USOO86.03478B2

(12) United States Patent (10) Patent No.: US 8,603,478 B2 Whalen et al. (45) Date of Patent: Dec. 10, 2013

(54) ANT-RON ANTIBODES OTHER PUBLICATIONS (75) Inventors: Kerry Whalen, Chelmsford, MA (US); Burgess et al. (2006) “Fully Human Monoclonal Antibodies to Steve Bottega, Cambridge, MA (US); Hepatocyte Growth Factor with Therapeutic Potential against Hepatocyte Growth Factor/c-Met-Dependent Human Tumors' Can Andrea Boudrow, Peabody, MA (US); cer Res.66:1721-1729. Lyne Breault, Roslindale, MA (US); Camp et al. (2007) “Tyrosine Kinase Receptor RON in Human Pan Ting Chen, Acton, MA (US); James creatic Cancer—Expression, Function, and Validation as a Target' Gifford, Somerville, MA (US); May Cancer 109:1030-1039. Han, Brookline, MA (US); Jinwei Carter (2006) “Potent Antibody Therapeutics by Design” Nature Jiang, Chestnut Hill, MA (US); Lorena Reviews. Immunology 6:343-357. Han et al. (2010) “Anti-tumor activity of anti-RON antibodies and Lerner, Newton Centre, MA (US); Qing biomarker of response' European Journal of Cancer. Supplement. Liu, Acton, MA (US); Kristan Meetze, Nov. 18, 2010, Plenary Session 6. Proffered papers. Abstract 2LB. Lexington, MA (US); Sylvie Vincent, Hayden-Ledbetter et al. (2009) “CD20-Directed Small Modular Somerville, MA (US): Solly Weiler, Immunopharmaceutical, TRU-015, Depletes Normal and Malignant Newton, MA (US); William M. B Cells Clin. Cancer Res. 15:2739-2746. Winston, Jr., Marlborough, MA (US); Lu et al. (2007) “Multiple variants of the RON receptor tyrosine kinase: Biochemical properties, tumorigenic activities, and potential Jeno Gyuris, Lincoln, MA (US) drug targets' Cancer Lett. 257: 157-164. Montero-Julian et al. (1998) "Characterization of Two Monoclonal (73) Assignee: AVEO Pharmaceuticals, Inc., Antibodies Against the RONTyrosine Kinase Receptor' Hybridoma Cambridge, MA (US) 17:541-551. O'Toole et al. (2006) “Therapeutic Implications of a Human Neu (*) Notice: Subject to any disclaimer, the term of this tralizing Antibody to the Macrophage-Stimulating Protein Receptor patent is extended or adjusted under 35 Tyrosine Kinase (RON), ac-MET Family Member” Cancer Research U.S.C. 154(b) by 104 days. 66:9162-9170. Qian et al. (2009) “Inhibition of Tumor Cell Growth, Invasion, and Metastasis by EXEL-2880 (XL880, GSK1363089), a Novel Inhibi (21) Appl. No.: 13/177,071 tor of HGF and VEGF Receptor Tyrosine Kinases' Cancer Res. 69:8009-8016. (22) Filed: Jul. 6, 2011 Raeppeletal. (2010) “Identification of a novel series of potent RON receptor tyrosine kinase inhibitors' Bioorg Med Chem Lett 20:2745 (65) Prior Publication Data 9. Rampino et al. (2007) “Neutralization of macrophage-stimulating US 2012/0027773 A1 Feb. 2, 2012 protein ameliorates renal injury in anti-thy 1 glomerulonephritis' Journal of the American Society of Nephrology 18: 1486-1496. Related U.S. Application Data Schroeder et al. (2009) “Discovery of N-(4-(2-Amino-3- (60) Provisional application No. 61/361,808, filed on Jul. 6, chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4- 2010, provisional application No. 61/466,679, filed on fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (BMS 777607), a Selective and Orally Efficacious Inhibitor of the Met Mar. 23, 2011. Kinase Superfamily” J. Med Chem. 52:1251-1254. Secco et al. (2004) "Characterization of a single-chain intrabody (51) Int. C. directed against the human receptor tyrosine kinase Ron' Journal of A 6LX39/395 (2006.01) Immunological Methods 285:99-109. (52) U.S. C. Wagh et al. (2008) "Met-Related Receptor Tyrosine Kinase Ron in USPC ...... 424/133.1; 424/139.1 Tumor Growth and Metastasis' Adv. Cancer Res. 100: 1-33. (58) Field of Classification Search Warket al. (2006) "Latest technologies for the enhancement of anti None body affinity” Advanced Drug Delivery Reviews 58:657-670. Yao et al. (2006) "Agonistic Monoclonal Antibodies Potentiate See application file for complete search history. Tumorigenic and Invasive Activities of Splicing Variant of the RON References Cited Receptor Tyrosine Kinase” Cancer Biology and Therapy 5:1179 (56) 1186. U.S. PATENT DOCUMENTS Zhang et al. (2008) “Identification of a Novel Recepteur d'Origine Nantaisic-Met Small-Molecule Kinase Inhibitor with Antitumor 5,707,624 A 1, 1998 Nickoloff et al. Activity In vivo Cancer Res.68:6680-6687. 7,235,523 B2 6, 2007 Waltz et al. 7,498.416 B2 3, 2009 Yayon et al. (Continued) 2009, O13651.0 A1 5/2009 Pereira et al. 2009/0202547 A1 8, 2009 Yayon et al. Primary Examiner — Brian J Gangle 2009, 0226442 A1 9, 2009 Huet et al. Assistant Examiner — Andrea McCollum (74) Attorney, Agent, or Firm — Goodwin Procter LLP FOREIGN PATENT DOCUMENTS (57) ABSTRACT WO WO-2005/12O557 12/2005 WO WO-2006/020258 2, 2006 Monoclonal antibodies that bind and inhibit activation of WO WO-2008, 100624 8, 2008 WO WO-2009/07O294 6, 2009 human RON (Recepteur d' Origine Nantais) are disclosed. WO WO-2009/094148 T 2009 The antibodies can be used to treat certain forms of cancer WO WO-2009/134776 11, 2009 that are associated with activation of RON. WO WO-2010/037835 4/2010 WO WO-2011/O90761 T 2011 14 Claims, 19 Drawing Sheets US 8,603.478 B2 Page 2

(56) References Cited Product insert for Human MSPR/Ron Antibody; Monoclonal Mouse IgG1 Clone # 992 11; Catalog No. MAB691 (R&D Systems) (1 OTHER PUBLICATIONS page), (2010). Zhao et al. (2007) “Targeting CD37-positive lymphoid malignancies International Search Report and Written Opinion, International with a novel engineered Small modular immunopharmaceutical” Patent Application No. PCT/US2011/043056, mailed on Jan. 24, Blood 110:2569-2577. 2012 (27 pages).

U.S. Patent US 8,603,478 B2

U.S. Patent US 8,603,478 B2 U.S. Patent Dec. 10, 2013 Sheet 6 of 19 US 8,603,478 B2

FIG. 6

Neutralization of ligand binding

1OO o O7FO1 x 29B06 A 17FO6 50 {0 12B11 H 18HO9 U.S. Patent Dec. 10, 2013 Sheet 7 Of 19 US 8,603,478 B2

FIG. 7

p-ERK inhibition

120 x 29B06 1OO A 17FO6 5 80 8 O7FO1 60 18HO9 40 $ 12B11 & 20

log nM AB U.S. Patent Dec. 10, 2013 Sheet 8 of 19 US 8,603,478 B2

FIG. 8 1400000 pour

1200000 s " E 1000000 to

3. 800000 cc

5 600000 irr Trror gu. 40CCO s resur r rr r i 200000 ir r r r r r e s .u.u.u.u.u. (FF}. 18- OS BOS 1311 (6. gG U.S. Patent Dec. 10, 2013 Sheet 9 Of 19 US 8,603,478 B2

FIG. 9

1,400

E200 f : E E E300 d 300 a 3E s s FF 600 s is 3B 400 at SOS s e -- igG U.S. Patent Dec. 10, 2013 Sheet 10 of 19 US 8,603,478 B2

FIG 10

500 1400 r 1200 E s E as SBS 6 2000 d 17F(6 800 -- FE S. 600 HIEEE 5 { a 383 igg - 200

:------U.S. Patent Dec. 10, 2013 Sheet 11 of 19 US 8,603,478 B2

FIG.11

1230 --29B08 (40mpk 3xweek) 1000 s -et-mulga (40mpk 3x week) r

SE E 800 d s 500 s e s 400

AUC

S S s

U.S. Patent Dec. 10, 2013 Sheet 16 of 19 US 8,603,478 B2

6OOOOO t SOOOOO d

S 400000 r e 300000 200000

to O ...... is . . . . . sassissis-s-s-s-s-s-trotocorres-s-s-s-ss.soss- as-s-s-s Sh29B06-78 + ShO7FO1-62 + higG+ nO MSP 1nM MSP 1 nM MSP 1 nM MSP AB (1 ug/ml)

Fig. 16 U.S. Patent Dec. 10, 2013 Sheet 17 Of 19 US 8,603,478 B2

700000 ro 600000 tour 500000 400000 but

300000 hu CMS 200000 38 y VSP

OOOOO Y Y V V v N. Y. Y Y V V v N. Y. V. V Y

. . . ------Si29806-78 shCFFO1-62 hugG AB (1 ug/ml)

