DOCSLIB.ORG

<I>Nodipecten Subnodosus</I>

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
<I>Nodipecten Subnodosus</I> University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Papers and Publications in Animal Science Animal Science Department 2006 Characterization of 35 Microsatellite Loci in the Pacific Lion-Paw Scallop (Nodipecten subnodosus) and Their rC oss-Species Amplification in Four Other Scallops of the Pectinidae Family Ana M. Ibarra Centro de Investigaciones Biológicas del Noroeste S.C., [email protected] Jessica Lynn Petersen University of Nebraska-Lincoln, [email protected] Thomas R. Famula University of California - Davis Bernie May University of California - Davis Follow this and additional works at: http://digitalcommons.unl.edu/animalscifacpub Part of the Aquaculture and Fisheries Commons, Biodiversity Commons, Cellular and Molecular Physiology Commons, Marine Biology Commons, Molecular Genetics Commons, and the Zoology Commons Ibarra, Ana M.; Petersen, Jessica Lynn; Famula, Thomas R.; and May, Bernie, "Characterization of 35 Microsatellite Loci in the Pacific Lion-Paw Scallop (Nodipecten subnodosus) and Their rC oss-Species Amplification in Four Other Scallops of the Pectinidae Family" (2006). Faculty Papers and Publications in Animal Science. 819. http://digitalcommons.unl.edu/animalscifacpub/819 This Article is brought to you for free and open access by the Animal Science Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Papers and Publications in Animal Science by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Published in Molecular Ecology Notes (2006) 6: 153-156. DOI: 10.1111/j.1471-8286.2005.01173.x. Copyright 2006, Wiley. Used by permission. PRIMER NOTE Characterization of 35 Microsatellite Loci in the Pacific Lion-Paw Scallop (Nodipecten subnodosus) and Their Cross-Species Amplification in Four Other Scallops of the Pectinidae Family Ana M. Ibarra,1 Jessica L. Petersen,2 Thomas R. Famula,2 and Bernie May2 1Aquaculture Genetics Laboratory, Centro de Investigaciones Biológicas del Noroeste S.C., La Paz B.C.S., México (Corresponding author: [email protected]) 2Department of Animal Science, University of California-Davis, Davis, California, USA Abstract Four microsatellite-enriched DNA libraries yielded 35 microsatellite loci from 100 primer pairs designed for Pacific lion-paw scallop,Nodipecten subnodosus. The number of alleles ranged from four to 28. Three of the 35 loci were not in Hardy–Weinberg equilibrium and linkage disequi- librium was found for one pair of loci. These microsatellites will be used to analyze the popula- tion structure of the species in Mexico’s Baja Peninsula to propose management strategies for scallop aquaculture development. Twenty-six primer pairs cross-amplified inNodipecten nodo- sus, whereas none (Argopecten ventricosus) or few cross-amplified in theArgopecten species. Keywords: Argopecten, Guerrero Negro — Ojo de Liebre lagoon, Microsatellite, Primers Article history: Received July 13, 2005; revision accepted August 25, 2005. The lion-paw scallop, Nodipecten (Lyropecten) subno- sequenced (n = 170) from this mixed DNA by Genetic dosus, is the largest scallop species found in the tropi- Identification Services (Chatsworth) according to Mer- cal waters of the East Pacific (Peña 2001). In Mexico, edith & May (2002) and Schwartz & May (2004). One it is harvested on the Pacific and Gulf of California hundred and four primers were designed using PRIM- sides of the Baja California Peninsula and on the coast ERSELECT 4.0 (DNA Star Inc.) at the GVL of Univer- of Sonora state. The largest population is found in the sity of California-Davis. lagoon of Ojo de Liebre, which is part of the Guerrero To determine if loci amplified in scallop or crayfish, Negro lagoon system on the Pacific side of the Baja primers were first tested on four scallops from the same Peninsula. A fundamental question for the optimal de- wild population. All 35 ‘positive’ primers for the scal- velopment of lion-paw scallop aquaculture is whether lop were screened on 30 individuals, including 25 from populations native to different lagoons are genetically Ojo de Liebre lagoon on the Pacific side of the Baja Cal- distinct. We isolated and characterized microsatellite ifornia Peninsula, and five from Bahia de La Paz, on loci that will allow for the analysis of population struc- the Gulf of California side of the peninsula. We