University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Papers and Publications in Animal Science Animal Science Department 2006 Characterization of 35 Microsatellite Loci in the Pacific Lion-Paw Scallop (Nodipecten subnodosus) and Their rC oss-Species Amplification in Four Other Scallops of the Pectinidae Family Ana M. Ibarra Centro de Investigaciones Biológicas del Noroeste S.C., [email protected] Jessica Lynn Petersen University of Nebraska-Lincoln, [email protected] Thomas R. Famula University of California - Davis Bernie May University of California - Davis Follow this and additional works at: http://digitalcommons.unl.edu/animalscifacpub Part of the Aquaculture and Fisheries Commons, Biodiversity Commons, Cellular and Molecular Physiology Commons, Marine Biology Commons, Molecular Genetics Commons, and the Zoology Commons Ibarra, Ana M.; Petersen, Jessica Lynn; Famula, Thomas R.; and May, Bernie, "Characterization of 35 Microsatellite Loci in the Pacific Lion-Paw Scallop (Nodipecten subnodosus) and Their rC oss-Species Amplification in Four Other Scallops of the Pectinidae Family" (2006). Faculty Papers and Publications in Animal Science. 819. http://digitalcommons.unl.edu/animalscifacpub/819 This Article is brought to you for free and open access by the Animal Science Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Papers and Publications in Animal Science by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Published in Molecular Ecology Notes (2006) 6: 153-156. DOI: 10.1111/j.1471-8286.2005.01173.x. Copyright 2006, Wiley. Used by permission. PRIMER NOTE Characterization of 35 Microsatellite Loci in the Pacific Lion-Paw Scallop (Nodipecten subnodosus) and Their Cross-Species Amplification in Four Other Scallops of the Pectinidae Family Ana M. Ibarra,1 Jessica L. Petersen,2 Thomas R. Famula,2 and Bernie May2 1Aquaculture Genetics Laboratory, Centro de Investigaciones Biológicas del Noroeste S.C., La Paz B.C.S., México (Corresponding author: [email protected]) 2Department of Animal Science, University of California-Davis, Davis, California, USA Abstract Four microsatellite-enriched DNA libraries yielded 35 microsatellite loci from 100 primer pairs designed for Pacific lion-paw scallop,Nodipecten subnodosus. The number of alleles ranged from four to 28. Three of the 35 loci were not in Hardy–Weinberg equilibrium and linkage disequi- librium was found for one pair of loci. These microsatellites will be used to analyze the popula- tion structure of the species in Mexico’s Baja Peninsula to propose management strategies for scallop aquaculture development. Twenty-six primer pairs cross-amplified inNodipecten nodo- sus, whereas none (Argopecten ventricosus) or few cross-amplified in theArgopecten species. Keywords: Argopecten, Guerrero Negro — Ojo de Liebre lagoon, Microsatellite, Primers Article history: Received July 13, 2005; revision accepted August 25, 2005. The lion-paw scallop, Nodipecten (Lyropecten) subno- sequenced (n = 170) from this mixed DNA by Genetic dosus, is the largest scallop species found in the tropi- Identification Services (Chatsworth) according to Mer- cal waters of the East Pacific (Peña 2001). In Mexico, edith & May (2002) and Schwartz & May (2004). One it is harvested on the Pacific and Gulf of California hundred and four primers were designed using PRIM- sides of the Baja California Peninsula and on the coast ERSELECT 4.0 (DNA Star Inc.) at the GVL of Univer- of Sonora state. The largest population is found in the sity of California-Davis. lagoon of Ojo de Liebre, which is part of the Guerrero To determine if loci amplified in scallop or crayfish, Negro lagoon system on the Pacific side of the Baja primers were first tested on four scallops from the same Peninsula. A fundamental question for the optimal de- wild population. All 35 ‘positive’ primers for the scal- velopment of lion-paw scallop aquaculture is whether lop were screened on 30 individuals, including 25 from populations native to different lagoons are genetically Ojo de Liebre lagoon on the Pacific side of the Baja Cal- distinct. We isolated and characterized microsatellite ifornia Peninsula, and five from Bahia de La Paz, on loci that will allow for the analysis of population struc- the Gulf of California side of the peninsula. We further ture, from which optimum management strategies for tested these primers for cross-amplification of the mi- aquaculture ventures can be proposed. These markers crosatellite loci in five to six individuals of each of the will also allow for evaluation of optimum spawning following scallop species: Argopecten irradians (USA, strategies for hatcheries that minimize genetic drift and west Atlantic), Argopecten purpuratus (Chile, east Pa- inbreeding in this functional hermaphrodite species. cific), Argopecten ventricosus (Mexico, east Pacific) and Whole genomic DNA was extracted using QIAGEN’s Nodipecten nodosus (Venezuela, west Atlantic). DNA DNeasy Tissue Kit from adductor muscle of wild lion- was extracted from muscle tissue preserved in 70% paw scallops naturally settled at Bahia de La Paz. DNA alcohol (A. irradians and A. ventricosus), or from dried obtained from four scallops and 18 crayfish, the last adductor muscle tissue (A. purpuratus and N. nodosus). also being studied in the Genomic Variation Labora- Polymerase chain reaction (PCR) was performed us- tory (GVL), were mixed in equal concentrations prior ing 5 ng of genomic DNA, 1 × Taq DNA polymerase to library construction. Four libraries enriched for tet- buffer B, 2.0 mm MgCl2, 0.2 mm of each dNTP, 1 µm ra- and trinucleotide repeat motifs (TAGA)n, (TGAC)n, of each primer and 0.38 U Taq DNA polymerase (all (TACA)n and (ATC)n were constructed, screened and reagents from Promega), with a total PCR volume pairs) andfor for seen was cross-amplification lantic species from the same genus. The next largest loci in primer pairs that successfully amplified polymorphic amplified in all the cross-amplified species. None of theveloped, primers nine (25%) resulted in no amplification for four species are in Table 2. Of the 35 primer pairs de comparisons ( significance and a Bonferroni correction for multiple vent within locus disequilibrium from affecting and the pairwise LD was found only between loci pability for this functional hermaphrodite. Significant ca self-fertilizing the of because mating nonrandom or is not known if these deviations are due to null alleles tion, were not in HWE after applying a Bonferroni correc was evaluated with the Fisher’s exact test. Three loci gda program (Lewis & Zaykin 2001), and significance Deviations from HWE and LD were calculated using we present number of alleles and their lagoon. size For ranges. the five individuals from Bahíacalculated from Lathe 25 individuals from Ojo Paz, de Liebre locus. Observed and expected heterozygosities were tifs are specific to the one sequenced clonerium for(LD), each are presented in Table 1. The repeat mo Weinberg equilibrium (HWE) and linkage disequilib their polymorphism data and analyses for Hardy– a standard400bpladder(TheGelCompany). with comparison by estimated were sizes Product 595. and scanned with a Molecular Dynamics FluorImager Green™-agarose overlay protocol (Rodzen et al. 1998) Amplified products were visualized using the Sybr- 5% denaturing polyacrylamide gel at 50 W for 70 min. a on separated were Samples min. 2–3 for ice on chilled mide loading buffer, denatured at 95 °C for 2 min and amplified products were diluted 1:1 with 98% forma The equipment. and reagents same the using min, 2 for for 45 s with a 0.5 °C decrease each cycle, and 72 1 °C min followed by 30 cycles at 95 °C for 1 min, 67 °C subnodosus producing multiple-bands in the primary species ( 72 °C for 5 min, and held at 4 °C. For for those cross-amplifications),primers 72 °C for 30 s, followed by min, 30 cycles at 94 °C for 30 s, 56 °C for 30 2.30 for °C 94 conditions: following the s under PTC-100 (53 °C of 10 µL. PCR was carried out using an MJ Research 154 Results of cross-amplification of primers on the other the on primers of cross-amplification of Results The primer sequences amplifying in NsubC262 NsubA007 N. subnodosus ), we performed touchdown PCR: 95 °C for A. ventricosus P A. purpuratus following a test using genotypes to pre to genotypes using test a following , =0.0014). NsubA010 amplified in . Twenty-six (74%) of the 35 and (sevenprimer pairs). NsubB215 A. irradians A. N. nodosus N. subnodosus , although it (11 primer (11 NsubA223 , the At N. - - - - - - - - , I BARRA Table 1 Characterization of 35 microsatellite loci in lion-paw scallop (Nodipecten subnodosus) from Lagoon Ojo de Liebre (OL) within the Guerrero Negro lagoons system and Bahia de La Paz, Mexico. GenBank , P Accession nos, primer sequences, repeat motif, loci amplified using touchdown PCR, number of individuals genotyped, number of alleles, gel estimated allele size range (bp), observed and expected heterozygosities, ETERSEN and test for conformance to Hardy-Weinberg equilibrium for the Ojo de Liebre lagoon. Allele number and size ranges for Bahía de La Paz Locus GenBank Primer sequence (5'-3') TD n Repeat motif No. of Gel estimated allele H H P(HWE) & Bahía de La Paz (n = 5) O E , F Accession no. PCR alleles size range (bp) significance(1) no. of alleles (size range) AMULA NsubA001 DQ108619 F: GAGGATGACAGTGTGAAGATG + 23 (TGA)3 TTA(TGA)9 4 285–300 0.65 0.54 0.6166 4 (285–300) & R: CACAAAACAGAATGTGTGAAGA