy number assays
Transgene copy number assays were performed by duplex Taqman real-time PCR, where one assay interrogates the transgene copy number, whereas the other assay to mouse Tfrc serves as a reference. Primers and probes were custom designed for the 5ʹTRE for PB or pre-made
(RNAseP) and were supplied by Applied Biosystems. The primer and probe sequences are as follows: PB 5TRE Copy Forward GTGACACTTACCGCATTGACAAG, PB 5TRE Copy Reverse
GCTGTGCATTTAGGACATCTCAGT, PB Reporter ACGCCTCACGGGAGCTC. The assays were performed according to the TaqMan copy number assay protocol (Applied Biosystems) using the
Step-One-Plus real-time PCR machine in a 20µl reaction volume containing 50 ng of genomic
DNA. A minimum of five replicates per sample was assayed. PCR parameters: initial denaturation at 94°C for 2 min followed by 35 cycles of 20s denaturation at 94°C, 15s annealing at 58°C, and 1 min elongation at 72°C, with a final elongation for 20 min. The copy number assays were normalized to Tfrc, known to occur in two copies in the genome (4458367, Applied Biosystems).
The results were analyzed using the software CopyCaller (Applied Biosystems). The copy number assay was run on all mice in each generation to determine ideal breeding pairs for colony growth and data collection.
2.3.10 Breeding
Breeding of mice needed to be timed to know the exact day of pregnancy to ensure consistency across sonoporation trials. Male mice of appropriate copy number were kept as breeders. Males were isolated for one week prior to mating. Two females were added to a cage
35 of one male. Females were checked for plugs to confirm the date of conception. The day the plug was found was considered day 0.5 days post coitum (dpc).
2.3.11 Fetus and Placenta Collection
On day 17.5 dpc, pregnant dams were weighed and then sacrificed via CO2 asphyxiation.
The abdomen was carefully opened to expose the uterine horn. The uterine horn was excised, cutting along the maternal arteries supplying blood to the placentas. Starting at one end, scissors were carefully used to rupture uterus that exposed the first of the fetus/placenta pairs. The amniotic sac was ruptured and the placenta and fetus were separated. Placenta and fetuses were cleaned of connective tissue, weighed for data collection, and then frozen at -80°C.
2.3.12 Trophoblast Plasma Membrane (TPM) Isolation
TPMs were isolated from frozen placental homogenates using differential centrifugation and Mg2+ precipitation. All procedures were performed on ice and centrifugation steps were performed at 4°C. Homogenates were centrifuged at 10,000 g for 15 min; pellets were resuspended, re-homogenized in 1 ml of buffer D, and centrifuged at 10,000 g for 10 min. The resulting supernatants were combined and spun at 125,000 g for 30 min. The pelleted crude membrane fraction was resuspended in 2 ml of buffer D, and 12 mM MgCl2 was added. The suspension was stirred for 20 min on ice. After centrifugation at 2500 g for 10 min, the supernatant was centrifuged at 125,000 g for 30 min. The final pellet was resuspended in buffer
D to give a protein concentration of 10 mg/mL.
36 2.3.13 Western Blot mTOR signaling
Western blots were conducted using the Odyssey Western Blotting kit VII (Licor, product number P/N 926-3401 4). Western blots were performed on frozen tissue. Lysis buffer containing
298 uL RIPA buffer, 3.5 uL protease inhibitor mixture, 3.5 uL EDTA, 10 uL DDT and 7 uL PMSF was added to each sample. Samples were then sonicated with 11-13 pulses. Sonicated tissue was then centrifuged at 4oC at 16,000xg for 20 minutes. The supernatant was isolated and protein concentration was measured using a NanoDrop. Amersham ECL Rainbow Marker (GE Healthcare,
USA) and 1-2 ug of protein mixed with Laemmili loading and centrifuged at 2000 rpm for 30 seconds were then loaded into a NuPAGE polyacrylamide gel. Gels were run in 1x NuPAGE MOPS
SDS running buffer at 80 volts for 20 minutes and then at 150 volts for 50 minutes. To blot the gels, 1x NuPAGE transfer buffer with 15% methanol was used. Gels were washed with 1x PBST.
The membrane and gel were placed between filter papers and sponges, placed in the transfer chamber, and run at 100 mA at room temperature overnight.
2.3.14 Amino Acid System Transporter Uptake Assay
The activity of System A and L amino acid transporters in TPM was determined using radiolabeled amino acids and rapid filtration techniques. Na+-dependent uptake of MeAIB
(corresponding to system A activity) was calculated by subtracting Na+-independent uptakes from total uptakes. For leucine (corresponding to system L activity), mediated uptake was calculated by subtracting non-mediated transport, as determined in the presence of 20 mM unlabeled leucine, from total uptake. The intra-assay coefficient of variation for System A and L was 10 and 9.5%, respectively. All measurements of system A and system L activity were
37 performed within one day of TPM isolation from frozen placentas. System A activity was measured over 15 s at room temperature (∼22 °C) in the presence and absence of an inwardly directed Na+ gradient. Briefly, uptake was initiated by the addition of 20 μl TPM lysate (124–281
μg protein) to 20 μl 14C-MeAIB (0.33 mM; Perkin Elmer, Buckinghamshire, UK) in the presence or absence of Na+ contained in the buffer (5 mM Tris, 5 mM Hepes, 145 mM NaCl or KCl, pH 7.4)
[10]. System uptake was stopped by the addition of 2 ml ice-cold Krebs Ringer phosphate buffer
(KRP; 130 mM NaCl, 10 mM Na2HPO4, 4.2 mM KCl, 1.2 mM MgS04, 0.75 mM CaCl2, pH 7.4) and
2 ml of the resultant solution applied to a filter under vacuum filtration, which was washed with
10 ml KRP and dissolved in 2 ml 2-ethoxyethanol and counted by liquid scintillation spectroscopy.
38 2.4 Results
2.4.1 Clone Validation in Cells
As a first step in the process of generating a DEPTOR KD transgenic mouse line, we assessed to which extend the chosen shRNAmir clone would knockdown DEPTOR. Figure 2.4 shows Western blot and densitometry data demonstrating effective DEPTOR knockdown with clone 155 shRNAmir. Figure 2.4a shows a reduction in DEPTOR protein in cells treated with the
DEPTOR155 shRNAmir, quantified by densitometry and graphed as relative density in comparison to cells treated with a scrambled shRNAmir vector (Figure 2.4b). These data show that the
DEPTOR 155 clone is sufficient to induce DEPTOR protein knockdown through RNA interference.
A B Scrambled shRNA
DEPTOR 155 shRNAmir Scrambled shRNA DEPTOR shRNAmir 155 DEPTOR P=0.04
Total protein (Ponceau)
Figure 2.4 DEPTOR Knockdown Clone Validation. A: Western blot of DEPTOR protein levels in cultured primary human trophoblast (PHT) cell lysates. B: Densitometry data comparing DEPTOR levels in cell treated with DEPTOR 155 shRNAmir and cells treated with scrambled siRNA. Data points represent each replicate and horizontal bars represent the mean of each replicate + SEM, Student T-test (*p<0.05).
39 2.4.2 Detection of Transgene in Founding Transgenic Mice
The TMII Core of the IBR performed te-PNI using our DEPTOR shRNAmir Genie-3 plasmid.
To identify transgenic offspring, we first genotyped these fonder (F0) pups. Tail clips were taken from each mouse and digested in lysis buffer overnight before PCR amplification of the lysate containing genomic DNA. Primers flanking the shRNAmir were used for DNA amplification. Figure
2.5 shows a representative agarose gel that was used to determine presence of our transgene in the F0 mice. Three out of five pups tested contained the inserted transgene. Myogenin was used for a control for the presence of genomic DNA.
Transgene
Myogenin
Figure 2.5 Transgenic Mouse Line Founders Genotyping. Agarose gel showing a representation of the genotyping that was performed to determine which DEPTOR KD transgenic mouse line founders were transgene positive. Primers flanked the shRNAmir, which was chosen to be the amplified region in the PCR.
2.4.3 Validation of Germline Transgenesis in DEPTOR KD Mouse Line
To determine which of the founding mice were germline transgenic, F0 mice were back- crossed to wild type B6D2 mice. The offspring (F1) were evaluated for presence of transgenes by copy number assay to determine germline transmission of the transgene. Figure 2.6shows the results of the copy number assay of the F1 generation for the DEPTOR KD mouse line. There
40 was no amplification signal for mouse 1, indicating no germline transmission. Offspring from
Mouse 2 and Mouse 3 show copy numbers ranging from zero to two, indicating that they were
germline transgenic founders. Offspring with copy numbers of one or higher were used for
subsequent breeding.
Number Copy Copy +CTRL - 1.1F 1.2F 1.3F 1.4F 2.1F 2.1M 2.2F 2.2M 2.3M 2.4M 2.5M 3.1F 3.1M 3.2F 3.2M 3.3F CTRL
Mouse 1 Offspring Mouse 2 Offspring Mouse 3 Offspring
Figure 2.6 Transgenic Mouse Line F1 Copy Number. Graphical representation of calculated copy number assays from the F1 generation of DEPTOR 155 shRNAmir transgenic mouse line. Litters were produced by breeding F0 mice with wild-type B6D2 mice.
41 2.4.3 Generation of Mice for Experimental Analysis
Transgenic F1 mice were bred with each other to generate F2 offspring. We selected six
F2 breeding pairs, with parental copy numbers of 1 or 2. Table 1 summarizes the data, showing litter size ranging from 6 to 10 pups and their corresponding parental copy numbers. At 17.5 dpc, placentas and fetuses from these breeding pairs were collected, weighed (data shown in next section), and then frozen for downstream molecular analyses.
Table 1: Litter Size and Parental Copy Number
Litter ID Number of Pups and Maternal Copy Paternal Copy Placentas in Litter Number Number 1 6 1 2 2 7 2 2 3 6 1 2 4 8 2 2 5 8 1 1 6 10 2 2
2.4.4 Evaluation of Fetal and Placental Weight
Fetal and placental weights were recorded and then averaged by litter. Figure 2.7a shows a scatter plot illustrating average fetal weight per litter in control and KD litters (N=6 litters per group). Statistical analysis indicated that there was a significant increase in average fetal weight
(p-value of 0.02) when compared to wildtype controls.
Figure 2.7b depicts a scatter plot illustrating the different in placental weight in control and KD litters (placental weights were averaged by litter, N=6 litters per group). Figure 2.7b shows a slight increase in placental weight, however, statistical analysis showed that the difference in weight observed was not significant.
42 A B
P=0.02
Figure 2.7 Fetal and Placental Weights in DEPTOR KD Mouse Line. A: Scatter plot showing fetal weights in control and DEPTOR KD mice. B: Scatter plot showing placental weights in control and DEPTOR KD mice. Data points represent the average for each litter and horizontal bars represent the total mean + SEM, Student T-test (*p<0.05).
2.4.5 Validation of DEPTOR KD in Transgenic Mouse Line
The trophoblast plasma membrane (TPM) was isolated from each of the placentas from each fetus and pooled by litter for all of the following analyses. As a first step we evaluated the if the DEPTOR 155 mRNA knock-down in our transgenic mouse line also resulted in a reduction of DEPTOR protein levels. And indeed, as shown in Figure 2.8a, Western blot data
(representative) confirmed DEPTOR protein levels are reduced when compared to wildtype control. Figure 2.8b shows densitometry data, of all samples investigated, that illustrates the relative density of DEPTOR protein in the KD mouse to be reduced when compared to control.
43
A B DEPTOR+ DEPTOR- Wildtype Control Wildtype DEPTOR shRNAmir DEPTOR 47 kDa DEPTOR
42 kDa β-actin
Figure 2.8 DEPTOR Protein Levels in the TPM of DEPTOR KD Mouse Line. A: Western blot of DEPTOR protein levels in TPM lysates of placentas collected. B: Densitometry data comparing DEPTOR levels in DEPTOR KD mice and wildtype control. Data points represent the average for each litter and horizontal bars represent the total mean + SEM, Student T-test (*p<0.0005).
2.4.6 Evaluation of the Effect of DEPTOR Knockdown on mTOR signaling in the TPM
After confirming DEPTOR protein reduction in the transgenic mouse line, we then assessed the effect of the KD on mTOR signaling. Figure 2.9a shows a representative Western blot of S6Ser-235/236 in the DEPTOR KD mouse line relative to controls, quantified by scatter plot
(Figure 2.9b) illustrating the density of S6Ser-235/236 in the DEPTOR KD mouse line relative to controls (Figure 2.9b). S6Ser-235/236 levels in the DEPTOR KD mouse line were significantly increased
(p-value of 0.009). Figure 2.9c shows a representative Western blot of AktSer-473 in the DEPTOR
KD mouse line relative to controls, quantified by scatter plot (Figure 2.9d) illustrating the density of AktSer-473 in the DEPTOR KD mouse line relative to controls. AktSer-473 levels in the KD mouse line
44 were significantly increased (p-value of 0.0005). Collectively, these data show a marked increase in mTORC1 and mTORC2 signaling.
B A
DEPTOR + DEPTOR -
-type Control
Wild DEPTOR shRNAmir Ser-235/236 S6 P=0.009 β-actin 235/236 S6 C D
2.5 DEPTOR + * - 2.0 DEPTOR
-type Control 1.5 Wild DEPTOR shRNAmir 1.0 Ser-473 P=0.0005 Akt 0.5 Relative density β-actin 0.0 Ser-473 Akt
Figure 2.9 mTORC1 and mTORC2 signaling in the TPM of DEPTOR KD Mouse Line. A: Western blot of S6Ser-235/236 protein levels in TPM lysates of DEPTOR KD and wild-type control mice. B: Scatter plot illustrating relative protein levels of S6Ser-235/236 in DEPTOR KD placenta TPM compared to controls. C: Western blot of AktSer-473 protein levels in TPM lysates of DEPTOR KD and wild-type control mice. D: A: Scatter plot illustrating relative protein levels of AktSer-473 in DEPTOR KD placenta TPM compared to controls. Data points represent the average for each litter and horizontal bars represent the total mean + SEM, Student T-test (*p<0.01).