Fig. 17

U.S. Patent Dec. 10, 2013 Sheet 19 Of 19 US 8,603,478 B2

migG S38 SESSE-i 83

RON 8-tL:Lin rigg SO-6

RON

B-tailin

Fig. 19 US 8,603,478 B2 1. 2 ANTI-RON ANTIBODES WO 2006/020258: Pereira et al., WO 2005/120557; and com mercial antibody MAB691, R&D Systems, Minneapolis, CROSS-REFERENCE TO RELATED Minn.). APPLICATIONS Naturally occurring antibodies are multimeric proteins that contain four polypeptide chains (FIG.1). Two of the polypep This application claims the benefit of and priority to U.S. tide chains are called heavy chains (H chains), and two of the Provisional Application Ser. No. 61/466,679, filed Mar. 23, polypeptide chains are called light chains (L chains). The 2011, and U.S. Provisional Application Ser. No. 61/361,808, immunoglobulin heavy and light chains are connected by an filed Jul. 6, 2010; the contents of each application are hereby interchain disulfide bond. The immunoglobulin heavy chains incorporated by reference in their entirety. 10 are connected by interchain disulfide bonds. A light chain consists of one variable region (V, in FIG.1) and one constant SEQUENCE LISTING region (C, in FIG. 1). The heavy chain consists of one vari able region (V in FIG. 1) and at least three constant regions The instant application contains a Sequence Listing which (CH, CH, and CH in FIG. 1). The variable regions deter has been submitted in ASCII format via EFS-Web and is 15 mine the specificity of the antibody. Each variable region hereby incorporated by reference in its entirety. Said ASCII comprises three hyperVariable regions also known as comple copy, created on Jul.18, 2011, is named AVO-010.txt and is mentarity determining regions (CDRs) flanked by four rela 174,495 bytes in size. tively conserved framework regions (FRs). The three CDRs, referred to as CDR, CDR, and CDR, contribute to the FIELD OF THE INVENTION antibody binding specificity. Naturally occurring antibodies have been used as starting material for engineered antibodies, The field of the invention is molecular biology, immunol Such as chimeric antibodies and humanized antibodies. ogy and oncology. More particularly, the field is therapeutic Although antibodies that bind RON are known in the art, antibodies. 25 there is still a need for improved RON antibodies that can be used as therapeutic agents. BACKGROUND SUMMARY Recepteur d' Origine Nantais (RON), also known as Mac rophage Stimulating Protein Receptor (MSPR, or MST1-R), 30 The invention is based, in part, upon the discovery of a is a member of the MET family of receptor tyrosine kinases family of antibodies that specifically bind human RON. The that binds the ligand known as Macrophage Stimulating Pro antibodies contain RON binding sites based on the CDRs of tein (MSP). RON is composed of a 40 kDa extracellular C. the antibodies. The antibodies can be used as therapeutic chain and a 150 kDa transmembrane B chain. The B chain is agents. When used as therapeutic agents, the antibodies are responsible for the intrinsic kinase activity, and the extracel 35 engineered, e.g., humanized, to reduce or eliminate an lular portions of the two chains function together as the ligand immune response when administered to a human patient. binding domain (Wagh et al., 2008, ADV. CANCER RES. 100: 1 The antibodies prevent or inhibit the activation of (i.e., 33). neutralize) human RON. In some embodiments, the antibod MSP binding to RON activates multiple downstream sig 40 ies prevent RON from binding to its ligand, MSP, thereby naling pathways and mediates multiple cellular activities. neutralizing RON activity. In certain embodiments, the anti RON pathway dysregulation is involved in inflammatory bodies prevent RON activation without inhibiting RON bind response, wound healing and liver regeneration. RON signal ing to MSP. The antibodies can be used to inhibit the down ing can Sustain tumor growth, Survival, motility, invasion and stream signaling of the breast tumor cell line T47D. angiogenesis in certain malignancies. The RON protein exists 45 Furthermore, when administered to a mammal, the antibodies in several splice variants, some of which are tumorigenic in can inhibit or reduce tumor growth in the mammal. animal models of cancer. One such splice variant is delta 160 These and other aspects and advantages of the invention RON, which lacks exons 5 and 6 (Lu et al., 2007, CANCER LETT. will become apparent upon consideration of the following 257: 157-164). figures, detailed description, and claims. As used herein, When activated by ligand binding. RON activates the 50 “including' means without limitation, and examples cited are PI3K/AKT pathway and the MAPK pathway. RON also non-limiting. affects cells through interactions with other receptors, e.g., c-Met, integrins and EGFR. To date, no activating mutations DESCRIPTION OF THE DRAWINGS in RON exons have been reported. Alternative splicing and overexpression appear to be the main mechanisms for consti 55 The invention can be more completely understood with tutive activation of the receptor. Several small molecule reference to the following drawings. inhibitors have been reported that inhibit multiple receptor FIG. 1 (prior art) is a schematic representation of a typical tyrosine kinases, including RON, examples of which include naturally-occurring antibody. EXCEL-2880, (Qian et al., 2009, CANCER RES. 69:8009-8016) FIG. 2 is a sequence alignment showing the amino acid and BMS-77607 (Schroeder et al., 2009 J. MED CHEM. 60 sequence of the complete immunoglobulin heavy chain vari 52:1251-1254). A dual c-met/RON inhibitor has also been able region of antibodies 07F01, 12B11, 17F06, 18H09 and reported, Amgen compound I (Zhanget al., 2008, CANCER RES. 29B06. The amino acid sequences for each antibody are 68:6680-6687). A recent publication describes a selective aligned againstone another, and CDR, CDR, and CDR, are RON small molecule inhibitor (Raeppel et al., 2010 BIOORG identified in boxes. The unboxed sequences represent frame MED CHEM LETT 20:2745-9). Several antibodies that inhibit 65 work (FR). Alignment positioning (gaps) are based on Kabat human RON activity have been reported (Huet et al., US numbering, rather than an alignment algorithm Such as 2009/0226442; Pereira et al., US 2009/0136510; Zhu et al., Clustal sequences. US 8,603,478 B2 3 4 FIG. 3 is a sequence alignment showing the CDR, CDR, FIG. 13A is a schematic diagram showing the CDR, and CDR sequences for each of the immunoglobulin heavy CDR, and CDR sequences (Kabat definition) for each of the chain variable region sequences in FIG. 2. variable region sequences shown in FIG. 12A. FIG. 4 is a sequence alignment showing the amino acid FIG. 13B is a schematic diagram showing the CDR, sequence of the complete immunoglobulin light chain vari- 5 CDR, and CDR sequences (Kabat definition) for each of the able region of antibodies 07F01, 12B11, 17F06, 18H09 and variable region sequences shown in FIG. 12B. 29B06. The amino acid sequences for each antibody are FIG. 14A is a schematic diagram showing the amino acid aligned against one another, and CDR, CDR, and CDR, are sequences of the complete light chain variable region of identified in boxes. The unboxed sequences represent frame 07F01 (SEQID NO: 4) and the complete light chain variable work (FR) sequences. Alignment positioning (gaps) are based 10 regions denoted as HEL 07F01 Kv1-9 (SEQID NO: 139) and ShO7F01 Kv1-9 F 1 (SEQ ID NO: 141). The amino acid on Kabat numbering, rather than an alignment algorithm Such sequences for each light chain variable region are aligned as Clustal sequences. against one another, and CDR, CDR, and CDR sequences FIG. 5 is a sequence alignment showing the CDR, CDR, (Kabat definition) are identified in boxes. The unboxed and CDR sequences for each of the immunoglobulin light 15 sequences represent framework (FR) sequences. chain variable region sequences in FIG. 4. FIG. 14B is a schematic diagram showing the amino acid FIG. 6 is a graph showing dose-response curves for inhi sequences of the complete light chain variable region of bition of the MSP-RON binding interaction by antibodies 29B06 (SEQ ID NO. 44) and the complete light chain vari 17F06 (A), 07F01 (O), 12B11 (0), 18H09 (), and 29B06 able region denoted as Sh29B06 Kv2-28 (SEQID NO: 149). (X), as measured by electrochemiluminescence assay. 2O The amino acid sequences for each light chain variable region FIG. 7 is a graph showing dose-response curves for inhi are aligned againstone another, and CDR, CDR, and CDR bition of MSP-dependent phosphorylation of ERK by anti sequences (Kabat definition) are identified in boxes. The bodies 17F06 (A), 07F01 (O), 12B11 (0), 18H09 (), and unboxed sequences represent framework (FR) sequences. 29B06 (x) by ELISA assay. FIG. 15A is a sequence alignment showing the CDR, FIG. 8 is a histogram Summarizing results from an experi- 25 CDR, and CDR sequences (Kabat definition) for each of the ment measuring inhibition of MSP induced HPAF-II cell variable region sequences shown in FIG. 14A. migration by antibodies 07F01, 18H09, 29B06, 12B11, FIG. 15B is a sequence alignment showing the CDR, 17F06 and an IgG negative control (murine IgG) by transwell CDR, and CDR sequences (Kabat definition) for each of the assay. variable region sequences shown in FIG. 14B. FIG.9 is a graph summarizing data on inhibition of growth 30 FIG.16 is a histogram Summarizing results from an experi of a wild-type (wt) RON-dependent in vivo tumor model by ment measuring inhibition of MSP induced HPAF-II cell antibodies 07F01 (O), 12B11 (0), 18H09 (), 29B06 (*), migration by anti-RON antibodies Sh29B06-78 and and a murine IgG control (O). The antibodies and IgG control Sh07FO1-62, an IgG negative control (human IgG), and a no were dosed at 20 mg/kg twice per week intraperitoneally. MSP control by transwell assay. FIG. 10 is a graph summarizing data on inhibition of 35 FIG.17 is a histogram Summarizing results from an experi growth of a delta 160 RON-dependent in vivo tumor model by ment measuring inhibition of MSP induced HPAF-II cell antibodies 17F06 (A), 07F01 (O), 12B11 (0), 18H09 (), invasion by anti-RON antibodies Sh29B06-78 and ShO7F01 29B06 (*), and a murine IgG control (O). The antibodies and 62 and an IgG negative control (human IgG) at 0 and 1 nM IgG control were dosed at 20 mg/kg twice per week intrap MSP. eritoneally. 40 FIG. 18 is a graph summarizing data on inhibition of FIG. 11 is a graph Summarizing data on inhibition of growth of an NCI-H358 xenograft tumor model by anti-RON growth of an NCI-H358 xenograft tumor model by antibody antibodies mu07F01 (O), ShO7F01-62 (A), mu29B06 (0), 29B06 (*) and a murine IgG control (O). The antibody and RON8 (), and Sh29B06-78 (O), and a human IgG control IgG control were dosed at 40 mg/kg (abbreviated as “mpk') (+). three per week intraperitoneally. 45 FIG. 19 depicts Western blots summarizing results from an FIG. 12A is a schematic diagram showing the amino acid experiment measuring RON receptor degradation by anti sequences of the complete immunoglobulin heavy chain vari RON antibodies mu07F01, ShO7FO1-62, mu29B06, RON8, able region of07F01 (SEQID NO: 2) and the complete heavy and Sh29B06-78. chain variable regions denoted as Chimeric 07FO1 C102S (SEQID NO: 133), ShO7F01 Hv3-48 (SEQID NO: 135), and 50 DETAILED DESCRIPTION ShO7F01 Hv3-48 D28T T60A L63V E65G (SEQ ID NO: 137). The amino acid sequences for each heavy chain variable The anti-RON antibodies disclosed herein are based on the region are aligned against one another, and Complementary antigen binding sites of certain monoclonal antibodies that Determining Sequences (CDR) (Kabat definition), CDR, have been selected on the basis of binding and neutralizing CDR, and CDR, are identified in boxes. The unboxed 55 the activity of human RON. The antibodies contain immuno sequences represent framework (FR) sequences. globulin variable region CDR sequences that define a binding FIG. 12B is a schematic diagram showing the amino acid site for human RON. sequences of the complete immunoglobulin heavy chain vari In view of the neutralizing activity of these antibodies, they able region of 29B06 (SEQ ID NO: 42) and the complete are useful for modulating the growth and/or proliferation of heavy chain variable regions denoted as Sh29B06 Hv4-59 60 certain types of cancer cells. When used as a therapeutic (SEQ ID NO: 143), Hu29B06 Hv4-59 (SEQ ID NO: 145), agent, the antibodies can be engineered to minimize or elimi and Hu29B06 Hv4-59 D27GT30S M48II67V Y78F (SEQ nate an immune response when administered to a human ID NO: 147). The amino acid sequences for each heavy chain patient. In some embodiments, the antibodies are fused or variable region are aligned against one another, and CDR, conjugated to other moieties, such as effector molecules (e.g., CDR, and CDR sequences (Kabat definition) are identified 65 other proteins or Small molecule therapeutics), a detectable in boxes. The unboxed sequences represent framework (FR) label or a toxin moiety. Various features and aspects of the Sequences. invention are discussed in more detail below. US 8,603,478 B2 5 6 As used herein, unless otherwise indicated, the term “anti sequence of SEQ ID NO: 123 (Chimeric 07F01 C102S, body’ means an intact antibody (e.g., an intact monoclonal ShO7F01 Hv3-48, ShO7FO1 Hv3-48 D28T T60A L63V antibody) or antigen-binding fragment of an antibody (e.g., E65G). an antigen-binding fragment of a monoclonal antibody), In some embodiments, the antibody comprises an immu including an intact antibody orantigen-binding fragment that noglobulin heavy chain variable region comprising a CDR has been modified, engineered or chemically conjugated, or comprising the amino acid sequence of SEQ ID NO: 15 that is a human antibody. Examples of antibodies that have (12B11) or SEQID NO: 53 (12B11), a CDR, comprising been modified or engineered are chimericantibodies, human the amino acid sequence of SEQID NO: 16 (12B11), and a ized antibodies, and multispecific antibodies (e.g., bispecific CDR comprising the amino acid sequence of SEQID NO: antibodies). Examples of antigen-binding fragments include 10 17 (12B11). Fab, Fab', F(ab'). Fv, single chain antibodies (e.g., scFv), In some embodiments, the heavy chain variable region minibodies and diabodies. An antibody conjugated to a toxin comprises a CDR comprising the amino acid sequence of moiety is an example of a chemically conjugated antibody. SEQ ID NO: 25 (17F06) or SEQ ID NO. 55 (17F06), a I. Antibodies that Bind RON CDR comprising the amino acid sequence of SEQID NO: 15 26 (17F06), and a CDR comprising the amino acid The antibodies disclosed herein comprise: (a) an immuno sequence of SEQID NO: 27 (17F06). globulin heavy chain variable region comprising the structure In some embodiments, the heavy chain variable region CDR-CDR-CDR and (b) an immunoglobulin light comprises a CDR comprising the amino acid sequence of chain variable region comprising the structure CDR SEQ ID NO:35 (18HO9) or SEQ ID NO: 57 (18H09), a CDR-CDR, wherein the heavy chain variable region and CDR comprising the amino acid sequence of SEQID NO: the light chain variable region together define a single binding 36 (18H09), and a CDR, comprising the amino acid site for binding human RON protein. sequence of SEQID NO:37 (18H09). In some embodiments, the antibody comprises: (a) an In some embodiments, the heavy chain variable region immunoglobulin heavy chain variable region comprising the comprises a CDR comprising the amino acid sequence of structure CDR-CDR-CDR and (b) an immunoglobu 25 SEQID NO:45 (29B06), SEQID NO. 59 (29B06), or SEQ lin light chain variable region, wherein the heavy chain vari ID NO: 126 (Sh29B06 Hv4-59, Hu29B06 Hv4-59 D27G able region and the light chain variable region together define T30S M48II67VY78F), a CDR comprising the amino acid a single binding site for binding human RON. A CDR, sequence of SEQIDNO: 46 (29B06), and a CDR compris comprises an amino acid sequence selected from the group ing the amino acid sequence of SEQID NO: 47 (29B06). consisting of SEQ ID NO: 5 (07F01), SEQ ID NO: 51 30 In some embodiments, the heavy chain variable region (07F01), SEQ ID NO: 124 (ShO7F01 Hv3-48 D28T T60A comprises a CDR comprising the amino acid sequence of L63V E65G), SEQ ID NO: 15 (12B11), SEQ ID NO: 53 SEQ ID NO: 45 (29B06) or SEQ ID NO: 126 (Sh29B06 (12B11), SEQID NO: 25 (17F06), SEQID NO:55 (17F06), Hv4-59, Hu29B06 Hv4-59 D27GT30S M48II67VY78F), a SEQID NO:35 (18HO9), SEQID NO:57 (18H09), SEQ ID CDR comprising the amino acid sequence of SEQID NO: NO:45 (29B06), SEQID NO. 59 (29B06), and SEQID NO: 35 46 (29B06), and a CDR comprising the amino acid 126 (Sh29B06 Hv4-59, Hu29B06 Hv4-59 D27GT30S M48I sequence of SEQID NO: 47 (29B06). I67VY78F); a CDR comprises an amino acid sequence Preferably, the CDR, CDR, and CDR sequences are selected from the group consisting of SEQID NO: 6 (07F01), interposed between human or humanized immunoglobulin SEQID NO: 16 (12B11), SEQID NO: 26 (17F06), SEQ ID FRS. The antibody can be an intact antibody or an antigen NO:36 (18H09), SEQID NO:46 (29B06), and SEQID NO: 40 binding antibody fragment. 122 (ShO7F01 Hv3-48 D28T T60A L63V E65G); and a In some embodiments, the antibody comprises (a) an CDR comprises an amino acid sequence selected from the immunoglobulin light chain variable region comprising the group consisting of SEQID NO:7 (07F01), SEQID NO: 17 structure CDR-CDR-CDRs, and (b) an immunoglobulin (12B11), SEQID NO:27 (17F06), SEQID NO:37 (18HO9), heavy chain variable region, wherein the IgG light chain SEQID NO: 47 (29B06), and SEQ ID NO: 123 (Chimeric 45 variable region and the IgG heavy chain variable region 07F01 C102S, ShO7F01 Hv3-48, ShO7F01 Hv3-48 D28T together define a single binding site for binding human RON. T60A L63V E65G). Throughout the specification a particular A CDR, comprises an amino acid sequence selected from SEQID NO. is followed in parentheses by the antibody that the group consisting of SEQID NO: 8 (07F01), SEQID NO: was the origin of that sequence. For example, “SEQID NO: 18 (12B11), SEQ ID NO: 28 (17F06), SEQ ID NO:38 5 (07F01) means that SEQID NO: 5 comes from antibody 50 (18HO9), SEQID NO:48 (29B06), and SEQID NO: 130 (HE O7FO1. L 07F01 Kv1-9, ShO7F01 Kv1-9 F1): a CDR, comprises an In some embodiments, the antibody comprises an immu amino acid sequence selected from the group consisting of noglobulin heavy chain variable region comprising a CDR SEQ ID NO: 9 (07F01), SEQID NO: 19 (12B11), SEQID comprising the amino acid sequence of SEQ ID NO: 5 NO: 29 (17F06), SEQID NO:39 (18HO9), SEQID NO: 49 (07F01), SEQ ID NO. 51 (07F01), or SEQ ID NO: 124 55 (29B06), and SEQID NO: 131 (HEL 07F01 Kv1-9, ShO7F01 (ShO7F01 Hv3-48 D28TT60A L63V E65G); a CDR, com KV1-9 F1); and a CDR, comprises an amino acid sequence prising the amino acid sequence of SEQID NO: 6 (07F01) or selected from the group consisting of SEQ ID NO: 10 SEQ ID NO: 122 (ShO7F01 Hv3-48 D28T T60A L63V (07F01), SEQID NO:20 (12B11), SEQID NO:30 (17F06), E65G), and a CDR comprising the amino acid sequence of SEQID NO:40 (18H09), and SEQID NO: 50 (29B06). SEQID NO: 7 (07F01) or SEQID NO: 123 (Chimeric 07F01 60 In some embodiments, the antibody comprises an immu C102S, ShO7F01 Hv3-48, ShO7F01 Hv3-48 D28T T60A noglobulin light chain variable region comprising a CDR, L63V E65G). comprising the amino acid sequence of SEQ ID NO: 8 In some embodiments, the heavy chain variable region (07F01) or SEQID NO: 130 (HE L 07F01 Kv1-9, ShO7F01 comprises a CDR comprising the amino acid sequence of KV1-9F1), a CDR comprising the amino acid sequence of SEQID NO: 5 (07F01), a CDR comprising the amino acid 65 SEQ ID NO: 9 (07F01) or SEQ ID NO: 131 (HE L 07F01 sequence of SEQID NO: 122 (Sh07F01 Hv3-48 D28TT60A Kv1-9, ShO7F01 Kv1-9 F1), and a CDR, comprising the L63V E65G), and a CDR comprising the amino acid amino acid sequence of SEQID NO: 10 (07F01). US 8,603,478 B2 7 8 In some embodiments, the antibody comprises an immu (18HO9), SEQID NO:49 (29B06), and SEQID NO: 131 (HE noglobulin light chain variable region comprising a CDR, L 07F01 Kv1-9, ShO7F01 Kv1-9 F1); and the CDR, is an comprising the amino acid sequence of SEQID NO: 130 (HE amino acid sequence selected from the group consisting of L 07F01 Kv1-9, ShO7F01 Kv1-9 F1): a CDR, comprising SEQID NO: 10 (07F01), SEQID NO:20 (12B11), SEQ ID the amino acid sequence of SEQID NO: 131 (HE L 07F01 NO:30 (17F06), SEQID NO:40 (18H09), and SEQID NO: Kv1-9, ShO7F01 Kv1-9 F1); and a CDR, comprising the 50 (29B06). amino acid sequence of SEQID NO: 10 (07F01). The antibodies disclosed herein comprise an immunoglo In some embodiments, the antibody comprises an immu bulin heavy chain variable region and an immunoglobulin noglobulin light chain variable region comprising a CDR, light chain variable region. In some embodiments, the anti comprising the amino acid sequence of SEQ ID NO: 18 10 (12B11); a CDR comprising the amino acid sequence of body comprises an immunoglobulin heavy chain variable SEQID NO: 19 (12B11); and a CDR, comprising the amino region selected from the group consisting of SEQID NO: 2 acid sequence of SEQID NO:20 (12B11). (07F01), SEQID NO: 12 (12B11), SEQID NO: 22 (17F06), In some embodiments, the antibody comprises an immu SEQID NO:32 (18HO9), SEQID NO:42 (29B06), SEQ ID noglobulin light chain variable region comprising a CDR. 15 NO: 133 (Chimeric 07F01 C102S), SEQ ID NO: 135 comprising the amino acid sequence of SEQ ID NO: 28 (ShO7F01 Hv3-48), SEQ ID NO: 137 (ShO7F01 Hv3-48 (17F06); a CDR comprising the amino acid sequence of D28TT60A L63V E65G), SEQID NO: 143 (Sh29B06 Hv4 SEQID NO: 29 (17F06); and a CDR, comprising the amino 59), SEQID NO: 145 (Hu29B06 Hv4-59), and SEQID NO: acid sequence of SEQID NO:30 (17F06). 147 (Hu29B06 Hv4-59 D27GT30S M48II67VY78F), and In some embodiments, the antibody comprises an immu an immunoglobulin light chain variable region. noglobulin light chain variable region comprising a CDR, In other embodiments, the antibody comprises an immu comprising the amino acid sequence of SEQ ID NO: 38 noglobulin light chain variable region selected from the group (18HO9); a CDR, comprising the amino acid sequence of consisting of SEQ ID NO: 4 (07F01), SEQ ID NO: 14 SEQIDNO:39 (18H09); and a CDR, comprising the amino (12B11), SEQID NO: 24 (17F06), SEQID NO:34 (18H09), acid sequence of SEQID NO: 40 (18H09). 25 SEQ ID NO. 44 (29B06), SEQ ID NO: 139 (HE L 07F01 In some embodiments, the antibody comprises an immu Kv1-9), SEQID NO: 141 (ShO7F01 Kv1-9 F1), and SEQID noglobulin light chain variable region comprising a CDR. NO: 149 (Sh29B06 KV2-28), and an immunoglobulin heavy comprising the amino acid sequence of SEQ ID NO: 48 chain variable region. (29B06); a CDR comprising the amino acid sequence of In some embodiments, the antibody comprises an immu SEQIDNO: 49 (29B06); and a CDR, comprising the amino 30 noglobulin heavy chain variable region selected from the acid sequence of SEQID NO: 50 (29B06). group consisting of SEQID NO: 2 (07F01), SEQID NO: 12 Preferably, the CDR, CDR, and CDR sequences are (12B11), SEQID NO:22(17F06), SEQID NO:32 (18H09), interposed between human or humanized immunoglobulin SEQID NO:42 (29B06), SEQID NO: 133 (Chimeric 07F01 FRS. The antibody can be an intact antibody or an antigen C102S), SEQID NO: 135 (ShO7F01 Hv3-48), SEQ ID NO: binding antibody fragment. 35 137 (ShO7F01 Hv3-48 D28T T60A L63V E65G), SEQ ID In some embodiments, the antibody comprises: (a) an NO: 143 (Sh29B06 Hv4-59), SEQ ID NO: 145 (Hu29B06 immunoglobulin heavy chain variable region comprising the Hv4-59), and SEQ ID NO: 147 (Hu29B06 Hv4-59 D27G structure CDR-CDR-CDR and (b) an immunoglobu T30S M48II67VY78F), and an immunoglobulin light chain lin light chain variable region comprising the structure variable region selected from the group consisting of SEQID CDR-CDR-CDR, wherein the heavy chain variable 40 NO: 4 (07F01), SEQ ID NO: 14 (12B11), SEQ ID NO: 24 region and the light chain variable region together define a (17F06), SEQID NO:34 (18H09), SEQID NO: 44 (29B06), single binding site for binding human RON. The CDR is an SEQ ID NO: 139 (HE L 07 FO1 Kv1-9), SEQ ID NO: 141 amino acid sequence selected from the group consisting of (ShO7F01 Kv1-9 F1), and SEQID NO: 149 (Sh29B06 Kv2 SEQ ID NO: 5 (07F01), SEQ ID NO. 51 (07F01), SEQID 28). NO: 124 (ShO7FO1 Hv3-48 D28T T60A L63V E65G), SEQ 45 In some embodiments, the antibody comprises an immu ID NO: 15 (12B11), SEQ ID NO:53 (12B11), SEQID NO: noglobulin heavy chain variable region comprising the amino 25 (17F06), SEQ ID NO. 55 (17F06), SEQ ID NO:35 acid sequence of SEQID NO: 2 (07F01), and an immunoglo (18H09), SEQID NO:57 (18HO9), SEQID NO:45 (29B06), bulin light chain variable region comprising the amino acid SEQID NO. 59 (29B06), and SEQ ID NO: 126 (Sh29B06 sequence of SEQID NO: 4 (07F01). Hv4-59, Hu29B06 Hv4-59 D27G T30S M48II67V Y78F); 50 In some embodiments, the antibody comprises an immu the CDR is an amino acid sequence selected from the group noglobulin heavy chain variable region comprising the amino consisting SEQID NO: 6 (07F01), SEQID NO: 16 (12B11), acid sequence of SEQID NO: 12 (12B11), and an immuno SEQID NO: 26 (17F06), SEQID NO:36 (18HO9), SEQ ID globulin light chain variable region comprising the amino NO: 46 (29B06), and SEQ ID NO: 122 (Sh07F01 Hv3-48 acid sequence of SEQID NO: 14 (12B11). D28TT60A L63V E65G); and the CDR is an amino acid 55 In some embodiments, the antibody comprises an immu sequence selected from the group consisting of SEQID NO:7 noglobulin heavy chain variable region comprising the amino (07F01), SEQID NO: 17 (12B11), SEQID NO:27 (17F06), acid sequence of SEQID NO: 22 (17F06), and an immuno SEQID NO:37 (18H09), SEQID NO.47 (29B06), and SEQ globulin light chain variable region comprising the amino ID NO: 123 (Chimeric 07F01 C102S, ShO7F01 Hv3-48, acid sequence of SEQID NO: 24 (17F06). ShO7F01 Hv3-48 D28TT60A L63V E65G). The CDR, is an 60 In some embodiments, the antibody comprises an immu amino acid sequence selected from the group consisting of noglobulin heavy chain variable region comprising the amino SEQ ID NO: 8 (07F01), SEQID NO: 18 (12B11), SEQID acid sequence of SEQID NO: 32 (18HO9), and an immuno NO: 28 (17F06), SEQID NO:38 (18HO9), SEQ ID NO. 48 globulin light chain variable region comprising the amino (29B06), and SEQID NO: 130 (HEL 07F01 Kv1-9, ShO7F01 acid sequence of SEQID NO:34 (18H09). Kv1-9 F1): the CDR, is an amino acid sequence selected 65 In some embodiments, the antibody comprises an immu from the group consisting of SEQID NO: 9 (07F01), SEQID noglobulin heavy chain variable region comprising the amino NO: 19 (12B11), SEQ ID NO: 29 (17F06), SEQID NO:39 acid sequence of SEQID NO: 42 (29B06), and an immuno US 8,603,478 B2 9 10 globulin light chain variable region comprising the amino In some embodiments, the antibody comprises an immu acid sequence of SEQID NO: 44 (29B06). noglobulin heavy chain comprising the amino acid sequence In some embodiments, the antibody comprises an immu of SEQ ID NO: 101 (17F06), and an immunoglobulin light noglobulin heavy chain variable region comprising the amino chain comprising the amino acid sequence of SEQ ID NO: acid sequence of SEQID NO: 137 (ShO7F01 Hv3-48 D28T 103 (17F06). T60A L63V E65G), and an immunoglobulin light chain vari In some embodiments, the antibody comprises an immu able region comprising the amino acid sequence of SEQID noglobulin heavy chain comprising the amino acid sequence NO: 139 (HE L 07F01 Kv1-9). of SEQ ID NO: 105 (18H09), and an immunoglobulin light In some embodiments, the antibody comprises an immu chain comprising the amino acid sequence of SEQ ID NO: 10 107 (18HO9). noglobulin heavy chain variable region comprising the amino In some embodiments, the antibody comprises an immu acid sequence of SEQID NO: 147 (Hu29B06 Hv4-59 D27G noglobulin heavy chain comprising the amino acid sequence T30S M48II67VY78F), and an immunoglobulin light chain of SEQ ID NO: 109 (29B06), and an immunoglobulin light variable region comprising the amino acid sequence of SEQ chain comprising the amino acid sequence of SEQ ID NO: ID NO: 149 (Sh29B06 Kv2-28). 15 111 (29B06). In certain embodiments, the antibodies disclosed herein In some embodiments, the antibody comprises an immu comprise an immunoglobulin heavy chain and an immuno noglobulin heavy chain comprising the amino acid sequence globulin light chain. In some embodiments, the antibody of SEQ ID NO: 166 (ShO7F01 Hv3-48 D28T T60A L63V comprises an immunoglobulin heavy chain selected from the E65G IgG1), and an immunoglobulin light chain comprising group consisting of SEQID NO: 93 (07F01), SEQID NO: 97 the amino acid sequence of SEQID NO: 168 (HE L 07F01 (12B11), SEQ ID NO: 101 (17F06), SEQ ID NO: 105 Kv1-9 Kappa). (18H09), SEQID NO: 109 (29B06), SEQID NO: 156 (Chi In some embodiments, the antibody comprises an immu meric 07F01 C102S IgG1), SEQ ID NO: 160 (Chimeric noglobulin heavy chain comprising the amino acid sequence 29B06 IgG1), SEQ ID NO: 164 (ShO7F01 Hv3-48 IgG1), of SEQ ID NO: 176 (Hu29B06 Hv4-59 D27G T30S M48I SEQID NO: 166 (ShO7F01 Hv3-48 D28TT60A L63 VE65G 25 I67VY78F IgG1), and an immunoglobulin light chain com IgG1), SEQ ID NO: 172 (Sh29B06 Hv4-59 IgG1), SEQ ID prising the amino acid sequence of SEQ ID NO: 178 NO: 174 (Hu29B06 Hv4-59 IgG1), and SEQ ID NO: 176 (Sh29B06 Kv2-28 Kappa). (Hu29B06 Hv4-59 D27GT30S M48II67VY78F IgG1), and In certain embodiments, an isolated antibody that binds an immunoglobulin light chain. human RON comprises an immunoglobulin heavy chain vari In other embodiments, the antibody comprises an immu 30 able region comprising an amino acid sequence that is at least noglobulin light chain selected from the group consisting of 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to SEQID NO: 95 (07F01), SEQID NO:99 (12B11), SEQID the entire variable region or the framework region sequence NO: 103 (17F06), SEQ ID NO: 107 (18H09), SEQ ID NO: of SEQID NO. 2 (07F01), SEQID NO: 12 (12B11), SEQID 111 (29B06), SEQ ID NO: 158 (Chimeric 07F01 Kappa), NO: 22 (17F06), SEQID NO:32 (18HO9), SEQID NO:42 SEQID NO: 162 (Chimeric 29B06 Kappa), SEQID NO: 168 35 (29B06), SEQID NO: 133 (Chimeric 07F01 C102S), SEQID (HE L 07F01 Kv1-9 Kappa), SEQ ID NO: 170 (ShO7F01 NO: 135 (ShO7F01 Hv3-48), SEQ ID NO: 137 (ShO7F01 Kv1-9 ul Kappa), and SEQ ID NO: 178 (Sh29B06 Kv2-28 Hv3-48 D28T T60A L63V E65G), SEQ ID NO: 143 Kappa), and an immunoglobulin heavy chain. (Sh29B06 Hv4-59), SEQID NO: 145 (Hu29B06 Hv4-59), or In some embodiments, the antibody comprises (i) an SEQID NO: 147 (Hu29B06 Hv4-59 D27GT30S M48II67V immunoglobulin heavy chain selected from the group con 40 Y78F). sisting of SEQID NO: 93 (07F01), SEQID NO: 97 (12B11), In certain embodiments, an isolated antibody that binds SEQ ID NO: 101 (17F06), SEQID NO: 105 (18H09), SEQ human RON comprises an immunoglobulin light chain vari ID NO: 109 (29B06), SEQ ID NO: 156 (Chimeric 07F01 able region comprising an amino acid sequence that is at least C102S IgG1), SEQ ID NO: 160 (Chimeric 29B06 IgG1), 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to SEQID NO: 164 (ShO7F01 Hv3-48 IgG1), SEQID NO: 166 45 the entire variable region or the framework region sequence (ShO7F01 Hv3-48 D28T T60A L63V E65G IgG1), SEQ ID of SEQID NO: 4 (07F01), SEQID NO: 14 (12B11), SEQID NO: 172 (Sh29B06 Hv4-59 IgG1), SEQ ID NO: 174 NO: 24 (17F06), SEQID NO:34 (18HO9), SEQID NO:44 (Hu29B06 Hv4-59 IgG1), and SEQ ID NO: 176 (Hu29B06 (29B06), SEQ ID NO: 139 (HE L 07F01 Kv1-9), SEQ ID Hv4-59 D27G T30S M48I I67V Y78F IgG1), and (ii) an NO: 141 (ShO7F01 Kv1-9F1), or SEQID NO: 149 (Sh29B06 immunoglobulin light chain selected from the group consist 50 Kv2-28). ing of SEQ ID NO: 95 (07F01), SEQ ID NO: 99 (12B11), Homology or identity may be determined in various ways SEQ ID NO: 103 (17F06), SEQID NO: 107 (18H09), SEQ that are within the skill in the art, for instance, using publicly ID NO: 111 (29B06), SEQ ID NO: 158 (Chimeric 07F01 available computer software such as BLAST, BLAST-2, Kappa), SEQID NO: 162 (Chimeric 29B06 Kappa), SEQID ALIGN or Megalign (DNASTAR) software. BLAST (Basic NO: 168 (HE L 07F01 Kv1-9 Kappa), SEQ ID NO: 170 55 Local Alignment Search Tool) analysis using the algorithm (ShO7F01 Kv1-9 F1 Kappa), and SEQID NO: 178 (Sh29B06 employed by the programs blastp, blastin, blastX, thlastn and Kv2-28 Kappa). thlastx (Karlin et al., (1990) PROC. NATL. ACAD. SCI. USA 87, In some embodiments, the antibody comprises an immu 2264-2268: Altschul, (1993).J. MOL. EvOL. 36,290-300; Alts noglobulin heavy chain comprising the amino acid sequence chulet al., (1997) NUCLEIC ACIDS RES. 25, 3389-3402, incor of SEQ ID NO: 93 (07F01), and an immunoglobulin light 60 porated by reference) are tailored for sequence similarity chain comprising the amino acid sequence of SEQID NO: 95 searching. The approach used by the BLAST program is to (07F01). first consider similar segments between a query sequence and In some embodiments, the antibody comprises an immu a database sequence, then to evaluate the statistical signifi noglobulin heavy chain comprising the amino acid sequence cance of all matches that are identified and finally to Summa of SEQ ID NO: 97 (12B11), and an immunoglobulin light 65 rize only those matches which satisfy a preselected threshold chain comprising the amino acid sequence of SEQID NO: 99 of significance. For a discussion of basic issues in similarity (12B11). searching of sequence databases see Altschul et al., (1994) US 8,603,478 B2 11 12 NATURE GENETICS 6, 119-129 which is fully incorporated by as measured by Surface plasmon resonance methods at 37°C. reference. Those skilled in the art can determine appropriate under the conditions described in Examples 5 and 14. parameters for measuring alignment, including any algo In certain embodiments, the antibodies inhibit human MSP rithms needed to achieve maximal alignment over the full binding to human RON. For example, the antibodies can have length of the sequences being compared. The search param an ICs (concentration at 50% of maximum inhibition) of eters for histogram, descriptions, alignments, expect (i.e., the about 5 nM, 2 nM, 1 nM or lower, when assayed using the statistical significance threshold for reporting matches protocol described in Examples 8 and 15. against database sequences), cutoff matrix and filter are at the Although the embodiments illustrated in the Examples default settings. The default scoring matrix used by blastp. comprise pairs of variable regions, pairs of full length anti blastX, thlastin, and thlastx is the BLOSUM62 matrix (Heni 10 body chains, or pairs of CDR1, CDR2 and CDR3 regions, one koff et al., (1992) PROC. NATL. ACAD. SCI. USA 89, 10915 from a heavy chain and one from a light chain, a skilled 10919, fully incorporated by reference). Four blastn param artisan will recognize that alternative embodiments may com eters may be adjusted as follows: Q=10 (gap creation prise single heavy chain variable regions or single light chain penalty); R=10 (gap extension penalty); wink-1 (generates 15 variable regions, single full length antibody chains, or CDR1. word hits at every wink. Sup.th position along the query); and CDR2 and CDR3 regions from one antibody chain, either gapw-16 (sets the window width within which gapped align heavy or light. The single variable region, full length antibody ments are generated). The equivalent Blastp parameter set chain or CDR1, CDR2 and CDR3 region of one chain can be tings may be Q=9; R=2; wink=1; and gapw-32. Searches used to screen for corresponding domains in another chain, may also be conducted using the NCBI (National Center for the two chains capable of forming an antibody that binds Biotechnology Information) BLAST Advanced Option antigen. The screening may be accomplished by phage dis parameter (e.g.: -G, Cost to open gap Integer: default=5 for play Screening methods using, e.g., a hierarchical dual com nucleotides/11 for proteins; -E, Cost to extendgap Integer: binatorial approach disclosed in PCT Publ. No. WO92/ default=2 for nucleotides/1 for proteins; -q, Penalty for nucle 01047. In this approach, an individual colony containing otide mismatch Integer: default=-3; -r, reward for nucle 25 either a heavy or light chain clone is used to infect a complete otide match Integer: default=1; -e, expect value Real: library of clones encoding the other chain (light or heavy), default=10; -W, wordsize Integer: default=11 for nucle and the resulting two-chain specific antigen-binding domain otides/28 for megablast/3 for proteins; -y, propoff (X) for is selected in accordance with phage display techniques as blast extensions in bits: default=20 for blastn/7 for others;-X, described. X dropoff value for gapped alignment (in bits): default=15 for 30 II. Production of Antibodies all programs, not applicable to blastn; and -Z, final X dropoff Methods for producing antibodies, such as those disclosed value for gapped alignment (in bits): 50 for blastin, 25 for herein, are known in the art. For example, DNA molecules others). ClustalW for pairwise protein alignments may also encoding light chain variable regions and/or heavy chain be used (default parameters may include, e.g., Blosumó2 variable regions can be chemically synthesized using the matrix and Gap Opening Penalty=10 and Gap Extension Pen 35 sequence information provided herein. Synthetic DNA mol alty=0.1). A Bestfit comparison between sequences, available ecules can be ligated to other appropriate nucleotide in the GCG package version 10.0, uses DNA parameters sequences, including, e.g., constant region coding sequences, GAP=50 (gap creation penalty) and LEN=3 (gap extension and expression control sequences, to produce conventional penalty) and the equivalent settings in protein comparisons gene expression constructs encoding the desired antibodies. are GAP=8 and LEN=2. 40 Production of defined gene constructs is within routine skill In each of the foregoing embodiments, it is contemplated in the art. Alternatively, the sequences provided herein can be herein that immunoglobulin heavy chain variable region cloned out of hybridomas by conventional hybridization tech sequences and/or light chain variable region sequences that niques or polymerase chain reaction (PCR) techniques, using together bind human RON may contain amino acid alter synthetic nucleic acid probes whose sequences are based on ations (e.g., at least 1,2,3,4, 5, or 10amino acid Substitutions, 45 sequence information provided herein, or prior art sequence deletions, or additions) in the framework regions of the heavy information regarding genes encoding the heavy and light and/or light chain variable regions. chains of murine antibodies in hybridoma cells. In certain embodiments, the antibody binds human RON Nucleic acids encoding desired antibodies can be incorpo with a K, of 1 nM, 900 pM, 750 pM, 650 pM, 600 pM, 500 rated (ligated) into expression vectors, which can be intro pM, 400 pM,300 pM,250 pM,200 pM, 150 pM, 100 pM, 50 50 duced into host cells through conventional transfection or pM or lower. Unless otherwise specified, Kvalues are deter transformation techniques. Exemplary host cells are E. coli mined by Surface plasmon resonance methods under the con cells, Chinese hamster ovary (CHO) cells, human embryonic ditions described in Examples 5 and 14. kidney 293 (HEK293) cells, HeLa cells, baby hamster kidney Antibody Sh29B06-78 binds human RON with a Kof 500 (BHK) cells, monkey kidney cells (COS), human hepatocel pM,250 pM,200 pM, 150 pM, 100 pM or lower as measured 55 lular carcinoma cells (e.g., Hep G2), and myeloma cells that by Surface plasmon resonance methods under the conditions do not otherwise produce IgG protein. Transformed host cells described in Examples 5 and 14. In an exemplary embodi can be grown under conditions that permit the host cells to ment, antibody Sh29B06-78 binds human RON with a K of express the genes that encode the immunoglobulin light and/ 150 pM or lower as measured by surface plasmon resonance or heavy chain variable regions. methods at 37°C. under the conditions described in Examples 60 Specific expression and purification conditions will vary 5 and 14. depending upon the expression system employed. For Antibody SH07F01-62 binds human RON with a K of example, ifa gene is to be expressed in E. coli, it is first cloned 500pM,400pM,350pM,300pM,250pM,200 pM, 150pM, into an expression vector by positioning the engineered gene 100 pM or lower as measured by surface plasmon resonance downstream from a suitable bacterial promoter, e.g., Trp or methods under the conditions described in Examples 5 and 65 Tac, and a prokaryotic signal sequence. The expressed 14. In an exemplary embodiment, antibody SH07F01-62 secreted proteinaccumulates in refractile or inclusion bodies, binds human RON with a K of 250 pM to 350 pM or lower and can be harvested after disruption of the cells by French US 8,603,478 B2 13 14 press or sonication. The refractile bodies then are solubilized, 6855, Neuberger et al., 1984, NATURE 312:604-608; U.S. Pat. and the proteins refolded and cleaved by methods known in Nos. 6,893,625 (Robinson); 5,500,362 (Robinson); and the art. 4,816,567 (Cabilly). If the engineered gene is to be expressed in eukayotic host In an approach known as CDR grafting, the CDRs of the cells, e.g., CHO cells, it is first inserted into an expression light and heavy chain variable regions are grafted into frame vector containing a suitable eukaryotic promoter, a secretion works from another species. For example, murine CDRs can signal, IgG enhancers, and various introns. This expression be grafted into human FRS. In some embodiments, the CDRs vector optionally contains sequences encoding all or part of a of the light and heavy chain variable regions of an anti-RON constant region, enabling an entire, or a part of a heavy or antibody are grafted into human FRS or consensus human light chain to be expressed. The gene construct can be intro 10 FRs. To create consensus human FRS, FRs from several duced into eukaryotic host cells using conventional tech human heavy chain or light chain amino acid sequences are niques. The host cells express V, or V fragments, V-V. aligned to identify a consensus amino acid sequence. CDR heterodimers, V-V, or V-V single chain polypeptides, grafting is described in U.S. Pat. Nos. 7,022,500 (Queen); complete heavy or light immunoglobulin chains, or portions 6,982,321 (Winter); 6,180,370 (Queen); 6,054,297 (Carter); thereof, each of which may be attached to a moiety having 15 5,693,762 (Queen); 5,859.205 (Adair); 5,693,761 (Queen); another function (e.g., cytotoxicity). In some embodiments, a 5,565,332 (Hoogenboom): 5,585,089 (Queen); 5,530,101 host cell is transfected with a single vector expressing a (Queen); Jones et al. (1986) NATURE 321:522-525; Riech polypeptide expressing an entire, or part of a heavy chain mann et al. (1988) NATURE 332: 323-327; Verhoeyen et al. (e.g., a heavy chain variable region) or a light chain (e.g., a (1988) SCIENCE 239: 1534-1536; and Winter (1998) FEBS LETT light chain variable region). In other embodiments, a host cell 430: 92-94. is transfected with a single vector encoding (a) a polypeptide In an approach called “SUPERHUMANIZATIONTM,” comprising a heavy chain variable region and a polypeptide human CDR sequences are chosen from human germline comprising a light chain variable region, or (b) an entire genes, based on the structural similarity of the human CDRs immunoglobulin heavy chain and an entire immunoglobulin to those of the mouse antibody to be humanized. See, e.g., light chain. In still other embodiments, a host cell is co 25 U.S. Pat. No. 6,881,557 (Foote); and Tan et al., 2002, J. transfected with more than one expression vector (e.g., one IMMUNOL. 169:1119-1125. expression vector expressing a polypeptide comprising an Other methods to reduce immunogenicity include “reshap entire, or part of a heavy chain or heavy chain variable region, ing.” “hyperchimerization, and "veneering/resurfacing.” and another expression vector expressing a polypeptide com See, e.g., Vaswami et al., 1998, ANNALS OF ALLERGY, ASTHMA, & prising an entire, or part of a light chain or light chain variable 30 IMMUNOL.81:105; Roguska et al., 1996, PROT. ENGINEER 9:895 region). 904; and U.S. Pat. No. 6,072,035 (Hardman). In the veneer A polypeptide comprising an immunoglobulin heavy chain ing/resurfacing approach, the surface accessible amino acid variable region or light chain variable region can be produced residues in the murine antibody are replaced by amino acid by growing a host cell transfected with an expression vector residues more frequently found at the same positions in a encoding Such variable region, under conditions that permit 35 human antibody. This type of antibody resurfacing is expression of the polypeptide. Following expression, the described, e.g., in U.S. Pat. No. 5,639,641 (Pedersen). polypeptide can be harvested and purified using techniques Another approach for converting a mouse antibody into a well known in the art, e.g., affinity tags such as glutathione form suitable for medical use in humans is known as S-transferase (GST) and histidine tags. ACTIVMABTM technology (Vaccinex, Inc., Rochester, A monoclonal antibody that binds human RON, or an 40 N.Y.), which involves a vaccinia virus-based vector to express antigen-binding fragment of the antibody, can be produced by antibodies in mammalian cells. High levels of combinatorial growing a host cell transfected with: (a) an expression vector diversity of IgG heavy and light chains are said to be pro that encodes a complete or partial immunoglobulin heavy duced. See, e.g., U.S. Pat. Nos. 6,706,477 (Zauderer); 6,800, chain, and a separate expression vector that encodes a com 442 (Zauderer); and 6,872,518 (Zauderer). plete or partial immunoglobulin light chain; or (b) a single 45 Another approach for converting a mouse antibody into a expression vector that encodes both chains (e.g., complete or form Suitable for use in humans is technology practiced com partial heavy and light chains), under conditions that permit mercially by KaloBios Pharmaceuticals, Inc. (Palo Alto, expression of both chains. The intact antibody (or antigen Calif.). This technology involves the use of a proprietary binding fragment) can be harvested and purified using tech human “acceptor' library to produce an “epitope focused niques well known in the art, e.g., Protein A, Protein G, 50 library for antibody selection. affinity tags such as glutathione-S-transferase (GST) and his Another approach for modifying a mouse antibody into a tidine tags. It is within ordinary skill in the art to express the form suitable for medical use in humans is HUMAN ENGI heavy chain and the light chain from a single expression NEERINGTM technology, which is practiced commercially vector or from two separate expression vectors. by XOMA (US) LLC. See, e.g., PCT Publication No. WO III. Antibody Modifications 55 93/11794 and U.S. Pat. Nos. 5,766,886 (Studnicka): 5,770, Methods for reducing or eliminating the antigenicity of 196 (Studnicka); 5,821,123 (Studnicka); and 5,869,619 antibodies and antibody fragments are known in the art. When (Studnicka). the antibodies are to be administered to a human, the antibod Any suitable approach, including any of the above ies preferably are “humanized to reduce or eliminate anti approaches, can be used to reduce or eliminate human immu genicity in humans. Preferably, the humanized antibodies 60 nogenicity of an antibody. have the same or Substantially the same affinity for the antigen In addition, it is possible to create fully human antibodies as the non-humanized mouse antibody from which it was in mice. Fully human mAbs lacking any non-human derived. sequences can be prepared from human immunoglobulin In one humanization approach, chimeric proteins are cre transgenic mice by techniques referenced in, e.g., Lonberget ated in which mouse immunoglobulin constant regions are 65 al., NATURE 368:856-859, 1994; Fishwild et al., NATURE BIO replaced with human immunoglobulin constant regions. See, TECHNOLOGY 14:845-851, 1996; and Mendez et al., NATURE e.g., Morrison et al., 1984, PROC. NAT. ACAD. SCI. 81:6851 GENETICS 15:146-156, 1997. Human mAbs can also be pre US 8,603,478 B2 15 16 pared and optimized from phage display libraries by tech the course of treatment. Human dosage can be optimized, niques referenced in, e.g., Knappik et al., J. MoL. BIOL. 296: e.g., in a conventional Phase I dose escalation study designed 57-86, 2000; and Krebs et al., J. Immunol. Meth. 254:67-84 to run from 0.5 mg/kg to 20 mg/kg. Dosing frequency can 2001). vary, depending on factors such as route of administration, If the antibody is for use as a therapeutic, it can be conju dosage amount and the disease being treated. Exemplary gated to an effectoragent such as a small molecule toxin or a dosing frequencies are once per day, once per week and once radionuclide using standard in vitro conjugation chemistries. every two weeks. In some embodiments, dosing is once every If the effector agent is a polypeptide, the antibody can be two weeks. A preferred route of administration is parenteral, chemically conjugated to the effector orjoined to the effector e.g., intravenous infusion. Formulation of monoclonal anti as a fusion protein. Construction of fusion proteins is within 10 body-based drugs is within ordinary skill in the art. In some ordinary skill in the art. embodiments, the antibody is lyophilized and reconstituted in IV. Use of Antibodies buffered saline at the time of administration. The antibodies disclosed hereincan be used to treat various For therapeutic use, an antibody preferably is combined forms of cancer, e.g., non-Small cell lung cancer, breast, ova with a pharmaceutically acceptable carrier. As used herein, rian, prostate, cervical, colorectal, lung, pancreatic, gastric, 15 “pharmaceutically acceptable carrier means buffers, carri and head and neck cancers. The cancer cells are exposed to a ers, and excipients suitable for use in contact with the tissues therapeutically effective amount of the antibody so as to of human beings and animals without excessive toxicity, irri inhibit or reduce proliferation of the cancer cell. In some tation, allergic response, or other problem or complication, embodiments, the antibodies inhibit cancer cell proliferation commensurate with a reasonable benefit/risk ratio. The car by at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%.99%, rier(s) should be “acceptable' in the sense of being compat or 100%. ible with the other ingredients of the formulations and not In some embodiments, the antibody (e.g., 07F01, 29B06, deleterious to the recipient. Pharmaceutically acceptable car 17F06, 18HO9, 12B11, sh29B06, sho7F01) inhibits or riers include buffers, solvents, dispersion media, coatings, reduces proliferation of a tumor cell by inhibiting binding of isotonic and absorption delaying agents, and the like, that are human RON to its ligand, MSP. In some embodiments, the 25 compatible with pharmaceutical administration. The use of antibody (e.g., 07F01, 29B06, 17F06, 18HO9, 12B11, Such media and agents for pharmaceutically active Substances sh29B06, sh()7F01) inhibits or reduces proliferation of a is known in the art. tumor cell without inhibiting RON binding to MSP. The anti Pharmaceutical compositions containing antibodies, such body (e.g., 07F01, 29B06, 17F06, 18HO9, 12B11, sh29B06, as those disclosed herein, can be presented in a dosage unit sh()7F01) can also be used in therapy. The antibody (e.g., 30 form and can be prepared by any suitable method. A pharma 07F01, 29B06, 17F06, 18HO9, 12B11, sh29B06, sho7F01) ceutical composition should be formulated to be compatible can be used to inhibit tumor growth in a mammal (e.g., a with its intended route of administration. Examples of routes human patient). In some embodiments, use of the antibody to of administration are intravenous (IV), intradermal, inhala inhibit tumor growth in a mammal comprises administering tion, transdermal, topical, transmucosal, and rectal adminis to the mammal atherapeutically effective amount of the anti 35 tration. A preferred route of administration for monoclonal body. antibodies is IV infusion. Useful formulations can be pre In certain embodiments, antibody sh29B06-78 is used in pared by methods well known in the pharmaceutical art. For therapy. For example, antibody sh29B06-78 can be used for example, see Remington's Pharmaceutical Sciences, 18th ed. inhibiting or reducing proliferation of a tumor cell. Antibody (Mack Publishing Company, 1990). Formulation compo sh29B06-78 can also be used for inhibiting or reducing tumor 40 nents Suitable for parenteral administration include a sterile growth in a mammal. diluent such as water for injection, Saline solution, fixed oils, In other embodiments, antibody sho7FO1-62 is used in polyethylene glycols, glycerine, propylene glycol or other therapy. For example, antibody sho7F01-62 can be used for synthetic solvents; antibacterial agents such as benzyl alcohol inhibiting or reducing proliferation of a tumor cell. Antibody or methyl paraben; antioxidants such as ascorbic acid or sh()7F01-62 can also be used for inhibiting or reducing tumor 45 sodium bisulfite; chelating agents such as EDTA; buffers growth in a mammal. Such as acetates, citrates or phosphates; and agents for the Cancers associated with overexpression or inappropriate adjustment of tonicity Such as sodium chloride or dextrose. activation of RON include non-small cell lung cancer, breast For intravenous administration, Suitable carriers include cancer, ovarian cancer, prostate cancer, lung cancer, colorec physiological saline, bacteriostatic water, Cremophor ELTM tal cancer, pancreatic cancer, bladder cancer, and some forms 50 (BASF, Parsippany, N.J.) orphosphate buffered saline (PBS). of brain cancer, melanomas, and gastrointestinal cancers. The carrier should be stable under the conditions of manu As used herein, “treat,” “treating” and “treatment’ mean facture and storage, and should be preserved against micro the treatment of a disease in a mammal, e.g., in a human. This organisms. The carrier can be a solvent or dispersion medium includes: (a) inhibiting the disease, i.e., arresting its develop containing, for example, water, ethanol, polyol (for example, ment; and (b) relieving the disease, i.e., causing regression of 55 glycerol, propylene glycol, and liquid polyethylene glycol), the disease state. and suitable mixtures thereof. Generally, a therapeutically effective amount of active Pharmaceutical formulations preferably are sterile. Steril component is in the range of 0.1 mg/kg to 100 mg/kg, e.g., 1 ization can be accomplished, for example, by filtration mg/kg to 100 mg/kg, 1 mg/kg to 10 mg/kg. The amount through sterile filtration membranes. Where the composition administered will depend on variables Such as the type and 60 is lyophilized, filter sterilization can be conducted prior to or extent of disease or indication to be treated, the overall health following lyophilization and reconstitution. of the patient, the in vivo potency of the antibody, the phar maceutical formulation, and the route of administration. The EXAMPLES initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level. 65 The following Examples are merely illustrative and are not Alternatively, the initial dosage can be Smaller than the opti intended to limit the scope or content of the invention in any mum, and the dosage may be progressively increased during way. US 8,603,478 B2 17 18 Example 1 extracellular domain (hRON-ECD). Two Balb/c mice with sera displaying the highest anti-RON activity by Enzyme Production of Human RON Extracellular Domain LinkedImmunosorbent Assay (ELISA) were chosen for sub (ECD) sequent fusion. Spleens and lymph nodes from the appropri ate mice were harvested. B-cells were harvested and fused This Example describes the production of the antigen, with a myeloma line. Fusion products were serially diluted hRON ECD protein. The use of the full length ECD as the onto forty 96-well plates to near clonality. immunogen, allowed for the selection of two classes of hybri Approximately 4,000 supernatants from the cell fusions domas: (a) those producing antibodies that interact with the were screened by ELISA for binding to recombinant hRON ligand binding domain, thereby inhibiting contact of the 10 ECD. A total of 158 supernatants containing antibodies ligand to the receptor, and (b) those producing antibodies that against RON were further characterized by in vitrobiochemi bind outside the ligand binding domain, thereby inhibiting the cal and cell-based assays, as described below. A panel of receptor functions through mechanisms other than inhibition hybridomas was selected, subcloned and expanded. Hybri of ligand binding. doma cell lines were transferred to BioXCell (West Lebanon, DNA encoding the extracellular domain of human RON 15 N.H.) for antibody expression and purification by affinity (hRON ECD) (refseq NM 002447) was amplified by PCR chromatography on Protein G resin, under standard condi and subcloned using the Xmal/EcoRI restriction sites in tions. frame into the pEE 14.4 vector (Lonza, Basel, Switzerland) containing THXmlFC (Thrombin/His tag/Factor Xa-AJ Example 3 mouse IgG-Fc), to produce a fusion protein. The resulting clone was linearized using the PVul enzyme (NEBiolabs, Cat. Screening Assays No. R0150), then electroporated into CHO K1 SVcells (Lonza). The electroporated cells were diluted in 200 ml CD A biochemical assay was carried out to identify antibodies CHO media (Gibco Cat. No. 10743-011). The next day, CD that inhibit ligand binding. A cell-based assay was carried out CHO media containing methionine sulfoximine (MSX) for a 25 to identify antibodies that inhibit MSP induced phosphoERK final concentration of 50M was added to the cells. After four downstream signaling of the receptor. Antibodies that inhib weeks, positive clones were selected by sandwich ELISA in ited RON mediated cellular signaling were selected for fur which the immobilized antibody was commercial mono ther characterization regardless of whether they blocked clonal anti-hRON antibody MAB691 (R&D Systems), and ligand binding in the neutralization assay. the detection antibody was commercial polyclonal anti 30 The biochemical neutralization assay measures inhibition hRON antibody AF691 (R&D Systems). Positive clones were of MSP binding to hRON by antibodies in hybridoma super re-transfected using LIPOFECTAMINETM 2000 in a standard natants, using electrochemiluminescence (ECL). MA2400 protocol. Cells were aliquoted into four separate shaker flasks 96-well high binding plates (Meso Scale Discovery) were and selected using 50 uM, 100 uM, 200 uM, and 400 uM coated with 25 ul of 0.42 ug/mL hRON SEMA+PSI (an MSX. After two weeks of selection, the individual flasks were 35 N-terminal portion of the ECD of hRON: R&D Systems) in checked for hRON-ECD protein expression by ELISA. The PBS for one hour at room temperature with agitation. The highest selection pressure, 400 uMMSX, yielded good pro plates were washed four times with PBS+0.1%TWEEN-20R) tein expression and was chosen for scale-up and purification. (PBST), and blocked with 150 ul of charcoal-stripped fetal Cells were grown for 2 weeks at 37° C. in BELLOCELL(R) bovine serum (FBS) (Gibco). The hybridoma Supernatant bottles (Bellco Glass, Vineland, N.J.) at a concentration of 40 were added and incubated for 45 minutes at room tempera 2-2.5x10° cells/ml in CD CHO media, with a final concen ture. After incubation, 5 ul of MSP (3 ug/mL) in charcoal tration of 80 uMMSX for protein production. The resulting stripped FBS was added to each well, and incubated for 45 cells were spun down in 500 ml conical tubes for 15 minutes. minutes. The plate was washed four times with PBST, and 25 The Supernatant was filtered using vacuum filtration using a ul of 1 lug/mL biotinylated anti-MSP antibody (R&D Sys 0.45 micron filter and then a 0.22 micron filter. The protein 45 tems) was added to the plates for one hour at room tempera was then batch bound to PROSEPR-A beads (Millipore) at 4° ture with agitation. The plates were washed four times with C. overnight with rotation after adjusting the pH to 7.5. The PBST, and incubated with 25 ul of 1 g/mL ST-streptavidin beads were washed with 1xPBS and loaded onto disposable (Meso Scale Discovery) for one hour at room temperature protein A affinity columns (Bio-Rad ECONO-PAC(R) col with agitation. The plates were washed four times with PBST, umns: Bio-Rad cat. No. 732-1010). The beads were washed 50 and 150 ul read buffer (Meso Scale Discovery) was added to with 10 column volumes (CV) of glycine binding buffer (3M each well before the plates were analyzed on a SECTORR) glycine ph9.0, 1MNaCl). The protein was then eluted off the IMAGER 2400 (Meso Scale Discovery) instrument. Anti columnusing 5-10 CV of 200 mM glycine pH 2.5 acid elution bodies 07F01, 18H09 and 29B06 each blocked MSP binding buffer. The samples were then neutralized using 1.3 mL of 1.0 to hRON SEMA+PSI in this neutralization assay. M Tris pH 8.0 neutralization buffer concentrated using 55 In the cell-based assay, antibodies in the hybridoma Super VIVASPINR concentrators (Sartorius Stedim Biotech). natant were tested for inhibition of MSP-induced phospho rylation of ERK, which is a RON downstream signaling mol Example 2 ecule. T47D cells were cultured in 96-well plates in RPMI 1640+10% FBS+ insulin. Medium was removed, and cells Anti-RON Antibodies 60 were incubated in serum-free medium for 24 hours. Hybri doma Supernatants containing RON antibodies were added to This Example describes the production of anti-hRON the cells at a dilution of 1:4 in-serum-free medium, and incu monoclonal antibodies. Immunizations, fusions, and primary bated for one hour at 37° C. MSP (5 nM) was added to the screens were conducted at Maine Biotechnology Services wells and incubated for 15 minutes. Medium was removed, Inc. (Portland, Me.), following the Repetitive Immunization 65 and cells were fixed in 4% paraformaldehyde (PFA) in PBS. Multiple Sites (RIMMS) protocol. Five AJ mice and five Total ERK and phospho-ERK were measured according to Balbic mice were immunized with recombinant human RON the vendors instructions (R&D Systems, DY1018). Antibod US 8,603,478 B2 19 20 ies 07 FO1, 12B11, 17F06, 18HO9 and 29B06 each inhibited fication of 5' cDNA ends in conjunction with the SMARTerTM MSP induced ERK phosphorylation in T47D cells. RACE cDNA Amplification Kit, the Universal Primer Mix A As discussed herein (see Examples 8 and 9), antibodies primer (Clontech), a mix of 5' CTAATACGACTCACTATAGGGCAAG 07FO1, 12B11, 17F06, 18HO9 and 29B06 each inhibited MSP CAGTGGTATCAACGCAGAGT3' (SEQ ID NO: 113) and 5' CTAATAC induced ERK phosphorylation in T47D cells, while only anti GACTCACTATAGGGC 3' (SEQ ID NO: 114), was used as a 5' bodies 07F01, 18H09 and 29B06 each blocked MSP binding primer. Heavy chain variable regions were amplified using to hRON SEMA+PSI in the neutralization assay. This sug the above 5' primers and a 3' IgG1 constant region specific gests that antibodies 12B11 and 17F06 do not neutralize primer, 5'TATGCAAGGCTTACAACCACA3' (SEQID NO: 115), or a binding of MSP to the hRON SEMA+PSI domain, neutralize 3'IgG2a constant region specific primer, 5' AGGACAGGGCTTGAT binding of MSP to RON in the context of the full RON 10 TGTGGG 3' (SEQ ID NO: 116). Kappa chain variable regions extracellular domain, or function by a mechanism other than were amplified with the above 5' primers and a 3' kappa blocking MSP binding to RON. constant region specific primer, 5' CTCATTCCTGTTGAAGCTCTTGA Example 4 CAAT 3' (SEQ ID NO: 117). Lambda chain variable regions 15 were amplified with the above 5' primers and a mix of 3 Antibody Sequence Analysis lambda constant region specific primers, 5' GCACGGGA CAAACTCTTCTC3" (SEQID NO: 118) and 5' CACAGTGTCCCCTTCAT. The light chain isotype and heavy chain isotype of each GTG 3' (SEQID NO: 119). monoclonal antibody in Example 2 was determined using the Individual PCR products were isolated by agarose gel elec ISOSTRIPTM Mouse Monoclonal Antibody Isotyping Kit trophoresis and purified using the QIAQUICKTM Gel Purifi according the kit vendor's instructions (Roche Applied Sci cation kit according to the kit vendors instructions (Qiagen). ence, Indianapolis, Ind.). All antibodies were found to be The PCR products were subsequently cloned into the PCRR) kappa or lambda light chain and IgG1 or IgG2a heavy chain. 4Blunt TOPOR) plasmid or PCRR) 2.1-TOPOR) plasmid The heavy and light chain variable regions of the mouse using the ZERO BLUNTR TOPO.R. PCR Cloning Kit or the monoclonal antibodies were sequenced using 5' RACE 25 TOPORTA Cloning Kit, respectively, according to the kit (Rapid Amplification of cDNA Ends). Total RNA was Vendors instructions (Invitrogen) and transformed into extracted from each monoclonal hybridoma cell line using DH5-C. bacteria (Invitrogen) through standard molecular the RNEASYR Miniprep kit according to the kit vendor's biology techniques. Plasmid DNA isolated from transformed instructions (Qiagen, Valencia, Calif.). Full-length first strand bacterial clones was sequenced using M13 Forward (5' cDNA containing 5' ends was generated using either the 30 GTAAAACGACGGCCAGT3') (SEQID NO: 120) and M13 Reverse GENERACERTM Kit (Invitrogen, Carlsbad, Calif.) or primers (5' CAGGAAACAGCTATGACC 3') (SEQ ID NO: 121) by SMARTERTM RACE cDNA Amplification Kit (Clontech, Beckman Genomics (Danvers, Mass.), using standard Mountain View, Calif.) according to the kit vendor's instruc dideoxy DNA sequencing methods to identify the sequence tions using random primers for 5 RACE. of the variable region sequences. The sequences were ana The variable regions of the light (kappa or lambda) and 35 lyzed using VECTOR NTIR software (Invitrogen) and the heavy (IgG1 or IgG2b) chains were amplified by PCR, using IMGT/V-Quest web server (imgt.cines.fr) to identify and KOD Hot Start Polymerase (EMD Chemicals, Gibbstown, confirm variable region sequences. N.J.), Expand High Fidelity PCR System (Roche Applied The nucleic acid sequences encoding and the protein Science), or Advantage 2 Polymerase Mix (Clontech) accord sequences defining variable regions of the murine mono ing to the kit vendors instructions. For amplification of 5' 40 clonal antibodies are shown below (amino terminal signal cDNA ends in conjunction with the GeneRacerTM Kit, the peptide sequences are not shown). CDR sequences (Kabat GeneRacerTM 5' Primer, 5' cgactggagcacgaggacactgaa' (SEQ definition) are indicated by bold font and underlining in the ID NO: 112) (Invitrogen) was used as a 5' primer. For ampli amino acid sequences.