further ture, from which optimum management strategies for tested these primers for cross-amplification of the mi- aquaculture ventures can be proposed. These markers crosatellite loci in five to six individuals of each of the will also allow for evaluation of optimum spawning following scallop species: Argopecten irradians (USA, strategies for hatcheries that minimize genetic drift and west Atlantic), Argopecten purpuratus (Chile, east Pa- inbreeding in this functional hermaphrodite species. cific), Argopecten ventricosus (Mexico, east Pacific) and Whole genomic DNA was extracted using QIAGEN’s Nodipecten nodosus (Venezuela, west Atlantic). DNA DNeasy Tissue Kit from adductor muscle of wild lion- was extracted from muscle tissue preserved in 70% paw scallops naturally settled at Bahia de La Paz. DNA alcohol (A. irradians and A. ventricosus), or from dried obtained from four scallops and 18 crayfish, the last adductor muscle tissue (A. purpuratus and N. nodosus). also being studied in the Genomic Variation Labora- Polymerase chain reaction (PCR) was performed us- tory (GVL), were mixed in equal concentrations prior ing 5 ng of genomic DNA, 1 × Taq DNA polymerase to library construction. Four libraries enriched for tet- buffer B, 2.0 mm MgCl2, 0.2 mm of each dNTP, 1 µm ra- and trinucleotide repeat motifs (TAGA)n, (TGAC)n, of each primer and 0.38 U Taq DNA polymerase (all (TACA)n and (ATC)n were constructed, screened and reagents from Promega), with a total PCR volume pairs) andfor for seen was cross-amplification lantic species from the same genus. The next largest loci in primer pairs that successfully amplified polymorphic amplified in all the cross-amplified species. None of theveloped, primers nine (25%) resulted in no amplification for four species are in Table 2. Of the 35 primer pairs de comparisons ( significance and a Bonferroni correction for multiple vent within locus disequilibrium from affecting and the pairwise LD was found only between loci pability for this functional hermaphrodite. Significant ca self-fertilizing the of because mating nonrandom or is not known if these deviations are due to null alleles tion, were not in HWE after applying a Bonferroni correc was evaluated with the Fisher’s exact test. Three loci gda program (Lewis & Zaykin 2001), and significance Deviations from HWE and LD were calculated using we present number of alleles and their lagoon. size For ranges. the five individuals from Bahíacalculated from Lathe 25 individuals from Ojo Paz, de Liebre locus. Observed and expected heterozygosities were tifs are specific to the one sequenced clonerium for(LD), each are presented in Table 1. The repeat mo Weinberg equilibrium (HWE) and linkage disequilib their polymorphism data and analyses for Hardy– a standard400bpladder(TheGelCompany). with comparison by estimated were sizes Product 595. and scanned with a Molecular Dynamics FluorImager Green™-agarose overlay protocol (Rodzen et al. 1998) Amplified products were visualized using the Sybr- 5% denaturing polyacrylamide gel at 50 W for 70 min. a on separated were Samples min. 2–3 for ice on chilled mide loading buffer, denatured at 95 °C for 2 min and amplified products were diluted 1:1 with 98% forma The equipment. and reagents same the using min, 2 for for 45 s with a 0.5 °C decrease each cycle, and 72 1 °C min followed by 30 cycles at 95 °C for 1 min, 67 °C subnodosus producing multiple-bands in the primary species ( 72 °C for 5 min, and held at 4 °C. For for those cross-amplifications),primers 72 °C for 30 s, followed by min, 30 cycles at 94 °C for 30 s, 56 °C for 30 2.30 for °C 94 conditions: following the s under PTC-100 (53 °C of 10 µL. PCR was carried out using an MJ Research 154 Results of cross-amplification of primers on the other the on primers of cross-amplification of Results The primer sequences amplifying in NsubC262 NsubA007 N. subnodosus ), we performed touchdown PCR: 95 °C for A. ventricosus P A. purpuratus following a test using genotypes to pre to genotypes using test a following , =0.0014). NsubA010 amplified in . Twenty-six (74%) of the 35 and (sevenprimer pairs). NsubB215 A. irradians A. N. nodosus N. subnodosus , although it (11 primer (11 NsubA223 , the At N. - - - - - - - - , I BARRA Table 1 Characterization of 35 microsatellite loci in lion-paw scallop (Nodipecten subnodosus) from Lagoon Ojo de Liebre (OL) within the Guerrero Negro lagoons