45 2.4.7 Evaluation of the Effect of DEPTOR Knockdown on Nutrient Transporters in TPM
Next, we evaluated the protein levels of two main nutrient transporters of the placenta,
SNAT2 and LAT1. Figure 2.10a shows Western blot data demonstrating SNAT2 protein levels are increased when compared to wildtype control. Figure 2.10b shows densitometry data that illustrates the relative density of SNAT2 protein in the KD mouse to be increased when compared to control. Figure 2.10c shows Western blot data demonstrating LAT1 protein levels are increased when compared to wildtype control. Figure 2.10d shows densitometry data that illustrates the relative density of LAT1 protein in the KD mouse to be increased when compared to control.
Collectively, these data demonstrate that increased mTOR signaling results in increased nutrient transporters in the placenta TPM.
46
B +
A
DEPTOR
- 2.5 * DEPTOR siRNA
siRNA DEPTOR 2.0 Scramble Scramble
SNAT2 1.5 1.0 Total protein 0.5 P=0.01
(Ponceau) Relative density 0.0 SNAT C D
2 +
3 DEPTOR
* DEPTOR - siRNA siRNA DEPTOR Scramble Scramble 2 LAT1 1 P=0.03 Total protein Relative density (Ponceau) 0 LAT1
Figure 2.10 SNAT2 and LAT1 Protein Levels in the TPM of DEPTOR KD Mouse Line A: Western blot of SNAT2 protein levels in TPM lysates of DEPTOR KD and wild-type control mice. B: Scatter plot illustrating relative protein levels of SNAT2 in DEPTOR KD placenta TPM compared to controls. C: Western blot of LAT1 protein levels in TPM lysates of DEPTOR KD and wild-type control mice. D: A: Scatter plot illustrating relative protein levels of LAT1 in DEPTOR KD placenta TPM compared to controls. Data points represent the average for each litter and horizontal bars represent the total mean + SEM, Student T-test (*p<0.01).
47 2.4.8 Evaluation of the Effect of DEPTOR Knockdown on System A and System L activity in TPM
Finally, we investigated the effect of DEPTOR KD on two main placental amino acid transport systems, System A and System L. Figure 2.11a shows a scatter plot for measured System
A activity in TPM lysates from DEPTOR KD vs controls. Figure 2.11b shows a bar graph illustrating the difference in System A activity in the DEPTOR KD mouse line relative to controls. System A in the DEPTOR KD mouse line as significantly increased (p-value of 0.04). Figure 2.11c shows a scatter plot for measured System L activity in TPM lysates from DEPTOR KD vs controls. Figure
2.11d shows a bar graph illustrating the difference in System L activity in the DEPTOR KD mouse line relative to controls. System L in the DEPTOR KD mouse line as significantly increased (p-value of 0.02). activity in two main nutrient transport systems in the TPM of placentas of DEPTOR KD mice. Collectively, these data demonstrate that increased TPM nutrient transporters results in increased nutrient transport in the placenta.
A B DEPTOR + 1.0 DEPTOR - 80 * + DEPTOR * - DEPTOR 0.8 60 0.6
40 0.4 P=0.04 System L uptake L System
20 X15 sec) (pmole/mg 0.2 System A activity A System P=0.02 (pmole/mgX 15 sec) (pmole/mgX
0.0 0
Figure 2.11 System A and System L Activity in DEPTOR KD Mouse Line A: Scatter plot showing System A activity in control and DEPTOR KD mice. B: Scatter plot showing System L activity in control and DEPTOR KD mice. Data points represent the average for each litter and horizontal bars represent the total mean + SEM, Student T-test (*p<0.05).
48 Chapter 3 – Placental Gene Delivery - Sonoporation
3.3.1 Introduction
Gene therapy is a promising approach for the treatment of human diseases, for example, by modulating gene expression in cells in vivo or ex vivo. Ultrasound, when applied to biological tissues, in vivo, causes cavitation bubbles to form pores through cell membranes. The pores made by the ultrasound allow for the transfer of DNA or RNA into the cytoplasm of the cell. This is a process is called sonoporation, a new and emerging technology used for gene delivery
(Feichtinger et al., 2014; Tomizawa, 2013a). Sonoporation is a less toxic, non-tumorigenic alternative to retroviral and adenoviral vectors commonly used for gene transfer. Retroviral vectors often result in tumorgenicity, while adenoviral vectors may elicit a severe immune response. Adeno-associated vectors do not cause an immune response, however they are not permissive in some tissue types (Jin et al., 2013; Miura et al., 2009; Raper et al., 2003). Plasmid
DNA by itself also does not induce an immune response due to the lack of coat protein of viruses
(Wells, 2010). Sonoporation is considered minimally invasive and microbubbles help lower the threshold needed for cavity formation in cells (Tomizawa, 2013a).
Presently, there are no treatments available for IUGR. In vivo gene therapy seems to be a promising option for the regulation of gene expression and the treatment of genetic diseases in humans. Optimizing sonoporation parameters as an approach for non-viral, minimally invasive, and tissue-specific in vivo gene delivery will allow for safe gene modulation in the placenta.
Injection of lipid contrast agents regularly used in cardiology coated with plasmid DNA into the maternal bloodstream is a sufficient delivery method to perform sonoporation on the liver, an
49 organ that is filled with maternal blood (Blomley et al., 2001; Song et al., 2012). The placenta is also blood-filled and it is the interface between the maternal and fetal bloodstream.
Furthermore, the placenta has a finite lifespan and is typically discarded at birth. Collectively, these characteristics illustrate why the placenta is an ideal target for sonoporation induced gene modulation.
3.2 Background Information
3.2.2 Ultrasound Gene Delivery - Sonoporation
Ultrasound is a term used to describe sounds and vibrations that are generated at frequencies above 20 kilohertz (kHz) up to 1 gigahertz (GHz). Ultrasound is mainly used for evaluative purposes, such as its use for diagnostic imaging. Generally, ultrasound waves are emitted from an ultrasound transducer, return waves are detected, and an image is the result.
Ultrasound has been used in combination with lipid microbubble contrast agents, especially in cardiograph to visualize the heart, veins and arteries, and analyze blood flow (Muskula & Main,
2017). Due to its non-invasive nature, cost efficiency, and portability, clinics have adopted the regular use of ultrasound for imaging. Recently, ultrasound technology has been adapted and used for many biomedical and therapeutic applications such as the delivery of drugs across the skin, gene therapy in targeted tissues, deliver chemotherapeutic drugs to tumors, deliver thrombolytic drugs for occlusion removal, and healing of wound and bone fractures (Mitragotri,
2005).
Sonoporation is a minimally invasive gene transfection technique that can direct the site of gene delivery to organs accessible to ultrasound. In this technique, a DNA vector cloned with a gene of interest is bound to lipid microbubbles and injected intravenously. Ultrasound induces
50 cell transfection of the DNA construct at the target organ via cavitation at a resonance frequency
(Walton et al., 2011). The use of naked plasmid DNA alone for in vivo gene delivery presents challenges such as enzymatic digestion in the blood and instability in intracellular compartments
(Miao & Brayman, 2005). The use of ultrasound and microbubbles in conjunction with plasmid
DNA provides a novel approach to DNA delivery in vivo. This method has proved to increase efficiency in non-viral DNA uptake in cells compared to plasmid DNA delivery alone. Previous studies have shown the use of sonoporation to deliver reporter genes, such as luciferase and green fluorescent protein (Shapiro et al., 2016; Tomizawa, 2013b), as well as potential therapeutic genes, such as bone morphogenic protein-6 and -7 (BMP-6, BMP-7), Cluster of
Differentiation 151 (CD151), PR Domain containing 16 (PRDM16), and peroxisome proliferator- activated receptor gamma-1a (PPARG1A) (Bastarrachea et al., 2017; Bez et al., 2017; Yang et al.,
2016). These studies demonstrated short-term gene transfection, but advances in non-viral vector technology have made the potential for sonoporation greater than before. With GENIE plasmids like the one described in the previous chapter and use of tissue specific promotors, stable, efficient, and tissue specific integration of transgenes may allow for longer-term, therapeutic level expression of the gene of interest. Sonoporation exhibits many favorable characteristics including low toxicity and immunogenicity due to vectors and ultrasound, minimal invasiveness due to method of delivery, high specificity due to ultrasound positioning and use of tissue-specific promoters, and the potential for adaptation to therapeutics and research.
51
Figure 3.1 Sonoporation Gene Delivery. A schematic representation of ultrasound induced microbubble cavitation directing cell transfection. Image from (Ine De Cock — Laboratory of General Biochemistry and Physical Pharmacy, n.d.)
3.2.3 Ultrasound Transducers
In non-destructive testing, ultrasound is used to detect and identify abnormalities within uniform solids such as metals. In the medical field, ultrasound is used as a diagnostic imaging tool. The basis of ultrasonic testing is the conversion of electrical pulses to mechanical vibrations, and then of reflected mechanical vibrations into electrical energy. The received electrical energy relays information about the physical properties of the test subject. Ultrasound transducers achieve this conversion of electrical pulses into mechanical vibrations with the use of piezoelectric material. Piezoelectric material expands and contracts in response to electrical signals, which in ultrasound transducers produce ultrasound waves (Nondestructive Evaluation
Techniques : Ultrasound, n.d.).
Single-element focused ultrasound transducers typically feature a convex face that allows for the convergence of ultrasound waves at a fixed distance from the transducer. Focused ultrasound can also be achieved through transducers with phased-array properties that allow the
52 convergence of multiple ultrasound emissions at a fixed distance from the transducer, as in high- intensity focused ultrasound (HIFU) transducers (Kim et al., 2008). HIFU has the potential for a multitude of clinical applications, such as tumor ablation, occlusion removal, and treatments for neurological diseases such as essential tremor, Parkinson disease, and dystonia (Fishman &
Frenkel, 2017). In HIFU, the focal zone as shown in Figure 3.2 is typically only 1-2 mm in diameter and 8-15 mm long. Additionally, the use of HIFU is usually coupled with magnetic resonance imaging (MRI) to aid with targeting of the focal zone (Shaw et al., 2014). Due to the small treatment area and specific equipment requirements associated with focused ultrasound, unfocused ultrasound was chosen for this project.
Figure 3.2 High Intensity Focused Ultrasound Transducer. Graphic representation of a HIFU transducer and its focal zone. Image from (Shaw et al., 2014)
Unfocused ultrasound transducers, as used in this project, feature a flat face to emit ultrasonic waves in an unfocused manner. Unfocused transducers aim to achieve a collimating beam, where ultrasound waves propagate in parallel and, thus, do not converge (Sirohi, 2020). A
53 truly collimating beam in reality is very difficult to achieve. Unfocused transducers typically have a “natural focus” that occurs at the point between the near field and far field zones (Figure 3.3).
Figure 3.3 Unfocused Ultrasound Transducer. Graphic representation an unfocused ultrasound transducer and its near field and far field zones. Image from (Ultrasound Beam Shape & Focusing, n.d.)
The near field distance is the point of natural convergence of unfocused ultrasonic transducers and is calculated as:
�!(�) � = 4�
Where N is the near field distance in cm, D is the diameter of the transducer in cm, f is the frequency of the transducer in Hz, and c is the velocity of sound in the medium in cm/sec.
The transducers used in this project were chosen to have a frequency of 1MHz (explained more in next section). The two transducers used were a 0.5” (1.27 cm) Olympus A303S unfocused transducer and a 0.25” (0.635 cm) General Electric Pencil unfocused transducer. The value for the velocity of sound in water was used in this calculation to determine the natural focus of the transducer. The velocity of sound in water is 150000 cm/sec, which is roughly equivalent to that of blood (157000 sm/sec), fat (145000 cm/sec), the liver (155000 cm/sec), and other bodily
54 tissues excluding bone (Feldman et al., 2009). The calculated near field distance of 0.67cm for the GE transducer and 2.69 cm for the Olympus transducer. was the distance used to measure peak ultrasound output from the transducer during transducer characterization (explained in a later section). Unfocused ultrasound was chosen for placental sonoporation because it can emit ultrasound to a wider area of tissue at its focal point compared to HIFU. Moreover, image coupling with MRI or other imaging methods is not needed due to the larger focal point, relinquishing the need for such equipment.
3.2.4 Microbubbles and Cavitation
Microbubbles have been commonly used as a contrast agent for ultrasound imaging for decades now. Their small size allows them access to many organs supplied by the vasculature when intravenously injected (Klibanov, 2006). Their gas cores efficiently reflect and scatter ultrasonic waves, increasing contrast between the vasculature it is present in and the surrounding tissue. Recently, microbubbles have been used in conjunction with drugs or DNA vectors as a carrier in the bloodstream. There are various types of microbubbles that differ primarily by their shell composition. Single-layered microbubbles shells are can be made of proteins, lipids, surfactants or polymers, whereas multi-layered microbubble shells are made of polyelectrolytes (Sirsi & Borden, 2009). Microbubbles are typically filled with gases of high molecular weight, such as octafluoropropane, which enhance microbubble circulation time in the bloodstream and increase their degree of expansion and contraction in response to ultrasound exposure (Kogan et al., 2010). In addition to the makeup of the microbubble shell, there are several approaches to attaching drugs or DNA to microbubbles. Figure 3.4 shows five methods of
55 drug or DNA conjugation to microbubbles. Microbubbles can be encapsulated (Figure 3.4a), included in the shell (Figure 3.4b), attached to the membrane (Figure 3.4c), attached to a ligand embedded in the membrane (Figure 3.4d), incorporated in a multilayer bubble (Figure 3.4e), or a combination of two or more of these. In this project, the microbubble shell used is lipid based.
The microbubble stock is mixed with DNA prior to microbubble formation (more details in
Methods section), which encapsulates the plasmid DNA inside of the microbubble. In addition, the negatively-charged plasmid DNA is bound to the surface of the positively-charged lipid shell.
Thus, the microbubbles used in this project is a combination of encapsulation and attachment to the membrane. Previous studies have shown that the protocol used to in this project produce microbubbles with average size ranging in size from 1.2 – 3 um, average size being 2.1 measured using a Beckman-Coulter Multisizer 3 (C. D. Anderson et al., 2016; Bekeredjian et al., 2005).
Figure 3.4 Mechanisms of Microbubble Attachment. A: Incorporation inside of microbubble. B: Incorporation within the microbubble shell. C: Attachment to the microbubble membrane. D: Attachment to a ligand embedded within the microbubble shell. E: Incorporation between layers of a multilayer microbubble. Image from (DIJKMANS et al., 2004)
56 In addition to being used as a carrier for drugs and DNA, microbubbles facilitate the uptake of the substrate it is carrying through its cavitation. Several studies have shown that microbubble destruction during ultrasound exposure increases cell permeability in the endothelial lining of blood vessels through cavitation (Price et al., 1998; Skyba et al., 1998).