Nucleic Acid Sequence Encoding the Heavy Chain Variable Region of the O7FO1 Antibody (SEQ ID NO: 1) 1 gaggtgaa.gc ttct coagtc tggaggtggc Ctggtgcagc cgggtggat.c cctgaaactic 61 to ctgtgcag cct caggatt cgattittagt agacactgga tgagttgggit ccggctggct 121 cc agggaaag ggctagaatg gatcgcagaa attaatccag at agcagaac gataaactat 181 acgc catcto taaaggagaa attcatcatc. tccagagaca acgc.caaaaa titcgctgttt 241 ctgcaaatga acagagtgag atctgaggac acagcc ctitt attact.gtgc alagacgggta

301 agaatt catt actacggcgc tatggactgc tggggtCaag gaacct cagt caccgt.ct co

361 tota Protein Sequence Defining the Heavy Chain Variable Region of the O7FO1 Antibody (SEQ ID NO: 2) 1 evkillesggg livopggslikl scaasgfdfs rhwimsWVrla pgkglewiae inpdsr tiny 61tpsilkekfii Srdinakinslf lomnirvrsed tallyy carrv rihyygamdc Wgq9tsvtvs

121s US 8,603,478 B2 21 22 - Continued Nucleic Acid Sequence Encoding the Kappa Chain Variable Region of the O7FO1 Antibody (SEQ ID NO : 3) 1gacattgttgt tacc cagtic ticaaaaaatc gtgtc. cacat cagtaggagc cagggit cagc 61gt.c acctgca aggcc agtica gaatgtgggit totagtt tag totggitatica acagaalacca 121ggit caat citc ctaaaac act gatttact.cg goat cct tcc gg tacagtgg agtcc ct gat 181.cgctt cacag goagtggat c togggacagat ttcact citca ccatcagcaa totgcagtict 241 gaagacittgg cagattattt ctdtcaacaa tataataact at cogct cac gttcggtgct 301.gggaccalagc tiggagctgaa a Protein Sequence Defining the Kappa Chain Variable Region of the O7FO1 Antibody (SEQ ID NO : 4) 1 divlt qsqki vstsvgarvs Witckasgnvg. ss.lv Wyggkp gospktliys as frysgvpd 61 riftgsgsgto. ftltiSnvos edladyfcgg ynnypltfga gtklelk Nucleic Acid Sequence Encoding the Heavy Chain Variable Region of the 12B11 Antibody (SEQ ID NO: 11) 1 gaggtgcagt tagtggagtic tiggggaggc titagtgaagc ctggagggit C cctgaaactic 61 toctdtgcag cct ctdgatt cactitt cagt accitatgcca totcttggat togccagact 121 ccggagaaga ggctggagtg ggit cqcagga at Cactaatg gtgg tagttt Cacct actat 181ccaga cactg tdaagggacg attcaccatc. tccagagaca atgcc aggaa catcc tatac 241 ctgcaaatga gcggtctgag gtctgaggac acggc catgt attattgttgc aagacagggit 301 tactatoggtg tta actittga c tactggggc caaggcacca ct ct cacagt ct cotca Protein Sequence Defining the Heavy Chain Variable Region of the 12B11 Antibody (SEQ ID NO: 12) 1 evolves.ggg livkpggs likl sca as giftfs tyamsWirqt pekirleWvag itnggs if tyy 61.pdtvkgrfti Srdinarnily lcmsglrsed tamyy cargg yygvnfdyWg qgttltVSS Nucleic Acid Sequence Encoding the Kappa Chain Variable Region of the 12B11 Antibody (SEQ ID NO: 13) 1 gatgctgtga tigacic caaac tocactic toc ctdcctgtca gt cittggaga toaa.gc.cticc 61 atctottgca ggit ctagt ca gagcc.ttgaa aacagtaacg gaaac actta tttgaactgg 121 tacct coaga aaccaggcca gtctic cacag citcct gatct acagggittt c caaccattt 181tctgggg.tcc CagaCaggitt Cagtgg tagt ggat Caggga cagattt cac actgaaaatc 241 atcagagtgg aggctgagga tittgggactt tatttctgcc to Caagttac acatgtc.ccg 301 cacacgttcg gaggggggaC caaactggala ttaaaa Protein Sequence Defining the Kappa Chain Variable Region of the 12B11 Antibody (SEQ ID NO: 14) 1 daVmtgtpls lp vslgdgas is Crssgsle nsingnty linw ylgkpggspa liliyrvsnrf 61sgvpdrfsgs gsgtoftliki irvealediligl yfc.lgvithvp htfgggtkle lik Nucleic Acid Sequence Encoding the Heavy Chain Variable Region of the 17 FO6 Antibody (SEQ ID NO: 21) 1gaagtgaagc tiggtggagtic ggggggaggc titagtgaagc ctggagcgtc. tctgaaactic 61 toctdtgcag cct ctdgatt catttitcagt toc tatggca totcttgggit togccagact 121 tdaga caaga ggctggagtg ggit cqct tcc attagtagtg gtggtgg tac Cacct actat 181 ctaga cactg taaagggc.cg attcaccatc. tccagagaga atgccaagga caccctgtac 241 ctgcaaatga gtggtctgaa gtctgaagac acggccttgt attactgtac aagaggccala 3O1ttt actaa agtttgctta Ctggggc.cala gggactctgg to actgtctic tica US 8,603,478 B2 23 24 - Continued Protein Sequence Defining the Heavy Chain Variable Region of the 17 FO6 Antibody (SEQ ID NO: 22) 1 evklves.ggg livkpgaslikl scaasgfifs sygmsWVrqt SdkrleWvas issgggttyy 61ldtvkgrfti Srenakdtly lcmsglksed tallyyctrgg willkfay Wgq gtlvt Visa Nucleic Acid Sequence Encoding the Lambda Chain Variable Region of the 17 FO6 Antibody (SEQ ID NO: 23) 1 caacttgttgc ticact cagtic atctt cagoc totttct coc tdggagcctic agcaaaactic 61 acgtgcacct tdagtag to a gcacactacg tacac cattgaatggitatica goaactgc.ca 121 ct caa.gc.ctic ctaagtatgt gatggagctt aagaaagatg galagccacag cacaggtgtt 181gggattic ctd atcgcttctic toggat.ccago totggtgctg at cqctacct taccatttcc 241aac atccago Ctgaagatga agcaatatac atctgtggtg tdggtgaga C aattgaggac 301 caatttgttgt atgttitt cqg cqgtggcacc aaggt cactg. tccta Protein Sequence Defining the Lambda Chain Variable Region of the 17 FO6 Antibody (SEQ ID NO: 24) 1 qlviltos ssa SfSlgasakil t c tilssg.htty tieWygglp likppkyVmell k.kdgshstgv 61.gipdrfsg SS Sgadrylt is niqpedeality icgvgetied gifvywfgggt kvtvil Nucleic Acid Sequence Encoding the Heavy Chain Variable Region of the 18HO9 Antibody (SEQ ID NO: 31) 1 gaggtgcagc titcaggagtic aggacct agc Ctcgtgaaac Cttct Cagac totgtcc ct c 61 acctgttatgtcactggcga citc catcacc agtgattact ggaattggat coggaaattic 121 ccaggaaata aacttgagta catgggatat atcagctaca gtggtag cac titact acaat 181c catc to tca aaagt cqaat ct c catcact cqagacacat coaagaacca gttctacctt 241 cqgttgaatt citctgactac taggacaca gccacatatt actgtgcaag aacccatata 301 cttacgattg Ctt actgggg C caagggact ctggit cactg. tctctgca Protein Sequence Defining the Heavy Chain Variable Region of the 18HO9 Antibody (SEQ ID NO: 32) 1 evoldesgps livkpSqtls l t cyvtgd sit sidywnWirkf pgnkleymgy isysgs tyyn 61.psilksri sit rot skingfyl rlinsvttedt atyycarthi litiayWgqigt livtvisa Nucleic Acid Sequence Encoding the Lambda Chain Variable Region of the 18HO9 Antibody (SEQ ID NO: 33) 1 caggctgttg togacticagga atctgcactic accacat cac ct ggtgaaac agt cacactic 61 acttgtc.gct Caagtgc.cgg ggctgttaca act agta act ttgccaact g ggtcCaagaa 121aaaccagatc atttatt cac togg totaata ggtgatacca acatc.cgagic to caggtgtt 181 cctgccagat t ct caggct C cct gattgga gacaaggctg. cc ct cac cat cacaggggca 241 Cagactgagg atgaggcaat at atttctgt gct Ctttggit acagdalacca ttactgggtg 3O1ttcggtggag galaccaaact gactgtc.cta Protein Sequence Defining the Lambda Chain Variable Region of the 18HO9 Antibody (SEQ ID NO: 34) 1 qavvtdesal tt Spgetvtil t criss agavt tisnfanWvge kpdhlft gli gotnirapgv 61 parfsg slig dkaaltitga qtedealiyfc alwysinhywv fgggtkltvil Nucleic Acid Sequence Encoding the Heavy Chain Variable Region of the 29B06 Antibody (SEQ ID NO: 41) 1 gaggtgcagc titcaggagtic aggacct agc Ctcgtgaaac Cttct Cagac totgtcc ct c 61 acctgttctg. t cactggcga citc catcacc agtggittact ggaactggat coggaaattic 121 C cagggaata aacttgagta catgggg tac ataagctaca gtggtaaaac ttact acaat US 8,603,478 B2 25 26 - Continued 181c catc to tca aaagt cqaat ct c catcact cgaga cacat coaagaacca ttactacctg 241 cagttgattt citctgactgc tigaggacaca gccacatatt actgtgcaag gtctaagtac 3O1 gactatocta toggac tact g giggit caagga acct cagtica cc.gtctic ct c a Protein Sequence Defining the Heavy Chain Variable Region of the 29B06 Antibody (SEQ ID NO: 42) 1 evoldesgps livkp sqtls l to svtgd sit sgyWinWirkf pgnkleymgy isysgktyyn 61 psilksri sit ratskinhyyl qli Svitaedt atyycarsky dyandy Wgqg tsvt VSS Nucleic Acid Sequence Encoding the Kappa Chain Variable Region of the 29B06 Antibody (SEQ ID NO: 43) 1 gacattgttgc tigacic caatc. tccagottct ttggctgtgt ctictaggaca gagggccacc

61 atctoctogca gagcc agcga aattgttgat aattittggca ttagtttitat galactggttc 121 caacagaaac caggacagoc acc caaactic ct catctatg ctgcatccaa ccaaggat CC

181ggggtcc ctg. C Caggitt tag tggcagtggg totggga cag actitcagcct CalacatcCat 241 cct gtggagg aggatgatac ticaatgitat ttctgtcagc aaagtaagga ggttcct cog 301 acgttcggtg gaggcaccala gctggaaatc aaa. Protein Sequence Defining the Kappa Chain Variable Region of the 29B06 Antibody (SEQ ID NO: 44) 1 divltospas lavslgcrat is craseivd infgisfmnwf GOkpgqppkl liyaasinggs 61 gvparfsgsg sgtdfslnih pveeddtamy foggskevpp trigggth.lei k

The amino acid sequences defining the immunoglobulin TABLE 1-continued heavy chain variable regions for the antibodies produced in Example 2 are aligned in FIG. 2. Amino terminal signal SEQ. ID NO. Nucleic Acid or Protein peptide sequences (for expression/secretion) are not shown. 35 17 2B11 Heavy Chain CDR CDR, CDR, and CDR (Kabat definition) are identified by 18 2B11 Light (kappa) Chain CDR 19 2B11 Light (kappa) Chain CDR2 boxes. FIG. 3 shows an alignment of the separate CDR, 2O 2B11 Light (kappa) Chain CDR CDR, and CDR sequences for each antibody. 21 7F06 Heavy Chain Variable Region-nucleic acid The amino acid sequences defining the immunoglobulin 22 7F06 Heavy Chain Variable Region-protein 40 23 7F06 Light (lambda) Chain Variable Region-nucleic light chain variable regions of the antibodies in Example 2 are acid aligned in FIG. 4. Amino terminal signal peptide sequences 24 7F06 Light (lambda) Chain Variable Region-protein (for expression/secretion) are not shown. CDR, CDR and 25 7F06 Heavy Chain CDR 26 7F06 Heavy Chain CDR, CDR are identified by boxes. FIG. 5 shows an alignment of 27 7F06 Heavy Chain CDR the separate CDR, CDR, and CDR sequences for each 28 7F06 Light (lambda) Chain CDR antibody. 45 29 7F06 Light (lambda) Chain CDR2 Table 1 shows the SEQID NO. of each sequence discussed 30 7F06 Light (lambda) Chain CDR 31 8HO9 Heavy Chain Variable Region-nucleic acid in this Example. 32 8HO9 Heavy Chain Variable Region-protein 33 8HO9 Light (lambda) Chain Variable Region-nucleic TABLE 1. acid 50 34 8HO9 Light (lambda) Chain Variable Region-protein SEQ. ID NO. Nucleic Acid or Protein 35 8H09 Heavy Chain CDR 36 8HO9 Heavy Chain CDR, 1 07 FO1 Heavy Chain Variable Region-nucleic acid 37 8HO9 Heavy Chain CDR 2 07 FO1 Heavy Chain Variable Region-protein 38 8HO9 Light (lambda) Chain CDR 3 07 FO1 Light (kappa) Chain Variable Region-nucleic 39 8HO9 Light (lambda) Chain CDR, acid 55 40 8HO9 Light (lambda) Chain CDR 4 07 FO1 Light (kappa) Chain Variable Region-protein 41 29B06 Heavy Chain Variable Region-nucleic acid 5 07 FO1 Heavy Chain CDR 42 29B06 Heavy Chain Variable Region-protein 6 07FO1 Heavy Chain CDR, 43 29B06 Light (kappa) Chain Variable Region-nucleic 7 07 FO1 Heavy Chain CDR acid 8 07 FO1 Light (kappa) Chain CDR 44 29B06 Light (kappa) Chain Variable Region-protein 9 07 FO1 Light (kappa) Chain CDR2 60 45 29B06 Heavy Chain CDR 10 07 FO1 Light (kappa) Chain CDR 46 29B06 Heavy Chain CDR, 11 12B11 Heavy Chain Variable Region-nucleic acid 47 29B06 Heavy Chain CDR 12 12B11 Heavy Chain Variable Region-protein 48 29B06 Light (kappa) Chain CDR 13 12B11 Light (kappa) Chain Variable Region-nucleic 49 29B06 Light (kappa) Chain CDR2 acid 50 29B06 Light (kappa) Chain CDR 14 12B11 Light (kappa) Chain Variable Region-protein 15 12B11 Heavy Chain CDR 65 16 12B11 Heavy Chain CDR2 Mouse monoclonal antibody heavy chain CDR sequences (Kabat, Chothia, and IMGT definitions) are shown in Table 2.