system and Bahia de La Paz, Mexico. GenBank , P Accession nos, primer sequences, repeat motif, loci amplified using touchdown PCR, number of individuals genotyped, number of alleles, gel estimated allele size range (bp), observed and expected heterozygosities, ETERSEN and test for conformance to Hardy-Weinberg equilibrium for the Ojo de Liebre lagoon. Allele number and size ranges for Bahía de La Paz Locus GenBank Primer sequence (5'-3') TD n Repeat motif No. of Gel estimated allele H H P(HWE) & Bahía de La Paz (n = 5) O E , F Accession no. PCR alleles size range (bp) significance(1) no. of alleles (size range) AMULA NsubA001 DQ108619 F: GAGGATGACAGTGTGAAGATG + 23 (TGA)3 TTA(TGA)9 4 285–300 0.65 0.54 0.6166 4 (285–300) & R: CACAAAACAGAATGTGTGAAGA
Load more

Recommended publications
  • Notes on the Growth, Survival, and Reproduction of the Lion's Paw
    Notes on the growth, survival, and reproduction of the lion’s paw scallop Nodipecten subnodosus maintained in a suspended culture Notas sobre el crecimiento, sobrevivencia y reproducción de la almeja mano de león Nodipecten subnodosus en cultivo en suspensión Marcial Villalejo-Fuerte1, Marcial Arellano-Martínez1, Miguel Robles-Mungaray2, and Bertha Patricia Ceballos-Vázquez1 1Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacional, Apartado Postal 592, La Paz, B.C.S. 23000, México Tel. +52(612)1225344 2Centro de Investigaciones Biológicas del Noroeste, Apdo. Postal 128, La Paz, Baja California Sur, 23000, México Tel. +52(612)1253633 ext. 144; Fax +52(612)1254715 E mail: [email protected] Villalejo-Fuerte, M. y M. Arellano-Martínez, M. Robles-Mungaray and B. P. Ceballos-Vázquez, 2004. Notes on the growth, survival, and reproduction of the lion’s paw scallop Nodipecten subnodosus maintained in a suspended culture. Hidrobiologica 14 (2): 161-165 Abstract.The study was conducted from March 1999 to Palabras clave: Pectinidae, pectinidos, cultivo, Golfo de November 2002 in a suspended culture located in Bahía California Juncalito, Gulf of California, Mexico. Nodipecten The lion’s paw scallop N. subnodosus (Sowerby, 1835) is subnodosus (Sowerby, 1835) is a species with fast growth distributed from the Laguna Guerrero Negro, Baja California (ø=3.91) and alometric, with a seasonality of 0.78 and an Sur, Mexico (including the Gulf of California) to Peru (Keen, amplitude of 0.8. Its growth was described by the von 1971). It is the largest of all pectinid species, reaching a Bertalanffy model. An average growth rate of 4 mm/month maximum length of 218 mm (Félix-Pico et al., 1999).
    [Show full text]
  • Carotenoid Extraction from the Gonad of the Scallop Nodipecten Nodosus
    Carotenoid extraction from the gonad of the scallop Nodipecten nodosus (Linnaeus, 1758) (Bivalvia: Pectinidae) Suhnel, S.a*, Lagreze, F.a, Ferreira, JF.a Campestrini, LH.b and Maraschin, M.b* aLaboratório de Moluscos Marinhos, Universidade Federal de Santa Catarina – UFSC Servidão dos Coroas, s/n, Barra da Lagoa, CEP 88061-600, Florianópolis, SC, Brazil bLaboratório de Morfogênese e Bioquímica Vegetal, Universidade Federal de Santa Catarina – UFSC Rod. Admar Gonzaga, 1346, Itacorubi, CEP 88040-900, Florianópolis, SC, Brazil *e-mail: [email protected], [email protected] Received November 14, 2007 – Accepted March 12, 2008 – Distributed February 28, 2009 (With 2 figures) Abstract In marine bivalve mollusks, unsaturated molecules called carotenoids are present in the natural diet and play an important role in different biological process, especially in reproduction. In order to gain more insights into these compounds in Nodipecten nodosus it was necessary to develop a suitable protocol for extraction of carotenoids from the gonads. Female gonads of cultured scallops (75 mm length) were lyophilized and macerated in liquid N2. To verify the effect of composition in organosolvents on the extracting solutions, two organic solvents were tested: acetone and hexane (Ac = O:Hex) at four ratios, 1:1, 1:3, 1:5, and 2:3, in four static extraction times: 0, 5, 10, and 15 minutes. Total carotenoids and astaxanthin contents were determined in the crude extracts by UV-visible spectrophotometry and high performance liquid chromatography (HPLC), respectively. Triplicate aliquots of 50 mg were used for each treatment. The results indicated that the best single extraction (0.312 ± 0.016 µg carotenoids/mg) was attained with Ac = O: Hex 1:3, for 15 minutes.