Microbubble cavitation is known to occur in contrast echocardiography, primarily by acoustic cavitation (Wei et al., 1997). Higher peak negative pressure, a measure of ultrasonic acoustic power (explained in the next section), and lower frequencies (such as 1MHz, as in this study) cause greater microbubble destruction (Dayton et al., 1999). The processes driving drug or gene uptake induced by microbubble are not fully understood yet. Fan et al. proposed five mechanisms by which sonoporation induced microbubble cavitation can facilitate drug or DNA uptake, shown in Figure 3.5 (Z. Fan et al., 2014). When microbubbles undergo ultrasonic treatment, oscillation in size begins to occur. Microbubbles compact during periods of high pressure and expand during periods of low pressure. This expansion and contraction, typically to sizes 2-fold or greater, can induce breaks in surrounding tissue and induce particle uptake (Figure 3.5a and 3.5b). When a bubble is located directly near a solid surface, inertial cavitation of the microbubble can result in jetting or microstreaming, in which the shell of the microbubble or fluid surrounding the bubble is shot through the adjacent membrane, resulting in a break and uptake of particles (Figure 3.5c and 3.5d). Finally, studies have shown that microbubbles can be pushed thorough the cell membrane without causing cavitation (Figure 3.5e).
57
Figure 3.5 Mechanisms of Microbubble Cavitation. Illustration of five mechanisms of microbubble cavitation and sonoporation in surrounding tissue. A: Pushing. B: Pulling. C: Jetting. D: Microstreaming. E: Translation. Image from (Z. Fan et al., 2014)
3.2.5 Bioeffects of Ultrasound
Sonoporation is generally considered a minimally invasive technique that has the potential for clinical and research applications. Additionally, delivery of nonviral vectors via sonoporation offer a safer alternative to strategies than currently utilized viral vectors. However, there are limitations of sonoporation that should be considered for potentially improving its safety for future applications.
Although ultrasound is widely used in the clinic for diagnostic imaging, ultrasound used to induce sonoporation-mediated drug or DNA delivery has some key differences. Reports have
58 shown that acoustic stable cavitation and inertial cavitation, occurring in sonoporation, induce responses that result in tissue changes. Among these tissue changes is microvascular damage diagnosed by increased microcapillary and cellular membrane permeability, microcapillary rupture, and extravasation of red blood cells into tissue interstitium (Price et al., 1998; Skyba et al., 1998).
Microbubble dosage and concentration should be considered for reducing the likelihood of a microembolism cause by blood vessel or capillary blockage by microbubbles. Microbubbles travel in the bloodstream, where blood vessel sizes range from large arteries (such as the aorta which has an average diameter of 25 mm) to small capillaries (smallest diameter of 8 um).
Although the microbubbles used in this project are of average diameter of 2 um, microbubbles can possibly coalesce to form larger particles, however this is more likely the case for protein- shelled microbubbles than lipid-shelled (E. Stride & Saffari, 2003).
Local tissue heating cause by ultrasound exposure is another potential bioeffect of concern, especially when increasing ultrasound intensities to achieve microbubble cavitation.
Inertial cavitation, which occurs in sonoporation, produces localized tissue heating (Ter Haar et al., 2011). Reports have shown that in some cases of inertial cavitation, internal temperatures inside of microbubbles can reach thousands of degrees Kelvin (Apfel & Holland, 1991).
Ultimately, it is important to optimize sonoporation parameters and analyze its bioeffects for every organ being targeted, especially since different tissues often have distinct and unique vascularity and may respond to ultrasound and microbubble cavitation differently (Newman &
Bettinger, 2007). This project aimed to optimize parameters that led to effective gene
59 transfection of the placenta, however bioeffects of the delivery technique, however, still need to be addressed.
3.2.6 Properties and Parameters of Ultrasound Waves
Ultrasound describes acoustic waves with frequencies above 20kHz and exhibits properties that are common to all types of waves: amplitude, period, and frequency. The amplitude of an ultrasound wave is the maximum displacement the wave is measured from its equilibrium. In Figure 3.6, the amplitude of the ultrasound wave is 100 volts (V). Amplitude is also sometimes measured from peak-to-peak, that is, from the most positive recorded value to the most negative recorded value. In Figure 3.6, the amplitude is 200 V peak-to-peak (Vpp). The peak- to-peak voltage is used as an input to the wave generator, a piece of equipment used in sonoporation experiments (described in the next section).
Figure 3.6 Properties of Pulsed Ultrasound Waves. Graphic representation of a pulsed ultrasound wave featuring wave properties and parameters such as period, pulse duration, pulse repetition period, and amplitude. Figure from the Master’s thesis of Kainalu Matthews, with permission.
60 The period is a describe is described as the duration of one complete cycle. The ultrasound wave in Figure 3.6 shows has a period of 20 us. The frequency of a wave is a measure of how many complete periods, or cycles, are generated per second and is directly related to the period.
A wave with a period of 20 us has a frequency of 50 kHz.
Waves are usually thought of as a continuous emission. The ultrasound waves emitted during sonoporation are pulsed, not continuous. For pulsed ultrasound, the ultrasonic emission is turned on for a set period of time, followed by a set period of time off. The pulse duration is the amount of time that the ultrasonic wave is being emitted in a single pulse. In Figure 3.6 the pulse duration is 40 us, which contains two periods in each pulse. The pulse duration can be lengthened or shortened to dampen or intensify the effects of ultrasound treatment. In this project, a pulse duration of 15 ms was determined to be suitable for placental sonoporation.
The pulse repetition period is the amount of time from the start of one pulse to the start of the next pulse. Pulse repetition frequency, is the number of pulses in a second. In Figure 3.6, the pulse repetition period (PRP) is 100 us, which gives a pulse repetition frequency of 10Hz. In this project, a PRP of 375 ms was determined by calculating the amount of time between each murine cardiac cycle. Under isoflurane anesthesia, the murine heart rate is approximately 450 beats per minute, or 7.5 beats per second (Ho et al., 2011). At a PRP of 375, there is one roughly one ultrasonic pulse for every two cardiac cycles, which allows for the capillary networks of the placenta to be replenished with microbubbles circulating in the bloodstream. We empirically determined that a PRP of 375 ms is suitable for placental sonoporation.
61 The duty cycle is a function of both the pulse duration and pulse repetition period. It is a percentage that expresses the on time to total time. In Figure 3.6, the duty cycle is 40% and is calculated by:
����� �������� ���� ����� = ����� ���������� ������
Duty cycle can be used to calculate the total amount of time of ultrasound emission exposure by multiplying it with the exposure time.
Exposure time is the total amount of time of treatment. For this project, an exposure time of 60 s was empirically determined. Longer exposure times resulted in negative biological effects and shorter exposure times resulted in lower transgene expression. In this project, a duty cycle of 4% was used, as calculated by dividing the pulse duration (15 ms) by the PRP (375 ms).
I addition to the above properties of ultrasound waves, there are two parameters that are important to measure before conducting sonoporation experiments. The peak negative pressure (PNP) is the lowest acoustic measurement that is recorded in a wave. In Figure 3.6, the
PNP is the pressure output (recorded on a hydrophone) that corresponds to the lowest voltage input, -100 V. PNP is directly dependent on the input voltage; increasing the voltage input increases the PNP.
Lastly, the mechanical index (MI) is a value used to measure the mechanical or shear stress introduced to a target tissue when applying ultrasound and is used as a measurement to reduce bioeffects in ultrasound-based treatments. MI is calculated by the following equation:
��� (�� ���) �� = �(�� ���)
62 Where f is the frequency of the transducer. An MI value of 0.7 is the threshold for inertial cavitation (Duck, 2007). A MI value of 1.9 is the maximum allowed by the National Institute of
Health (Şen et al., 2015). With the ultrasound transducers used in this project, the MI is calculated as the PNP divided by 1, since the frequency is in MHz. Therefore, in our system, the MI always equivalent to the PNP.
63 3.3 Materials and Methods
3.3.1 Transducer Characterization
The ultrasound transducers used in this project have some manufacturing tolerances and hence do not all emit the same pressure output in response for a given voltage input. For this reason, a characterization of each transducer needs to be performed before use to determine the appropriate input voltage to use during the sonoporation experiments. Transducer characterization requires specific equipment and software needed. The equipment can be divided into two parts: the transmission equipment and the recording equipment. The characterization equipment used in for this project are as follows:
Transmission equipment:
- Ultrasound Transducers
o 0.25” pencil transducer (General Electric, part number 113- 221-340)
o 0.5” immersible transducer (Olympus, part number I4-0108-S-SU U8420054).
- Waveform Generator (Keithley, model 3390, 50MHz Arbitrary Waveform Generator)
- Amplifier (Electronics & Innovation, LTD, NY, USA, model 150, 53 db Rf Amplifier)
- 2 X 50 W Coaxial Cable with BNC (Bayonet Neill-Concelman) connection
Recording Equipment:
- Hydrophone (Olympus)
o DC Block Adapter (Olympus)
- Water Tank
- Oscilloscope (Tektronix, TBS 1064 Oscilloscope)
- Computer
64 o USB-A to USB connection
o Matlab
o Excel
- 50 W Coaxial Cable with BNC (Bayonet Neill-Concelman) connection
To conduct a characterization experiment, the equipment must be set up in the configuration shown in Figure 3.7. In this figure, the arrows show the direction of the electrical and mechanical signals that are transmitted during the characterization process. The wave generator and Rf amplifier were connected to an AC power source. A 50 W coaxial cable was connecting the output terminal of the wave generator with the input terminal of the Rf amplifier. A second 50 W coaxial cable connected the output terminal of the Rf amplifier to the ultrasound transducer. This concluded the physical setup of the transmission equipment.
Transducer Hydrophone
Amplifier Oscilloscope
Wave Computer Generator
Figure 3.7 Transducer Characterization Setup. A graphic flow-chart showing the flow of electrical and mechanical signal through the transducer characterization setup.
65 To set up the recording equipment, the computer, oscilloscope, and hydrophone DC block adapter was connected to a power source. The computer was connected to the oscilloscope via a USB connector. The oscilloscope was then connected to the hydrophone DC block adapter
(included with the hydrophone) that was then plugged into the first terminal of the oscilloscope.
The hydrophone was submerged in a water tank to await measurement recording. The hydrophone was placed at a distance of 1 cm, which was the focal point calculated.
Initially, transducer characterization was performed using a continuous ultrasound wave.
However, we noticed that higher voltage inputs may damage the transducer, as identified by reduced or non-existent function post-characterization. For this reason, we changed the characterization protocol to record measurements while the transducer was in burst mode.
Burst parameters were empirically determined with the initial guidance of literature. The ultrasound wave generator was set to emit a pulse duration of 15 ms with a pulse repetition period of 375 ms. A series of pressure output recordings needed to be taken to at different input voltages to characterize the transducers behavior in our system. Briefly, the ultrasound transducer was positioned 1 cm from the hydrophone face and was turned on. The MatLab recording code was started (approximately 15 second run time). After the code saved the data in excel sheets, the measurement was repeated at a higher voltage input until the desired pressure output was reached.
66 3.3.2 Microbubble Preparation
Stock Solution
The phospholipid microbubbles were generated using a modified protocol adapted from
Walton et al. (Walton et al., 2011). A stock solution was prepared by combining 50 mg of DPPE
(1,2-dipalmityol-sn-glycero-3 phosphatidylethanolamine, Sigma-Aldrich), 200 mg of DPPC (1,2- dipalmityol-sn-glycero-3 phosphatidylcholine, Sigma-Aldrich), 1 g of glucose (Sigma-Aldrich), and sterile PBS (phosphate-buffered saline) in a 15 mL Falcon tube. The stock ingredients were then heated in a boiling water bath for 1 h, mixing by pipetting every 5 min, until the microbubble stock ingredients had completely dissolved.
DNA/Microbubble Solution Preparation
To generate the DNA conjugated microbubbles, 250 µL of microbubble stock was incubated in a 40°C water bath for 15 min. 50 uL of 100% Glycerol was pipetted with a cut pipette tip into a 1.5 mL microcentrifuge tube. The warmed microbubble stock was transferred into the tube containing glycerol. One mg of the desired plasmid was added to the tube and PBS was added to a final volume of 1 mL. Octofluoropropane gas was added to replace the microcentrifuge tube airspace. The tube was then placed in a dental amalgamator and shaken for 15 seconds at 4500
RPM. The shaken DNA/microbubble solution is kept on ice and can be used up to 2 h post- preparation.
3.3.3 Mouse Preparation
Mice were anesthetized in an isoflurane vaporizer chamber. Isoflurane at 5% and 3% was used for induction and for sustained anesthetization, respectively. For liver sonoporations, Nair was
67 used to remove the hair from the desired location. Nair was rubbed into the coat of the mouse and allowed to set for 30 seconds. Nair and hair were removed, and then area was cleaned with
70% ethanol. Mice were placed in the isoflurane chamber to await sonoporation. Care was taken not to allow mice to be anesthetized for more than 15 min.
3.3.4 Ultrasound Equipment Setup
The wave generator and Rf amplifier were plugged into a AC power source. A 50 W coaxial cable was connected to the output terminal of the wave generator. The other end of the coaxial cable was then attached to the input terminal of the Rf amplifier. Another 50 W coaxial cable was then plugged into the output terminal of the Rf amplifier and the other end connected to the ultrasound transducer. The wave generator and Rf amplifier were powered on and the desired sonoporation parameters were set on the wave generator.
Wave Generator Parameters
3.3.5 Intravenous Administration of Microbubbles
Syringe Preparation
In preparation for the intravenous injection, a 1 mL syringe (BD) was loaded with 150 uL of DNA/microbubble solution. A 30 G needle is then affixed to the tip of the syringe. Air was removed from the needle’s dead space and the needle was filled with the injectate. Following injection, the remaining microbubble solution was then returned to the tube containing the
DNA/microbubble solution, the tube was gently mixed, and the syringe and needle were then
68 refilled. This ensured consistent mixing of the DNA and microbubbles for uniform loading, as the
DNA/microbubble solution separates into layers as it sits on ice.
3.3.6 Heart Injection
One method of intravenous administration of the DNA/microbubble solution was by intracardiac, left-ventricular injection. To achieve this method, a 20 kHz imaging transducer was placed over the chest of an anesthetized, hairless mouse to visualize the left cardiac ventricle in the parasternal long axis view. Using the imaging transducer to for guidance, the needle was inserted into the chest cavity with the bevel facing up. DNA/MB solution (50 uL) was injected in the left ventricle. Injectate was allowed to exit the ventricular cavity before slow removal of the needle.