US 8,603,478 B2 31 32 - Continued (SEQ ID NO: 85) 1 akttaps Vyp lap vogdttg ssvtlgclvk gyfpepvtlt Wnsg.slssgv htfpavlos d 61 lytilsssvtv tsstwp sqsi t cnvahpass tkvdkkiepr gptikpcppc kcpapnillgg

121psviifppki kdvlmislsp iwtc.wwwows eddpdvcisw funnvevhta qtd thredyn

181stlrvivsalp ighgdwmsgk efkickwinniko lpapiertis kpkgs wrapq Vyvlpppeee 241 mtkkovtltc mvtdfmpedi yvewtnngkt elnykintepv losogsyfmy skilrvekknw 301 vernsys.csv wheglhnhht tksfsrtpgk Nucleic Acid Sequence Encoding the Murine Kappa Light Chain Constant Region (SEQ ID NO: 86) cgggctgatg ctgcaccaac tgitat coat c titc.ccaccat coagtgagca gttaa catct 61ggaggtgcct Cagtcgtgtg cittcttgaac aacttct acc ccaaaga cat Caatgtcaag 121 taagattg atggcagtga acgacaaaat ggcgt.cctga acagttggac tgat Caggac

181 agcaaagaca gCacctacag Catgagcagc accct cacgt taccaagga cgagtatgaa

241 cacatalaca gctatacctg tgaggcc act cacaaga cat caact tcacc cattgttcaag

301 agcttcaa.ca ggaatgagtg t Protein Sequence Defining the Murine Kappa Light Chain Constant Region (SEQ ID NO: 87) radaaptv.si fpps seqlts ggasvvc fln infypkdinvik wkiidgSergin gvlinswtddd 61 skidstysmss tiltltkdeye rhnsytceat hktistspivk sfnrnec Nucleic Acid Sequence Encoding the Murine Lambda (IGLC1) Light Chain Constant Region (SEQ ID NO: 88) agt ctitcgc.c atcagt cacc ctgtttic cac CttcCtctga agagctic gag 61 actaacaagg ccacactggit gtgtacgatc actgatttct acccaggtgt ggtgacagtg

121 gactggalagg tagatgg tac c cctdt cact Caggg tatgg agacaac cca gcct tccaaa 181 cagagcaa.ca acaagtacat ggctaggagc tacct gaccc tgacagcaa.g agcatgggaa

241 aggcatagda gttacagctg c cagg to act catgaaggt c acactgtgga galagagtttg 301 toccgtgctg actgttcc Protein Sequence Defining the Murine Lambda (IGLC1) Light Chain Constant Region (SEQ ID NO: 89) 1 gopks spsvt lfpps Seele timkatlvcti tolfypgvvtv dwkvdgtpvt qgmettopsk 61 qsnnkymass yltlitarawe rhs syscqvt heghtveksl Sradics Nucleic Acid Sequence Encoding the Murine Lambda (IGLC2) Light Chain Constant Region (SEQ ID NO: 1ggt cagocca agt cc acticc CactCtcaCC gtgtttic cac CttcCtctgaggagctcaag

61 gaaaacaaag ccacactggit gtgtctgatt to caact titt cc ccgagtgg ttgacagtg

121 goctggalagg caaatgg tac accitatcaCC Cagggtgttgg acact tcaaa toccaccalaa.

181 gagggcaa.ca agttcatggc cagcagott c ctacatttga catcggacca gtggagatct

241 cacaa.cagtt ttacctgtca agittacacat gaaggggaca Ctgtggaga a gagtctgtct

301 cct gcagaat gtctic

Protein Sequence Defining the Murine Lambda (IGLC2) Light Chain Constant Region (SEQ ID NO: 91) 1 gopkstptlt vfpps seelk enkatlvcli. Snf spsgvtv awkangtpit qqvdt Snptk 61egnkfmassif lhlts dowrs hnsft cqvth egdtvekslis paecil US 8,603,478 B2 33 34 The following sequences represent the actual or contem- included in the final secreted protein. Also not shown are stop plated full length heavy and light chain sequence (i.e., con- codons for termination of translation required at the 3' end of taining both the variable and constant regions sequences) for the DNA sequences. It is within ordinary skill in the art to each antibody described in this Example. Signal sequences select a signal sequence and/or a stop codon for expression of for proper secretion of the antibodies (e.g., signal sequences 5 the disclosed full length IgG heavy chain and light chain at the 5' end of the DNA sequences or the amino terminal end sequences. It is also contemplated that the variable region of the protein sequences) are not shown in the full length sequences can beligated to other constant region sequences to heavy and light chain sequences disclosed herein and are not produce active full length IgG heavy and light chains.

Nucleic Acid Sequence Encoding the Full Length. Heavy Chain Sequence (Heavy Chain Variable Region and IgG1 Constant Region) of O7FO1 (SEQ ID NO: 92) gaggtgaagc titct cagtic tigaggtggc Ctggtgcagc cqggtggat.c cctgaaactic 61 to Ctgtgcag cct caggatt cattt tagt agacactgga tigagttgggit ccggctggct 121 cc agggaaag ggctagaatg gatcgcagaa attaatcCag at agcagaac gataaact at 181 acgc catc to taaaggagaa attcatcatc. tccagagaca acgc.caaaaa titcgctgttt 241 ctgcaaatga acagagtgag atctgaggac acagcc ctitt attact.gtgc aagacgggta 301 agaatt catt act acggcgc tatggactgc tiggggt caag galacct cagt caccgt.ct Co 361 to agccaaaa coacaccc cc atctgtctat coactggc cc ctdgatctgc tigcc.caaact 421 aact coatgg taccCtggg atgcctggtc. aagggctatt tocctgagcc agtgacagtg 481 acctggaact ctdgatcc ct gtc.cagcggt gtgcacacct tcc cagctgt cct gcagt ct 541 gacctic taca citctgagcag ct cagtgact gtc.ccct c ca gcacctggcc cago.gaga cc 6O1 gt cacctgca acgttgcc.ca ccc.ggc.ca.gc agcaccalagg togacaagaa aattgttgc cc 661 agggattgtg gttgtaagcc ttgcatatgt acagtic ccag aagtat catc tdt citt catc 721 titcc cc ccaa agcc caagga tigtgct cacc attact ctda citcctaaggt cacgtgtgtt 781 gtgg tagaca to agcaagga tigatcc.cgag gtc.cagttca gctggtttgt agatgatgtg 841 gaggtgcaca cagotcagac goalacc.ccgg gaggagcagt tdaacagcac titt CCCt.ca 901 gt cagtgaac titcc catcat gcaccaggac tigct caatg gcaaggagtt Caaatgcagg 961 gttcaac agtg cagctitt.ccc togcc cc catc gagaaaacca tot coaaaac caaaggcaga 1021 cc galaggctic cacaggtgta Caccattcca Cctic ccaagg agcagatggc Caaggataaa 1081 gt cagtctga cctdcatgat aacagactitc titcc ct gaag acattact.gt gigagtggcag 1141 tigaatgggc agc.ca.gcgga galactacaag alacact cago C catcatgga cacagatggc 1201 tott actt.cg tctacagdala gct caatgtg Cagaagagca actgggaggc aggaaatact 1261 tt cacctgct citgttgttaca tdagggcc tig cacaaccacc at actgagaa gag cct ct co 1321 cact ct cotg gtaaa Protein Sequence Defining the Full Length. Heavy Chain Sequence (Heavy Chain Variable Region and IgG1 Constant Region) of O7FO1 (SEO ID NO: 93) 1 evkillesggg livopggslikl scaasgfdlfs rhwmswVrla pgkglewiae inpdsrtiny 61 to slkekfii srdinakinslf ligmnirvrsed tallyycarrv rihyygamdc Wogggtsvtvs 121 sakttppsvy plapgsaaqt insmvtlgclv kgyfpepvtv twinsg.sls sg. vhtfpavlds 181 dlytls ssvt Vps stwp set vtcnvahpas stkvdkkivp rocgckpcic tv pews.svfi 241 fppkpkdvlt it ltpkvtcv v vaiskddpe vof swifvadv evhtaqtd pr eeqfnstfrs 301 vselpimhod wilngkefkcr Vnsaafpapi ekti sktkgr plkapovytip ppked makdk 361 vs.lt cmit dif fpedit vewo Wngqipaenyk intop imdtdg syfvysklinv qksnWeagnt 421 ft.csvlhegl hnhhtekslis hspgk Nucleic Acid Sequence Encoding the Full Length Light Chain Sequence (Kappa Chain Variable Region and Constant Region) of O7FO1

US 8,603,478 B2

- Continued 301 pimhddwling kefkcrvnsa afpapiekti sktkgrpkap qVytipppke qmakdkvslt 361 cmitdiffped itvewgwngo paenykintop imdtdgsyfv yisklinVolksin Weagntfitcs 421 vlheglhinhh tekslish spg k Nucleic Acid Sequence Encoding the Full Length Light Chain Sequence (Kappa Chain Variable Region and Constant Region) of 29B06 (SEQ ID NO: 110) gacattgttgc tigacic caatc. tccagct tct ttggctgtgt ct ctaggaca gagggccacc 61 atctoctdca gagccagcga aattgttgat aattittggca ttagtttitat galactggttc 121 caacagaaac cagga cagoc acccaaactic ct catctatgctgcatccaa ccaaggat.cc 181 ggggit Coctg. C Caggitt tag tigcagtggg totggga cag actt cagcct caac at CCat 241 cct gtggagg aggatgatac ticaatgitat ttctgtcagc aaagtaagga ggttcCtcc.g 301 acgttcggtg gaggcaccala gctggaaatc aaacgggctg atgctgcacc aactgt at CC 361 atct tcc cac catccagtga gcagttaa.ca totggaggtg cct cagt cqt gtgctt cittg 421 aacaact tct accc.caaaga cat caatgtc. aagtggaaga ttgatggcag tsaacgacala 481 aatggcgtcc talacagttg gactgat cag gacagcaaag acagcacct a cagcatgagc 541 agcaccctica C9ttgaccala ggacgagtat galacgacata acagctatac Ctgtgaggcc 601 act cacaaga catcaacttic acccattgtc. aagagct tca acaggaatga gtgt Protein Sequence Defining the Full Length Light Chain Sequence (Kappa Chain Variable Region and Constant Region) of 29B06 (SEQ ID NO: 111) 1 divltgspas lavslgcrat is craseivd infgisfmnwf qq.kpgqppkl liyaasinggs 61 gvparfsgsg Sgtdfslnih pveeddtamy foggskevpp tifgggtklei kradaaptvs 121 ifpps seqlt Sggasvvcfl nnifypkdinv kwkidgs erq ngvlinswtdd diskdstysms 181 stiltltkdey erhnsytcea thkitstspiv ksfnrnec

Table 4 shows the correspondence between the full-length Example 5 sequences of the antibodies discussed in this Example with those presented in the Sequence Listing. Binding Affinities 40 TABLE 4 The binding affinities and kinetics of binding of antibodies 07FO1, 29B06, 17F06, 18HO9, and 12B11 to recombinant human RON-ECD/mFc fusion protein (rhRON ECD/mFc) SEQID NO. Nucleic Acid or Protein and recombinant human RON SEMA and PSI domains 92 O7 FO1 Heavy Variab e + IgG1 Constant-nucleic acid 45 (rhRON SEMA+PSI) (R&D Systems, Inc., Minneapolis, 93 O7 FO1 Heavy Variab e + IgG1 Constant-protein Minn.) were measured by Surface plasmon resonance, using a 94 O7 FO1 Kappa Variab e + Constant-nucleic acid BIACORER T100 instrument (GE Healthcare, Piscataway, 95 O7 FO1 Kappa Variab e + Constant-protein N.J.). 96 12 B11 Heavy Variab e + IgG1 Constant-nucleic acid Rabbit anti-mouse IgGs (GE Healthcare) were immobi 97 12 B11 Heavy Variab e + IgG1 Constant-protein 50 lized on carboxymethylated dextran CM4 sensor chips (GE 98 12 B11 Kappa Variab e + Constant-nucleic acid Healthcare) by amine coupling, according to a standard pro 99 12 B11 Kappa Variab e + Constant-protein tocol. Analyses were performed at 25°C. and 37°C., using 1OO 17 F06 Heavy Variable + IgG2A Constant-nucleic acid PBS containing 0.05% surfactant P20 as running buffer. The 101 17 F06 Heavy Variable + IgG2A Constant-protein antibodies were captured in individual flow cells at a flow rate 55 of 10 ul/min. Injection time was varied for each antibody to 102 17 F06 Lambda Varia ble + Constant (IGLC2)-nucleic acid yield an Rimax between 30 and 60 RU. 250 ug/mL mouse Fc 103 17 F06 Lambda Varia ble + Constant (IGLC2)-protein were injected at 30 ul/min for 120 seconds to block non 104 18 H09 Heavy Variab e + IgG1 Constant-nucleic acid specific binding of antibodies to Fc portion of the protein 105 18 H09 Heavy Variab e + IgG1 Constant-protein when needed. Buffer, rhRon ECD/mFc or rhRON SEMA+ 106 18 H09 Lambda Variable + Constant (IGLC1)-nucleic acid 60 PSI diluted in running buffer was injected sequentially over a 107 18 H09 Lambda Variable + Constant (IGLC1)-protein reference Surface (no antibody captured) and the active Sur 108 29 B06 Heavy Variab e + IgG1 Constant-nucleic acid face (antibody to be tested) for 300 seconds at 60 ul/minute. 109 29 B06 Heavy Variab e + IgG1 Constant-protein The dissociation phase was monitored for up to 3600 seconds. 110 29 B06 Kappa Variab e + Constant-nucleic acid The surface was then regenerated with two 60-second injec 111 29 B06 Kappa Variab e + Constant-protein 65 tions of 10 mM Glycine-HCl, pH 1.7, at a flow rate of 60 ul/min. The rhRON ECD/mFc or rhRON SEMA+PSI con centration range tested was 0.625 nM to 20 nM. US 8,603,478 B2 47 48 Kinetic parameters were determined using the kinetic sured at 4°C., using Fluorescence Activated Cell Sorting function of the BIAevaluation software (GE Healthcare) with (FACS). PC3 cells expressing the human wild-type RON, and double reference subtraction. Kinetic parameters for each HT29 cells expressing the delta 160 variant, were harvested antibody, k, (association rate constant), k (dissociation rate using cell dissociation buffer (Invitrogen), washed twice with constant) and K, (equilibrium dissociation constant) were FACS buffer (PBS with 0.5% BSA), and treated for 10 min determined. Kinetic values of the monoclonal antibodies on utes with Cyto Q Antibody diluent and FC receptor block rhRON ECD/mEc at 25° C. and 37° C. are Summarized in (Innovex Biosciences, Richmond, Calif.). Purified antibodies Table 5. were diluted in FACS buffer over a concentration range from TABLE 5

Antibody Binding to rhRON ECD/mFc

Measurements at 25°C. Measurements at 37°C.

Antibody ka (1/Ms) kd (1/s) K. (M) in ka (1/Ms) kd (1/s) K (M) in

O7FO1 AVG 4.OE-05 9.3E-OS 2.3E-10 4 21E--O6 3.5E-04 21E-10 3 STDEV 7.1E--O4 S.SE-06 3.4E-11 24E--O6 2.8E-04 7.1E-11 29B06 AVG 2.OE-05 1.3E-04 6.5E-10 3 2.3E--O6 7.OE-04 2.8E-10 3 STDEV 3.5E-04 1.OE-05 1.2E-10 1.3E--O6 4.8E-04 7.8E-11 17FO6 AVG 1.7E--OS 4.6E-08 2.9E-138 3 14E--OS 2.4E-OS 2.1E-10 3 STDEV 4.8E--O4 3.3E-08 1.7E-13 3.1E--04 22E-OS 2.4E-10 18HO9 AVG 3.3E--OS 5.7E-05 2.2E-10 3 18E--O6 7.OE-04 4.OE-10 1 STDEV 1SE--OS 2.3E-OS 16E-10 12B11 AVG 1.2E--OS S.9E-OS S.OE-10 3 2.OE-05 2.OE-04 11E-O9 3 STDEV 2.8E--O4 1.7E-OS 4.6E-11 11E--OS 3.8E-OS 4.6E-10

Outside instrument limit of detection

30 The data in Table 5 demonstrate that antibodies 07 FO1, 0.02 nM to 40 nM. Cells were incubated with 100 ul of 29B06, 17F06, 18H09, and 12B11 bind rhRON ECD/mFc antibody for one hour, washed with FACS buffer three times, with a K, of about 1 nM or less, 750 pM or less, 650 pM or and incubated for 45 minutes with goat anti-mouse PE-con less, 600 pM or less, 500 pM or less, 400 pMorless, 300 pM jugated antibody (Jackson ImmunoResearch Laboratories, or less, 250 pM or less, 200 pM or less, 150 pM or less, 100 35 West Grove, Pa.). Cells were washed three times with FACS pM or less, or 50 pM or less. buffer, resuspended in 300 ul of FACS buffer, and analyzed Kinetic values of the monoclonal antibodies on rhRON using a Beckman Coulter Cytomics FC 500 FACS instru SEMA+PSI at 25° C. and 37° C. are Summarized in Table 6. ment. Results are summarized in Table 7. TABLE 6

Antibody Binding to rhRON SEMA + PSI

Measurements at 25°C. Measurements at 37°C.

Antibody ka (1/Ms) kd (1/s) K. (M) in ka (1/Ms) kd (1/s) K. (M) in

O7FO1 AVG 5.2E--O6 3.6E-04 8.8E-11 3 2.OE--O6 8.OE-04 4.OE-1O 3 STDEV 7.OE--O6 4.3E-04 33E-11 2.1E--OS 7.5E-OS 8.3E-12 29B06 AVG 4.2E--OS 7.OE-OS 1.8E-10 3 S.2E--OS 6.9E-04 13E-09 3 STDEV 1.2E--OS 8.7E-06 6.1E-11 4.7E--04 4.9E-OS 99E-11 17FO6 AVG 1.9E--OS 1.4E-O6 9.OE-12 4 2.6E--OS 2.1E-OS 1.3E-10 3 STDEV 3.6E--04 1.7E-O6 11E-11 1.2E--OS 2.9E-OS 19E-10 18HO9 AVG 4.4E--OS 3.8E-O6 8.6E-12 3 5.8E--OS 1.2E-04 2.2E-10 2 STDEV 2.7E--04 6.3E-06 1.4E-11 7.6E--04 5.3E-OS 1.2E-10 12B11 AVG No binding 2 No binding