    [Show full text]
  • 000596567.Pdf
    i UNIVERSIDADE ESTADUAL PAULISTA CAMPUS EXPERIMENTAL DO LITORAL PAULISTA UNIDADE DO LITORAL PAULISTA MACROFAUNA ASSOCIADA AO CULTIVO SUSPENSO DE VIEIRAS Nodipecten nodosus (L.) LOCALIZADO NA ILHA GRANDE, ANGRA DOS REIS, RIO DE JANEIRO Yuri Bovi Morais Carvalho São Vicente - SP 2007 ii UNIVERSIDADE ESTADUAL PAULISTA CAMPUS EXPERIMENTAL DO LITORAL PAULISTA UNIDADE DO LITORAL PAULISTA MACROFAUNA ASSOCIADA AO CULTIVO SUSPENSO DE VIEIRAS Nodipecten nodosus (L.) LOCALIZADO NA ILHA GRANDE, ANGRA DOS REIS, RIO DE JANEIRO Yuri Bovi Morais Carvalho Orientador: Msc Julio César Lopes de Avelar Supervisora: Prof. Dra. Iracy Lea Pecora Trabalho de Conclusão de Curso apresentado ao Campus Experimental do Litoral Paulista - UNESP, como parte dos requisitos para a obtenção do título de Bacharel em Ciências Biológicas, Habilitação em Biologia Marinha São Vicente - SP 2007 iii Carvalho, Yuri Bovi Morais Macrofauna associada ao cultivo suspenso de vieiras Nodipecten nodosus (L.) localizado na Ilha Grande, Angra dos Reis, Rio de Janeiro / Yuri Bovi Morais Carvalho. – São Vicente, 2007. 67 p. Trabalho de conclusão (Bacharelado - Ciências Biológicas) - Universidade Estadual Paulista, Campus Experimental do Litoral Paulista. Orientador: Júlio César Lopes de Avelar 1. Aquicultura 2. Cultura de vieiras CDD 639.4 Palavras-chaves: pectinicultura, Nodipecten nodosus, fauna associada, Ilha Grande (RJ) iv Ao meu filhote Pietro. v Se for para esquentar, que seja o sol; Se for para enganar, que seja o estômago; Se for para chorar, que seja de alegria; Se for para mentir, que seja a idade; Se for para roubar, que se roube um beijo; Se for para perder, que seja o medo; Se for para cair, que seja na gandaia; Se existir guerra, que seja de travesseiros; Se existir fome, que seja de amor; Se for para ser feliz, que seja o tempo todo!! Mário Quintana vi AGRADECIMENTOS Gostaria de expor aqui os meus profundos agradecimentos aos pesquisadores que colaboraram na identificação do material coletado neste estudo.