3.3.7 Retroorbital Injection
Proparacaine was administered to the right eye of anesthetized mice. With the mouse on its abdomen, the right eye was forced to protrude by pulling back on the skin surrounding the eye socket with gentle pressure. Retro-orbital injection was achieved by inserting the needle with bevel away from the eye at a 30-45o angle through the conjunctiva of the medial canthus.
Injection into the retro orbital sinus was confirmed by echocardiography until injections were mastered.
69 3.3.8 Sonoporation
Immediately after intravenous administration of the DNA/microbubble solution, ultrasound gel was applied to the skin surface that covering the target organ. The ultrasound transducer was placed onto the ultrasound gel and the ultrasound treatment was initialized. The sonoporation transducer was moved over the target area using small circular motions (circles of about 1.5 times the diameter of the transducer face). The transducer was held directly over the target area for various exposure times. After the desired exposure time, the transducer was removed from the target area and the output on the wave generator was shut off.
3.3.9 Bioluminescence Verification of Sonoporation
Twenty-four hours after sonoporation, mice were injected with 7.5mg of D-luciferin (200 uL of D-luciferin at a concentration of 37.5 mg/mL) intraperitoneally. Care was taken to take a shallow angle to not harm fetuses during D-luciferin administration. Mice were anesthetized 8 min after injection. After two min, mice were transferred to the In Vivo Imaging System (IVIS,
Perkin Elmer). Exposure time, binning, and aperture settings were set on auto for whole animal and ex vivo images. Imaging was recorded in radiance so that images taken at with different settings could be compared together.
3.3.10 Placenta and Fetus Collection
After bioluminescent imaging, fetuses and placentas were placed in microcentrifuge tubes containing 1 mL of RNA Later. Care was taken to submerge tissues in at least 5 volumes of
70 RNA Later (w/v) for downstream molecular analysis. Samples were stored at RT until the following procedures were executed.
3.2.11 DNA Extraction from Sonoporation Treated Placentas
Extracted placentas and fetuses were placed in 1.2 mL of DirectPCR Lysis Buffer (Tail) freshly mixed with 0.3 mg/mL of proteinase K. Tubes were capped and secured with parafilm and were incubated in a rotating hybridization oven overnight at 55°C. The following morning, rotation was stopped, and the tubes were set at the bottom of the hybridization oven and incubated for 1 h at 85°C to inactivate the proteinase K. Lysates were mixed by inverting each tube and then centrifuged for 30 s at 10,000 x g. Lysates were stored at 4°C until used for PCR.
3.2.12 Quantitative Polymerase Chain Reaction for Plasmid Detection
Crude lysates were analyzed for plasmid detection by qPCR using SYBR Green Master Mix
(Millipore). 5 uL of SYBR Green Master Mix was combined with 0.4 uL each of 10 uM forward primers reverse primers, 100ng of crude lysate DNA, and H2O to a final volume of 10 uL per reaction. Primers for detection of Luciferase was used for plasmid detection and primer for detection of 18S ribosomal RNA sequence was used for housekeeping. The qPCR results were obtained from QuantStudio Software and statistical analyses were performed on Excel.
71 3.4 Results
3.4.1 Sonoporation Equipment Validation in Liver
The aim of this project was to determine optimal sonoporation parameters that would induce placental plasmid uptake and transgene expression following treatment. To start, we needed to use an organ that has been proven to be treatable with sonoporation. Efficient and repeatable sonoporation results has been produced in the liver (C. D. Anderson et al., 2016).
Given the large size and anatomy of the liver (being highly vascularized, similar to the placenta), it proved to be a suitable control organ to validate our sonoporation equipment. As a reporter, we used a luciferase expression plasmid under a CMV promoter. Figure 3.8 shows a successful liver sonoporation, validating that our sonoporation setup was sufficient in achieving consistent plasmid delivery to a target organ.
Figure 3.8 Luciferase Expression in the Livers of Treated Mice. Photo showing luciferase expression 24 hours after sonoporation treatment with luciferase expression plasmid.
72 3.4.2 Sonoporation in Placentas
After confirming that our sonoporation setup was efficiently and consistently delivering plasmids to the liver, we then attempted to deliver plasmids to the placentas of pregnant dams at 14.5 dpc. Figure 3.9 shows images of successful placental gene delivery, detected by localized luciferase expression in placentas only, but not in the fetuses.
Figure 3.9 Luciferase Expression in Placentas of Treated Mice. Series of photos showing placenta specific expression of luciferase reporter gene following treatment with sonoporation. Scale is measured in units of photons per seconds per square centimeter per steradian (p/sec/cm2/sr).
3.4.3 Quantification of Plasmid Delivery in Sonoporation Treated Placentas
We then sought to quantify the amount of plasmid that was delivered to the placentas during the sonoporation trials. Four pairs of fetuses and placentas from treated and untreated dams were analyzed for presence of a 120 bp section of the luciferase reporter gene. The
73 quantitative PCR results in Figure 3.10 show the fold-change value for each of the four groups
(n=4 per group). All fold-change values were normalized to the untreated placenta group. The results indicate that treated placentas had an average fold-change value of 22, while all other groups were relatively close to 1, confirming the presence of delivered plasmid through sonoporation.
We then constructed a standard curve to interpolate the quantity of plasmid delivered in each tissue. Using the standard curve, we calculated an average of 12 ug of plasmid DNA was delivered to the four treated placentas.
32.80961463 23.7437341 23.20226285 change value change - Fold 7.987617799 1.204484782 1.096428176 0.939587087 0.805900557 0.760963214 0.68027581 0.575106939 0.559900024 0.502777346 0.406706374 0.319482145 0.341074091
Treated 1Placentas Untreated2 Placentas Treated3 Fetuses Untreated4 Fetuses
Figure 3.10 Fold-Change Values of Treated and Untreated Placentas and Fetuses. Graph showing four groups evaluated for presence of luciferase plasmid in crude lysates. The expression levels for all groups were normalized to the untreated placentas group.
74 3.4.3 Success Rate of Placental Sonoporation
Table 2 shows a summary of 9 most recent placental sonoporation trials. In the far-right column, percentages of luciferase positive placentas were calculated per treated animal. The last row (bold) of Table 2 displays the average percentage of luciferase positive placentas following sonoporation treatment. This data demonstrates that we currently achieve almost an 80% success rate in delivering plasmids to the placenta.
Table 2: Percentage of Luciferase Positive Placentas
Trial Number Number of Total Placentas Percentage of Luciferase Positive in Litter Luciferase Positive Placentas Placentas
1 8 9 88.89% 2 7 9 77.78% 3 5 9 55.56% 4 8 8 100.00% 5 7 10 70.00% 6 8 9 88.89% 7 7 10 70.00% 8 7 8 87.50% 9 5 7 71.43% Average (N=9) 62 79 78.48%
3.4.4 Parameters for Placental Sonoporation
There were multiple parameters that were crucial to achieve transgene expression in the placenta. Table 3 summarizes the parameters that were used to achieve the most efficient plasmid uptake while reducing unwanted bioeffects. Based on the calculations in the previous chapter, a pulse repetition period of 375 ms was used to allow for microbubble replenishment in
75 the capillary network of the murine placenta. A pulse duration of 15ms, which produces a duty cycle of 4%, was found to be acceptable in achieving placental plasmid uptake and transgene expression. A peak-to-peak voltage of 325 mV, which produced a total pressure output of 0.8MPa and a peak negative pressure of 0.9 MPa, was found to efficiently induce sonoporation of placental cells. The mechanical index at these settings was 0.9, which is well below the NIH recommended maximum of 1.9.
Table 3: Final Placental Ultrasound Parameters
Parameter Value Pulse Repetition Period 375 ms Pulse Duration 15 ms Duty Cycle 4% Peak-to-Peak Voltage 325 mVpp Total Pressure Output 0.8 MPa Peak Negative Pressure 0.9 Mpa Mechanical Index 0.9
76 Chapter 4 - Discussion
The use of transgenic animals has become a cornerstone for studying gene mechanism and function and modeling human disease. With the exploitation of cellular mechanisms such as transposition and RNAi, as well as advancement in knowledge regarding tissue-specific promoters, transgenesis has become a widely used tool in many fields of biology. In the first project of this thesis, we aimed to knock down steady-state mRNA levels of DEPTOR through
RNAi to effectively reduce DEPTOR protein levels and, subsequently, function in vivo. We therefore designed and constructed a GENIE-3 plasmid for te-PNI that included a DEPTOR shRNAmir within the transposon. To restrict expression of the transgene to the placenta, we used the trophoblast-specific promoter, Cyp19I.1. Using the transgenic mouse created IBR TMII Core with this plasmid, we demonstrated that trophoblast-specific knockdown of DEPTOR steady- state mRNA results in decreased placental DEPTOR protein levels and increased placental mTOR signaling and amino acid transport.
Transposase-enhanced pronuclear injection is a novel method of transgenesis that has been shown to have increased efficiency in generating transgenic animals (Marh et al., 2012b;
Urschitz & Moisyadi, 2013). The use of our plasmid construct is the first demonstrated use of te-
PNI for the study of placental gene regulation. Other approaches to in vivo placental gene modulation were conducted with lentiviruses, mainly through trophectoderm transfection in blastocysts (X. Fan et al., 2012; Georgiades et al., 2007; Tobita et al., 2017). The production of lentiviral vectors requires transfection of cell lines in order to yield enough product for use. This process is more time consuming and costly in comparison to the production of plasmids for te-
PNI, which requires just a small number of transformed bacteria to produce an adequate amount
77 of plasmid needed for transgenesis. Te-PNI has been shown to be about twice as efficient in producing transgenic animals when compared to lentiviral approaches (Marh et al., 2012b).
Additionally, lentiviruses tend to preferentially integrate into the introns of transcriptionally active genes causing insertional mutagenesis, has a limited maximum cargo size of 8 kb, and often induce immune responses (Annoni et al., 2019; Connoly, 2002). The piggyBac system, however, does not induces immunogenic responses and has a cargo size of up to 100kb. The relative simplicity, cost efficiency, and ability to overcome challenges seen in viral approaches. Te-PNI utilizing GENIE plasmids discussed in this thesis allow us to overcome the some of these challenges seen in viral approaches. Illustrate the utility of the novel transgenesis method.
We placed an emphasis on designing the plasmid construct in this project to have a great potential for adaptability to different gene targets, cell types, tissue types, and regulatory processes. For example, the GENIE-3 DEPTOR KD plasmid contains a DEPTOR 155 shRNAmir, which is embedded in the miR-E context (a miR-30 variant, mentioned in a previous section). A simple restriction enzyme digestion and ligation will allow for the replacement of the 97-mer sequence that governs the shRNAmir specificity, producing a plasmid that would knockdown any mRNA target sequence of interest. Conversely, replacement of the shRNAmir sequence with a gene of interest will result in a knock-in of the gene of interest. Furthermore, the trophoblast- specific promoter, Cyp19.I.1 can be replaced with other trophoblast-specific promoters that have been shown to restrict expression to different time points in pregnancy or localized regions within trophoblast cells, aiding in the study of various aspects of placental health. Finally, any other cell- or tissue-specific promoter that restricts transgene expression to a specific region of the body can be used to substitute Cyp19.I.1 in the construct.
78 The variation of the plasmid constructed in this project is currently being assembled to facilitate the upregulation of Large Neutral Amino Acid Transporter Small Subunit 1, LAT1. LAT1 mediates the transfer of essential amino acids and thyroid hormones through System L transport
(Friesema et al., 2001; Ritchie & Taylor, 2001). System L amino acid transport in the placenta has been shown to be decreased in human IUGR (Thomas Jansson et al., 1998b; Paolini et al., 2001) and increased in fetal overgrowth (Thomas Jansson et al., 2002). Importantly, global LAT1 knockout results in embryonic lethality by E11.5 (Perez-Garcia et al., 2018). As Ohgaki et al reported disrupted development of the placental labyrinth, responsible for nutrient and gas exchange, in the Lat1−/− placenta it is possible that embryonic lethality is due to placental defect caused by the LAT1 global knockout (Ohgaki et al., 2017). To evaluate whether overexpression of placenta LAT1 can rescue embryonic lethality, a transgenic mouse line with placental LAT1 upregulation will be generated and bred with the global LAT1 knockout mouse line.
Most importantly, aside from the technical advances achieved in this part of the project, the mouse line generated provided valuable insight on the link between DEPTOR regulation and mTOR signaling, amino acid transport, and fetal growth. In response to placental DEPTOR knockdown, we observed an increase in mTORC1/2 signaling (confirmed by increased levels of phosphorylated of downstream targets of both complexes), amino acid transport (confirmed by increased levels of phosphorylated LAT1 and SNAT2 transporters and amino acid System A and
System L uptake), and fetal weight.
The results of this project were obtained in lean mice fed a normal diet. To further study the effect of DEPTOR knockdown on IUGR, the mouse line can be used in conjunction with a MNR diet, which is an effective method for inducing IUGR in animal models (Gaccioli & Lager, 2016).
79 Should DEPTOR KD mice on a nutrient restricted diet produce normalized fetal birthweight, then it can be concluded that DEPTOR may play a key regulatory role in the normalization mTOR expression and consequently fetal growth.
The findings in this first project illustrate that DEPTOR acts as an in vivo regulator of mTOR signaling. mTOR signaling is known to promote cellular processes involved in cell proliferation, growth, and fetal development and also has be directly correlated with fetal growth abnormalities such as macrosomia or IUGR. Ultimately, this suggests that DEPTOR is a promising molecular target for the regulation and normalization of mTOR signaling, and thus treatment for macrosomia or IUGR. This potential for DEPTOR to be used as a therapeutic gene target holds great promise, especially when combined with current advancements in gene therapy techniques such as sonoporation, the focus of the second project of this thesis.