The data in Table 6 demonstrate that antibodies 07 FO1, TABLE 7 29B06, 17F06 and 18HO9 bindrhRON SEMA+PSI with a K 60 of about 1 nMorless, 750 pMorless, 650 pMorless, 600 pM 29B06 O7FO1 or less, 500 pM or less, 400 pM or less, 300 pM or less, 250 Human RON - K (nM) O.133 O.O32 pMorless, 200 pMorless, 150pMorless, 100 pMorless, 75 Human RON-K range (nM) O.O89-0.177 O.O2S-O.O39 pM or less, 50 pM or less, or 10 pM or less. Antibody 12B11 Delta 160 RON - K (nM) O.146 O.O24 did not bind to rhRON SEMA+PSI. 65 Delta 160 RON-K range (nM) O.1OO-O.192 O.O2O-O.O29 Binding to cell surface human wild-type RON and the delta 160 RON variant by antibodies 29B06 and 07F01 was mea US 8,603,478 B2 49 50 The results in Table 7 demonstrate that antibodies 29B06 internalization was quantified by subtracting MFI at 4° C. and 07F01 bind both wild-type RON and the delta 160 RON from that at 37° C. Results are summarized in Table 9. variant on the cell surface with similar affinity. TABLE 9 Example 6 5 MFI (a 37° C. - MFI (a) MFI (a 37° C. - MFI (a) Cell Surface Binding Antibody 4°C. in PC-3 cells 4°C. in HT-29 cells mIgG control -0.15 -O.O7 29B06 O49 O.OO Binding to cell surface wild-type RON and delta 160 RON O7FO1 O.21 O.22 10 at 4°C. was determined for antibodies 07F01, 12B11, 17F06, 12B11 O48 O.81 18H09, and 29B06, using FACS. Cells expressing wild-type RON (PC3), and cells expressing delta 160 RON (HT-29), were harvested using cell dissociation buffer (Invitrogen), These results demonstrate that antibodies, 29B06, 07F01 washed twice with FACS buffer (0.5% BSA PBS) and treated and 12B11 induce receptor internalization in PC-3 cells with CytoQ Antibody diluent and FC receptor block (In 15 expressing wild-type RON. Only 07F01 and 12B11 induce novex). Purified antibodies were diluted at a concentration of receptor internalization in HT-29 cells expressing delta 160 10 g/ml, in FACS buffer. Cells were incubated with 100 ul of RON variant. antibody mix for one hour, washed with FACS buffer three times, and incubated for 45 minutes with goat anti-mouse PE Example 8 conjugated antibody (Jackson Immunoresearch Laborato ries). Cells were washed three times with FACS buffer, resus pended in 300 ul of FACS buffer and analyzed using a Beck Inhibition of MSP-RON Binding man Coulter Cytomics FC 500 FACS instrument. Percent binding as compared to murine IgG control is shown in Table 8. 25 Antibodies O7FO1, 12B11, 17F06, 18HO9, and 29B06 were tested for inhibition of MSP binding to hRON SEMA+PSI, as TABLE 8 measured by electrochemiluminescence (ECL) assay as described in Example 3. The antibodies (concentration range: Antibody PC3% cell surface binding HT-29% cell surface binding 0.006-10 ug/mL) were incubated for 45 minutes at room 99.29 99.08 temperature. 17FO6 99.08 99.00 The MSP-hRON binding interaction was inhibited by anti 29B06 99.06 99.04 18HO9 99.03 98.33 bodies 07F01, 18H06, and 29B06, but not by antibodies 12B11 94.52 88.64 17F06 and 12B11 (FIG. 6). The ICs and maximum percent mIgG 5.50 S.62 35 inhibition values for the antibodies (IgG1) are shown in Table 10. The results in Table 8 demonstrate that antibodies 07 FO1, 29B06, 17F06, 18H09, and 12B11 bind both wild-type RON TABLE 10 and the delta 160 RON variant expressed on the surface of ICso (nM Maximum Neutralization (% cells. 40 Antibody Average Stod Dev Average Std Dev l Example 7 O7FO1 O.26 O.OS 88.3 2.1 3 18HO9 O.91 O.15 86.9 6.7 3 Receptor Internalization 29B06 1.11 O.O6 87.6 4.7 3 45 12B11 NA NA 44.8 2O 3 Antibody-stimulated receptor internalization was mea 17FO6 NA NA 7.9 11.2 2 sured using FACS. PC3 cells were used to measure antibody stimulated internalization of the wild-type RON receptor. The results in Table 10 demonstrate that antibodies 07 FO1, HT-29 cells were used for the delta 160 RON receptor variant. 18H09 and 29B06 block MSP binding to hRON SEMA+PSI, Antibodies were first conjugated with R-Phycocerthrin 50 while antibodies 12B11 and 17 F06 do not. (Prozyme cat. No. PJ31K). All cells were washed with PBS and treated with CytoQ Antibody diluent and FC receptor block (Innovex). Cells were incubated with the antibodies (10 Example 9 ug/ml) for 2 hours at 37° C. or at 4°C. The cells were transferred to 4°C., washed with an acidic solution (0.5 M 55 Inhibition of Downstream Signaling by Anti-RON NaCl, 0.18 M Acetic Acid, 0.5% Na azide) to strip off the antibody remaining on the cell Surface, and fixed using BD Antibodies CYTOFIX/CYTOPERMTM kit (BD Biosciences, cat. No. 555028) to measure antibodies retained intracellularly due to Antibodies O7FO1, 12B11, 17F06, 18HO9, and 29B06 were internalization. At 37°C., cells can undergo antibody-medi 60 tested for inhibition of MSP-dependent phosphorylation of ated receptor internalization, and the process is inhibited at ERK, a RON downstream signaling molecule using the cell low temperature of 4° C., thus serving as a baseline (no based assay described in Example 3. The antibodies (concen internalization). The cells were analyzed using a Beckman tration range: 0.006-10 g/mL) in RPMI were added to the Coulter Cytomics FC 500 FACS instrument. A lowered anti cells and incubated for one hour at 37° C. RON median fluorescent intensity (MFI) and a left shift of the 65 Dose-dependent inhibition of ERK phosphorylation by histograms at 4° C. compared to that obtained at 37° C. antibodies O7FO1, 12B11, 17F06, 18HO9, and 29B06 is indicate antibody-induced receptor internalization. Receptor shown in Table 11 and FIG. 7. US 8,603,478 B2 52 TABLE 11 cDNA encoding wild-type human RON was introduced into BH3 tumor cells by retroviral transfer. Transfected tumor Antibody Mean IC50 (nM) Std Dev N cells were then implanted Subcutaneously into recipient mice. O7FO1 O.O7 O.O2 3 Growth of the BH3 tumors was dependent on expression of an 18HO9 O.71 O.36 3 inducible HER2 gene, which was not induced. Therefore, 29B06 0.44 0.27 3 tumors would grow only if the RON gene functionally 12B11 S.91 S.92 3 complemented the uninduced HER2 gene. Growth of the 17FO6 O.96 0.4 3 directed complementation tumors was observed. Primary tumors were propagated in vivo to generate Sufficient tumor The results in Table 11 and FIG. 7 demonstrate that anti 10 material for drug efficacy studies. Quality control for the bodies O7FO1, 18HO9, 29B06, 12B11 and 17F06 inhibit directed complemented tumors included RT-PCR for RON MSP-induced ERK phosphorylation in T47D breast cancer expression and immunohistochemistry (IHC) for protein cell line, even though 12B11 and 17F06 do not effectively expression. The tumors were stored as frozen archival ali block MSP binding to RON (see Examples 3 and 8). quots of approximately 1.5x10 cells/vial. These tumors were 15 thawed, washed once, resuspended in HBS+matrigel and Example 10 injected Subcutaneously. Tumor measurements were taken twice weekly using Vernier calipers. Tumor Volume was cal Inhibition of MSP-Dependent Cell Migration culated using the formula: width:xwidth:xlength/2. When tumors reached approximately 150 mm, the mice were ran Antibodies O7FO1, 18HO9, 29B06, 12B11 and 17F06 were domized into five groups often mice each. Each group (ten tested for inhibition of MSP-dependent cell migration. mice each) received one of the following antibody treatments: HPAF-II pancreatic cancer cells (ATCC) were incubated 07F01,29B06, 12B11, or 18H09, or murine IgG control, all at overnight under low serum conditions (1% FBS, MEM). 20 mg/kg. Treatment was administered by intra-peritoneal Cells were trypsinized, counted, and placed at a concentration injection, twice weekly, for two weeks. Antibodies 29B06 of 50,000/well in 45ul of 1% FBS/MEM in the upper cham 25 and 07F01 resulted in tumor growth inhibition (“TGI) ber of a BD 96-well FLUOROBLOKTM plate (Becton Dick greater than 50% (p<0.001), while antibodies 18H09 and inson). Antibodies were added at a concentration of 2 g/ml. 12B11 exhibited TGI of 25% and 29%, respectively (FIG.9). and cells were incubated for 2 hours. The bottom chamber All treatments were well-tolerated with no significant loss in contained 1% FBS MEM (200 ul) and 1 nM. MSP and cells body weight. were incubated for 24 hours. The number of migrated cells 30 Pharmacodynamic changes in RON receptor levels after was determined by the addition of Calcien Dye at 4 ug/ml 29B06 and 07 FO1 treatment were evaluated. Tumors were final concentration to the bottom chamber, followed by a treated with 20 mg/kg of the following antibodies: migG one-hour incubation. Fluorescence intensity was measured (control), 29B06 or 07F01 and tumors were harvested at 24 or using a WALLAC 1420 VICTORTM instrument (Perkin 48 hours. After harvest, the tumors were lysed in standard Elmer). Baseline fluorescent measurements were done in the 35 RIPA buffer (Boston Bioproducts, cat. No. BP-115) contain absence of MSP. Percent inhibition was determined by com ing protease inhibitors (Roche, catalog No. 04693159001) paring antibody-treated and antibody-untreated samples to and phosphatase inhibitors I and II (Sigma, cat. Nos. P2350 the baseline using the following formula: 100-(anti-RON and P5726). Lysates were cleared and protein concentration antibody treated-baseline)/(control huIgG treated-baseline) was measured. A Western blot for total RON was done using * 100. Results on inhibition of MSP-induced HPAFII cell 40 a polyclonal anti-RON antibody (Santa Cruz, cat. No. migration by antibodies 07F01, 18H09, 29B06, 12B11, and sc-322). The Western blot analysis showed that antibody 17F06 are Summarized in Table 12 and FIG. 8. 29B06 induced receptor degradation in vivo in RON-DC Xenograft at 24 hours, and to a greater extent at 48 hours. TABLE 12 45 Example 12 Antibody (2 g/ml) Percent Inhibition Inhibition of Growth of Delta 160 RON-Driven O7FO1 95.63 29B06 96.79 Tumor Model 17FO6 70.74 18HO9 106.96 50 Inhibition of tumor growth by the antibodies was tested in 12B11 98.93 a directed complementation model of delta 160 RON-driven tumor growth. The model was obtained as described in The results in Table 12 demonstrate that antibodies 07 FO1, Example 11, except that the transfected cDNA encoded 18H09, 29B06, 12B11 and 17F06 inhibit MSP-dependent human delta 160 (oncogenic) form of RON. Growth of the cell migration in HPAF-II pancreatic cancer cell lines, even 55 directed complementation tumors was observed. Primary though 12B11 and 17F06 do not effectively block MSP bind tumors were propagated in vivo to generate Sufficient tumor ing to RON. material for drug efficacy studies. Quality control for the directed complimented tumors included RT-PCR for RON Example 11 expression and IHC for protein expression. The tumors were 60 stored as frozen archival aliquots of approximately 1.5x10 Inhibition of Growth of Wild-Type RON-Dependent cells/vial. These tumors were thawed, washed once, resus Tumor Model pended in HBS plus matrigel, and injected Subcutaneously. Tumor measurements were taken twice weekly. When tumors Inhibition of tumor growth was tested in a directed comple reached approximately 150 mm, the mice were randomized mentation model of wild-type RON-driven tumor growth. 65 into five groups often mice each. Each group (ten mice per “Directed complementation” tumors were obtained as group) received one of the following treatments: murine IgG described in Robinson et al., U.S. Pat. No. 7,556,796. A control, 07FO1, 29B06, 12B11, 17F06, and 18HO9, all at 20 US 8,603,478 B2 53 54 mg/kg. Treatment was administered by intra-peritoneal injec Some examples, a predicted N-linked glycosylation consen tion, twice weekly, for two weeks. Each treatment group sus site (N-X-S/T) in 07F01 heavy CDR2 (e.g., N58, Y59, showed similar tumor growth inhibition of greater than 60% T60) was mutated (e.g., T60A) to prevent any possible gly (p<0.001) except for 18H09 (TGI 54%) as shown in FIG. 10. cosylation. The designed amino acid sequences were con All treatments were well-tolerated, with no significant loss in Verted to codon-optimized DNA sequences and synthesized body weight. by DNA2.0, Inc. to include (in the following order): 5' HindIII restriction site, Kozak consensus sequence, amino terminal Example 13 signal sequence, humanized variable region, human IgG1 or Kappa constant region, stop codon, and a 3" EcoRI restriction Inhibition of Growth of NCI-H358 Lung Xenograft 10 site. Tumor Model The anti-RON antibody chains humanized according to the SUPERHUMANIZATIONTM method, as described herein, Inhibition of tumor growth by the 29B06 antibody was are designated with the prefix "Sh” before the antibody chain tested in an NCI-H358 lung xenograft model. The NCI-H358 name. The anti-RON antibody chains humanized by the CDR cells were grown in culture at 37°C. in an atmosphere con 15 grafting method with back mutations, as described herein, are taining 5% CO, using RMPI medium (Invitrogen) contain designated with the prefix "Hu' before the antibody chain ing 10% FBS. Cells were inoculated subcutaneously into the name. The anti-RON antibody chains humanized by the flank of 8-week old female CB. 17 SCID mice with 5x10° HUMAN ENGINEERINGTM method, as described herein, cells per mouse in 50% matrigel. Tumor measurements were are designated with the prefix "HE before the antibody chain taken twice weekly. When tumors reached approximately 150 aC. mm, the mice were randomized into two groups often mice The anti-RON antibody heavy chain 07 FO1 was human each. Each group received one of the following treatments: ized according to the SUPERHUMANIZATIONTM method. murine IgG control or 29B06 at 40 mg/kg. Treatment was Human germline sequence IGHV3-48*01 (also referred to administered by intra-peritoneal injection three times per herein as Hv3-48) was selected as the human heavy chain week, for three weeks. Antibody 29B06 treatment resulted in 25 framework. In some embodiments, the human Hv3-48 heavy tumor growth inhibition of 70% (p<0.001) (FIG. 11). Treat chain framework sequence was mutated at amino acid posi ment was well-tolerated, with no significant loss in body tion 28 (e.g., D28T). Amino acid numbering is based on the weight. Kabat numbering system. The anti-RON antibody light chain 07FO1 was humanized Example 14 30 according to the HUMAN ENGINEERINGTM method. Human germline sequence IGKV1-901 was selected as the Humanization of Anti-RON Antibodies human light chain framework. The anti-RON antibody heavy chain 29B06 was human A. Construction of Humanized and Chimeric Anti-RON ized by the CDR grafting method with back mutations. Antibodies 35 Human germline sequence IGHV4-5901 (also referred to This Example describes the humanization of two murine hereinas Hv4-59) was selected as the human framework. The antibodies, designated 07F01 and 29B06, and the character human framework was back-mutated at amino acid positions ization of the resulting humanized antibodies. The humanized 27, 30, 39, 44, 47, 48, 67, 71, and 78 to the murine sequence anti-RON antibodies were designed using the SUPERHU when the Kabat CDR definitions were used. The back-mu MANIZATIONTM method (Cephalon, Inc. (Arana Therapeu 40 tated human Hv4-59 framework sequence was further tics Ltd.) and Hwang, W.Y. et al. (2005) METHODS 36:35 mutated to comprise at least one amino acid Substitution at 42), the CDR grafting method with back mutations (some positions 27, 30, 48, 67, and 78. Amino acid substitutions in human framework residues were changed to murine residues) the back-mutated Hv4-59 framework sequence (e.g., amino (See e.g., U.S. Pat. Nos. 5,530,101; 5,693,761; 5,693,762: acid Substitution from a murine residue to a human residue, 5,585,089; 6,180.370; 7,022,500), or the HUMAN ENGI 45 e.g., a human residue found in IGHV4-59) may be selected NEERINGTM method (Studnicka et al., Protein Eng. 1994 from the group consisting of D27G, T30S, M48I, I67V and June: 7(6):805-14; also see, e.g., PCT Publication No. WO Y78F. Amino acid numbering is based on the Kabat number 93/11794 and U.S. Pat. Nos. 5,766,886; 5,770, 196; 5,821, ing System. 123; and 5,869,619). With the exception of heavy chain The anti-RON antibody light chain 29B06 was humanized CDR1, the Kabat CDR definitions were used for CDR graft 50 according to the SUPERHUMANIZATIONTM method. ing onto human frameworks (SUPERHUMANIZATIONTM Human germline sequence IGKV2-2801 was selected as the and CDR grafting with back mutations). In some cases, a human light chain framework. combination of Kabat and Chothia definitions were used for Chimeric (murine variable region and human constant grafting heavy CDR1. In some cases, CDR residues (Kabator region) 07FO1 and 29B06 heavy (human IgG1) and light Chothia definitions) were changed to human residues to 55 (human Kappa) chains were also constructed. The cysteine increase humanness. Models of the murine antibodies were residue present in the heavy chain CDR3 of 07F01 was created using the SWISS-MODEL web server (Swissmodel changed to serine to prevent potential aggregation. To gener ..expasy.org). Predicted residue contacts were determined ate chimeric antibodies, the murine variable regions were using the Contact Map Analysis web server (ligin. Weizman fused to the human constant region using overlap extension n.ac.il/cma?), and residue surface accessibility was deter 60 PCR, including (in the following order): 5' HindIII restriction mined using the Accessible Molecular Surface web server site, Kozak consensus sequence, amino terminal signal (swift.cmbi.ru.nl/servers/html/accessres.html). Residues sequence, mouse variable region, human IgG1 or Kappa con were selected for back mutation based on predicted surface stant region, stop codon, and 3' EcoRI restriction site. accessibility, contact with CDR residues, and involvement in The humanized and chimeric heavy chains were subcloned the interface between heavy and light chains. Additionally, a 65 into pEE6.4 (Lonza, Basel, Switzerland) via HindIII and cysteine residue present in the heavy chain CDR3 of 07FO1 EcoRI sites using IN-FUSIONTM PCR cloning (Clontech, was changed to serine to prevent potential aggregation, and in Mountain View, Calif.). The humanized and chimeric Kappa US 8,603,478 B2 55 56 light chains were subcloned into pEE 14.4 (Lonza) via HindIII TABLE 13-continued and EcoRI sites using IN-FUSIONTM PCR cloning. Humanized antibody chains or chimeric antibody chains Light Chain Variable Region Heavy Chain Variable Region were transiently transfected into 293T cells to produce anti HE L 07 FO1 Kv1-9 Light SO7FO1 Hv3-48 D28TT6OA body. Antibody was either purified or used in cell culture Variable L63V E65G Heavy Variable media Supernatant for Subsequent in vitro analysis. Binding (SEQID NO: 139) (SEQID NO: 137) of the chimeric and humanized antibodies to human RON was ShO7FO1 Kv1-9 F1 Light ShO7FO1 Hv3-48 Heavy Variable Variable (SEQID NO: 135) measured as described below. The results are summarized in (SEQID NO: 141) Table 20. ShO7FO1 Kv1-9 F1 Light SO7FO1 Hv3-48 D28TT6OA Additionally, Some humanized antibody heavy and light 10 Variable L63V E65G Heavy Variable chain combinations were stably expressed in CHOK1SV (SEQID NO: 141) (SEQID NO: 137) cells using the GS SYSTEMTM (Lonza) in order to produce large quantities of purified humanized antibody. A single Each of the possible combinations of the humanized expression vector was constructed by combining pEE6.4 and 29B06 immunoglobulin heavy chain and immunoglobulin pEE 14.4 based vectors. First, pFE6.4 containing full length 15 humanized heavy chain cDNA was digested with NotI and light chain variable regions are set forth below in Table 14. SalI to isolate the hCMV-MIE promoter+full length human ized heavy chain cDNA+SV40 poly A fragment. This frag TABLE 1.4 ment was inserted into the pEE 14.4 vector already containing Light Chain Variable Region Heavy Chain Variable Region full length humanized light chain cDNA via NotI/SalI sites, Sh29B06 Kv2-28 Kappa Variable Sh29B06 Hv4-59 Heavy Variable thus creating an expression vector that simultaneously (SEQID NO: 149) (SEQID NO: 143) expresses heavy and light chains. The combined heavy and Sh29B06 Kv2-28 Kappa Variable Hu29B06 Hv4-59 Heavy Variable light chain vector was linearized and transfected into (SEQID NO: 149) (SEQID NO: 145) CHOK1 SV cells. Stable clones were selected in the presence Sh29B06 Kv2-28 Kappa Variable H29B06 Hv4-59 D27GT30S M48 of methionine sulfoximine. 25 (SEQID NO: 149) I67VY78F Heavy Variable Each of the possible combinations of the humanized 07F01 (SEQID NO: 147) immunoglobulin heavy chain and immunoglobulin light chain variable regions are set forth below in Table 13. The nucleic acid sequences encoding and the protein TABLE 13 sequences defining variable regions of the humanized 07 FO1 30 and 29B06 antibodies are summarized below (amino terminal Light Chain Variable Region Heavy Chain Variable Region signal peptide sequences are not shown). Sequences of the HE L 07 FO1 Kv1-9 Light ShO7FO1 Hv3-48 Heavy Variable modified chimeric 07 FO1 heavy variable region in which the Variable (SEQ ID NO: 135) cysteine in CDR3 is changed to serine are also Summarized (SEQID NO: 139) below. CDR sequences (Kabat definition) are shown in bold and are underlined in the amino acid sequences.

Nucleic Acid Sequence Encoding the Chimeric O7FO1 C1 O2S Heavy Chain Variable Region (SEQ ID NO: 132) 1 gaggtgaa.gc ttct coagtc tggaggtggc Ctggtgcagc cgggtggat.c cctgaaactic 61 to ctgtgcag cct caggatt cgattittagt agacactgga tgagttgggit ccggctggct 121 cc agggaaag ggctagaatg gatcgcagaa attaatccag at agcagaac gataaactat 181 acgc catcto taaaggagaa attcatcatc. tccagagaca acgc.caaaaa titcgctgttt 241 ctgcaaatga acagagtgag atctgaggac acagcc ctitt attact.gtgc alagacgggta 301 agaatt catt actacggcgc tatgga cagc tggggtCaag gaacct cagt caccgt.ct co

361 tota Protein Sequence Defining the Chimeric O7FO1 C102S Heavy Chain Variable Region (SEQ ID NO: 133) 1 evkillesggg livopggslikl scaasgfdfs rhwimsWVrla pgkglewiae inpdsr tiny 61tpsilkekfii Srdinakinslf lomnirvrsed tallyy carrv rihyygamds Wgq9tsvtvs

121s Nucleic Acid Sequence Encoding the ShO7FO1 Hv3 - 48 Heavy Chain Variable Region (SEQ ID NO: 134) 1 gaggttcago togtagaatc cggaggaggg ttgg to caac ctdgtggat.c act cagacitt

61 to atgcgc.cg cc agcggctt tacttctica Cacattgga tgagctgggit ccggCaggct 121 cc aggcaagg gcct cagtg ggittagcgag atcaatccag acagoagaac cattalactat 181 acacccagtic taaggagcg gttcaccata agcc.gtgata atgccaagaa ctic cctgtac

US 8,603,478 B2 61 62 - Continued 24.1 c.gggtggagg ccgaggacgt gggcgtgtac tattgtcaac agtc.caagga agtcc ct coc 301 actitt.cggcg gtgggacaaa ggttgagatt aag Protein Sequence Defining the Sh29B06 Kv2-28 Kappa Chain Variable Region (SEQ ID NO : 149) 1 divimtgspls lipvtpgepas is Craseivd infgisfmnwy lakpgqSpal liyaasinggs 61 gvpdrfsgsg sgtdftlikis rvealedvigvy yoggs kewpp tifogggtkvei k

The amino acid sequences defining the immunoglobulin TABLE 15-continued heavy chain variable regions for the antibodies produced in Example 14 are aligned in FIGS. 12A and 12B. Amino ter SEQ. ID NO. Nucleic Acid or Protein 15 minal signal peptide sequences (for proper expression/secre 38 HE L 07 FO1 Kv1-9 Light (kappa) Chain Variable tion) are not shown. CDR, CDR, and CDR (Kabat defini Region-nucleic acid 39 HE L 07 FO1 Kv1-9 Light (kappa) Chain Variable tion) are identified by boxes. FIGS. 13A and 13B show an Region-protein alignment of the separate CDR, CDR, and CDR sequences 30 HE L 07 FO1 Kv1-9 Light (kappa) Chain CDR for each of the variable region sequences shown in FIGS. 12A 31 HE L 07 FO1 Kv1-9 Light (kappa) Chain CDR2 and 12B, respectively. 10 HE L 07 FO1 Kv1-9 Light (kappa) Chain CDR The amino acid sequences defining the immunoglobulin 40 ShO7FO1 Kv1-9 F1 Light (kappa) Chain Variable Region-nucleic acid light chain variable regions for the antibodies in Example 14 41 ShO7FO1 Kv1-9 F1 Light (kappa) Chain Variable are aligned in FIGS. 14A and 14B. Amino terminal signal Region-protein peptide sequences (for proper expression/secretion) are not 30 ShO7FO1 Kv1-9 F1 Light (kappa) Chain CDR shown. CDR, CDR and CDR are identified by boxes. 25 31 ShO7FO1 Kv1-9 F1 Light (kappa) Chain CDR2 10 ShO7FO1 Kv1-9 F1 Light (kappa) Chain CDR FIGS. 15A and 15B show an alignment of the separate CDR, 42 Sh29B06 Hv4-59 Heavy Chain Variable Region-nucleic CDR, and CDR sequences for each of the variable region acid sequences shown in FIGS. 14A and 14B, respectively. 43 Sh29B06 Hv4-59 Heavy Chain Variable Region-protein Table 15 is a concordance chart showing the SEQID NO. 45 Sh29B06 Hv4-59 Heavy Chain CDR 30 46 Sh29B06 Hv4-59 Heavy Chain CDR, of each sequence discussed in this Example. 47 Sh29B06 Hv4-59 Heavy Chain CDR 44 Hu29B06 Hv4-59 Heavy Chain Variable Region-nucleic TABLE 1.5 acid 45 Hu29B06 Hv4-59 Heavy Chain Variable Region-protein SEQ. ID NO. Nucleic Acid or Protein 45 Hu29B06 Hv4-59 Heavy Chain CDR 35 46 Hu29B06 Hv4-59 Heavy Chain CDR, 32 Chimeric 07 FO1 C102S Heavy Chain Variable Region 47 Hu29B06 Hv4-59 Heavy Chain CDR nucleic acid 46 Hu29B06 Hv4-59 D27GT30S M48II67VY78F Heavy 33 Chimeric 07 FO1 C102S Heavy Chain Variable Region Chain Variable Region-nucleic acid protein 47 Hu29B06 Hv4-59 D27GT30S M48II67VY78F Heavy 5 Chimeric 07 FO1 C102S Heavy Chain CDR Chain Variable Region-protein 6 Chimeric 07 FO1 C102S Heavy Chain CDR, 40 45 Hu29B06 Hv4-59 D27GT30S M48II67VY78F Heavy 23 Chimeric 07 FO1 C102S Heavy Chain CDR Chain CDR 34 ShO7FO1 Hv3-48 Heavy Chain Variable Region-nucleic 46 Hu29B06 Hv4-59 D27GT30S M48II67VY78F Heavy acid Chain CDR, 35 S h07 FO1 Hv3-48 Heavy Chain Variable Region-protein 47 Hu29B06 Hv4-59 D27GT30S M48II67VY78F Heavy 5 ShO7FO1 Hv3-48 Heavy Chain CDR Chain CDR 6 ShO7FO1 Hv3-48 Heavy Chain CDR, 148 Sh29B06 Kv2-28 Light (kappa) Chain Variable 23 ShO7FO1 Hv3-48 Heavy Chain CDR 45 Region-nucleic acid 36 ShO7FO1 Hv3-48 D28TT60A L63V E65G Heavy Chain 149 Sh29B06 Kv2-28 Light (kappa) Chain Variable Variable Region-nucleic acid Region-protein 37 ShO7FO1 Hv3-48 D28TT60A L63V E65G Heavy Chain 48 Sh29B06 Kv2-28 Light (kappa) Chain CDR Variable Region-protein 49 Sh29B06 Kv2-28 Light (kappa) Chain CDR2 5 ShO7FO1 Hv3-48 D28TT60A L63V E65G Heavy Chain 50 Sh29B06 Kv2-28 Light (kappa) Chain CDR CDR 50 22 ShO7FO1 Hv3-48 D28TT60A L63V E65G Heavy Chain CDR 23 ShO7FO1 Hv3-48 D28TT60A L63V E65G Heavy Chain Humanized monoclonal antibody heavy chain CDR CDR sequences (Kabat, Chothia, and IMGT definitions) are shown in Table 16.

TABLE 16

CDR1 CDR2 CDR3

Kabat

OfFO1 RHWMS EINPDSRTINYTPSLKE RWRIHYYGAMDC (SEO ID NO; 5) (SEQ ID NO : 6) (SEO ID NO : 7)

Chimeric OfFO1 RHWMS EINPDSRTINYTPSLKE RWRIHYYGAMDS (SEO ID NO; 5) (SEQ ID NO : 6) (SEQ ID NO: 123)

US 8,603,478 B2 65 66 TABLE 16 - continued

CDR1 CDR2 CDR3

Hu29B06 HW 4- GGSISSGY ISYSGKT ARSKYDYAMDY 59 D27G T3. OS (SEQ ID NO: 129) (SEQ ID NO: 74) (SEO ID NO : 75) M48I I67W Y78F

10 Humanized monoclonal antibody Kappa light chain CDR sequences (Kabat, Chothia, and IMGT definitions) are shown in Table 17.

TABLE 1.7

CDR1 CDR2 CDR3 Kabat ?chothia

OfFO1 KASONVGSSLV SASFRYS OQYNNYPLT (SEQ ID NO: 8) (SEQ ID NO: 9) (SEQ ID NO : 10)

HE L O7FO1 Kv1-9 RASONVGSSLV SASFLYS OQYNNYPLT (SEQ ID NO: 13 O) (SEQ ID NO: 131) (SEQ ID NO : 10)

ShO7FO1 Kv1-9 F1 RASONVGSSLV SASFLYS OQYNNYPLT (SEQ ID NO: 13 O) (SEQ ID NO: 131) (SEQ ID NO : 10)

29BO 6 RASEIVDNFGISFMN AASNOGS OOSKEVPPT (SEQ ID NO: 48) (SEQ ID NO: 49) (SEQ ID NO : 50) Sh29B06 Kv2-28 RASEIVDNFGISFMN AASNOGS OOSKEVPPT (SEQ ID NO: 48) (SEQ ID NO: 49) (SEQ ID NO : 50)

IMGT

OfFO1 QNWGSS SAS OQYNNYPLT (SEO ID NO : 76) (SEQ ID NO : 10)

HE L O7FO1 Kv1-9 ONVGSS SAS OQYNNYPLT (SEO ID NO : 76) (SEQ ID NO : 10) ShO7FO1 Kv1-9 F1 ONVGSS SAS OQYNNYPLT (SEO ID NO : 76) (SEQ ID NO : 10)

29BO 6 EIWDNFGISF AAS OOSKEVPPT (SEQ ID NO: 81) (SEO ID NO : 50)

Sh29B06 Kv2-28 EIWDNFGISF AAS OOSKEVPPT (SEQ ID NO: 81) (SEO ID NO : 50)

45 To create the complete chimeric and humanized heavy or variable sequence followed by a human IgG1 heavy chain kappa chain antibody sequences, each variable sequence constant sequence. A complete kappa chain comprises a above is combined with its respective human constant region. kappa variable sequence followed by the human kappa light For example, a complete heavy chain comprises a heavy chain constant sequence.

Nucleic Acid Sequence Encoding the Human IgG1 Heavy Chain Constant Region (SEQ ID NO: 150) gcct caacaa aaggaccalag ttgttcc.ca citcgc.ccct a gcagdalagag tacat Coggg 61ggc actgcag cact.cggctg. cct citcaag gattattitt C cagagc.cagt aaccgtgagc 121 toggaac agitg gag cact cac ttctggtgtc. catacttitt c ctdctgtcct gcaaagctict 181ggcctgtact cacticagotc cqt cqtgacc gtgc.cat citt catct citggg cacticagacic 241 tacatctgta atgtaalacca caa.gc.ctago: aatactalagg togataagcg ggtggaaccc 3 O1aagagctg.cg acaag actica cacttgtc.cc ccatgcc ct g c ccct gaact tctggg.cggit 361 cccagogt ct ttttgttc cc accaaagcct aaagatact c tdatgataag tagaacaccc 421 gaggtgacat gtgttgttgt agacgtttcc cacgaggacc cagaggittaa gttcaactgg US 8,603,478 B2 67 68 - Continued 481 tacgttgatg gagt caagt acataatgct aagacca agc Ctagagagga gcagtataat 541 agtacatacc gtgtagt cag tittct caca gtgctgcacc aagactggct caacggcaaa 6O1 gaatacaaat gcaaagtgtc. Caacaaagca ctic ccagcc c citat cqagaa gact attagt 661 aaggcaaagg ggcagccticg talaccacag gtgtacactic tgccacc cag tagagaggaa 721 atgacaaaga accaagttctic attgacctgc Ctggtgaaag gottctaccc cagogacatc 781 gcc.gttgagt gggagagtala C9gtcagcct gagaacaatt acaagacaac cc ccc.ca.gtg 841 Ctggatagtg acgggtc.ttt ctittctgtac agtaagctga Ctgtgga caa gtc.ccgctgg 901 Cagcagggta acgtott cag ctgttcc.gtg atgcacgagg cattgcacaa cc act acacc 961 cagaagt cac tgagcct gag ccCagggaag Protein Sequence Defining the Human IgG1 Heavy Chain Constant Region (SEQ ID NO: 151) astkgpsvifp laps skists g g taalgclvk dyfpepvtvs wnsgaltsgv htfpavloss 61 gly slissvvt vps sslgtot yicnvnhkps ntkvdkrvep ks colkthtcp pcpapelligg 121psvilfppkp kdtilmisrtp evtcvvvdvis hedpevkfnw yvdgvevhna ktkpreedyn. 181 styrv vsvilt vlhddwlingk eykckvsnka lpapiektis kakgoprepo Vytlops ree 241 mtknowslitic lvkgfypsdi avewesngqip ennykttpp v. ldsdgsffly skiltvdksrw. 301 qqignvfscsv mhealhnhyt qkslislspgk Nucleic Acid Sequence Encoding the Human Kappa Light Chain Constant Region (used for chimeric antibodies) (SEQ ID NO: 152) 1 cc acagtcg cc.gct coctic cqtgttcatc titt CCaC cala gtgatgagca actgaagtict

61gg tactgctt Cagtcgtgtg tctgctgaac aattt CtaCC ct Cagaagc caaagtic caa

121 tigaagg tag acaacgcact gcagt ccggc aat agccaag aatcagttac cqaac aggat

181tcaaaggaca gtacatatt c cct gagcagc actictdaccc tgtcaaaggc cgattacgag 241aaa.caca agg tctatgcttg cgaagtgaca cat Cagggac tgtc.ca.gc.cc agtgacaaaa

301 tottttalacc gtggggagtg t Nucleic Acid Sequence Encoding the Human Kappa Light Chain Constant Region (used for humanized antibodies) (SEQ ID NO: 153 ) 1 cc acagttg ctgcc cc cag cqtgttcatt titcCCaC Cta gcgatgagca gctgaaaagc

61gg tactgcct ctgtcg tatgcttgct caac aacttittaCC cacgtgaggc talaggtgcag

121 tigaaagtgg ataatgcact tcaatctgga aac agt caag agtc.cgtgac agaac aggac

181 agcaaag act caact tattic act ct ct tcc. accctgactic tgtcCaaggc agact atgaa

241aaa.caca agg tatacgc.ct g c gaggittaca Caccagggitt tgtctagt cc tdtcaccaag

3 O1t cottcaata gggg.cgaatg t

Protein Sequence Defining the Human Kappa Light Chain Constant Region (used for chimeric and humanized antibodies (SEQ ID NO: 154) 1rtvaapsvii fppsdeqlks gtasvvcilln nifypreakvg wkvdnaldsg nsdesvteqd 61 skid stysliss tiltlskadye khkvyacevt hdglls spvtk sfnrged

The following sequences represent the actual or contem 60 included in the final secreted protein. Also not shown are stop plated full length heavy and light chain sequence (i.e., con codons for termination of translation required at the 3' end of taining both the variable and constant regions sequences) for the DNA sequences. It is within ordinary skill in the art to each antibody described in this Example. Signal sequences select a signal sequence and/or a stop codon for expression of for proper secretion of the antibodies (e.g., signal sequences the disclosed full length IgG heavy chain and light chain at the 5' end of the DNA sequences or the amino terminal end 65 sequences. It is also contemplated that the variable region of the protein sequences) are not shown in the full length sequences can beligated to other constant region sequences to heavy and light chain sequences disclosed herein and are not produce active full length IgG heavy and light chains.