    [Show full text]
  • Review of the Literature on Bivalve Cytogenetics in the Last Ten Years
    Cah. Biol. Mar. (2002) 43 : 17-26 Review of the literature on bivalve cytogenetics in the last ten years Catherine THIRIOT-QUIEVREUX Observatoire Océanologique, Université P. et M. Curie – CNRS - INSU, BP 28, 06230 Villefranche-sur-Mer, France Fax: (33) 4 93 76 38 48; E-mail: [email protected] Abstract: This paper provides a review of the studies on bivalve chromosomes since 1992, in order to gather available data and to highlight the recent progress in different fields of cytogenetics: karyotype and chromosome markers, genome size, aneuploidy, natural and induced polyploidy, and hybridization. Résumé: Revue des travaux des dix dernières années sur l’étude cytogénétique des bivalves. Cet article présente une revue sur l’étude des chromosomes des bivalves depuis 1992 afin de rassembler les données disponibles et de souligner les pro- grès récents dans les différents domaines de la cytogénétique : caryotype et marqueurs chromosomiques, taille du génome, aneuploïdie, polyploïdie naturelle et induite, et hydridisation. Keywords: Bivalvia, Chromosomes, Cytogenetics Introduction review, 1985). Later, the development of banding techniques which allowed chromosome identification in Cytogenetic studies encompass different levels of biological karyotypes began to be applied in bivalves (see Thiriot- organization ranging from the morphological to the Quiévreux review, 1994). Since these reviews, the study of molecular, depending on the applicable technology. bivalve chromosomes has greatly progressed in Chromosomes can be studied as a morphological karyological as well as molecular information, as a result of manifestation of the genome in terms of their routine application of several banding techniques and the microscopically visible size, shape, number and behaviour development of techniques for in situ hybridization.
    [Show full text]
  • Reproduction and Larval Development of the New Zealand Scallop, Pecten Novaezelandiae
    Reproduction and larval development of the New Zealand scallop, Pecten novaezelandiae. Neil E. de Jong A thesis submitted to Auckland University of Technology in partial fulfilment of the requirements for the degree of Master of Science (MSc) 2013 School of Applied Science Table of Contents TABLE OF CONTENTS ...................................................................................... I TABLE OF FIGURES ....................................................................................... IV TABLE OF TABLES ......................................................................................... VI ATTESTATION OF AUTHORSHIP ................................................................. VII ACKNOWLEDGMENTS ................................................................................. VIII ABSTRACT ....................................................................................................... X 1 CHAPTER ONE: INTRODUCTION AND LITERATURE REVIEW .............. 1 1.1 Scallop Biology and Ecology ........................................................................................ 2 1.1.1 Diet ............................................................................................................................... 4 1.2 Fisheries and Aquaculture ............................................................................................ 5 1.2.1 Scallop Enhancement .................................................................................................. 8 1.2.2 Hatcheries .................................................................................................................
    [Show full text]
  • (Linnaeus, 1758) (Bivalvia: Pectinidae) Em Diferentes
    Biotemas, 19 (2): 37-45, junho de 2006 37 Biologia reprodutiva de Sophora tomentosa L. ISSN 0103 - 1643 Eficiência comparada do cultivo da vieira Nodipecten nodosus (Linnaeus, 1758) (Bivalvia: Pectinidae) em diferentes densidades e profundidades Marcos Caiano Pereira de Albuquerque Jaime Fernando Ferreira* Laboratório de Moluscos Marinhos – Universidade Federal de Santa Catarina Rua dos Coroas s/n, Barra da Lagoa, CEP 88061-600 Florianópolis, Santa Catarina, Brasil *Autor para correspondência [email protected] Submetido em 12/09/2005 Aceito para publicação em 27/12/2005 Resumo Diferentes métodos de cultivo de pectinídeos são utilizados em diversas partes do mundo com diferentes densidades e profundidades. Estes métodos apresentam diferentes eficiências dependendo do local, da espécie e da fase de cultivo. Com o objetivo de avaliar um sistema de cultivo para juvenis da vieira Nodipecten nodosus comparou-se a sobrevivência e o crescimento destes em duas densidades ( 50 e 100 sementes por andar de lanterna) e três profundidades (4, 9 e 14m), avaliando-se os parâmetros físico-químicos e ambientais do local de cultivo. As sementes tinham comprimento inicial de 23,93mm ± 2,39 e, ao final do experimento, a maior média obtida foi de 47,97mm ± 4,54 a 4m de profundidade, em baixa densidade. Após 4 meses de experimento foi observado que a sobrevivência não diferiu nas densidades e profundidades testadas (P>0,05). Porém, o crescimento final foi significativamente maior a 4m de profundidade, em baixa densidade, quando comparado à profundidade de 14m, em alta densidade. Conclui-se que para juvenis de N. nodosus, o mais indicado é o cultivo próximo da superfície (4m), onde foram encontradas as maiores taxas de Clorofila a, menores taxas de matéria orgânica e crescimento final maior, sendo esta a profundidade operacionalmente mais viável para trabalho durante a etapa de cultivo intermediário.