The use of non-viral DNA vectors for gene therapy in the clinic is continuing to rise (Hardee et al., 2017). Many approved nonviral DNA clinical therapies include the use of naked plasmid
DNA (Ramamoorth & Narvekar, 2015). There are many areas of active research devoted to uncovering chemical and physical methods to aid in DNA uptake into target tissue. Sonoporation offers a novel, minimally invasive method for combining both lipid microbubble DNA carriers and ultrasound, for site-specific plasmid transfection. For the second project of this thesis, we aimed to optimize sonoporation parameters for placental plasmid delivery. We demonstrated that ultrasound induced vector uptake is feasible for the placenta, confirmed by in vivo bioluminescent luciferase detection and plasmid detection via semi-quantitative PCR. To date, just one publication has reported the use of sonoporation in the placenta, which was in a non- human primate, baboon model (Babischkin et al., 2019). In a report from Frazier et al. on
80 sonoporation induced plasmid delivery to the heart, the group discussed the potential for placental adaptation of the technique but did not go as far as to perform any experiments (Frazier et al., 2019). Plasmid transfer to the placentas in litter-bearing animals is difficult to achieve, due to the differences in litter size and placental orientation and location within the abdominal cavity
(Frazier et al., 2020). However, sonoporation to placentas in lower order animals such as rodents hold much value in research. Given their low cost, fast generational time, and previous use as research models in countless studies, mice provide an excellent tool for the study of genetic diseases in a whole animal model.
Of the sonoporation parameters we have modified, three were found to be the most critical for the success of the sonoporation trials in this study; the input voltage, the method of injection, and the distance between the transducer face and the target tissue. The degree of luciferase expression was directly dependent on the input voltage. We observed a nearly 10-fold decrease in luciferase expression in target tissue in response to an 100 mV decrease in input voltage. Additionally, we noted that input levels higher than what we currently are using may sometimes lead to unwanted bioeffects, discussed further below.
For this technique, IV injection is needed to administer the microbubble/DNA solution into the bloodstream in order for it to reach the target organ. We first utilized left ventricular cardiac injection as our main method of IV administration. In this approach, as noted by myself and previous lab members who have worked on this project, the heart injection was the one of the most critical steps in the entire procedure. The response to the IV injection differed by mouse; some mice exhibited an extremely reduced heart function (visualized with an ultrasound imaging transducer), which led to extended recovery times and a small percentage of mortality. When we
81 changed the intravenous administration method to retro-orbital injections (ROI), a much more consistent response and recovery time from every mouse undergoing the procedure was observed. Additionally, ROI relinquish the need for expensive equipment required for ultrasound imaging, which is needed to conduct intracardiac injections.
Another main factor was the distance between the transducer face and the target tissue.
Initially, we conducted sonoporation experiments while moving the transducer just above the skin of the abdomen. Based on our calculations, holding the transducer at this height would put its natural focus in the plane of the placentas. However, upon examination of the abdominal cavity of multiple dams, we noticed that the fetuses are almost always oriented toward ventral and lateral surfaces, while the placentas are oriented dorsal to the fetuses. Blood, and many other tissues have a very similar attenuation of ultrasound waves as water. Bone, on the other hand, has more than a two-fold higher attenuation. We believe that the bones of the developing fetuses were absorbing some of the ultrasound waves, reducing the level of microbubble cavitation and gene delivery. We therefore switched to lightly pressing the transducer into the abdomen, essentially trying to nudge past the fetuses and into the abdominal cavity. This approach resulted in greatly improved plasmid delivery to the placenta. The improvements of these three aforementioned parameters are what attributed most significantly to the success of our most recent sonoporation trials, in which almost 80% of treated placentas exhibited transgene expression.
An important finding in this study was that luciferase expression was only detected in the placentas, and not the fetuses of the treated mice. Studies evaluating the effects of microbubbles in contrast imaging found that contrast agents do not cross the placental barrier. This was
82 confirmed by several groups who noted the absence of contrast in rat umbilical arteries after IV contrast agent administration (Arthuis et al., 2013; Hua et al., 2009; Roberts & Frias, 2020). This finding is critical for the advancement and acceptance of sonoporation as a gene delivery technique in pregnancy because it clearly demonstrates an important safety aspect of this procedure. As microbubbles do not cross the placental barrier, the microbubble-bound vector
DNA will be also not be transferred to the fetus, minimizing the risk of genetic manipulation to the fetus. Additionally, placental genetic modification to improve fetal health is advantageous as the genomes of neither the mother nor the fetus is being modified, and the placenta will often be discarded at birth.
One limitation of this technique is the potential adverse side effects of microbubble destruction and, subsequently, the possibility of inducing damage to the target tissue, here the syncytiotrophoblasts. Microbubbles under high acoustic pressure, as it is in the sonoporation technique, have multiple mechanisms by which they can cavitate. Fluid microstreaming in response to ultrasound increase the mechanical stress in its surrounding environment, such as for endothelial cells. Reports have shown that ultrasound in conjunction with microbubbles result in increased cell permeability and holes in the plasma membrane (Eleanor Stride & Saffari, 2003).
Others have reported cell membrane damage and production of reactive oxygens species (Basta et al., 2003; Miller & Quddus, 2000). Membrane integrity post-treatment has been shown to restored after 120 min in trials where ultrasound and microbubbles were used to break the blood-brain barrier (Xie et al., 2008), which illustrates that the body is able to overcome the bioeffects induced by sonoporation and microbubbles cavitation. Ultrasound applied to contrast agents also produce heat in the biological system (Wu, 1998). In addition to the parameters that
83 were outlined in a previous section, the thermal index (TI) may be an additional parameter to consider when conducting sonoporation trials.
The sonoporation technique has room for improvement in terms of efficiency and safety before being used in the clinical setting. In our experiments, we, at times, have observed changes in livers or placenta color, which may be indicative or heat or mechanical damage to the tissue.
In addition, we also observed that some fetuses exhibited signs of reabsorption. This points us toward the need to further investigate the bioeffects of the sonoporation delivery. The main aim in this project was to achieve transgene expression in our tissue of interest, the placenta. Here, we have demonstrated the efficient delivery and consistent expression of reporter genes in the placenta. Hence, the next steps should be to reduce sonoporation parameters while still achieving placental transgene expression. Reports have shown successful sonoporation in livers and hearts using lower mechanical indexes of 0.6 MPa and lower duty cycles of 0.025% (Cynthia
D. Anderson et al., 2013; Frazier et al., 2019), which are much lower in comparison to our values reported in a previous section. Additionally, trials reducing total tissue exposure time will also aid in reducing any unforeseen bioeffects. Furthermore, histological and cytokine analyses can provide more insight into structural damage and inflammatory responses as a result of sonoporation.
The sonoporation technique could further be improved with a few changes in the DNA construct as well as the application of recent advancements in microbubble and ultrasound technology. DNA components can be altered to display tissue specificity. In this project, we attempted to deliver plasmids with transgenes under the placental promoter, Cyp19I.1.
Unfortunately, we did not achieve transgene expression in these trials. However, use of tissue
84 specific promoters is not out of question. In fact, the use of tissue specific promoters in conjunction with microbubbles and ultrasound have the most promise to translate into the clinic.
Reducing unspecific expression is one of the central concerns behind any gene therapy technique. To overcome this shortfall, we can implement the use of other placenta specific promoters that have been reported to have trophoblast specific expression, such as PLAC1, HLA-
C, or DSCR4(Abd Ellah et al., 2015; Asai et al., 2008; Johnson et al., 2018). Additionally, human placentas are much larger than mice, making them easier to target.
The use of monodisperse microbubbles can aid in reducing variability in microbubble reactivity to ultrasound. The frequency required to induce microbubble cavitation, as mentioned in a previous section, is heavily dependent on the size of the microbubbles. For our microbubble preparations, the microbubbles are produced in a dental amalgamator, generating bubbles from
1.2 to 3 um in diameter. This discrepancy in size could result in microbubbles responding sub- optimally or remain unaffected in response a single ultrasound frequency. Recently, advances in monofluidic technology allowed for the production of microbubble contrast agent size to be attuned to a single resonance frequency (Segers et al., 2019). A report using these monodisperse microbubbles in rats and pigs found that imaging sensitivity was 10 to 15 times greater compared to that of commonly used polydisperse microbubble contrast agents. Additionally, microbubbles produced with tissue specific ligands embedded in the microbubble shell may aid in tissue targeting and site-specificity of the sonoporation technique. This finding provides a strong rationale behind the adaptation of new advancements to microbubble technology to ultrasound gene delivery.
85 Recent advancements in technology may also increase the safety of the sonoporation. For the technique to be adaptable for human therapy, monitoring of microbubble destruction using imaging technology, such as Magnetic Resonance Imaging (MRI), Computerized Tomography
(CT), or ultrasound imaging can be used in conjunction with sonoporation to achieve image coupled sonoporation. In addition to image coupling, these technologies can be used to monitor heat production in real time. To closely monitor the effects of microbubble gene delivery, cavitation detection has been implemented in multiple experimental setups (Eleanor Stride et al., 2020). Cavitation detection measures gas formation and cavitation by measuring the feedback emitted from tissue undergoing sonoporation.
There is great potential of the sonoporation technique in the placenta in its application to research. Currently, the most commonly used method to study gene modulation in the placenta require the use of transgenic animals, as in the first project of this thesis. The use of transgenic animals, however, require a significant amount of time and resources to generate and, subsequently, breed the colony. The use nonviral plasmid with placental specificity in te-PNI or lentiviral transfection of the trophectoderm both are utilized for transgenic animal generation for placental studies. Both methods require embryo manipulation and transfer into surrogate mice. Sonoporation offers an alternative approach, by allowing for the manipulation of placental genes in adult animals, bypassing the need for embryo transfection and manipulation and reducing the time from project conception to data collection.
In conjunction with the scientific premise of the first project of this thesis, sonoporation can provide additional insight on the mechanism of DEPTOR KD in vivo. As mentioned previously, mice kept on a MNR diet exhibit lower birth weight and fetal health complications apparent in
86 IUGR. By delivering the DEPTOR KD plasmid used to generate the DEPTOR KD mouse line (Figure
2.3) via sonoporation, a reversal of IUGR phenotype in the MNR induced IUGR mouse model would provide additional evidence in DEPTOR’s role in IUGR. This would not only show that value that sonoporation technique hold in its research application, but also in its potential for clinical translation. In August 2018, the U.S. Food and Drug Administration (FDA) announced the first approval of an RNAi based drug for the treatment of polyneuropathy, a rare, neurological disorder (Setten et al., 2019). In this light, the two projects outlined in this thesis pose a potential gene target and plasmid delivery method for the treatment of IUGR by RNAi.
87 Chapter 5 – Conclusion
The use of transgenic animals has provided the basis behind countless whole animal studies of gene modulation. In the Chapter 2 of this thesis, we utilized transgenic animals to study the regulatory role DEPTOR plays in the regulation of mTOR signaling, amino acid transport, and fetal growth. This led us to the conclusion that the knockdown of DEPTOR by RNAi is a promising method of the positive regulation of these important processes involved in fetal development.
In Chapter 3, we demonstrated feasibility of sonoporation to be used as a tool for placental plasmid delivery and gene modulation by reporting the successful transfection of approximately
80% of treated placentas. Collectively, the research conducted in this thesis highlight 1) DEPTOR as a promising molecular target for the treatment of IUGR and 2) sonoporation as a promising tool for not only the study of gene modulation in the placenta, but also as a potential treatment strategy in the future.
88 References
Abd Ellah, N., Taylor, L., Troja, W., Owens, K., Ayres, N., Pauletti, G., & Jones, H. (2015). Development of Non-Viral, Trophoblast-Specific Gene Delivery for Placental Therapy. PLOS ONE, 10(10), e0140879. https://doi.org/10.1371/journal.pone.0140879 Agha, M., & Agha, R. (2017). The rising prevalence of obesity. International Journal of Surgery Oncology, 2(7), e17. https://doi.org/10.1097/IJ9.0000000000000017 Anderson, C. D., Moisyadi, S., Avelar, A., Walton, C. B., & Shohet, R. V. (2016). Ultrasound- targeted hepatic delivery of factor IX in hemophiliac mice. Gene Therapy, 23(6), 510–519. https://doi.org/10.1038/gt.2016.23 Anderson, Cynthia D., Urschitz, J., Khemmani, M., Owens, J. B., Moisyadi, S., Shohet, R. V., & Walton, C. B. (2013). Ultrasound Directs a Transposase System for Durable Hepatic Gene Delivery in Mice. Ultrasound in Medicine and Biology, 39(12), 2351–2361. https://doi.org/10.1016/j.ultrasmedbio.2013.07.002 Annoni, A., Gregori, S., Naldini, L., & Cantore, A. (2019). Modulation of immune responses in lentiviral vector-mediated gene transfer. In Cellular Immunology (Vol. 342). Academic Press Inc. https://doi.org/10.1016/j.cellimm.2018.04.012 Apfel, R. E., & Holland, C. K. (1991). Gauging the likelihood of cavitation from short-pulse, low- duty cycle diagnostic ultrasound. Ultrasound in Medicine and Biology, 17(2), 179–185. https://doi.org/10.1016/0301-5629(91)90125-G Arthuis, C. J., Novell, A., Escoffre, J. M., Patat, F., Bouakaz, A., & Perrotin, F. (2013). New insights into uteroplacental perfusion: Quantitative analysis using Doppler and contrast-enhanced ultrasound imaging. Placenta, 34(5), 424–431. https://doi.org/10.1016/j.placenta.2013.01.019 Asai, S., Yamaki, A., Kudoh, J., Shimizu, N., & Shimizu, Y. (2008). Analysis of the promoter region of human placenta-specific DSCR4 gene. Biochimica et Biophysica Acta - Gene Regulatory Mechanisms, 1779(1), 40–50. https://doi.org/10.1016/j.bbagrm.2007.09.005 Babischkin, J. S., Aberdeen, G. W., Lindner, J. R., Bonagura, T. W., Pepe, G. J., & Albrecht, E. D. (2019). Vascular endothelial growth factor delivery to placental basal plate promotes uterine artery remodeling in the primate. Endocrinology, 160(6), 1492–1505. https://doi.org/10.1210/en.2019-00059 Balasubramanian, S., Rajendra, Y., Baldi, L., Hacker, D. L., & Wurm, F. M. (2016). Comparison of three transposons for the generation of highly productive recombinant CHO cell pools and cell lines. Biotechnology and Bioengineering, 113(6), 1234–1243. https://doi.org/10.1002/bit.25888 Barker, D. J. P., Godfrey, K. M., Gluckman, P. D., Harding, J. E., Owens, J. A., & Robinson, J. S. (1993). Fetal nutrition and cardiovascular disease in adult life. The Lancet, 341(8850), 938– 941. https://doi.org/10.1016/0140-6736(93)91224-A Baschat, A. A., & Hecher, K. (2004). Fetal Growth Restriction due to Placental Disease. Seminars in Perinatology, 28(1), 67–80. https://doi.org/10.1053/j.semperi.2003.10.014 Basta, G., Venneri, L., Lazzerini, G., Pasanisi, E., Pianelli, M., Vesentini, N., Del Turco, S., Kusmic, C., & Picano, E. (2003). In vitro modulation of intracellular oxidative stress of endothelial cells by diagnostic cardiac ultrasound. Cardiovascular Research, 58(1), 156–161.