US 8,603,478 B2 85 86 - Continued 421 aacaacttitt acccacgtga ggcta aggtg cagtggaaag togataatgc acttcaatct 481 ggaaacagtic aagagtc.cgt gacagaacag gacagcaaag acticaactta tt cact citct 541 tocaccctga citctgtc.caa ggcagacitat gaaaaacaca aggtatacgc ct gcgaggitt 601 acacaccagg gtttgtctag toctdtcacc aagt cct tca at agggg.cga atgt Protein Sequence Defining the Full Length Humanized Sh29B06 Kv2-28 Light Chain (Humanized Kappa Chain Variable Region and Human Constant Region) (SEO ID NO : 178) 1 divmtgspls lipvtpgepas is craseivd infgisfmnwy lokpggspol liyaasinggs 61 gvpdrfsgsg sgtdftlikis rvealedvigvy yoqq skewpp tigggtkvei kirtvaapsvi 121 ifpps deqlk sgtasvvcll nnifypreakv qwkvdnalds gnsgesvteq diskdstysls 181 stiltlskady ekhikvyacev thqglls spvt ksfnrged

For convenience, Table 18 provides a concordance chart showing the SEQID NO. of each sequence discussed in this Example. TABLE 18 SEQID NO. Nucleic Acid or Protein 50 Human IgG1 constant-nucleic acid 51 Human IgG1 constant-protein 52 Human Kappa constant (used for chimericantibodies)-nucleic acid 53 Human Kappa constant (used for humanized antibodies)-nucleic acid S4 Human Kappa constant (used for chimeric and humanized antibodies)-protein 55 Chimeric 07FO1 C102S Mouse Heavy Chain Variable + Human IgG1 constant nucleic acid 56 Chimeric 07FO1 C102S Mouse Heavy Chain Variable + Human IgG1 constant protein 57 Chimeric 07FO1 Mouse Light Chain Variable + Human Kappa constant-nucleic acid 58 Chimeric 07FO1 Mouse Light Chain Variable + Human Kappa constant-protein 59 Chimeric 29B06 Mouse Heavy Chain Variable + Human IgG1 constant-nucleic acid 60 Chimeric 29B06 Mouse Heavy Chain Variable + Human IgG1 constant-protein 61 Chimeric 29B06 Mouse Light Chain Variable + Human Kappa constant-nucleic acid 62 Chimeric 29B06 Mouse Light Chain Variable + Human Kappa constant-protein 63 Humanized ShO7FO1 Hv3-48 Heavy Human Variable + Human IgG1 constant nucleic acid 64 Humanized ShO7FO1 Hv3-48 Heavy Human Variable + Human IgG1 constant protein 65 Humanized ShO7FO1 Hv3-48 D28TT60A L63V E65G Heavy Human Variable + Human IgG1 constant-nucleic acid 66 Humanized ShO7FO1 Hv3-48 D28TT60A L63V E65G Heavy Human Variable + Human IgG1 constant-protein 67 Humanized HE L 07 FO1 Kv1-9 Human Variable + Human Kappa constant-nucleic acid 68 Humanized HE L 07 FO1 Kv1-9 Human Variable + Human Kappa constant-protein 69 Humanized sho7FO1 Kv1-9 F1 Human Variable + Human Kappa constant-nucleic acid 70 Humanized sho7FO1 Kv1-9 F1 Human Variable + Human Kappa constant-protein 71 Humanized Sh29B06 Hv4-59 Heavy Human Variable + Human IgG1 constant nucleic acid 72 Humanized Sh29B06 Hv4-59 Heavy Human Variable + Human IgG1 constant protein 73 Humanized Hu29B06 Hv4-59 Heavy Human Variable + Human IgG1 constant nucleic acid 74 Humanized Hu29B06 Hv4-59 Heavy Human Variable + Human IgG1 constant protein 75 Humanized Hu29B06 Hv4-59 D27GT30S M48II67VY78F Heavy Human Variable + Human IgG1 constant-nucleic acid 76 Humanized Hu29B06 Hv4-59 D27GT30S M48II67VY78F Heavy Human Variable + Human IgG1 constant-protein 77 Humanized Sh29B06 Kv2-28 Human Variable + Human Kappa constant-nucleic acid 78 Humanized Sh29B06 Kv2-28 Human Variable + Human Kappa constant-protein US 8,603,478 B2 87 88 Table 19 below shows antibodies containing chimeric Human IgG1 Constant Region (SEQID NO: 176) plus immunoglobulin heavy and light chains and each of the pos Sh29B06 Kv2-28 Light Chain Variable Region and sible combinations of the full-length chimeric or humanized Human Kappa Constant Region (SEQID NO: 178) immunoglobulin heavy and light chains. B. Binding Affinities of Humanized and Chimeric Anti RON Monoclonal Antibodies The binding affinities and kinetics of interaction of mono TABLE 19 clonal antibodies produced in Example 14 against recombi Antibody nant human RON SEMA and PSI domains (rhRON SEMA+ Name Light Chain Heavy Chain PSI) (R&D Systems, Inc., Minneapolis, Minn.) were measured by Surface plasmon resonance using a Biacore SO7FO1-2 Chimeric 07 FO1 Kappa Chimeric 07 FO1 C102S 10 T100 (Biacore (GE Healthcare), Piscataway, N.J.) instru (SEQ ID NO: 158) Heavy IgG1 ment. (SEQID NO: 156) SO7FO1-43 HE LO7FO1 Kv1-9 ShO7FO1 Hv3-48 IgG1 Goatanti-human IgGFc (Jackson ImmunoResearch, Cata Kappa (SEQID NO: 164) log No. 109-005-098) was immobilized on carboxymethy (SEQ ID NO: 168) lated dextran CM4 sensor chips (Biacore) by amine coupling SO7FO1-62 HE LO7FO1 Kv1-9 SO7FO1 Hv3-48 D28T (Biacore) using a standard coupling protocol according to the Kappa T60A L63V E65G IgG1 15 vendors instructions. The analyses were performed at 37°C. (SEQ ID NO: 168) (SEQID NO: 166) using PBS (Invitrogen) containing 0.05% surfactant P20 SO7FO1-69 SO7FO1 Kv1-9 F1 ShO7FO1 Hv3-48 IgG1 (Biacore) as running buffer. Kappa (SEQID NO: 164) The antibodies were captured in individual flow cells at a (SEQ ID NO: 170) flow rate of 60 ul/minute. Injection time was varied for each SO7FO1-83 SO7FO1 Kv1-9 F1 SO7FO1 Hv3-48 D28T Kappa T60A L63V E65G IgG1 antibody to yield an R between 30 and 60 RU. Buffer or (SEQ ID NO: 170) (SEQID NO: 166) rhRON SEMA+PSI diluted in running buffer was injected SO7FO1-99 Chimeric 07 FO1 Kappa ShO7FO1 Hv3-48 IgG1 sequentially over a reference Surface (no antibody captured) (SEQ ID NO: 158) (SEQID NO: 164) and the active surface (antibody to be tested) for 300 seconds ShO7FO1-100 Chimeric 07 FO1 Kappa ShO7FO1 Hv3-48 D28T at 60 ul/minute. The dissociation phase was monitored for up (SEQ ID NO: 158) T60A L63V E65G IgG1 to 1200 seconds. The surface was then regenerated with two (SEQID NO: 166) 25 60 second injections of Glycine pH 2.25 (made from Glycine SO7FO1-101 HEL 07 FO1 Kv1-9 Chimeric 07FO1 C102S pH 2.0 (Biacore) and pH 2.5 (Biacore)) at 60 ul/minute. For Kappa Heavy IgG1 the initial Screening, only one or two concentrations of (SEQ ID NO: 168) (SEQID NO: 156) SO7FO1-102 SOfFO1 Kv1-9 F1 Chimeric 07FO1 C102S rhRON SEMA+PSI were tested, typically 10.0 and 2.5 nM Kappa Heavy IgG1 (results are summarized in Table 20). (SEQ ID NO: 170) (SEQID NO: 156) 30 Kinetic parameters were determined using the kinetic S29B06-1 Chimeric 29B06 Kappa Chimeric 29B06 Heavy IgG1 function of the BIAevaluation software (Biacore) with double (SEQ ID NO: 162) (SEQID NO: 160) reference Subtraction. Kinetic parameters for each antibody, S29B06-2 Chimeric 29B06 Kappa Hu29B06 Hv4-59 IgG1 k (association rate constant), k (dissociation rate constant) (SEQ ID NO: 162) (SEQID NO: 174) and K, (equilibrium dissociation constant) were determined. Sh29BO6-4 Chimeric 29B06 Kappa Sh29B06 Hv4-59 IgG1 Certain monoclonal antibodies were screened using cell cul (SEQ ID NO: 162) (SEQID NO:172) 35 ture media Supernatant containing secreted antibody, and S29BO6-9 Sh29B06 Kv2-28 Kappa Chimeric 29B06 Heavy IgG1 kinetic values of the monoclonal antibodies on rhRON (SEQ ID NO:178) (SEQID NO: 160) SEMA+PSI at 37° C. are Summarized in Table 20. S29B06-23 Sh29B06 Kv2-28 Kappa Hu29B06 Hv4-59 IgG1 (SEQ ID NO:178) (SEQID NO: 174) S29B06-2S Sh29B06 Kv2-28 Kappa Sh29B06 Hv4-59 IgG1 TABLE 20 (SEQ ID NO:178) (SEQID NO:172) S29B06-78 Sh29B06 Kv2-28 Kappa Hu29B06 Hv4-59 D27G 40 Antibody ka (1/Ms) kd (1/s) KD (M) l (SEQ ID NO:178) T30S M48II67VY78F IgG1 (SEQID NO: 176) SO7FO1-2 2.OE--O6 7.3E-04 3.8E-10 3 Sh29B06-84 Chimeric 29B06 Kappa Hu29B06 Hv4-59 D27G SO7FO1-62 3.9E-06 14E-O3 3.6E-10 2 (SEQ ID NO: 162) T30S M48II67VY78F IgG1 SO7FO1-69 2.3E--O6 1.2E-O3 5.6E-10 2 (SEQID NO: 176) SO7FO1-76 2.3E--O6 1.3E-O3 S.7E-10 2 45 SO7FO1-83 2.6E--O6 14E-O3 54E-10 2 S29B06-1 6.7E--OS 7.6E-04 11E-09 3 The antibody constructs containing the full length chimeric S29BO6-9 8.7E--OS 2.2E-04 2.6E-10 1 heavy and light chains are designated below: S29B06-23 7.8E--OS 4.8E-04 6.4E-10 4 Chimeric 07F01 C102S=Full Length Chimeric 07F01 S29B06-2S No Binding C102S Heavy Chain (Mouse Variable Region with C102S mutation and Human IgG1 Constant Region) 50 The results in Table 20 demonstrate that the chimeric and (SEQ ID NO: 156) plus Full Length Chimeric 07F01 each of the humanized antibodies, except Sh29B06-25, have Light Chain (Mouse Variable Region and Human Kappa fast association rates (k), very slow disassociation rates (k) Constant Region) (SEQID NO: 158) and very high affinities (K). In particular, the antibodies Chimeric 29B06=Full Length Chimeric 29B06 Heavy have affinities ranging from about 260 pM to about 1.1 nM. Chain (Mouse Variable Region and Human IgG1 Con 55 No binding was observed for Sh29B06-25. Because stant Region) (SEQID NO: 160) plus Full Length Chi Sh29B06-25 does not bind rhRON SEMA+PSI and meric 29B06 Light Chain (Mouse Variable Region and Sh29B06-23 does, one or more of the back mutations present Human Kappa Constant Region) (SEQID NO: 162) in the heavy chain of Sh29B06-23 appear to be required for Two of the possible antibody constructs containing the full binding with high affinity. length immunoglobulin heavy and light chains containing The binding affinities and kinetics of certain purified humanized variable regions are designated below: 60 monoclonal antibodies were also determined. To further char ShO7FO1-62=Humanized ShO7FO1 HV3-48 D28T T60A acterize certain antibodies, the Surface plasmon resonance L63V E65G Heavy Chain Variable Region and Human experiments described above were conducted using concen IgG1 Constant Region (SEQ ID NO: 166) plus HEL trations of rhRON SEMA+PSI between 0.3125 nM and 10.0 07F01 KV 1-9 Light Chain Variable Region and Human nM (a 2-fold serial dilution). Kappa Constant Region (SEQID NO: 168) 65 The kinetic values of certain purified monoclonal antibod Sh29B06-78=Humanized Hu29B06 HV4-59 D27G T30S ies (i.e., ShO7F01-62 and Sh29B06-78) on rhRON SEMA+ M48I I67V Y78F Heavy Chain Variable Region and PSI at 25° C. and 37° C. are Summarized in Table 21. US 8,603,478 B2 89 90 TABLE 21 Antibody Binding to rhRON SEMA + PSI

Measurements at 25°C. Measurements at 37°C.

Antibody ka (1/Ms) kd (1/s) KD (M) in ka (1/Ms) kd (1/s) KD (M) l ShO7FO1-2 1.2E--06 9.8E-05 8.2E-11 9 1.7E+06 5.3E-04 3.1E-10 ShO7FO1-43 1.2E--06 1.1E-04 9.0E-11. 3 1.8E--06 5.6E-04 3.OE-10 ShO7FO1-62 1.8E--06 1.6E-04 8.5E-11 4 2.8E--06 6.9E-04 2.5E-10 ShO7FO1-69 1.1E--06 1.4E-04 1.2E-10 2 2.5E-06 7.8E-04 3.OE-10 ShO7FO1-76 9.8E--05 1.3E-04 1.3E-10 2 2.4E--06 7.9E-04 3.3E-10 ShO7FO1-83 1.6E--06 1.8E-04 1.1E-10 2 3.2E--06 7.9E-04 2.4E-10 Sh29B06-1 5.3E--05 2.OE-04 3.6E-10 6 8.2E--05 7.OE-04 8.6E-10 Sh29B06-23 6.7E+05 9.5E-05 14E-10 4 7.3E--05 3.3E-04 4.6E-10 S29B06-78 7.SE-OS 3.9E-OS 5.2E-11 7 1.OE-06 1.1E-04 1.1E-10

The results in Table 21 demonstrate the purified antibodies The results in Table 22 demonstrate that the humanized have affinities ranging from about 52 pM to 360 pM when antibodies ShO7F01-62 and Sh29B06-78 retain their ability tested at 25° C. or about 110 pM to about 860 pM when tested to bind both wild-type RON and the delta 160 RON variant on at 37° C. the cell surface with affinities equivalent to their murine anti Binding to cell surface human wild-type RON and the delta body counterparts (i.e. 07FO1 and 29B06, respectively). 160 RON variant by antibodies 07F01, ShO7F01-62, 29B06, and Sh29B06-78 was measured at 4°C., using Fluorescence C. Comparison of Other Anti-RON Antibodies Activated Cell Sorting (FACS). PC3 cells expressing the human wild-type RON, and HT29 cells expressing the delta 25 160 variant, were harvested using cell dissociation buffer Three antibodies that inhibit the function of human RON (Invitrogen), washed twice with FACS buffer (PBS with 0.5% were constructed and expressed using published information. BSA), and treated 10 minutes with Cyto Q Antibody diluent One antibody, referred to as 1P3B2-BIIBAb, was constructed and FC receptor block (Innovex Biosciences, Richmond, based on the disclosure of Huet et al., U.S. Patent Publication Calif.). Purified antibodies were diluted in FACS buffer over 30 No. 2009/0226442 (Biogen Idec, Inc.). Two additional anti a concentration range from 0.01 nM to 25 nM. Cells were bodies, referred to as RON6 and RON8, were constructed incubated with 100 ul of antibody for one hour, washed with based on the disclosure of Pereira et al., U.S. Patent Publica FACS buffer three times, and incubated for 45 minutes with tion No. 2009/0136510 (Imclone Systems, Inc.). goat anti-mouse PE-conjugated antibody (Jackson Immu noResearch Laboratories, West Grove, Pa.) or donkey anti 35 human PE-conjugated antibody (Jackson ImmunoResearch Kinetic parameters for the 1P3B2-BIIB Ab, RON6, and Laboratories, West Grove, Pa.). Cells were washed three RON8 antibodies on rhRON SEMA+PSI at 25° C. and 37° C. times with FACS buffer, resuspended in 300 ul of FACS were determined by Biacore as described above (See Section buffer, and analyzed using a Beckman Coulter Cytomics FC B. Binding Affinities of Humanized and Chimeric Anti-RON 500 FACS instrument. All four antibodies were compared in 40 Monoclonal Antibodies). The kinetic values for each anti the same experiment. Results are summarized in Table 22. body are summarized in Table 23. TABLE 23 Antibody Binding to rhRON SEMA + PSI Measurements at 25°C. Measurements at 37°C. Antibody ka (1/Ms) kd (1/s) KD (M) in ka (1/Ms) kd (1/s) KD (M) in Sh29B06-78 6.8E--05 3.1E-05 4.8E-11 6 9.6E--05 1.OE-04 1.1E-10 8 ShO7FO1-62 1.8E--06 1.6E-04 8.5E-11 4 2.8E--06 6.9E-04 2.5E-10 4 1P3B2-BIIB 1.5E-06 1.2E-O3 8.OE-10 1 2.2E--O7 2.6E-O2 1.2E-09 1 RON6 2.3E--06 2.6E-03 11E-09 1 1.9E-10 1.9E-01 1.OE-09 1 RON8 1.2E--06 6.8E-04 6.7E-10 3 7.OE-06 2.5E-03 9.2E-1O 3

55 TABLE 22 The results in Table 23 demonstrate that the overall equi O7FO1 SOfFO1-62 29B06 S29B06-78 librium dissociation constant (K) for Sh29B06-78 and Sh07FO1-62 were smaller (i.e., higher affinity) than the K, Human RON - K. O.OS3 0.043 O.136 0.090 for 1P3B2-BIIB, RON6, and RON8 at both 25° C. and 37° C. Ran RON - K O.O36 to 0.026 to O.O83 to O.O63 to " The K, of 1P3B2-BIIB, RON6, and RON8 antibodies can range (nM) O.O69 O.O60 O.190 O.117 also be compared with other humanized 29B06 or 07 FO1 Delta 160 RON- K. O.100 0.118 O.167 0.239 variants by comparing Tables 21 and 23. Delta(nM) 160 RON - K 0.071 to 0.045 to 0.066 to 0.202 to Therefore, the binding- affinities of Sh29B06-78 and range (nM) O.129 O.191 0.267 0.277 65 ShO7F01-62 are significantly higher than the affinities of 1P3B2-BIIB, RON6, and RON8 antibodies as disclosed herein. US 8,603,478 B2 91 92 Example 15 Example 17 Inhibition of MSP-RON Binding Inhibition of MSP-Dependent Cell Migration Humanized antibodies sh29B06-78 and ShO7FO1-62 as The chimeric and humanized antibodies produced in produced in Example 14 were tested for their ability to inhibit Example 14 were tested for inhibition of MSP binding to MSP-induced cell migration as described in Example 10. In hRON SEMA+PSI, as measured by electrochemilumines this example, antibodies were added at a concentration of 1 cence (ECL) assay as described in Example 3. The antibodies ug/ml and serially diluted at a 1:5 dilution, and cells were (concentration range: 0.006-10 ug/mL) were incubated for 45 incubated for 2 hours. Percent inhibition was determined by minutes at room temperature. 10 the following formula: 100-(anti-RON antibody treated The MSP-hRON binding interaction was inhibited by the baseline)/(control hulgG treated-baseline)* 100. Results on chimeric and humanized antibodies listed in Table 24, which inhibition of MSP-induced HPAF-II cell migration by anti were tested in this assay. The ICs for the antibodies (IgG1) RON antibodies, sh29B06-78 and sho7F01-62, are summa are shown in Table 24. rized in Table 26 and FIG. 16. 15 TABLE 24 TABLE 26

Antibody Mean ICso Std Dev of ICso N AB concentration Sh29B06-78 sh)7FO1-62 S29B06-1 1.73 1.24 8 S29B06-23 1.24 1.57 9 S29B06-78 O41 O.24 8 ng/ml AVG St DEV AVG Std DEV SO7FO1-2 O.91 1.42 8 1OOO.OO 94.82 3.34 98.96 3.79 SO7FO1-43 O.22 O.09 2 200.00 90.67 2.37 97.8O 1.12 SO7FO1-62 O.32 O.12 6 40.00 59.85 12.SO 67.18 7.67 SO7FO1-69 O.28 O.18 2 8.00 59.71 2.87 37.22 4.16 SO7FO1-76 O.38 O.33 2 25 160 63.95 20.15 38.91 13.79 SO7FO1-83 O.33 O.24 2 O.32 42O3 39.88 43.27 5.76 O.O6 60.37 11.92 34.40 2.31 The results in Table 24 demonstrate that the chimeric and humanized anti-RON antibodies listed in Table 24 (i.e., The results in Table 26 demonstrate that humanized anti Sh29B06-1, Sh29B06-23, Sh29B06-78, ShO7FO1-2, 30 RON antibodies, sh29B06-78 and sho7F01-62, potently ShO7FO1-43, ShO7FO1-62, ShO7FO1-69, ShO7FO1-76, and inhibit MSP-induced cell migration in HPAF-II pancreatic Sh07F01-83) retain the ability to block MSP binding to cancer cell lines. hRON SEMA+PSI with high potency. Example 18 Example 16 35 Inhibition of MSP-Induced Cell Invasion Inhibition of Downstream Signaling by Anti-RON Antibodies Humanized antibodies sh29B06-78 and ShC7FO1-62 as produced in Example 14 were tested for their ability to inhibit The chimeric and humanized anti-RON antibodies pro 40 MSP-induced cell invasion. HPAF-II pancreatic cancer cells duced in Example 14 were tested for their ability to inhibit were trypsinized, counted, and placed at a concentration of MSP-induced phosphorylation of ERK, a RON downstream 50,000/well in 45ul of 10% FBS/MEM in the upper chamber signaling molecule, using the cell-based assay described in of a BD 96-well BD BIOCOATTM MATRIGELTM invasion Example 3. The antibodies (concentration range: 0.006-10 FLUOROBLOKTM plate (Becton Dickinson). Antibodies ug/mL) in RPMI were added to the cells and incubated for one 45 were added at a concentration of 30 ug/ml and cells were hour at 37°C. The IC50s of ERK phosphorylation inhibition incubated for 2 hours. The bottom chamber contained 10% by the chimeric and humanized anti-RON antibodies tested in FBSMEM (2000 and 1 nMMSP, and cells were incubated for this assay are shown in Table 25. 24 hours. The number of cells that underwent invasion through the membrane was determined by the addition of TABLE 25 50 Calcien Dye at 4 ug/ml final concentration to the bottom chamber, followed by a one-hour incubation. Fluorescence Antibody Mean ICso Std Dev of ICso N intensity was measured using a WALLAC 1420 VICTORTM S29B06-1 O.10 O.10 6 instrument (Perkin Elmer). Results on inhibition of MSP S29B06-23 O.11 O.08 10 induced HPAFII cell invasion by anti-RON antibodies are S29B06-78 O.13 O.08 5 55 summarized in FIG. 17. SO7FO1-2 O.O6 O.O6 7 SO7FO1-43 O.O2 O.OO 3 The results in FIG. 17 demonstrate that humanized anti SO7FO1-62 O.O3 O.O3 2 RON antibodies sh29B06-78 and sho7F01-6 potently inhibit SO7FO1-69 O.OS O.O2 2 MSP-dependent cell invasion in HPAF-II pancreatic cancer SO7FO1-76 O.10 O.O3 2 cell line. SO7FO1-83 O.O3 O.O2 2 60 Example 19 The results in Table 25 demonstrate that the chimeric and humanized anti-RON antibodies listed in Table 25 (i.e., Inhibition of Growth of NCI-H358 Lung Xenograft Sh29B06-1, Sh29B06-23, Sh29B06-78, ShO7FO1-2, Tumor Model ShO7FO1-43, ShO7FO1-62, ShO7FO1-69, ShO7FO1-76, and 65 Sh07F01-83) inhibit MSP-induced ERK phosphorylation in Inhibition of tumor growth by the humanized anti-RON T47D breast cancer cell line with high potency. antibodies was tested in an NCI-H358 lung xenograft model. US 8,603,478 B2 93 94 The NCI-H358 cells (ATCC) were grown in culture at 37° C. Example 20 in an atmosphere containing 5% CO, using RMPI medium (Invitrogen) containing 10% FBS. Cells were inoculated sub RON Receptor Degradation cutaneously into the flank of 8-week old female CB. 17 SCID Western blots were performed to determine total levels of mice (Taconic Labs) with 5x10° cells per mouse in 50% RON receptor at the end of treatment. Four tumor samples matrigel (Becton Dickinson). Tumor measurements were from each of the treatment groups were weighed, lysed in taken twice weekly using vernier calipers. When tumors RIPA buffer (Boston Bioproducts), 1 mM EDTA Bioprod reached approximately 150 mm, the mice were randomized ucts), 1 mM Sodium OrthoVandadate (Sigma), 1x protease into six groups often mice each. Each group received one of inhibitor (Sigma) and 1x Phosphatase Inhibitor I and II the following treatments: human IgG (hulgG) control, 10 (Sigma). The samples were homogenized using a hand-held mu29B06, sh29B06-78, mu07FO1, sh()7FO1-62 and RON8. electric homogenizer and incubated for 10 minutes on ice. Treatment was administered by intra-peritoneal injection two Samples are spun down at 11,000 RPM for 30 minutes at 4°C. times per week at 10 mg/kg for seven weeks. Treatment was Supernatants were collected and protein concentrations were well-tolerated, with no significant loss in body weight. Tumor determined using Pierce BCATM assay kit according to the 15 manufacturers protocol. The C-20 (Santa Cruz) antibody was growth inhibition is expressed as percent inhibition (baseline used to detect total RON protein. B-tubulin (Cell Signaling Subtracted) to the hugG control and statistical analysis was Technologies) was blotted as loading control. The Western conducted using ANOVA. Results for tumor growth inhibi blots were blocked for one hour in 5% Milk in 1XTBST tion on day 41 in the NCI-H358 model are shown in FIG. 18 (TBS-0.1%TWEEN) (Sigma), followed by primary antibody and Table 27. incubation over night at 4°C. in 5% BSA 1XTBST at 1:1000 for both antibodies. Western blots were washed three times TABLE 27 with 1xTBST, incubated with anti-rabbit HRP conjugated secondary antibody (Cell Signaling Technologies), for one ANOVA hour at room temperature. Western blots were washed three Treatment TGIo (compared to huIgG) 25 times with 1xTBST and then developed using Dura Signal (Pierce). mu29B06 88.93 P<0.01 The results in FIG. 19 demonstrate RON receptor degra Sh29B06-78 89.02 P<0.01 dation in the mu29B06 and sh29B06-78 treated samples and mu07FO1 34.15 P & O.05 to a lesser extent in the mu07 FO1 and sh()7FO1-62 treated ShO7FO1-62 39.05 P & O.05 30 samples. RON receptor degradation was not observed in the RON8 37.99 P & O.05 RON8 treated samples. INCORPORATION BY REFERENCE Anti-RON antibody treatments resulted in tumor growth The entire disclosure of each of the patent documents and inhibition compared to huIgG control. Specifically, mu29B06 35 scientific articles referred to herein is incorporated by refer antibody treatment resulted in tumor growth inhibition of ence for all purposes. 89% (P<0.01); sh29B06-78 antibody treatment resulted in tumor growth inhibition of 89% (P<0.01); mu07F01 antibody EQUIVALENTS treatment resulted in tumor growth inhibition of 34% The invention may be embodied in other specific forms (P>0.05); shO7F01-62 antibody treatment resulted in tumor 40 without departing from the spirit or essential characteristics growth inhibition of 39% (P>0.05); and RON8 antibody treat thereof. The foregoing embodiments are therefore to be con ment resulted in tumor growth inhibition of 38% (P -0.05). sidered in all respects illustrative rather than limiting on the These results demonstrate that sh29B06-78 and mu29B06 invention described herein. Scope of the invention is thus inhibit tumor growth in a NCI-H358 xenograft model indicated by the appended claims rather than by the foregoing (P<0.01), whereas the mu07F01, sho7F01-62, and RON8 45 description, and all changes that come within the meaning antibodies did not inhibit tumor growth in this model (P-0.05, and the range of equivalency of the claims are intended to be which is not statically significant). embraced therein.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 178

<21 Oc SEO ID NO 1 <211 LENGTH: 363 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <22 Os FEATURE; OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs SEQUENCE: 1

gaggtgaagc titcticgagtic tigaggtggc ctggtgcagc cqggtggat C cctgaaactic 60

to Ctgtgcag cctoaggatt cattttagt agaCactgga tigagttgggit Coggctggct 12O

Ccagggaaag ggctagaatg gatcgcagaa attaatcCag at agcagaac gataaact at 18O US 8,603,478 B2 95 - Continued acgc catc to taaaggagaa attcatcatc. tccagagaca acgc.caaaaa titcgctgttt 24 O Ctgcaaatga acagagtgag atctgaggac acagc cctitt attactgtgc alagacgggta 3OO agaatt catt act acggcgc tatggactgc tigggg.tcaag galacct cagt caccgt.ct cc 360 toa 363