    [Show full text]
  • Catalogue of Type Specimens 4. Linnaean Specimens
    Uppsala University Museum of Evolution Zoology section Catalogue of type specimens. 4. Linnaean specimens 1 UPPSALA UNIVERSITY, MUSEUM OF EVOLUTION, ZOOLOGY SECTION (UUZM) Catalogue of type specimens. 4. Linnaean specimens The UUZM catalogue of type specimens is issued in four parts: 1. C.P.Thunberg (1743-1828), Insecta 2. General zoology 3. Entomology 4. Linnaean specimens (this part) Unlike the other parts of the type catalogue this list of the Linnaean specimens is heterogenous in not being confined to a physical unit of material and in not displaying altogether specimens qualifying as types. Two kinds of links connect the specimens in the list: one is a documented curatorial tradition referring listed material to collections handled and described by Carl von Linné, the other is associated with the published references by Linné to literary or material sources for which specimens are available in the Uppsala University Zoological Museum. The establishment of material being 'Linnaean' or not (for the ultimate purpose of a typification) involves a study of the history of the collections and a scrutiny of individual specimens. An important obstacle to an unequivocal interpretation is, in many cases, the fact that Linné did not label any of the specimens included in the present 'Linnaean collection' in Uppsala (at least there are no surviving labels or inscriptions with his handwriting or referable to his own marking of specimens; a single exception will be pointed out below in the historical survey). A critical examination must thus be based on the writings of Linné, a consideration of the relation between between these writings and the material at hand, and finally a technical and archival scrutiny of the curatorial arrangements that have been made since Linné's time.
    [Show full text]
  • Estimation of Growth Parameters of the Black Scallop Mimachlamys Varia in the Gulf of Taranto (Ionian Sea, Southern Italy)
    water Article Estimation of Growth Parameters of the Black Scallop Mimachlamys varia in the Gulf of Taranto (Ionian Sea, Southern Italy) Ermelinda Prato * , Francesca Biandolino, Isabella Parlapiano, Loredana Papa, Giuseppe Denti and Giovanni Fanelli CNR/IRSA (National Research Council/Water Research Institute), Via Roma 3, 74100 Taranto, Italy; [email protected] (F.B.); [email protected] (I.P.); [email protected] (L.P.); [email protected] (G.D.); [email protected] (G.F.) * Correspondence: [email protected] Received: 22 October 2020; Accepted: 26 November 2020; Published: 28 November 2020 Abstract: The present study examines the juvenile growth of nine cohorts of Mimachlamys varia in a coastal area of the Ionian Sea, from January 2014 to May 2015. The results showed that M. varia could reach commercial size in less than one year of cultivation, but significant differences in absolute growth rate (AGR) and specific growth rate (SGR) were found among cohorts (p < 0.05). Relationships between scallop growth (size and weight) and environmental variables (water temperature, dissolved oxygen and chlorophyll concentration) were also identified. The length–weight relationship showed negative allometric growth and indicated high correlation with R2, ranging from 0.95 to 0.82. Von Bertalanffy growth parameters showed the highest values of L in the cohorts collected in January, April and 1 February (52.2, 51.2 and 50.3), respectively. The growth performance index ('’) ranged between 2.52 (cohort collected in June) and 3.03 (cohort collected in August). The obtained data add basic knowledge to the growth performance of this species, making this a good opportunity to facilitate aquaculture diversification in this part of Mediterranean Sea.