89 https://doi.org/10.1016/S0008-6363(02)00665-X Bastarrachea, R. A., Chen, J., Kent, J. W., Nava-Gonzalez, E. J., Rodriguez-Ayala, E., Daadi, M. M., Jorge, B., Laviada-Molina, H., Comuzzie, A. G., Chen, S., & Grayburn, P. A. (2017). Engineering brown fat into skeletal muscle using ultrasound-targeted microbubble destruction gene delivery in obese Zucker rats: Proof of concept design. IUBMB Life, 69(9), 745–755. https://doi.org/10.1002/iub.1658 Baumann, M. U., Deborde, S., & Illsley, N. P. (2002). Placental glucose transfer and fetal growth. Endocrine, 19(1), 13–22. https://doi.org/10.1385/ENDO:19:1:13 Bekeredjian, R., Chen, S., Grayburn, P. A., & Shohet, R. V. (2005). Augmentation of cardiac protein delivery using ultrasound targeted microbubble destruction. Ultrasound in Medicine and Biology, 31(5), 687–691. https://doi.org/10.1016/j.ultrasmedbio.2004.08.002 Bez, M., Sheyn, D., Tawackoli, W., Avalos, P., Shapiro, G., Giaconi, J. C., Da, X., David, S. Ben, Gavrity, J., Awad, H. A., Bae, H. W., Ley, E. J., Kremen, T. J., Gazit, Z., Ferrara, K. W., Pelled, G., & Gazit, D. (2017). In situ bone tissue engineering via ultrasound-mediated gene delivery to endogenous progenitor cells in mini-pigs. Science Translational Medicine, 9(390). https://doi.org/10.1126/scitranslmed.aal3128 Biron-Shental, T., Schaiff, W. T., Ratajczak, C. K., Bildirici, I., Nelson, D. M., & Sadovsky, Y. (2007). Hypoxia regulates the expression of fatty acid-binding proteins in primary term human trophoblasts. American Journal of Obstetrics and Gynecology, 197(5), 516.e1-516.e6. https://doi.org/10.1016/j.ajog.2007.03.066 Black, R. E., Allen, L. H., Bhutta, Z. A., Caulfield, L. E., De Onis, M., Ezzati, M., Mathers, C., & Rivera, J. (n.d.). Series Maternal and Child Undernutrition 1 Maternal and child undernutrition: global and regional exposures and health consequences. https://doi.org/10.1016/S0140 Blomley, M. J. K., Cooke, J. C., Unger, E. C., Monaghan, M. J., & Cosgrove, D. O. (2001). Science, medicine, and the future: Microbubble contrast agents: A new era in ultrasound. In British Medical Journal (Vol. 322, Issue 7296, pp. 1222–1225). https://doi.org/10.1136/bmj.322.7296.1222 Bourque, G., Burns, K. H., Gehring, M., Gorbunova, V., Seluanov, A., Hammell, M., Imbeault, M., Izsvák, Z., Levin, H. L., Macfarlan, T. S., Mager, D. L., & Feschotte, C. (2018). Ten things you should know about transposable elements 06 Biological Sciences 0604 Genetics. Genome Biology, 19(1), 1–12. https://doi.org/10.1186/s13059-018-1577-z Brett, K. E., Ferraro, Z. M., Yockell-Lelievre, J., Gruslin, A., & Adamo, K. B. (2014). Maternal–Fetal nutrient transport in pregnancy pathologies: The role of the placenta. In International Journal of Molecular Sciences (Vol. 15, Issue 9, pp. 16153–16185). MDPI AG. https://doi.org/10.3390/ijms150916153 Campbell, F. M., Bush, P. G., Veerkamp, J. H., & Dutta-Roy, A. K. (1998). Detection and cellular localization of plasma membrane-associated and cytoplasmic fatty acid-binding proteins in human placenta. Placenta, 19(5–6), 409–415. https://doi.org/10.1016/S0143- 4004(98)90081-9 Chen, Y. Y., Rosario, F. J., Shehab, M. A., Powell, T. L., Gupta, M. B., & Jansson, T. (2015). Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR. Clinical Science, 129(12), 1131–1141.
90 https://doi.org/10.1042/CS20150511 Cleal, J. K., & Lewis, R. M. (2008). The Mechanisms and Regulation of Placental Amino Acid Transport to the Human Foetus. Journal of Neuroendocrinology, 20(4), 419–426. https://doi.org/10.1111/j.1365-2826.2008.01662.x Connoly, J. B. (2002). Lentiviruses in gene therapy clinical reseach. In Gene Therapy (Vol. 9, Issue 24, pp. 1730–1734). Gene Ther. https://doi.org/10.1038/sj.gt.3301893 Dayton, P. A., Morgan, K. E., Klibanov, A. L., Brandenburger, G. H., & Ferrara, K. W. (1999). Optical and acoustical observations of the effects of ultrasound on contrast agents. IEEE Transactions on Ultrasonics, Ferroelectrics, and Frequency Control, 46(1), 220–232. https://doi.org/10.1109/58.741536 Díaz, P., Powell, T. L., & Jansson, T. (2014). The role of placental nutrient sensing in maternal- fetal resource allocation. In Biology of Reproduction (Vol. 91, Issue 4, pp. 82–83). Society for the Study of Reproduction. https://doi.org/10.1095/biolreprod.114.121798 DIJKMANS, P., JUFFERMANS, L., MUSTERS, R., VANWAMEL, A., TENCATE, F., VANGILST, W., VISSER, C., DEJONG, N., & KAMP, O. (2004). Microbubbles and ultrasound: from diagnosis to therapy. European Journal of Echocardiography, 5(4), 245–256. https://doi.org/10.1016/j.euje.2004.02.001 Ding, S., Wu, X., Li, G., Han, M., Zhuang, Y., & Xu, T. (2005). Efficient transposition of the piggyBac (PB) transposon in mammalian cells and mice. Cell, 122(3), 473–483. https://doi.org/10.1016/j.cell.2005.07.013 Duck, F. A. (2007). Medical and non-medical protection standards for ultrasound and infrasound. In Progress in Biophysics and Molecular Biology (Vol. 93, Issues 1–3, pp. 176– 191). Pergamon. https://doi.org/10.1016/j.pbiomolbio.2006.07.008 Eckel, R. H., Grundy, S. M., & Zimmet, P. Z. (2005). The metabolic syndrome. In www.thelancet.com (Vol. 365). www.thelancet.com Eriksson, J. G. (2005). The fetal origins hypothesis—10 years on. In BMJ (Vol. 330, Issue 7500, pp. 1096–1097). BMJ Publishing Group. https://doi.org/10.1136/bmj.330.7500.1096 Fan, X., Petitt, M., Gamboa, M., Huang, M., Dhal, S., Druzin, M. L., Wu, J. C., Chen-Tsai, Y., & Nayak, N. R. (2012). Transient, inducible, placenta-specific gene expression in mice. Endocrinology, 153(11), 5637–5644. https://doi.org/10.1210/en.2012-1556 Fan, Z., Kumon, R. E., & Deng, C. X. (2014). Mechanisms of microbubble-facilitated sonoporation for drug and gene delivery. In Therapeutic Delivery (Vol. 5, Issue 4, pp. 467–486). Future Science Ltd. https://doi.org/10.4155/tde.14.10 Feichtinger, G. A., Hofmann, A. T., Slezak, P., Schuetzenberger, S., Kaipel, M., Schwartz, E., Neef, A., Nomikou, N., Nau, T., van Griensven, M., McHale, A. P., & Redl, H. (2014). Sonoporation Increases Therapeutic Efficacy of Inducible and Constitutive BMP2/7 In Vivo Gene Delivery. Human Gene Therapy Methods, 25(1), 57–71. https://doi.org/10.1089/hgtb.2013.113 Feldman, M. K., Katyal, S., & Blackwood, M. S. (2009). US artifacts. Radiographics, 29(4), 1179– 1189. https://doi.org/10.1148/rg.294085199 Fellmann, C., Hoffmann, T., Sridhar, V., Hopfgartner, B., Muhar, M., Roth, M., Lai, D. Y., Barbosa, I. A. M., Kwon, J. S., Guan, Y., Sinha, N., & Zuber, J. (2013). An optimized microRNA backbone for effective single-copy RNAi. Cell Reports, 5(6), 1704–1713. https://doi.org/10.1016/j.celrep.2013.11.020 Fishman, P. S., & Frenkel, V. (2017). Treatment of Movement Disorders With Focused
91 Ultrasound. Journal of Central Nervous System Disease, 9, 117957351770567. https://doi.org/10.1177/1179573517705670 Frazier, S., McBride, M. W., Mulvana, H., & Graham, D. (2020). From animal models to patients: The role of placental microRNAs, miR-210, miR-126, and miR-148a/152 in preeclampsia. In Clinical Science (Vol. 134, Issue 8, pp. 1001–1025). Portland Press Ltd. https://doi.org/10.1042/CS20200023 Frazier, S., Morgan, H., McBride, M., Bradshaw, A., Mulvana, H., & Graham, D. (2019). Ultrasound and Microbubble Gene Delivery for Targeting Altered Placental MicroRNAs in Preeclampsia. IEEE International Ultrasonics Symposium, IUS, 2019-October, 1551–1555. https://doi.org/10.1109/ULTSYM.2019.8926052 Friesema, E. C. H., Docter, R., Moerings, E. P. C. M., Verrey, F., Krenning, E. P., Hennemann, G., & Visser, T. J. (2001). Thyroid Hormone Transport by the Heterodimeric Human System L Amino Acid Transporter. Endocrinology, 142(10), 4339–4348. https://doi.org/10.1210/endo.142.10.8418 Gaccioli, F., & Lager, S. (2016). Placental nutrient transport and intrauterine growth restriction. In Frontiers in Physiology (Vol. 7, Issue FEB, p. 40). Frontiers Media S.A. https://doi.org/10.3389/fphys.2016.00040 Gao, W., Li, J. Z. H., Chan, J. Y. W., Ho, W. K., & Wong, T.-S. (2012). mTOR Pathway and mTOR Inhibitors in Head and Neck Cancer. ISRN Otolaryngology, 2012, 1–7. https://doi.org/10.5402/2012/953089 Garnica, A. D., & Chan, W. Y. (1996). The role of the placenta in fetal nutrition and growth. Journal of the American College of Nutrition, 15(3), 206–222. https://doi.org/10.1080/07315724.1996.10718591 Georgiades, P., Cox, B., Gertsenstein, M., Chawengsaksophak, K., & Rossant, J. (2007). Trophoblast-specific gene manipulation using lentivirus-based vectors. BioTechniques, 42(3), 317–325. https://doi.org/10.2144/000112341 Gillman, M. W. (1995). Mothers, Babies, and Disease in Later Life. BMJ, 310(6971), 68. https://doi.org/10.1136/bmj.310.6971.68a Glazier, J. D., Cetin, I., Perugino, G., Ronzoni, S., Grey, A. M., Mahendran, D., Marconi, A. M., Pardi, G., & Sibley, C. P. (1997). Association between the activity of the system A amino acid transporter in the microvillous plasma membrane of the human placenta and severity of fetal compromise in intrauterine growth restriction. Pediatric Research, 42(4), 514–519. https://doi.org/10.1203/00006450-199710000-00016 Gluckman, P. D., Hanson, M. A., Cooper, C., & Thornburg, K. L. (2008). Effect of in utero and early-life conditions on adult health and disease. In New England Journal of Medicine (Vol. 359, Issue 1, p. 61). Massachussetts Medical Society. https://doi.org/10.1056/NEJMra0708473 Grimm, D., Streetz, K. L., Jopling, C. L., Storm, T. A., Pandey, K., Davis, C. R., Marion, P., Salazar, F., & Kay, M. A. (2006). Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature, 441(7092), 537–541. https://doi.org/10.1038/nature04791 Gu, S., Jin, L., Zhang, Y., Huang, Y., Zhang, F., Valdmanis, P. N., & Kay, M. A. (2012). The loop position of shRNAs and pre-miRNAs is critical for the accuracy of dicer processing in vivo. Cell, 151(4), 900–911. https://doi.org/10.1016/j.cell.2012.09.042 Hannon, G. J., & Rossi, J. J. (2004). Unlocking the potential of the human genome with RNA