<210s, SEQ ID NO 2 &211s LENGTH: 121 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 2 Glu Val Lys Lieu. Lieu. Glu Ser Gly Gly Gly Lieu Val Glin Pro Gly Gly 1. 5 1O 15 Ser Lieu Lys Lieu. Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Arg His 2O 25 3O Trp Met Ser Trp Val Arg Lieu Ala Pro Gly Lys Gly Lieu. Glu Trp Ile 35 4 O 45 Ala Glu Ile Asin Pro Asp Ser Arg Thr Ile Asn Tyr Thr Pro Ser Leu SO 55 6 O Lys Glu Lys Phe Ile Ile Ser Arg Asp Asn Ala Lys Asn. Ser Lieu. Phe 65 70 7s 8O Lieu. Glin Met Asn Arg Val Arg Ser Glu Asp Thr Ala Lieu. Tyr Tyr Cys 85 90 95 Ala Arg Arg Val Arg Ile His Tyr Tyr Gly Ala Met Asp Cys Trp Gly 1OO 105 11 O Gln Gly. Thir Ser Val Thr Val Ser Ser 115 12 O

<210s, SEQ ID NO 3 &211s LENGTH: 321 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 3 gacattgttgt tacccagtic ticaaaaaatc gtgtc. cacat Cagtaggagc Cagggit cagc 6 O gtcacctgca aggc.cagt ca gaatgtgggit totagtt tag tictggitatica acagaalacca 12 O ggtcaatcto ctaaaacact gatttact cq goat cct tcc ggtacagtgg agt coct gat 18O cgct tcacag gcagtggat.c tdggacagat ttcactict ca C catcagcaa ttgcagtict 24 O gaag acttgg cagattattt citgtcaacaa tataataact atcc.gct cac gttcggtgct 3OO gggaccalagc tiggagctgaa a 321

<210s, SEQ ID NO 4 &211s LENGTH: 107 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 4 Asp Ile Val Lieu. Thr Glin Ser Gln Lys Ile Val Ser Thr Ser Val Gly 1. 5 1O 15 US 8,603,478 B2 97 98 - Continued

Ala Arg Val Ser Val Thr Cys Lys Ala Ser Glin Asn Val Gly Ser Ser 2O 25 3O Lieu Val Trp Tyr Glin Gln Lys Pro Gly Glin Ser Pro Llys Thr Lieu. Ile 35 4 O 45 Tyr Ser Ala Ser Phe Arg Tyr Ser Gly Val Pro Asp Arg Phe Thr Gly SO 55 6 O Ser Gly Ser Gly Thr Asp Phe Thr Lieu. Thir Ile Ser Asn Val Glin Ser 65 70 7s 8O Glu Asp Lieu Ala Asp Tyr Phe Cys Glin Glin Tyr Asn. Asn Tyr Pro Lieu. 85 90 95 Thir Phe Gly Ala Gly Thr Llys Lieu. Glu Lieu Lys 1OO 105

<210s, SEQ ID NO 5 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 5 Arg His Trp Met Ser 1. 5

<210s, SEQ ID NO 6 &211s LENGTH: 17 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 6 Glu Ile Asin Pro Asp Ser Arg Thr Ile Asn Tyr Thr Pro Ser Leu Lys 1. 5 1O 15

Glu

<210s, SEQ ID NO 7 &211s LENGTH: 12 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 7 Arg Val Arg Ile His Tyr Tyr Gly Ala Met Asp Cys 1. 5 1O

<210s, SEQ ID NO 8 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 8 Lys Ala Ser Glin Asn Val Gly Ser Ser Lieu Val 1. 5 1O

<210s, SEQ ID NO 9 &211s LENGTH: 7 US 8,603,478 B2 99 100 - Continued

212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 9 Ser Ala Ser Phe Arg Tyr Ser 1. 5

<210s, SEQ ID NO 10 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 10 Gln Glin Tyr Asn Asn Tyr Pro Leu. Thr 1. 5

<210s, SEQ ID NO 11 &211s LENGTH: 357 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 11 gaggtgcagt tagtggagtic tiggggaggc titagtgaagc Ctggagggit C C Ctgaaactic 6 O t cct gtgcag cct ctdgatt cactitt cagt accitatgcca tdt cittggat t cqccagact 12 O ccggagaaga ggctggagtg ggtcgcagga at Cactaatg gtggtag titt Cacct act at 18O ccagacactg talagggacg attcaccatc. tccagagaca atgcc aggala catcctatac 24 O Ctgcaaatga gcggtctgag gtctgaggac acggc catgt attattgttgc alagacagggit 3OO tact atggtg ttaactittga c tactgggg.c caaggcacca citct cacagt citcctica 357

<210s, SEQ ID NO 12 &211s LENGTH: 119 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 12 Glu Val Glin Lieu Val Glu Ser Gly Gly Gly Lieu Val Llys Pro Gly Gly 1. 5 1O 15 Ser Leu Lys Lieu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr 2O 25 3O Ala Met Ser Trp Ile Arg Glin Thr Pro Glu Lys Arg Lieu. Glu Trp Val 35 4 O 45 Ala Gly Ile Thr Asn Gly Gly Ser Phe Thr Tyr Tyr Pro Asp Thr Val SO 55 6 O Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Arg Asn. Ile Lieu. Tyr 65 70 7s 8O Lieu Gln Met Ser Gly Lieu. Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Arg Glin Gly Tyr Tyr Gly Val Asn. Phe Asp Tyr Trp Gly Glin Gly 1OO 105 11 O US 8,603,478 B2 101 102 - Continued

Thir Thir Lieu. Thir Wal Ser Ser 115

<210s, SEQ ID NO 13 &211s LENGTH: 336 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 13 gatgctgtga tigacccaaac tocactict co citgcctgtca gtc.ttggaga t caa.gc.ctic c 6 O atct cittgca ggit ctagt ca gagcc.ttgaa alacagtaacg gaaac actta tittgaactgg 12 O tacctic caga aaccaggcca gttct coacag citcct gatct acagggitttic caa.ccgattit 18O tctggggtco Cagacaggtt cagtgg tagt ggat Caggga Cagattt cac actgaaaatc 24 O atcagagtgg aggctgagga tittgggactt tatttctgcc ticcaagttac acatgtc.ccg 3OO

Cacacgttcg gaggggggac caaactggaa ttaaaa 336

<210s, SEQ ID NO 14 &211s LENGTH: 112 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 14 Asp Ala Val Met Thr Glin Thr Pro Leu Ser Leu Pro Val Ser Leu Gly 1. 5 1O 15 Asp Glin Ala Ser Ile Ser Cys Arg Ser Ser Glin Ser Lieu. Glu Asn. Ser 2O 25 3O Asn Gly Asn Thr Tyr Lieu. Asn Trp Tyr Lieu Gln Lys Pro Gly Glin Ser 35 4 O 45 Pro Gln Leu Lieu. Ile Tyr Arg Val Ser Asn Arg Phe Ser Gly Val Pro SO 55 6 O Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Lieu Lys Ile 65 70 7s 8O Ile Arg Val Glu Ala Glu Asp Lieu. Gly Lieu. Tyr Phe Cys Lieu. Glin Val 85 90 95 Thr His Val Pro His Thr Phe Gly Gly Gly Thr Lys Lieu. Glu Lieu Lys 1OO 105 11 O

<210s, SEQ ID NO 15 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 15 Thr Tyr Ala Met Ser 1. 5

<210s, SEQ ID NO 16 &211s LENGTH: 17 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide US 8,603,478 B2 103 104 - Continued

<4 OOs, SEQUENCE: 16 Gly Ile Thr Asn Gly Gly Ser Phe Thr Tyr Tyr Pro Asp Thr Val Lys 1. 5 1O 15 Gly

<210s, SEQ ID NO 17 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 17 Gln Gly Tyr Tyr Gly Val Asn Phe Asp Tyr 1. 5 1O

<210s, SEQ ID NO 18 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 18 Arg Ser Ser Glin Ser Lieu. Glu Asn. Ser Asn Gly Asn. Thir Tyr Lieu. Asn 1. 5 1O 15

<210s, SEQ ID NO 19 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 19 Arg Val Ser Asn Arg Phe Ser 1. 5

<210s, SEQ ID NO 2 O &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 2O

Lieu. Glin Wall Thr His Wall Pro His Thr 1. 5

<210s, SEQ ID NO 21 &211s LENGTH: 354 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 21 gaagtgaagc tiggtggagtic ggggggaggc titagtgaagc Ctggagcgtc. tctgaaactic 6 O t cct gtgcag cct ctdgatt catttitcagt toc tatggca tdt cittggg t t cqccagact 12 O t cagacaaga ggctggagtg ggtcgctt Co attagtagtg gtggtgg tac Cacct act at 18O US 8,603,478 B2 105 106 - Continued

Ctagacactg. taaagggc.cg attcaccatc. tccagagaga atgccaagga Caccctgtac 24 O Ctgcaaatga gtggtctgaa gtctgaagac acggccttgt attactgtac aagaggccala 3OO tggittact aa agtttgctta Ctgggggcaa gggactctgg to actgtct c teca 3.54

<210s, SEQ ID NO 22 &211s LENGTH: 118 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 22 Glu Val Lys Lieu Val Glu Ser Gly Gly Gly Lieu Val Llys Pro Gly Ala 1. 5 1O 15 Ser Leu Lys Lieu Ser Cys Ala Ala Ser Gly Phe Ile Phe Ser Ser Tyr 2O 25 3O Gly Met Ser Trp Val Arg Glin Thir Ser Asp Lys Arg Lieu. Glu Trp Val 35 4 O 45 Ala Ser Ile Ser Ser Gly Gly Gly Thr Thr Tyr Tyr Lieu. Asp Thr Val SO 55 6 O Lys Gly Arg Phe Thir Ile Ser Arg Glu Asn Ala Lys Asp Thir Lieu. Tyr 65 70 7s 8O Lieu. Glin Met Ser Gly Lieu Lys Ser Glu Asp Thr Ala Lieu. Tyr Tyr Cys 85 90 95 Thr Arg Gly Gln Trp Lieu. Lieu Lys Phe Ala Tyr Trp Gly Glin Gly Thr 1OO 105 11 O

Leul Wall. Thir Wal Ser Ala 115

<210s, SEQ ID NO 23 &211s LENGTH: 345 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 23 caacttgtgc ticacticagtic atctt cagcc tictitt ct coc togggagcctic agcaaaactic 6 O acgtgcacct tdagtagt ca gcacactacg tacac cattgaatggitatica gcaactgc.ca 12 O Ctcaa.gc.ctic ctalagtatgt gatggagctt aagaaagatg gaa.gc.cacag cacaggtgtt 18O gggatt cotg atcgcttctic toggat.ccago totggtgctg atcgctacct taccatttcc 24 O alacatc.ca.gc ctgaagatga agcaatatac atctgtggtg tdggtgaga C aattgaggac 3OO

Caatttgttgt atgtttitcgg C9gtggcacc aaggt cactg. tcc ta 345

<210s, SEQ ID NO 24 &211s LENGTH: 115 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 24 Gln Leu Val Lieu. Thr Glin Ser Ser Ser Ala Ser Phe Ser Lieu. Gly Ala 1. 5 1O 15

Ser Ala Lys Lieu. Thr Cys Thr Lieu Ser Ser Gln His Thr Thr Tyr Thr US 8,603,478 B2 107 108 - Continued

2O 25 3O Ile Glu Trp Tyr Glin Gln Leu Pro Leu Lys Pro Pro Llys Tyr Val Met 35 4 O 45 Glu Lieu Lys Lys Asp Gly Ser His Ser Thr Gly Val Gly Ile Pro Asp SO 55 6 O Arg Phe Ser Gly Ser Ser Ser Gly Ala Asp Arg Tyr Lieu. Thir Ile Ser 65 70 7s 8O Asn. Ile Glin Pro Glu Asp Glu Ala Ile Tyr Ile Cys Gly Val Gly Glu 85 90 95 Thir Ile Glu Asp Glin Phe Val Tyr Val Phe Gly Gly Gly Thr Llys Val 1OO 105 11 O

Thir Wall Lieu. 115

<210s, SEQ ID NO 25 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 25 Ser Tyr Gly Met Ser 1. 5

<210s, SEQ ID NO 26 &211s LENGTH: 17 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 26 Ser Ile Ser Ser Gly Gly Gly Thr Thr Tyr Tyr Lieu. Asp Thr Val Lys 1. 5 1O 15 Gly

<210s, SEQ ID NO 27 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 27 Gly Glin Trp Lieu Lleu Lys Phe Ala Tyr 1. 5

<210s, SEQ ID NO 28 &211s LENGTH: 12 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 28 Thr Lieu Ser Ser Gln His Thr Thr Tyr Thr Ile Glu 1. 5 1O

<210s, SEQ ID NO 29 US 8,603,478 B2 109 110 - Continued

&211s LENGTH: 11 212. TYPE: PRT ORGANISM: Artificial Sequence 22 Os. FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 29 Lieu Lys Lys Asp Gly Ser His Ser Thr Gly Val 1. 5

<210s, SEQ ID NO 3 O &211s LENGTH: 13 212. TYPE: PRT ORGANISM: Artificial Sequence 22 Os. FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 30 Gly Val Gly Glu Thir Ile Glu Asp Glin Phe Val Tyr Val 1. 5

<210s, SEQ ID NO 31 &211s LENGTH: 348 &212s. TYPE: DNA ORGANISM: Artificial Sequence 22 Os. FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 31 gaggtgcagc titcaggagtic aggacctago citcgtgaaac cittct cagac totgtcc ct c 6 O acctgttatgtcactggcga CtcCatCaCC agtgattact ggaattggat CC9gaaattic 12 O cCaggaaata aacttgagta Catgggat at atcagctaca gtgg tag cac titact acaat 18O c catct ct ca aaagttctgaat CtcCatCact cgaga Cacat c caagaacca gttctacctt 24 O cggttgaatt Ctgttgactac tgaggacaca gcc acatatt actgtgcaag aaccoatata 3OO Cttacgattg Ctt actgggg cCaagggact Ctggit cactg t citctgca 348

<210s, SEQ ID NO 32 &211s LENGTH: 116 212. TYPE: PRT ORGANISM: Artificial Sequence 22 Os. FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 32

Glu Val Glin Lieu. Glin Glu Ser Gly Pro Ser Lieu. Wall Pro Ser Glin 1. 5 1O 15

Thir Leu Ser Lieu. Thr Cys Tyr Val Thr Gly Asp Ser Ile Thir Ser Asp 25 3O

Trp Asn Trp Ile Arg Llys Phe Pro Gly Asn Lell Glu Tyr Met 35 4 O 45

Gly Tyr Ile Ser Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Lieu Lys SO 55 6 O

Ser Arg Ile Ser Ile Thr Arg Asp Thir Ser Lys Asn Glin Phe Tyr Lieu. 65 70 7s 8O

Arg Lieu. Asn. Ser Wall. Thir Thr Glu Asp Thir Ala Thir Tyr Cys Ala 85 90 95

Arg Thir His Ile Lieu. Thir Ile Ala Tyr Trp Gly Glin Gly Thir Lieu. Wall 105 11 O US 8,603,478 B2 111 112 - Continued

Thir Wal Ser Ala 115

SEQ ID NO 33 &211s LENGTH: 330 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 33 caggctgttg tdacticagga atctgcactic accacat cac ctdgtgaaac agt cacactic 6 O acttgtc.gct Caagtgc.cgg ggctgttaca act agta act ttgccaactg. g.gt ccaagaa 12 O aaaccagatc atttatt cac togg totaata ggtgatacca acatc.cgagc ticcaggtgtt 18O

Cctgccagat t ct caggctic cct gattgga gacaaggctg C cct cac cat cacaggggca 24 O Cagactgagg atgaggcaat at atttctgt gct ctittggit acagcaacca ttactgggtg 3OO titcggtggag galaccaaact gactgtc.cta 33 O

<210s, SEQ ID NO 34 &211s LENGTH: 110 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 34 Glin Ala Val Val Thr Glin Glu Ser Ala Lieu. Thir Thr Ser Pro Gly Glu 1. 5 1O 15 Thr Val Thr Lieu. Thr Cys Arg Ser Ser Ala Gly Ala Val Thir Thr Ser 2O 25 3O Asn Phe Ala Asn Trp Val Glin Glu Lys Pro Asp His Lieu. Phe Thr Gly 35 4 O 45 Lieu. Ile Gly Asp Thr Asn. Ile Arg Ala Pro Gly Val Pro Ala Arg Phe SO 55 6 O Ser Gly Ser Lieu. Ile Gly Asp Lys Ala Ala Lieu. Thir Ile Thr Gly Ala 65 70 7s 8O Gln Thr Glu Asp Glu Ala Ile Tyr Phe Cys Ala Leu Trp Tyr Ser Asn 85 90 95 His Tyr Trp Val Phe Gly Gly Gly Thr Lys Lieu. Thr Val Lieu. 1OO 105 11 O

<210s, SEQ ID NO 35 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 35 Ser Asp Tyr Trp Asn 1. 5

<210s, SEQ ID NO 36 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic US 8,603,478 B2 113 114 - Continued peptide

<4 OOs, SEQUENCE: 36 Tyr Ile Ser Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser 1. 5 1O 15

<210s, SEQ ID NO 37 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 37 Thr His Ile Lieu. Thir Ile Ala Tyr 1. 5

<210s, SEQ ID NO 38 &211s LENGTH: 14 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 38 Arg Ser Ser Ala Gly Ala Val Thir Thir Ser Asn. Phe Ala Asn 1. 5 1O

<210s, SEQ ID NO 39 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 39 Asp Thr Asn. Ile Arg Ala Pro 1. 5

<210s, SEQ ID NO 4 O &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 4 O Ala Leu Trp Tyr Ser Asn His Tyr Trp Val 1. 5 1O

<210s, SEQ ID NO 41 &211s LENGTH: 351 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 41 gaggtgcagc titcaggagtic aggacctago Ctcgtgaaac Cttct Cagac totgtcc ct c 6 O acctgttctg. t cactggcga ctic catcacc agtggitt act ggaactggat CC9gaaattic 12 O cCagggaata aacttgagta catgggg tac ataagctaca gtggtaaaac titact acaat 18O US 8,603,478 B2 115 116 - Continued c catct ct ca aaagttctgaat ct c catcact cqagacacat ccaagaacca ttactacctg 24 O Cagttgattt Ctgttgactgc tigaggacaca gcc acatatt actgtgcaag gtctaagtac 3OO gactatgcta tigact actggggtcaagga acct cagtica cc.gtctic ct c a 351

<210s, SEQ ID NO 42 &211s LENGTH: 117 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 42 Glu Val Glin Leu Gln Glu Ser Gly Pro Ser Leu Val Llys Pro Ser Glin 1. 5 1O 15 Thr Lieu Ser Lieu. Thr Cys Ser Val Thr Gly Asp Ser Ile Thr Ser Gly 2O 25 3O Tyr Trp Asn Trp Ile Arg Llys Phe Pro Gly Asn Lys Lieu. Glu Tyr Met 35 4 O 45 Gly Tyr Ile Ser Tyr Ser Gly Lys Thr Tyr Tyr Asn Pro Ser Leu Lys SO 55 6 O Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn His Tyr Tyr Lieu. 65 70 7s 8O Gln Lieu. Ile Ser Val Thr Ala Glu Asp Thr Ala Thr Tyr Tyr Cys Ala 85 90 95 Arg Ser Lys Tyr Asp Tyr Ala Met Asp Tyr Trp Gly Glin Gly Thr Ser 1OO 105 11 O

Wall. Thir Wal Ser Ser 115

<210s, SEQ ID NO 43 &211s LENGTH: 333 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 43 gacattgttgc tigacccaatc. tccagcttct ttggctgtgt Citctaggaca gagggccacc 6 O atct cotgca gagccagoga aattgttgat aattittggca ttagtttitat gaactggttc 12 O caacagaaac caggacagcc acccaaactic ct catctato citgcatccaa ccaaggat.cc 18O gggg.tcCCtg C caggtttag tigcagtggg totggga cag actticago'ct caa.catcCat 24 O Cctgtggagg aggatgatac to aatgt at ttctgtcagc aaagtaagga ggttcct cog 3OO acgttcggtg gaggcaccala gctggaaatc aaa. 333

<210s, SEQ ID NO 44 &211s LENGTH: 111 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 44 Asp Ile Val Lieu. Thr Glin Ser Pro Ala Ser Lieu Ala Val Ser Lieu. Gly 1. 5 1O 15

Glin Arg Ala Thir Ile Ser Cys Arg Ala Ser Glu Ile Val Asp Asn. Phe 2O 25 3O US 8,603,478 B2 117 118 - Continued

Gly Ile Ser Phe Met Asn Trp Phe Glin Glin Llys Pro Gly Glin Pro Pro 35 4 O 45 Llys Lieu. Lieu. Ile Tyr Ala Ala Ser Asn Glin Gly Ser Gly Val Pro Ala SO 55 6 O Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Lieu. Asn Ile His 65 70 7s 8O Pro Val Glu Glu Asp Asp Thr Ala Met Tyr Phe Cys Glin Glin Ser Lys 85 90 95 Glu Val Pro Pro Thr Phe Gly Gly Gly Thr Lys Lieu. Glu Ile Llys 1OO 105 11 O

<210s, SEQ ID NO 45 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 45 Ser Gly Tyr Trp Asn 1. 5

<210s, SEQ ID NO 46 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 46 Tyr Ile Ser Tyr Ser Gly Lys Thr Tyr Tyr Asn Pro Ser Leu Lys Ser 1. 5 1O 15

<210s, SEQ ID NO 47 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 47 Ser Lys Tyr Asp Tyr Ala Met Asp Tyr 1. 5

<210s, SEQ ID NO 48 &211s LENGTH: 15 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 48 Arg Ala Ser Glu Ile Val Asp Asn. Phe Gly Ile Ser Phe Met Asn 1. 5 1O 15

<210s, SEQ ID NO 49 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide US 8,603,478 B2 119 120 - Continued

<4 OOs, SEQUENCE: 49 Ala Ala Ser Asn Glin Gly Ser 1. 5

<210s, SEQ ID NO 50 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 50 Gln Glin Ser Lys Glu Val Pro Pro Thr 1. 5

<210s, SEQ ID NO 51 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 51 Gly Phe Asp Phe Ser Arg His 1. 5

<210s, SEQ ID NO 52 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 52 Asn Pro Asp Ser Arg Thr 1. 5

<210s, SEQ ID NO 53 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 53 Gly Phe Thr Phe Ser Thr Tyr 1. 5

<210s, SEQ ID NO 54 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 54 Thr Asn Gly Gly Ser Phe 1. 5

<210s, SEQ ID NO 55 &211s LENGTH: 7 212. TYPE: PRT US 8,603,478 B2 121 122 - Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 55 Gly Phe Ile Phe Ser Ser Tyr 1. 5

<210s, SEQ ID NO 56 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 56 Ser Ser Gly Gly Gly Thr 1. 5

<210s, SEQ ID NO 57 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 57 Gly Asp Ser Ile Thir Ser Asp 1. 5

<210s, SEQ ID NO 58 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 58 Ser Tyr Ser Gly Ser 1. 5

<210s, SEQ ID NO 59 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 59 Gly Asp Ser Ile Thr Ser Gly 1. 5

<210s, SEQ ID NO 60 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 60 Ser Tyr Ser Gly Lys 1. 5 US 8,603,478 B2 123 124 - Continued

<210s, SEQ ID NO 61 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 61 Gly Phe Asp Phe Ser Arg His Trp 1. 5

<210s, SEQ ID NO 62 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 62 Ile Asin Pro Asp Ser Arg Thir Ile 1. 5

<210s, SEQ ID NO 63 &211s LENGTH: 14 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 63 Ala Arg Arg Val Arg Ile His Tyr Tyr Gly Ala Met Asp Cys 1. 5 1O

<210s, SEQ ID NO 64 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 64 Gly Phe Thr Phe Ser Thr Tyr Ala 1. 5

<210s, SEQ ID NO 65 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 65 Ile Thr Asn Gly Gly Ser Phe Thr 1. 5

<210s, SEQ ID NO 66 &211s LENGTH: 12 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 66 US 8,603,478 B2 125 126 - Continued

Ala Arg Glin Gly Tyr Tyr Gly Val Asn. Phe Asp Tyr 1. 5 1O

<210s, SEQ ID NO 67 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 67 Gly Phe Ile Phe Ser Ser Tyr Gly 1. 5

<210s, SEQ ID NO 68 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 68 Ile Ser Ser Gly Gly Gly Thr Thr 1. 5

<210s, SEQ ID NO 69 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 69 Thir Arg Gly Glin Trp Lieu Lleu Lys Phe Ala Tyr 1. 5 1O

<210s, SEQ ID NO 70 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 7 O Gly Asp Ser Ile Thr Ser Asp Tyr 1. 5

<210s, SEQ ID NO 71 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 71 Ile Ser Tyr Ser Gly Ser Thr 1. 5

<210s, SEQ ID NO 72 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 8,603,478 B2 127 128 - Continued <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 72 Ala Arg Thr His Ile Lieu. Thir Ile Ala Tyr 1. 5 1O

<210s, SEQ ID NO 73 &211s LENGTH: 8 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 73 Gly Asp Ser Ile Thr Ser Gly Tyr 1. 5

<210s, SEQ ID NO 74 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 74 Ile Ser Tyr Ser Gly Lys Thr 1. 5

<210s, SEQ ID NO 75 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 75 Ala Arg Ser Lys Tyr Asp Tyr Ala Met Asp Tyr 1. 5 1O

<210s, SEQ ID NO 76 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 76 Gln Asn Val Gly Ser Ser 1. 5

<210s, SEQ ID NO 77 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 77 Gln Ser Lieu. Glu Asn Ser Asn Gly Asn Thr Tyr 1. 5 1O

<210s, SEQ ID NO 78 US 8,603,478 B2 129 130 - Continued

&211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 78 Ser Gln His Thr Thr Tyr Thr 1. 5

<210s, SEQ ID NO 79 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OO > SEQUENCE: 79 Lieu Lys Lys Asp Gly Ser His 1. 5

<210s, SEQ ID NO 8O &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 80 Ala Gly Ala Val Thr Thr Ser Asn Phe 1. 5

<210s, SEQ ID NO 81 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 81 Glu Ile Val Asp Asn Phe Gly Ile Ser Phe 1. 5 1O

<210s, SEQ ID NO 82 &211s LENGTH: 972 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 82 gccaaaacga cacccc catc tdt citatic ca citggc.ccctg gatctgctgc ccaaactaac 6 O tccatggtga C cctgggatg cctggtcaag ggctattitcc ctgagcc agit gacagtgacc 12 O tggaactctg gatcc.ctgtc. cagcggtgtg cacacct tcc cagctgtc.ct gcagtctgac 18O citctacactic tdagcagotc agtgactgtc. ccctic cagoa cct ggcc cag cqagaccgt.c 24 O acctgcaacg ttgc.ccaccc ggc.ca.gcagc accalaggtgg acaagaaaat ttgcc.cagg 3OO gattgtggitt gtaagc ctitg catatgtaca gtc.ccagaag tat catctgt citt catcttic 360 cc.cccaaag.c ccaaggatgt gct caccatt actictdactic ctaaggt cac gtgtgttgttg 42O gtag acatca gcaaggatga t cc.cgagg to Cagttcagct ggitttgtaga tigatgtggag 48O US 8,603,478 B2 131 132 - Continued gtgcacacag Ctcagacgca accc.cgggag gag cagttca acagc actitt C cct cagtic 54 O agtgaact tc C catcatgca C caggactgg Ctcaatggca aggagttcaa atgcagggit c 6OO aacagtgcag ctitt.coct gc ccc catcgag aaaac catct c caaaac caa aggcagaccg 660 aaggct coac aggtgtacac cattccacct cccaaggagc agatggccala ggataaagtic 72 O agtctgacct gcatgataac agacittct tc cct galagaca ttact.gtgga gtggcagtgg 78O aatgggcagc cagcggagaa ctacaagaac act cago'cca toatggacac agatggctict 84 O tact tcgt.ct acagdaagct caatgtgcag aagagcaact gggaggcagg aaatactitt C 9 OO acctgctctg tdttacatga gqqcctgcac aaccaccata citgagaagag cct ct cocac 96.O tctic ctdgta aa 972

<210s, SEQ ID NO 83 &211s LENGTH: 324 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 83

Ala Lys. Thir Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala 1. 5 1O 15

Ala Glin Thir Asn. Ser Met Wall. Thir Lieu. Gly Cys Lell Wall Lys Gly Tyr 25 3O

Phe Pro Glu Pro Wall. Thir Wall. Thir Trp Asn Ser Gly Ser Luel Ser Ser 35 4 O 45

Gly Wall His Thir Phe Pro Ala Wall Lieu. Glin Ser Asp Lell Tyr Thr Lieu. SO 55 6 O

Ser Ser Ser Wall. Thir Wall Pro Ser Ser Thir Trp Pro Ser Glu Thir Wall 65 70 7s 8O

Thir Asn. Wall Ala His Pro Ala Ser Ser Thr Wall Asp Llys Llys 85 90 95

Ile Wall Pro Arg Asp Cys Gly Cys Llys Pro Cys Ile Thir Wa Pro 105 11 O

Glu Wall Ser Ser Wall Phe Ile Phe Pro Pro Llys Pro Lys Asp Val Lieu 115 12 O 125

Thir Ile Thir Lieu. Thr Pro Llys Val Thr Cys Val Wall Wall Asp Ile Ser 13 O 135 14 O

Lys Asp Asp Pro Glu Wall Glin Phe Ser Trp Phe Wall Asp Asp Val Glu 145 150 155 160

Wall His Thir Ala Glin. Thir Glin Pro Arg Glu Glu Glin Phe Asn. Ser Thr 1.65 17O 17s