    [Show full text]
  • Cultivo De Vieiras Em Santa Catarina: Tecnologias Utilizadas E Influência De Fatores Ambientais
    INFORMAtiVo TÉCNICO Cultivo de vieiras em Santa Catarina: tecnologias utilizadas e influência de fatores ambientais Guilherme Sabino Rupp¹ resumo – Neste trabalho é apresentada uma síntese das atividades de cultivo da vieiraNodipecten nodosus em Santa Catarina, das tecnologias utilizadas e dos resultados de estudos sobre a influência dos fatores ambientais nas vieiras cultivadas. O cultivo é realizado em lanternas japonesas suspensas em sistema tipo long-line de superfície, no qual as vieiras atingem o tamanho comercial de 7 a 8cm em cerca de um ano, e são comercializadas ao preço de aproximadamente R$ 50,00 dúzia-1. Com base em resultados de pesquisas, são discutidos os principais fatores limitantes para a ampliação da produção de vieiras no Estado, tais como pouca disponibilidade de áreas com condições ambientais adequadas ao cultivo e são sugeridas propostas para superá-los. termos para indexação: moluscos bivalves; Nodipecten nodosus; maricultura Scallop culture in Santa catarina: technologies used and influence of environmental factors Abstract – This paper presents a summary of the aquaculture activities with the scallopNodipecten nodosus in Santa Catarina, the technologies used, and results of studies on the influence of environmental factors on cultivated scallops. The cultivation is carried out in Japanese-type lantern-nets suspended in surface long-lines, in which the scallops reach the commercial size of 7 to 8cm in about a year, and are sold at a price of approximately R$ 50,00 dozen-1. Based on research results, the main constraints for expanding the production of scallops in the State, such as the availability of areas with adequate environmental conditions are discussed and suggestions are made to overcome them.
    [Show full text]
  • Anatomia E Morfogênese Da Margem Do Manto Da Vieira Nodipecten Nodosus (L. 1758) (Bivalvia: Pectinidae)
    JORGE ALVES AUDINO Anatomia e morfogênese da margem do manto da vieira Nodipecten nodosus (L. 1758) (Bivalvia: Pectinidae) Anatomy and morphogenesis of the mantle margin in the scallop Nodipecten nodosus (L. 1758) (Bivalvia: Pectinidae) SÃO PAULO 2014 JORGE ALVES AUDINO Anatomia e morfogênese da margem do manto da vieira Nodipecten nodosus (L. 1758) (Bivalvia: Pectinidae) Anatomy and morphogenesis of the mantle margin in the scallop Nodipecten nodosus (L. 1758) (Bivalvia: Pectinidae) SÃO PAULO 2014 Jorge Alves Audino Anatomia e morfogênese da margem do manto da vieira Nodipecten nodosus (L. 1758) (Bivalvia: Pectinidae) Anatomy and morphogenesis of the mantle margin in the scallop Nodipecten nodosus (L. 1758) (Bivalvia: Pectinidae) Dissertação apresentada ao Instituto de Biociências da Universidade de São Paulo, para a obtenção de Título de Mestre em Ciências Biológicas, na Área de Zoologia. Orientadora: Profa. Dra. Sônia Godoy Bueno Carvalho Lopes Co-orientador: Prof. Dr. José Eduardo Amoroso Rodriguez Marian São Paulo 2014 Audino, Jorge Alves Anatomia e morfogênese da margem do manto da vieira Nodipecten nodosus (L. 1758) (Bivalvia: Pectinidae) 147p. Dissertação (Mestrado) - Instituto de Biociências da Universidade de São Paulo. Departamento de Zoologia, 2014. 1. Bivalvia – Pectinidae 2. Margem do manto – Pregas paliais 3. Olhos paliais – Tentáculos 4. Anatomia – Microscopia I. Universidade de São Paulo. Instituto de Biociências. Departamento de Zoologia. COMISSÃO JULGADORA _____________________________ _____________________________ Prof. Dr. Prof. Dr. ________________________________________ Profa. Dra. Sônia Godoy Bueno Carvalho Lopes Orientadora J. Audino/CNPq As coisas tangíveis tornam-se insensíveis à palma da mão. Mas as coisas findas, muito mais que lindas, essas ficarão. Carlos Drummond de Andrade, Memória (Antologia Poética) AGRADECIMENTOS Gostaria de agradecer a todos aqueles que contribuíram para o desenvolvimento desta dissertação de mestrado.