92 interference. In Nature (Vol. 431, Issue 7006, pp. 371–378). https://doi.org/10.1038/nature02870 Hardee, C. L., Arévalo-Soliz, L. M., Hornstein, B. D., & Zechiedrich, L. (2017). Advances in non- viral DNA vectors for gene therapy. In Genes (Vol. 8, Issue 2). MDPI AG. https://doi.org/10.3390/genes8020065 Herrera, E., & Ortega-Senovilla, H. (2014). Lipid Metabolism During Pregnancy and its Implications for Fetal Growth. Current Pharmaceutical Biotechnology, 15(1), 24–31. https://doi.org/10.2174/1389201015666140330192345 Ho, D., Zhao, X., Gao, S., Hong, C., Vatner, D. E., & Vatner, S. F. (2011). Heart Rate and Electrocardiography Monitoring in Mice. In Current Protocols in Mouse Biology (Vol. 1, p. 123). John Wiley & Sons, Inc. https://doi.org/10.1002/9780470942390.mo100159 Howell, K. R., & Powell, T. L. (2018). Effects of maternal obesity on placental function and fetal development. 153(3), 1–23. https://doi.org/10.1530/REP-16-0495.Effects Hua, X., Zhu, L. P., Li, R., Zhong, H., Xue, Y. F., & Chen, Z. H. (2009). Effects of Diagnostic Contrast-Enhanced Ultrasound on Permeability of Placental Barrier: A Primary Study. Placenta, 30(9), 780–784. https://doi.org/10.1016/j.placenta.2009.06.009 Ine De Cock — Laboratory of General Biochemistry and Physical Pharmacy. (n.d.). Retrieved April 12, 2021, from https://www.ugent.be/fw/pharmaceutics/biochemphypharm/en/team/inedc.htm Jansson, N., Pettersson, J., Haafiz, A., Ericsson, A., Palmberg, I., Tranberg, M., Ganapathy, V., Powell, T. L., & Jansson, T. (2006). Down-regulation of placental transport of amino acids precedes the development of intrauterine growth restriction in rats fed a low protein diet. Journal of Physiology, 576(2), 945–946. https://doi.org/10.1113/jphysiol.2006.109561 Jansson, T., Aye, I. L. M. H., & Goberdhan, D. C. I. (2012). The emerging role of mTORC1 signaling in placental nutrient-sensing. Placenta, 33(SUPPL. 2). https://doi.org/10.1016/j.placenta.2012.05.010 Jansson, T., Ylvén, K., Wennergren, M., & Powell, T. L. (2002). Glucose transport and system A activity in syncytiotrophoblast microvillous and basal plasma membranes in intrauterine growth restriction. Placenta, 23(5), 392–399. https://doi.org/10.1053/plac.2002.0826 Jansson, Thomas, Ekstrand, Y., Björn, C., Wennergren, M., & Powell, T. L. (2002). Alterations in the activity of placental amino acid transporters in pregnancies complicated by diabetes. Diabetes, 51(7), 2214–2219. https://doi.org/10.2337/diabetes.51.7.2214 Jansson, Thomas, Scholtbach, V., & Powell, T. L. (1998a). Placental transport of leucine and lysine is reduced in intrauterine growth restriction. Pediatric Research, 44(4), 532–537. https://doi.org/10.1203/00006450-199810000-00011 Jansson, Thomas, Scholtbach, V., & Powell, T. L. (1998b). Placental transport of leucine and lysine is reduced in intrauterine growth restriction. Pediatric Research, 44(4), 532–537. https://doi.org/10.1203/00006450-199810000-00011 Jewell, J. L., Russell, R. C., & Guan, K. L. (2013). Amino acid signalling upstream of mTOR. Nature Reviews Molecular Cell Biology, 14(3), 133–139. https://doi.org/10.1038/nrm3522 Jin, L., Li, F., Wang, H., Li, Y., Wei, F., & Du, L. (2013). Ultrasound-targeted microbubble destruction enhances gene transduction of adeno-associated virus in a less-permissive cell type, NIH/3T3. Molecular Medicine Reports, 8(2), 320–326. https://doi.org/10.3892/mmr.2013.1560
93 Johnson, J. K., Wright, P. W., Li, H., & Anderson, S. K. (2018). Identification of trophoblast- specific elements in the HLA-C core promoter. HLA, 92(5), 288–297. https://doi.org/10.1111/tan.13404 Kamat, A., & Mendelson, C. R. (2001). Identification of the regulatory regions of the human aromatase P450 (CYP19) gene involved in placenta-specific expression. Journal of Steroid Biochemistry and Molecular Biology, 79(1–5), 173–180. https://doi.org/10.1016/S0960- 0760(01)00156-X Kavitha, J. V., Rosario, F. J., Nijland, M. J., McDonald, T. J., Wu, G., Kanai, Y., Powell, T. L., Nathanielsz, P. W., & Jansson, T. (2014). Down-regulation of placental mTOR, insulin/IGF-I signaling, and nutrient transporters in response to maternal nutrient restriction in the baboon. The FASEB Journal, 28(3), 1294–1305. https://doi.org/10.1096/fj.13-242271 Kazantzis, M., & Stahl, A. (2012). Fatty acid transport proteins, implications in physiology and disease. In Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids (Vol. 1821, Issue 5, pp. 852–857). Elsevier. https://doi.org/10.1016/j.bbalip.2011.09.010 Khan, M. N., Rahman, M. M., Shariff, A. A., Rahman, M. M., Rahman, M. S., & Rahman, M. A. (2017). Maternal undernutrition and excessive body weight and risk of birth and health outcomes. Archives of Public Health, 75(1), 12. https://doi.org/10.1186/s13690-017-0181- 0 Kidima, W. B. (2015). Syncytiotrophoblast Functions and Fetal Growth Restriction during Placental Malaria: Updates and Implication for Future Interventions. In BioMed Research International (Vol. 2015). Hindawi Publishing Corporation. https://doi.org/10.1155/2015/451735 Kim, Y., Rhim, H., Choi, M. J., Lim, H. K., & Choi, D. (2008). High-Intensity Focused Ultrasound Therapy: an Overview for Radiologists. Korean Journal of Radiology, 9(4), 291. https://doi.org/10.3348/kjr.2008.9.4.291 Klibanov, A. L. (2006). Microbubble Contrast Agents. Investigative Radiology, 41(3), 354–362. https://doi.org/10.1097/01.rli.0000199292.88189.0f Knight, S., Collins, M., & Takeuchi, Y. (2013). Insertional Mutagenesis by Retroviral Vectors: Current Concepts and Methods of Analysis. Current Gene Therapy, 13(3), 211–227. https://doi.org/10.2174/1566523211313030006 Kogan, P., Gessner, R. C., & Dayton, P. A. (2010). Microbubbles in imaging: Applications beyond ultrasound. In Bubble Science, Engineering and Technology (Vol. 2, Issue 1, pp. 3–8). NIH Public Access. https://doi.org/10.1179/175889610X12730566149100 Kwon, E. J., & Kim, Y. J. (2017). What is fetal programming?: A lifetime health is under the control of in utero health. In Obstetrics and Gynecology Science (Vol. 60, Issue 6, pp. 506– 519). Korean Society of Obstetrics and Gynecology. https://doi.org/10.5468/ogs.2017.60.6.506 Lager, S., & Powell, T. L. (2012). Regulation of nutrient transport across the placenta. In Journal of Pregnancy (Vol. 2012). https://doi.org/10.1155/2012/179827 Li, M. A., Pettitt, S. J., Eckert, S., Ning, Z., Rice, S., Cadinanos, J., Yusa, K., Conte, N., & Bradley, A. (2013). The piggyBac Transposon Displays Local and Distant Reintegration Preferences and Can Cause Mutations at Noncanonical Integration Sites. Molecular and Cellular Biology, 33(7), 1317–1330. https://doi.org/10.1128/mcb.00670-12 Liu, Y. P., Haasnoot, J., ter Brake, O., Berkhout, B., & Konstantinova, P. (2008). Inhibition of HIV-
94 1 by multiple siRNAs expressed from a single microRNA polycistron. Nucleic Acids Research, 36(9), 2811–2824. https://doi.org/10.1093/nar/gkn109 Ma, N., & Hardy, D. B. (2012). The fetal origins of the metabolic syndrome: Can we intervene? In Journal of Pregnancy (Vol. 2012). https://doi.org/10.1155/2012/482690 Marciniak, A., Patro-Małysza, J., Kimber-Trojnar, Ż., Marciniak, B., Oleszczuk, J., & Leszczyńska- Gorzelak, B. (2017). Fetal programming of the metabolic syndrome. In Taiwanese Journal of Obstetrics and Gynecology (Vol. 56, Issue 2, pp. 133–138). Elsevier Ltd. https://doi.org/10.1016/j.tjog.2017.01.001 Marh, J., Stoytcheva, Z., Urschitz, J., Sugawara, A., Yamashiro, H., Owens, J. B., Stoytchev, I., Pelczar, P., Yanagimachi, R., & Moisyadi, S. (2012a). Hyperactive self-inactivating piggyBac for transposase-enhanced pronuclear microinjection transgenesis. Proceedings of the National Academy of Sciences of the United States of America, 109(47), 19184–19189. https://doi.org/10.1073/pnas.1216473109 Marh, J., Stoytcheva, Z., Urschitz, J., Sugawara, A., Yamashiro, H., Owens, J. B., Stoytchev, I., Pelczar, P., Yanagimachi, R., & Moisyadi, S. (2012b). Hyperactive self-inactivating piggyBac for transposase-enhanced pronuclear microinjection transgenesis. Proceedings of the National Academy of Sciences of the United States of America, 109(47), 19184–19189. https://doi.org/10.1073/pnas.1216473109 Meng, D., Frank, A. R., & Jewell, J. L. (2018). mTOR signaling in stem and progenitor cells. In Development (Cambridge) (Vol. 145, Issue 1). Company of Biologists Ltd. https://doi.org/10.1242/dev.152595 Merritt, W. M., Lin, Y. G., Han, L. Y., Kamat, A. A., Spannuth, W. A., Schmandt, R., Urbauer, D., Pennacchio, L. A., Cheng, J.-F., Nick, A. M., Deavers, M. T., Mourad-Zeidan, A., Wang, H., Mueller, P., Lenburg, M. E., Gray, J. W., Mok, S., Birrer, M. J., Lopez-Berestein, G., … Sood, A. K. (2008). Dicer, Drosha, and Outcomes in Patients with Ovarian Cancer. New England Journal of Medicine, 359(25), 2641–2650. https://doi.org/10.1056/NEJMoa0803785 Miao, C. H., & Brayman, A. A. (2005). Ultrasound-mediated gene delivery. In Sheng wu yi xue gong cheng xue za zhi = Journal of biomedical engineering = Shengwu yixue gongchengxue zazhi (Vol. 22, Issue 2, pp. 403–406). IntechOpen. https://doi.org/10.5772/21196 Miller, D. L., & Quddus, J. (2000). Sonoporation of monolayer cells by diagnostic ultrasound activation of contrast-agent gas bodies. Ultrasound in Medicine and Biology, 26(4), 661– 667. https://doi.org/10.1016/S0301-5629(99)00170-2 Mitragotri, S. (2005). Healing sound: The use of ultrasound in drug delivery and other therapeutic applications. Nature Reviews Drug Discovery, 4(3), 255–260. https://doi.org/10.1038/nrd1662 Miura, K., Okada, Y., Aoi, T., Okada, A., Takahashi, K., Okita, K., Nakagawa, M., Koyanagi, M., Tanabe, K., Ohnuki, M., Ogawa, D., Ikeda, E., Okano, H., & Yamanaka, S. (2009). Variation in the safety of induced pluripotent stem cell lines. Nature Biotechnology, 27(8), 743–745. https://doi.org/10.1038/nbt.1554 Mohr, S. E., & Perrimon, N. (2012). RNAi screening: new approaches, understandings, and organisms. Wiley Interdisciplinary Reviews: RNA, 3(2), 145–158. https://doi.org/10.1002/wrna.110 Mueckler, M., & Thorens, B. (2013). The SLC2 (GLUT) family of membrane transporters. In Molecular Aspects of Medicine (Vol. 34, Issues 2–3, pp. 121–138). Pergamon.
95 https://doi.org/10.1016/j.mam.2012.07.001 Muskula, P. R., & Main, M. L. (2017). Safety with Echocardiographic Contrast Agents. Circulation: Cardiovascular Imaging, 10(4). https://doi.org/10.1161/CIRCIMAGING.116.005459 Neitzke, U., Harder, T., & Plagemann, A. (2011). Intrauterine Growth Restriction and Developmental Programming of the Metabolic Syndrome: A Critical Appraisal. In Microcirculation (Vol. 18, Issue 4, pp. 304–311). Microcirculation. https://doi.org/10.1111/j.1549-8719.2011.00089.x Newman, C. M. H., & Bettinger, T. (2007). Gene therapy progress and prospects: Ultrasound for gene transfer. In Gene Therapy (Vol. 14, Issue 6, pp. 465–475). Gene Ther. https://doi.org/10.1038/sj.gt.3302925 Nondestructive Evaluation Techniques : Ultrasound. (n.d.). Retrieved April 11, 2021, from https://www.nde-ed.org/NDETechniques/Ultrasonics/Introduction/description.xhtml Norberg, S., Powell, T. L., & Jansson, T. (1998). Intrauterine growth restriction is associated with a reduced activity of placental taurine transporters. Pediatric Research, 44(2), 233–238. https://doi.org/10.1203/00006450-199808000-00016 Norwitz, E. R., Schust, D. J., & Fisher, S. J. (2001). Implantation and the Survival of Early Pregnancy. New England Journal of Medicine, 345(19), 1400–1408. https://doi.org/10.1056/nejmra000763 Ohgaki, R., Ohmori, T., Hara, S., Nakagomi, S., Kanai-Azuma, M., Kaneda-Nakashima, K., Okuda, S., Nagamori, S., & Kanai, Y. (2017). Essential Roles of L-Type Amino Acid Transporter 1 in Syncytiotrophoblast Development by Presenting Fusogenic 4F2hc. Molecular and Cellular Biology, 37(11). https://doi.org/10.1128/mcb.00427-16 Pantham, P., Rosario, F. J., Nijland, M., Cheung, A., Nathanielsz, P. W., Powell, T. L., Galan, H. L., Li, C., & Jansson, T. (2015). Reduced placental amino acid transport in response to maternal nutrient restriction in the baboon. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 309(7), R740–R746. https://doi.org/10.1152/ajpregu.00161.2015 Paolini, C. L., Marconi, A. M., Ronzoni, S., Di Noio, M., Fennessey, P. V., Pardi, G., & Battaglia, F. C. (2001). Placental transport of leucine, phenylalanine, glycine, and proline in intrauterine growth-restricted pregnancies. Journal of Clinical Endocrinology and Metabolism, 86(11), 5427–5432. https://doi.org/10.1210/jcem.86.11.8036 Perez-Garcia, V., Fineberg, E., Wilson, R., Murray, A., Mazzeo, C. I., Tudor, C., Sienerth, A., White, J. K., Tuck, E., Ryder, E. J., Gleeson, D., Siragher, E., Wardle-Jones, H., Staudt, N., Wali, N., Collins, J., Geyer, S., Busch-Nentwich, E. M., Galli, A., … Hemberger, M. (2018). Placentation defects are highly prevalent in embryonic lethal mouse mutants. Nature, 555(7697), 463–468. https://doi.org/10.1038/nature26002 Priante, E., Verlato, G., Giordano, G., Stocchero, M., Visentin, S., Mardegan, V., & Baraldi, E. (2019). Intrauterine growth restriction: New insight from the metabolomic approach. In Metabolites (Vol. 9, Issue 11). MDPI AG. https://doi.org/10.3390/metabo9110267 Price, R. J., Skyba, D. M., Kaul, S., & Skalak, T. C. (1998). Delivery of colloidal particles and red blood cells to tissue through microvessel ruptures created by targeted microbubble destruction with ultrasound. Circulation, 98(13), 1264–1267. https://doi.org/10.1161/01.CIR.98.13.1264
96 Ramamoorth, M., & Narvekar, A. (2015). Non viral vectors in gene therapy - An overview. In Journal of Clinical and Diagnostic Research (Vol. 9, Issue 1, pp. GE01–GE06). Journal of Clinical and Diagnostic Research. https://doi.org/10.7860/JCDR/2015/10443.5394 Raper, S. E., Chirmule, N., Lee, F. S., Wivel, N. A., Bagg, A., Gao, G. P., Wilson, J. M., & Batshaw, M. L. (2003). Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Molecular Genetics and Metabolism, 80(1–2), 148–158. https://doi.org/10.1016/j.ymgme.2003.08.016 Ritchie, J. W. A., & Taylor, P. M. (2001). Role of the System L permease LAT1 in amino acid and iodothyronine transport in placenta. Biochemical Journal, 356(3), 719–725. https://doi.org/10.1042/0264-6021:3560719 Roberti, S. L., Higa, R., White, V., Powell, T. L., Jansson, T., & Jawerbaum, A. (2018). Critical role of mTOR, PPARγ and PPARδ signaling in regulating early pregnancy decidual function, embryo viability and feto-placental growth. Molecular Human Reproduction, 24(6), 327– 340. https://doi.org/10.1093/molehr/gay013 Roberts, V. H. J., & Frias, A. E. (2020). Contrast-enhanced ultrasound for the assessment of placental development and function. In BioTechniques (Vol. 69, Issue 5, pp. 393–400). Future Science Ltd. https://doi.org/10.2144/btn-2020-0069 Roos, S., Kanai, Y., Prasad, P. D., Powell, T. L., & Jansson, T. (2009). Regulation of placental amino acid transporter activity by mammalian target of rapamycin. American Journal of Physiology-Cell Physiology, 296(1), C142–C150. https://doi.org/10.1152/ajpcell.00330.2008 Roos, Sara, Jansson, N., Palmberg, I., Säljö, K., Powell, T. L., & Jansson, T. (2007). Mammalian target of rapamycin in the human placenta regulates leucine transport and is down- regulated in restricted fetal growth. Journal of Physiology, 582(1), 449–459. https://doi.org/10.1113/jphysiol.2007.129676 Sadler, T. W. (2019). Langman’s Medical Embryology, 14e. Schilit, S. L. P., Ohtsuka, M., Quadros, R. M., & Gurumurthy, C. B. (2016). Pronuclear injection- based targeted transgenesis. Current Protocols in Human Genetics, 2016, 15.10.1-15.10.28. https://doi.org/10.1002/cphg.23 Schlabritz-Loutsevitch, N., Ballesteros, B., Dudley, C., Jenkins, S., Hubbard, G., Burton, G. J., & Nathanielsz, P. (2007). Moderate Maternal Nutrient Restriction, but not Glucocorticoid Administration, Leads to Placental Morphological Changes in the Baboon (Papio sp.). Placenta, 28(8–9), 783–793. https://doi.org/10.1016/j.placenta.2006.11.012 Segers, T., Lassus, A., Bussat, P., Gaud, E., & Frinking, P. (2019). Improved coalescence stability of monodisperse phospholipid-coated microbubbles formed by flow-focusing at elevated temperatures. Lab on a Chip, 19(1), 158–167. https://doi.org/10.1039/c8lc00886h Şen, T., Tüfekçioğlu, O., & Koza, Y. (2015). Mechanical index. Anadolu Kardiyoloji Dergisi, 15(4), 334–336. https://doi.org/10.5152/akd.2015.6061 Setten, R. L., Rossi, J. J., & Han, S. ping. (2019). The current state and future directions of RNAi- based therapeutics. In Nature Reviews Drug Discovery (Vol. 18, Issue 6, pp. 421–446). Nature Publishing Group. https://doi.org/10.1038/s41573-019-0017-4 Shapiro, G., Wong, A. W., Bez, M., Yang, F., Tam, S., Even, L., Sheyn, D., Ben-David, S., Tawackoli, W., Pelled, G., Ferrara, K. W., & Gazit, D. (2016). Multiparameter evaluation of in vivo gene delivery using ultrasound-guided, microbubble-enhanced sonoporation.
97 Journal of Controlled Release, 223, 157–164. https://doi.org/10.1016/j.jconrel.2015.12.001 Shaw, C. J., Ter Haar, G. R., Rivens, I. H., Giussani, D. A., & Lees, C. C. (2014). Pathophysiological mechanisms of high-intensity focused ultrasound-mediated vascular occlusion and relevance to non-invasive fetal surgery. In Journal of the Royal Society Interface (Vol. 11, Issue 95). Royal Society. https://doi.org/10.1098/rsif.2014.0029 Shibata, S., Kobayashi, E. H., Kobayashi, N., Oike, A., Okae, H., & Arima, T. (2020). Unique features and emerging in vitro models of human placental development. Reproductive Medicine and Biology, 19(4), 301–313. https://doi.org/10.1002/rmb2.12347 Sirohi, R. S. (2020). Optical beam collimation procedures and collimation testing: a summary. Optical Engineering, 59(04), 1. https://doi.org/10.1117/1.OE.59.4.040801 Sirsi, S. R., & Borden, M. A. (2009). Microbubble compositions, properties and biomedical applications. In Bubble Science, Engineering and Technology (Vol. 1, Issues 1–2, pp. 3–17). NIH Public Access. https://doi.org/10.1179/175889709X446507 Skyba, D. M., Price, R. J., Linka, A. Z., Skalak, T. C., & Kaul, S. (1998). Direct in vivo visualization of intravascular destruction of microbubbles by ultrasound and its local effects on tissue. Circulation, 98(4), 290–293. https://doi.org/10.1161/01.CIR.98.4.290 Slade, N. (2001). Viral vectors in gene therapy. Periodicum Biologorum, 103(2), 139–143. https://doi.org/10.3390/diseases6020042 Smale, S. T. (2010). Luciferase assay. Cold Spring Harbor Protocols, 5(5). https://doi.org/10.1101/pdb.prot5421 Song, S., Noble, M., Sun, S., Chen, L., Brayman, A. A., & Miao, C. H. (2012). Efficient microbubble- and ultrasound-mediated plasmid DNA delivery into a specific rat liver lobe via a targeted injection and acoustic exposure using a novel ultrasound system. Molecular Pharmaceutics, 9(8), 2187–2196. https://doi.org/10.1021/mp300037t Stein, Z., & Susser, M. (1975). The Dutch Famine, 1944–1945, and the Reproductive Process. I. Effects on Six Indices at Birth. Pediatric Research, 9(2), 70–76. https://doi.org/10.1203/00006450-197502000-00003 Stride, E., & Saffari, N. (2003). Microbubble ultrasound contrast agents: A review. Proceedings of the Institution of Mechanical Engineers, Part H: Journal of Engineering in Medicine, 217(6), 429–447. https://doi.org/10.1243/09544110360729072 Stride, Eleanor, & Saffari, N. (2003). On the destruction of microbubble ultrasound contrast agents. Ultrasound in Medicine and Biology, 29(4), 563–573. https://doi.org/10.1016/S0301-5629(02)00787-1 Stride, Eleanor, Segers, T., Lajoinie, G., Cherkaoui, S., Bettinger, T., Versluis, M., & Borden, M. (2020). Microbubble Agents: New Directions. In Ultrasound in Medicine and Biology (Vol. 46, Issue 6, pp. 1326–1343). Elsevier USA. https://doi.org/10.1016/j.ultrasmedbio.2020.01.027 Svensson-Arvelund, J. (2015). Immune regulation at the fetal-maternal interface with focus on decidual macrophages (Vol. 1448). Linköping University Electronic Press. https://doi.org/10.3384/diss.diva-117183 Swaminathan, S., Hemalatha, R., Pandey, A., Kassebaum, N. J., Laxmaiah, A., Longvah, T., Lodha, R., Ramji, S., Kumar, G. A., Afshin, A., Gupta, S. S., Kar, A., Khera, A. K., Mathai, M., Awasthi, S., Rasaily, R., Varghese, C. M., Millear, A. I., Manguerra, H., … Dandona, L. (2019). The burden of child and maternal malnutrition and trends in its indicators in the states of India:
98 the Global Burden of Disease Study 1990–2017. The Lancet Child and Adolescent Health, 3(12), 855–870. https://doi.org/10.1016/S2352-4642(19)30273-1 Ter Haar, G., Shaw, A., Pye, S., Ward, B., Bottomley, F., Nolan, R., & Coady, A. M. (2011). Guidance on Reporting Ultrasound Exposure Conditions for Bio-Effects Studies. In Ultrasound in Medicine and Biology (Vol. 37, Issue 2, pp. 177–183). Ultrasound Med Biol. https://doi.org/10.1016/j.ultrasmedbio.2010.10.021 Tichy, E. D., Pillai, R., Deng, L., Liang, L., Tischfield, J., Schwemberger, S. J., Babcock, G. F., & Stambrook, P. J. (2010). Mouse embryonic stem cells, but not somatic cells, predominantly use homologous recombination to repair double-strand DNA breaks. Stem Cells and Development, 19(11), 1699–1711. https://doi.org/10.1089/scd.2010.0058 Tobita, T., Kiyozumi, D., & Ikawa, M. (2017). Placenta-specific gene manipulation using lentiviral vector and its application. Placenta, 59, S37–S43. https://doi.org/10.1016/j.placenta.2017.09.012 Tomizawa, M. (2013a). Sonoporation: Gene transfer using ultrasound. World Journal of Methodology, 3(4), 39. https://doi.org/10.5662/wjm.v3.i4.39 Tomizawa, M. (2013b). Sonoporation: Gene transfer using ultrasound. World Journal of Methodology, 3(4), 39. https://doi.org/10.5662/wjm.v3.i4.39 Ultrasound Beam Shape & Focusing. (n.d.). Retrieved April 13, 2021, from https://e- echocardiography.com/page/page.php?UID=1429454181 Urschitz, J., Kawasumi, M., Owens, J., Morozumi, K., Yamashiro, H., Stoytchev, I., Marh, J., Dee, J. A., Kawamoto, K., Coates, C. J., Kaminski, J. M., Pelczar, P., Yanagimachi, R., & Moisyadi, S. (2010). Helper-independent piggyBac plasmids for gene delivery approaches: Strategies for avoiding potential genotoxic effects. Proceedings of the National Academy of Sciences of the United States of America, 107(18), 8117–8122. https://doi.org/10.1073/pnas.1003674107 Urschitz, J., & Moisyadi, S. (2013). Transpositional transgenesis with piggyBac . Mobile Genetic Elements, 3(3), e25167. https://doi.org/10.4161/mge.25167 Walton, C. B., Anderson, C. D., Boulay, R., & Shohet, R. V. (2011). Introduction to the ultrasound targeted microbubble destruction technique. Journal of Visualized Experiments, 52. https://doi.org/10.3791/2963 Wei, K., Skyba, D. M., Firschke, C., Jayaweera, A. R., Lindner, J. R., & Kaul, S. (1997). Interactions between microbubbles and ultrasound: In vitro and in vivo observations. Journal of the American College of Cardiology, 29(5), 1081–1088. https://doi.org/10.1016/S0735- 1097(97)00029-6 Wells, D. J. (2010). Electroporation and ultrasound enhanced non-viral gene delivery in vitro and in vivo. In Cell Biology and Toxicology (Vol. 26, Issue 1, pp. 21–28). https://doi.org/10.1007/s10565-009-9144-8 Wenzel, P. L., & Leone, G. (2007). Expression of Cre recombinase in early diploid trophoblast cells of the mouse placenta. Genesis, 45(3), 129–134. https://doi.org/10.1002/dvg.20276 Wilson, J., & Wilson, J. G. (1999). The Barker Hypothesis. An analysis. Australian and New Zealand Journal of Obstetrics and Gynaecology, 39(1), 1–7. https://doi.org/10.1111/j.1479- 828X.1999.tb03432.x Wilson, M. H., Coates, C. J., & George, A. L. (2007). PiggyBac transposon-mediated gene transfer in human cells. Molecular Therapy, 15(1), 139–145. https://doi.org/10.1038/sj.mt.6300028
99 Woods, L., Perez-Garcia, V., & Hemberger, M. (2018). Regulation of Placental Development and Its Impact on Fetal Growth—New Insights From Mouse Models. Frontiers in Endocrinology, 9, 570. https://doi.org/10.3389/fendo.2018.00570 Wu, J. (1998). Temperature rise generated ultrasound in the presence of contrast agent. Ultrasound in Medicine and Biology, 24(2), 267–274. https://doi.org/10.1016/S0301- 5629(97)00246-9 Xie, F., Boska, M. D., Lof, J., Uberti, M. G., Tsutsui, J. M., & Porter, T. R. (2008). Effects of Transcranial Ultrasound and Intravenous Microbubbles on Blood Brain Barrier Permeability in a Large Animal Model. Ultrasound in Medicine and Biology, 34(12), 2028–2034. https://doi.org/10.1016/j.ultrasmedbio.2008.05.004 Yang, S.-L., Tang, K.-Q., Tao, J.-J., Wan, A.-H., Lin, Y.-D., Nan, S.-L., Guo, Q.-K., Shen, Z. Y., & Hu, B. (2016). Delivery of CD151 by Ultrasound Microbubbles in Rabbit Myocardial Infarction. Cardiology, 135(4), 221–227. https://doi.org/10.1159/000446639 Zeitlin, J., El Ayoubi, M., Jarreau, P. H., Draper, E. S., Blondel, B., Künzel, W., Cuttini, M., Kaminski, M., Gortner, L., Van Reempts, P., Kollée, L., & Papiernik, E. (2010). Impact of fetal growth restriction on mortality and morbidity in a very preterm birth cohort. Journal of Pediatrics, 157(5). https://doi.org/10.1016/j.jpeds.2010.05.002 Zeng, Y., Wagner, E. J., & Cullen, B. R. (2002). Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Molecular Cell, 9(6), 1327–1333. https://doi.org/10.1016/S1097-2765(02)00541-5 Zhao, S., Jiang, E., Chen, S., Gu, Y., Shangguan, A. J., Lv, T., Luo, L., & Yu, Z. (2016). PiggyBac transposon vectors: The tools of the human gene encoding. In Translational Lung Cancer Research (Vol. 5, Issue 1, pp. 120–125). AME Publishing Company. https://doi.org/10.3978/j.issn.2218-6751.2016.01.05
100