    [Show full text]
  • Marine Invertebrates in Tubes of Ceriantharia (Cnidaria: Anthozoa)
    Biodiversity Data Journal 8: e47019 doi: 10.3897/BDJ.8.e47019 Research Article Knock knock, who’s there?: marine invertebrates in tubes of Ceriantharia (Cnidaria: Anthozoa) Hellen Ceriello‡,§, Celine S.S. Lopes‡,§, James Davis Reimer|, Torkild Bakken ¶, Marcelo V. Fukuda#, Carlo Magenta Cunha¤, Sérgio N. Stampar‡,§ ‡ Universidade Estadual Paulista "Júlio de Mesquita Filho" (UNESP), FCL, Assis, Brazil § Universidade Estadual Paulista "Júlio de Mesquita Filho" (UNESP), Instituto de Biociências, Botucatu, Brazil | University of the Ryukyus, Nishihara, Okinawa, Japan ¶ Norwegian University of Science and Technology, NTNU University Museum, Trondheim, Norway # Museu de Zoologia da Universidade de São Paulo (MZSP), São Paulo, Brazil ¤ Universidade Federal de São Paulo (Unifesp), Instituto do Mar, Santos, Brazil Corresponding author: Hellen Ceriello ([email protected]) Academic editor: Pavel Stoev Received: 02 Oct 2019 | Accepted: 04 Dec 2019 | Published: 08 Jan 2020 Citation: Ceriello H, Lopes CS.S, Reimer JD, Bakken T, Fukuda MV, Cunha CM, Stampar SN (2020) Knock knock, who’s there?: marine invertebrates in tubes of Ceriantharia (Cnidaria: Anthozoa). Biodiversity Data Journal 8: e47019. https://doi.org/10.3897/BDJ.8.e47019 Abstract This study reports on the fauna found in/on tubes of 10 species of Ceriantharia and discusses the characteristics of these occurrences, as well as the use of mollusc shells in ceriantharian tube construction. A total of 22 tubes of Ceriantharia from Argentina, Brazil, Japan, Norway, Portugal and the United States were analysed, revealing 58 species of marine invertebrates using them as alternative substrates. Based on a literature review and analyses of the sampled material, we report new occurrences for Photis sarae (Crustacea), Microgaza rotella (Mollusca), Brada sp., Dipolydora spp., Notocirrus spp., and Syllis garciai (Annelida).
    [Show full text]
  • Detection of a Parasitic Amoeba (Order Dactylopodida) in the Female Gonads of Oysters in Brazil
    Vol. 109: 241–250, 2014 DISEASES OF AQUATIC ORGANISMS Published July 3 doi: 10.3354/dao02748 Dis Aquat Org Detection of a parasitic amoeba (Order Dactylopodida) in the female gonads of oysters in Brazil Simone Sühnel1,2,*, Celene da S. Ivachuk1, Ana L. C. Schaefer1, Vitor A. Pontinha1, Maurício L. Martins1, Antonio Figueras3, Gary R. Meyer4, Simon R. M. Jones4, Johnson C. Stewart4, Helen J. Gurney-Smith2, Aimê R. M. Magalhães1, Susan M. Bower4 1Nucleus for Aquatic Pathology Studies, Federal University of Santa Catarina (UFSC), Rodovia Admar Gonzaga, 1346, 88040-900, Florianópolis, Santa Catarina (SC), Brazil 2Centre for Shellfish Research, Vancouver Island University, 900 Fifth Street, Nanaimo, British Columbia V9R 5S5, Canada 3Spanish National Reference Laboratory for Molluscs Diseases, Instituto de Investigaciones Marinas, Consejo Superior de Investigaciones Científicas (CSIC), Eduardo Cabello 6, 36208 Vigo, Spain 4Pacific Biologic Station, Fisheries and Oceans Canada (DFO), 3190 Hammond Bay Road, Nanaimo, British Columbia V9T 6N7, Canada ABSTRACT: The impacts of oocyte parasites on the reproductive success of molluscs are largely unknown. In this study, we evaluated the presence of gonad parasites in 6 species of marine bivalve molluscs native to southern Brazil. Cultured bivalves included the mangrove oyster Crass- ostrea gasar (sometimes called C. brasiliana), the brown mussel Perna perna, the lion’s paw scal- lop Nodipecten nodosus and the wing pearl oyster Pteria hirundo. Another species of mangrove oyster, C. rhizophorae, and the carib pointed venus clam Anomalocardia brasiliana (syn. A. flexu- osa) were collected from the wild. Molluscs were collected in winter 2009 and summer 2010 for histopathological and molecular evaluation.
    [Show full text]