Phe Arg Ser Wall Ser Glu Lieu. Pro Ile Met His Glin Asp Trp Lieu. Asn 18O 185 19 O

Gly Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro 195 2O5

Ile Glu Thir Ile Ser Lys Thr Pro Ala Pro Glin 21 O 215 22O

Wall Thir Ile Pro Pro Pro Llys Glu Gln Met Ala Asp Llys Val 225 23 O 235 24 O

Ser Luell Thir Cys Met Ile Thr Asp Phe Phe Pro Glu Ile Thir Wall 245 250 255

Glu Trp Gln Trp Asn Gly Glin Pro Ala Glu Asn Asn. Thir Glin 26 O 265 27 O US 8,603,478 B2 133 134 - Continued

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Luell Asn 27s 285

Val Glin Llys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thir Cys Ser Wall 29 O 295 3 OO

Lieu. His Glu Gly Lieu. His Asn His His Thr Glu Ser Luell Ser His 3. OS 310 315 32O Ser Pro Gly Lys

<210s, SEQ ID NO 84 &211s LENGTH: 990 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 84 gccaaaacaa cagc.cc catc ggit citat coa Ctggc.ccctg tgttgttggaga tacaactggc 6 O t cct cqgtga Ct c taggatg Cctggtcaag ggittattitcc Ctgagc.cagt gaccttgacc 12 O tggaactctg gatcc.ctgtc. Cagtggtgttg Cacacct tcc. cagctgtc.ct gcagt ctgac 18O citctacaccc ticagoagctic agtgactgta accticagda Cctggcc.ca.g c cagt ccatc 24 O acctgcaatig toggcccaccc ggcaa.gcagc accalaggtgg acaagaaaat tgagcc.caga 3OO gggccCacaa t caa.gc.cctg t cct c catgc aaatgcc cag Cacct aacct Cttgggtgga 360 ccatcc.gtct tcatct tccc tccaaagatc aaggatgtac t catgat citc cctgagc.ccc 42O atagt cacat gtgtggtggit ggatgttgagc gaggatgacc cagatgtc.ca gat cagotgg 48O tttgttgaaca acgtggaagt acacacagct cagacacaaa cc catagaga ggattacaac 54 O agtact ct co gggtggtcag tgc cct cocc atc.ca.gcacc aggactggat gagtggcaa.g 6OO gagttcaaat gcaaggtoaia caacaaagac ctic ccagcgc c catcgaga.g aac Catctoa 660 aalacccaaag ggt cagtaag agctic cacag gtatatgtct tgcct coacc agaagaagag 72 O atgact aaga aac agg to ac tctgacctgc atggit cacag actitcatgcc tgaagacatt 78O tacgtggagt ggaccaacaa cgggaaaa.ca gagctaaact acaagaacac tgaac cagtic 84 O ctgg actctg atggttctta citt catgitac agcaa.gctga gagtggaaaa gaagaactgg 9 OO gtggaaagaa at agct actic Ctgttcagtg gtc. cacgagg gtctgcacaa t caccacacg 96.O actaagagct tct cocqqac tcc.gggtaaa 990

<210s, SEQ ID NO 85 &211s LENGTH: 330 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 85 Ala Lys Thir Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Wall Cys Gly 1. 5 1O 15

Asp Thir Thr Gly Ser Ser Val Thr Lieu. Gly Cys Lell Wall Lys Gly Tyr 25 3O

Phe Pro Glu Pro Wall. Thir Lieu. Thir Trp Asn Ser Gly Ser Luell Ser Ser 35 4 O 45

Gly Val His Thr Phe Pro Ala Val Lieu. Glin Ser Asp Lell Thir Lieu. SO 55 6 O US 8,603,478 B2 135 136 - Continued Ser Ser Ser Wall. Thir Wall. Thir Ser Ser Thir Trp Pro Ser Glin Ser Ile 65 70 7s 8O

Thir Asn Wall Ala His Pro Ala Ser Ser Thr Lys Wall Asp Llys Llys 85 90 95

Ile Glu Pro Arg Gly Pro Thr Ile Llys Pro Cys Pro Pro Cys Lys Cys 105 11 O

Pro Ala Pro Asn Lieu. Lieu. Gly Gly Pro Ser Wall Phe Ile Phe Pro Pro 115 12 O 125

Ile Asp Val Lieu Met Ile Ser Lieu. Ser Pro Ile Wall Thr Cys 13 O 135 14 O

Wall Wall Wall Asp Val Ser Glu Asp Asp Pro Asp Wall Glin Ile Ser Trp 145 150 155 160

Phe Wall Asn Asn Val Glu Wal His Thir Ala Glin Thir Glin Thir His Arg 1.65 17O 17s

Glu Asp Asn Ser Thr Lieu. Arg Wall Wal Ser Ala Lell Pro Ile Glin 18O 185 19 O

His Glin Asp Trp Met Ser Gly Lys Glu Phe Lys Lys Wall Asn. Asn 195

Asp Luell Pro Ala Pro Ile Glu Arg Thr Ile Ser Pro 21 O 215 22O

Ser Wall Arg Ala Pro Glin Val Tyr Wall Leu Pro Pro Pro Glu Glu Glu 225 23 O 235 24 O

Met Thir Lys Glin Val Thr Lieu Thr Cys Met Wall Thir Asp Phe Met 245 250 255

Pro Glu Asp Ile Tyr Val Glu Trp Thir Asn. Asn Gly Thir Glu Lieu. 26 O 265 27 O

Asn Tyr Lys Asn. Thir Glu Pro Wall Lieu. Asp Ser Asp Gly Ser Tyr Phe 27s 285

Met Tyr Ser Llys Lieu. Arg Val Glu Llys Lys Asn Trp Wall Glu Arg Asn 29 O 295 3 OO

Ser Ser Cys Ser Val Val His Glu Gly Lieu. His Asn His His Thr 3. OS 310 315 32O

Thir Ser Phe Ser Arg Thr Pro Gly Lys 3.25 330

SEQ ID NO 86 LENGTH: 321 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

SEQUENCE: 86 cgggctgatg Ctgcaccaac tgitat coat c titcCCaC cat Ccagtgagca gttaa catct 6 O ggaggtgcct Cagtcgtgtg cittcttgaac aactt CtaCC c caaaga cat Caatgtcaag 12 O tggaagattg atggcagtga acgacaaaat ggcgt.cctga acagttggac tgat caggac 18O agcaaagaca gCacct acag Catgagcagc accct cacgt. tgacCaagga cgagtatgaa 24 O cgacataa.ca gctatacctg tgaggccact cacaaga cat Caact tcaCC cattgtcaag 3OO agct tcaa.ca ggaatgagtg t 321

SEO ID NO 87 LENGTH: 1. Of TYPE : PRT ORGANISM: Artificial Sequence FEATURE: US 8,603,478 B2 137 138 - Continued <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OO > SEQUENCE: 87 Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 1. 5 1O 15 Gln Lieu. Thir Ser Gly Gly Ala Ser Val Val Cys Phe Lieu. Asn Asin Phe 2O 25 3O Tyr Pro Lys Asp Ile Asn. Wall Lys Trp Llys Ile Asp Gly Ser Glu Arg 35 4 O 45 Glin Asn Gly Val Lieu. Asn. Ser Trp Thr Asp Glin Asp Ser Lys Asp Ser SO 55 6 O Thr Tyr Ser Met Ser Ser Thr Lieu. Thir Lieu. Thir Lys Asp Glu Tyr Glu 65 70 7s 8O Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 85 90 95 Pro Ile Val Lys Ser Phe Asn Arg Asn. Glu. Cys 1OO 105

<210s, SEQ ID NO 88 &211s LENGTH: 318 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 88 ggc.ca.gc.cca agt citt cqcc at cagt cacc ctdtttic cac ct tcc totga agagct coag 6 O actaacaagg C cacactggt gtgtacgatc actgatttct acc caggtgt ggtgacagtg 12 O gactggalagg tagatggtac C cctgtcact Caggg tatgg agacaac cca gcc titcCaaa 18O cagagcaa.ca acaagtacat ggctaggagc tacct gaccc tacagcaag agcatgggaa 24 O aggcat agca gttacagctg. C Caggit cact catgaagg to acactgtgga gaagagtttg 3OO tcc.cgtgctg actgttcc 3.18

<210s, SEQ ID NO 89 &211s LENGTH: 106 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 89 Gly Glin Pro Llys Ser Ser Pro Ser Val Thr Lieu Phe Pro Pro Ser Ser 1. 5 1O 15 Glu Glu Lieu. Glu Thir Asn Lys Ala Thr Lieu Val Cys Thir Ile Thr Asp 2O 25 3O Phe Tyr Pro Gly Val Val Thr Val Asp Trp Llys Val Asp Gly Thr Pro 35 4 O 45 Val Thr Glin Gly Met Glu Thir Thr Glin Pro Ser Lys Glin Ser Asn Asn SO 55 6 O Llys Tyr Met Ala Ser Ser Tyr Lieu. Thir Lieu. Thir Ala Arg Ala Trp Glu 65 70 7s 8O Arg His Ser Ser Tyr Ser Cys Glin Val Thr His Glu Gly His Thr Val 85 90 95 Glu Lys Ser Lieu. Ser Arg Ala Asp Cys Ser 1OO 105 US 8,603,478 B2 139 140 - Continued

<210s, SEQ ID NO 90 &211s LENGTH: 315 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 90 ggtcagcc.ca agt ccact co cactic to acc gtgtttic cac ct tcc totgaggagct caag 6 O gaaaacaaag C cacactggit gtgtctgatt to Caacttitt CCC cagtgg ttgacagtg 12 O gcctggalagg caaatggtac accitat cacc Cagggtgtgg acact tcaaa t cccaccalaa 18O gagggcaa.ca agttcatggC cagcagct tc Ctacatttga catcggacca gtggagatct 24 O caca acagtt ttacctgtca agttacacat gaaggggaca Ctgtggagala gag totgtct 3OO cctgcagaat gtctic 315

<210s, SEQ ID NO 91 &211s LENGTH: 105 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 91 Gly Glin Pro Llys Ser Thr Pro Thr Lieu. Thr Val Phe Pro Pro Ser Ser 1. 5 1O 15 Glu Glu Lieu Lys Glu Asn Lys Ala Thr Lieu Val Cys Lieu. Ile Ser Asn 2O 25 3O Phe Ser Pro Ser Gly Val Thr Val Ala Trp Lys Ala Asn Gly Thr Pro 35 4 O 45 Ile Thr Glin Gly Val Asp Thr Ser Asn Pro Thr Lys Glu Gly Asn Lys SO 55 6 O Phe Met Ala Ser Ser Phe Lieu. His Lieu. Thir Ser Asp Gln Trp Arg Ser 65 70 7s 8O His Asn Ser Phe Thr Cys Glin Val Thr His Glu Gly Asp Thr Val Glu 85 90 95 Llys Ser Lieu. Ser Pro Ala Glu. Cys Lieu. 1OO 105

<210s, SEQ ID NO 92 &211s LENGTH: 1335 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 92 gaggtgaagc titcticagtic tigaggtggc Ctggtgcago C9ggtggat C cctgaaactic 6 O t cct gtgcag cct caggatt cattttagt agacactgga tigagttgggit cc.ggctggct 12 O cCagggaaag ggctagaatg gatcgcagaa attaatc.cag at agcagaac gataalactat 18O acgc catc to taaaggagaa attcatcatc. tccagagaca acgc.caaaaa titcgctgttt 24 O Ctgcaaatga acagagtgag atctgaggac acagc cctitt attactgtgc alagacgggta 3OO agaatt catt act acggcgc tatggactgc tigggg.tcaag galacct cagt caccgt.ct cc 360 t cagccaaaa cqacac cc cc atctgtctat coactggc.cc ctdgatctgc tigcc.caaact 42O US 8,603,478 B2 141 142 - Continued aact coatgg taccctggg atgcctggtc. aagggctatt tocctgagcc agtgacagtg 48O acctggaact ctdgatcc ct gtc.ca.gcggt gtgcacacct tcc cagotgt cctdcagtict 54 O gacct Ctaca Ctctgagcag ct cagtgact gtc.ccct coa gcacctggcc cagcgagacc 6OO gtcacctgca acgttgcc.ca ccc.ggc.ca.gc agcaccalagg togacaagaa aattgttgcCC 660 agggattgttg gttgtaagcc ttgcatatgt acagt cc cag aagtat catc tdt citt catc 72 O titcc cc ccaa agcc.caagga tigtgct cacc attactctga citcctaaggit cacgtgttgtt 78O gtgg tagaca t cagcaagga tigatc.ccgag gtc.cagttca gctggitttgt agatgatgtg 84 O gaggtgcaca cagct Cagac gcaa.ccc.cgg gaggagcagt toaac agcac titt cogctica 9 OO gtcagtgaac titcc catcat gcaccaggac tigct caatg gcaaggagtt Caaatgcagg 96.O gtcaiacagtg cagctitt.ccc togcc.cccatc gagaaaacca tot coaaaac caaaggcaga 1 O2O ccgaaggctic cacaggtgta Caccattcca cct Coca-agg agcagatggc Caaggataaa 108 O gtcagtctga Cctgcatgat alacagactitc titcCctgaag acatt actgt ggagtggcag 114 O tggaatgggc agc.cagcgga gaact acaag aac acticago C catcatgga cacagatggc 12 OO tctt actt.cg tct acagcaa gCt caatgtg Cagaagagca actgggaggc aggaaatact 126 O ttcacctgct ctdtgttaca togagggcc tig cacaaccacc at actgagaa gag cct citcc 132O cact ct cotg gtaaa 1335

<210s, SEQ ID NO 93 &211s LENGTH: 445 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 93

Glu Val Lys Lieu. Lieu. Glu Ser Gly Gly Gly Lieu. Wall Glin Pro Gly Gly 1. 5 1O 15

Ser Luell Lys Lieu. Ser Cys Ala Ala Ser Gly Phe Asp Phe Ser Arg His 25

Trp Met Ser Trp Val Arg Lieu Ala Pro Gly Lys Gly Lell Glu Trp Ile 35 4 O 45

Ala Glu Ile Asn Pro Asp Ser Arg Thir Ile Asn Tyr Thir Pro Ser Luell SO 55 6 O

Lys Glu Phe Ile Ile Ser Arg Asp Asn Ala Asn Ser Lieu. Phe 65 70 7s 8O

Lell Glin Met Asn Arg Val Arg Ser Glu Asp Thr Ala Lell Tyr Tyr Cys 85 90 95

Ala Arg Arg Val Arg Ile His Tyr Tyr Gly Ala Met Asp Cys Trp Gly 105 11 O

Glin Gly Thir Ser Wall. Thir Wal Ser Ser Ala Lys Thir Thir Pro Pro Ser 115 12 O 125

Wall Tyr Pro Lieu Ala Pro Gly Ser Ala Ala Glin Thir Asn Ser Met Wall 13 O 135 14 O

Thir Luell Gly Cys Lieu Val Lys Gly Tyr Phe Pro Glu Pro Wall Thir Wall 145 150 155 160

Thir Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thir Phe Pro Ala 1.65 17O 17s

Wall Luell Glin Ser Asp Leu Tyr Thr Luell Ser Ser Ser Wall Thir Wall Pro 18O 185 19 O US 8,603,478 B2 143 144 - Continued Ser Ser Thir Trp Pro Ser Glu Thr Val Thr Cys Asn Wall Ala His Pro 195

Ala Ser Ser Thir Lys Val Asp Llys Lys Ile Val Pro Arg Asp Cys Gly 21 O 215 22O

Cys Pro Cys Ile Cys Thr Val Pro Glu Wall Ser Ser Wall Phe Ile 225 23 O 235 24 O

Phe Pro Pro Llys Pro Lys Asp Wall Lieu. Thir Ile Thir Lell Thir Pro Llys 245 250 255

Wall Thir Val Val Val Asp Ile Ser Lys Asp Asp Pro Glu Wall Glin 26 O 265 27 O

Phe Ser Trp Phe Val Asp Asp Wall Glu Wal His Thir Ala Glin Thr Gin 285

Pro Arg Glu Glu Glin Phe Asn. Ser Thr Phe Arg Ser Wall Ser Glu Lieu. 29 O 295 3 OO

Pro Ile Met His Glin Asp Trp Lieu. Asin Gly Lys Glu Phe 3. OS 310 315 32O

Wall Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu Thir Ile Ser Lys 3.25 330 335

Thir Gly Arg Pro Lys Ala Pro Glin Val Tyr Thir Ile Pro Pro Pro 34 O 345 35. O

Glu Glin Met Ala Lys Asp Llys Wal Ser Lieu. Thir Cys Met Ile Thr 355 360 365

Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp Glin Trp Asn Gly Glin 37 O 375

Pro Ala Glu ASn Tyr Lys Asn Thr Gln Pro Ile Met Asp Thir Asp Gly 385 390 395 4 OO

Ser Phe Val Tyr Ser Llys Lieu. Asn. Wall Glin Ser Asn Trp. Glu 4 OS 41O 415

Ala Gly Asn Thr Phe Thr Cys Ser Wall Lieu. His Glu Gly Luell His Asn 425 43 O

His His Thir Glu Lys Ser Lieu. Ser His Ser Pro Gly Lys 435 44 O 445

SEQ ID NO 94 LENGTH: 642 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 94 gacattgttgt tacccagtic toaaaaaatc. gtgtccacat Cagtaggagc Cagggit cagc 6 O gtcacctgca aggc.cagt ca gaatgttgggt tctagtttag tctggitatica acagaaacca 12 O ggtcaatcto Ctaaaa.cact gatt tact cq gcatcct tcc ggtacagtgg agt ccct gat 18O cgct tcacag gcagtggatc tgggacagat tt cact cit ca. c catcagcaa tgtgcagtict 24 O gaag acttgg cagattattt ctgtcaacaa tataataact atcc.gct cac gttcggtgct 3OO gggaccalagc tggagctgaa acgggctgat gctgcaccala citgitatic cat Ctt CC Cacca 360 tccagtgagc agittaa catc tggaggtgcc t cagt cqtgt gctitcttgaa Caact totaC cc caaagaca t caatgtcaa gtggalagatt gatggcagtg aacgacaaaa tggcgt.cctg alacagttgga Ctgat Cagga Cagcaaagac agcacct aca gcatgagcag caccct cacg 54 O ttgaccalagg acgagtatga acgacataac agctatacct gtgaggccac t cacaagaca toalactitcaic c cattgtcaa gagcttcaac aggaatgagt gt 642 US 8,603, 478 B2 145 146 - Contin lued

<210s, SEQ ID NO 95 &211s LENGTH: 214 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OO > SEQUENCE: 95 Asp Ile Val Lieu. Thr Glin Ser Gln Lys Ile Val Ser Thr Ser Val Gly 1. 5 1O 15 Ala Arg Val Ser Val Thr Cys Lys Ala Ser Glin Asn Val Gly Ser Ser 2O 25 3O Lieu Val Trp Tyr Glin Gln Lys Pro Gly Glin Ser Pro Llys Thr Lieu. Ile 35 4 O 45 Tyr Ser Ala Ser Phe Arg Tyr Ser Gly Val Pro Asp Arg Phe Thr Gly SO 55 6 O Ser Gly Ser Gly Thr Asp Phe Thr Lieu. Thir Ile Ser Asn Val Glin Ser 65 70 7s 8O Glu Asp Lieu Ala Asp Tyr Phe Cys Glin Glin Tyr Asn. Asn Tyr Pro Lieu. 85 90 95 Thir Phe Gly Ala Gly Thr Llys Lieu. Glu Lieu Lys Arg Ala Asp Ala Ala 1OO 105 11 O Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Lieu. Thir Ser Gly 115 12 O 125 Gly Ala Ser Val Val Cys Phe Lieu. ASn ASn Phe Tyr Pro Lys Asp Ile 13 O 135 14 O Asn. Wall Lys Trp Llys Ile Asp Gly Ser Glu Arg Glin Asn Gly Val Lieu 145 150 155 160 Asn Ser Trp Thr Asp Glin Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser 1.65 17O 17s Ser Thr Lieu. Thir Lieu. Thir Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr 18O 185 19 O Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro Ile Val Lys Ser 195 2OO 2O5 Phe Asn Arg Asn. Glu. Cys 21 O

<210s, SEQ ID NO 96 &211s LENGTH: 1329 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 96 gaggtgcagt tagtggagtic tiggggaggc titagtgaagc Ctggagggit C cctgaaactic 6 O t cct gtgcag cct ctdgatt cactitt cagt accitatgcca tdt cittggat t cqccagact 12 O ccggagaaga ggctggagtg ggtcgcagga at Cactaatg gtggtag titt Cacct act at 18O ccagacactg talagggacg attcaccatc. tccagagaca atgcc aggala catcctatac 24 O Ctgcaaatga gcggtctgag gtctgaggac acggc catgt attattgttgc alagacagggit 3OO tact atggtg ttaactittga c tactgggg.c caaggcacca citct cacagt citcct cago c 360 aaaacgacac ccc catctgt citat coactg gcc cc toggat citgctg.ccca aacta acticc 42O atggtgaccc tiggatgcct ggt caagggc tattt Coctg agc.ca.gtgac agtgacctgg 48O US 8,603,478 B2 147 148 - Continued aactctggat coctdtccag cqgtgtgcac acct tcc cag ctgtc.ctgca gtctgacctic 54 O tacact ctga gcagotcagt gactgtc.ccc. tcc agcacct ggcc.cagcga gaccgt.c acc 6OO tgcaacgttg cccacccggc cagcagdacc aaggtggaca agaaaattgt gcc cagggat 660 tgtggttgta agccttgcat atgtacagtic ccagaagitat catctgtc.tt catct tcc cc 72 O cCaaag.ccca aggatgtgct cac cattact Ctgactic cta agg to acgtg tttgttggta 78O gacatcagca aggatgat Co. Cagg to Cag titcagctggt ttgtagatga tigtggaggtg 84 O

Cacacagctic agacgcaa.cc ccgggaggag cagttcaa.ca gcactitt cog Ctcagticagt 9 OO gaactt CC ca t catgcacca ggactggctic aatggcaagg agttcaaatg Cagggit caac 96.O agtgcagott tocctgcc cc catcgagaaa accatct coa aaaccaaagg cagaccgaag 1 O2O gctic cacagg ttacaccat tccacct CCC aaggagcaga tiggccaagga taaagttcagt 108 O

Ctgacctgca tatalacaga Cttct tcc ct galaga catta Ctgtggagtg gcagtggaat 114 O gggcagc.cag cqgagalacta Caagaacact cagcc catca tigacacaga tiggct ctitac 12 OO titcgt.ctaca gcaa.gcticaa ttgcagaag agcaactggg aggcaggaala tactitt Cacc 126 O tgctctgtgt tacatgaggg cct gcacaac caccatactg agaagagcct citcc.cactict 132O

Cctggtaaa 1329

<210s, SEQ ID NO 97 &211s LENGTH: 443 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OO > SEQUENCE: 97

Glu Wall Glin Lieu Wall Glu Ser Gly Gly Gly Lieu. Wall Pro Gly Gly 1. 5 1O 15

Ser Luell Lys Lieu. Ser Cys Ala Ala Ser Gly Phe Thir Phe Ser Thr Tyr 25

Ala Met Ser Trp Ile Arg Glin Thr Pro Glu Lys Arg Lell Glu Trp Val 35 4 O 45

Ala Gly Ile Thr Asn Gly Gly Ser Phe Thr Tyr Tyr Pro Asp Thir Wall SO 55 6 O

Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Arg Asn Ile Leu Tyr 65 70 7s 8O

Lell Glin Met Ser Gly Lieu. Arg Ser Glu Asp Thr Ala Met Tyr Cys 85 90 95

Ala Arg Glin Gly Tyr Tyr Gly Val Asin Phe Asp Trp Gly Gln Gly 105 11 O

Thir Thir Luell Thir Wal Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr 115 12 O 125

Pro Luell Ala Pro Gly Ser Ala Ala Glin. Thir Asn Ser Met Wall Thir Lieu. 13 O 135 14 O

Gly Cys Luell Val Lys Gly Tyr Phe Pro Glu Pro Wall Thir Wall Thir Trp 145 150 155 160

Asn Ser Gly Ser Leu Ser Ser Gly Wall His Thr Phe Pro Ala Wall Lieu 1.65 17O 17s

Glin Ser Asp Leu Tyr Thr Lieu Ser Ser Ser Wall Thir Wall Pro Ser Ser 18O 185 19 O

Thir Trp Pro Ser Glu. Thir Wall. Thir Cys Asn. Wall Ala His Pro Ala Ser 195 2O5 US 8,603,478 B2 149 150 - Continued

Ser Thir Val Asp Llys Lys Ile Wall Pro Arg Asp Cys Gly Cys Llys 21 O 215 22O

Pro Ile Cys Thr Wall Pro Glu Wall Ser Ser Wall Phe Ile Phe Pro 225 23 O 235 24 O

Pro Pro Wall Lieu. Thir Ile Thr Luell Thir Pro Wall. Thir 245 250 255

Wall Wall Val Asp Ile Ser Lys Asp Asp Pro Glu Wall Glin Phe Ser 26 O 265 27 O

Trp Phe Wall Asp Asp Wall Glu Wall His Thr Ala Glin Thir Glin Pro Arg 28O 285

Glu Glu Glin Phe Asn Ser Thir Phe Arg Ser Wall Ser Glu Luell Pro Ile 29 O 295 3 OO

Met His Glin Asp Trp Lieu. Asn Gly Lys Glu Phe Arg Wall Asn 3. OS 310 315 32O

Ser Ala Ala Phe Pro Ala Pro Ile Glu Lys Thir Ile Ser Thr Lys 3.25 330 335

Gly Arg Pro Lys Ala Pro Glin Wall Tyr Thr Ile Pro Pro Pro Lys Glu 34 O 345 35. O

Glin Met Ala Llys Val Ser Lieu. Thir Met Ile Thir Asp Phe 355 360 365

Phe Pro Glu Asp Ile Thir Wall Glu Trp Glin Trp Asn Gly Glin Pro Ala 37 O 375

Glu Asn Lys Asn Thir Gin Pro Ile Met Asp Thir Asp Gly Ser Tyr 385 390 395 4 OO

Phe Wall Ser Lys Lieu. Asn. Wall Gln Lys Ser Asn Trp Glu Ala Gly 4 OS 41O 415

Asn Thir Phe Thr Cys Ser Wall Lieu. His Glu Gly Lell His Asn His His 42O 425 43 O

Thir Glu Lys Ser Luell Ser His Ser Pro Gly 435 44 O

SEO ID NO 98 LENGTH: 657 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 98 gatgctgtga tigacccaaac tocactict co ctgcctgtca gtc.ttggaga t caagcc to c 6 O atct cittgca ggtctagt ca gag ccttgaa alacagtaacg gaaac actta tittgaactgg 12 O tacctic caga alaccaggcca gtctic cacag ctic ct gatct acagggittt C caa.ccgattit 18O tctggggit Co Cagacaggitt Cagtgg tagt ggat Caggga cagattt cac actgaaaatc 24 O atcagagtgg aggctgagga tittgggactt tatttctgcc tccaagttac acatgtc.ccg 3OO cacacgttcg gaggggggac Caaactggaa ttaaaacggg Ctgatgctgc accaactgta 360 to catct tcc. cac catccag tdagcagtta a catctggag gtgccticagt cgtgtgctt C ttgaacaact tct accc.caa agacat caat gtcaagtgga agattgatgg Cagtgaacga caaaatggcg t cctgaacag ttggactgat Caggacagca alagacagcac ctacago atg 54 O agcagc accc t cacgttgac Caaggacgag tatgaacgac atalacagcta tacctgtgag gccact caca aga catcaac titcacccatt gtcaa.gagct t caac aggaa tgagtgt 657 US 8,603,478 B2 151 152 - Continued <210s, SEQ ID NO 99 &211s LENGTH: 219 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 99 Asp Ala Val Met Thr Glin Thr Pro Leu Ser Leu Pro Val Ser Leu Gly 1. 5 1O 15 Asp Glin Ala Ser Ile Ser Cys Arg Ser Ser Glin Ser Lieu. Glu Asn. Ser 2O 25 3O Asn Gly Asn Thr Tyr Lieu. Asn Trp Tyr Lieu Gln Lys Pro Gly Glin Ser 35 4 O 45 Pro Gln Leu Lieu. Ile Tyr Arg Val Ser Asn Arg Phe Ser Gly Val Pro SO 55 6 O Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Lieu Lys Ile 65 70 7s 8O Ile Arg Val Glu Ala Glu Asp Lieu. Gly Lieu. Tyr Phe Cys Lieu. Glin Val 85 90 95 Thr His Val Pro His Thr Phe Gly Gly Gly Thr Lys Lieu. Glu Lieu Lys 1OO 105 11 O Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 115 12 O 125 Gln Lieu. Thir Ser Gly Gly Ala Ser Val Val Cys Phe Lieu. Asn Asin Phe 13 O 135 14 O Tyr Pro Lys Asp Ile Asn. Wall Lys Trp Llys Ile Asp Gly Ser Glu Arg 145 150 155 160 Glin Asn Gly Val Lieu. Asn. Ser Trp Thr Asp Glin Asp Ser Lys Asp Ser 1.65 17O 17s Thr Tyr Ser Met Ser Ser Thr Lieu. Thir Lieu. Thir Lys Asp Glu Tyr Glu 18O 185 19 O Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 195 2OO 2O5 Pro Ile Val Lys Ser Phe Asn Arg Asn. Glu. Cys 21 O 215

<210s, SEQ ID NO 100 &211s LENGTH: 1344 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 1.OO gaagtgaagc tiggtggagtic ggggggaggc titagtgaagc Ctggagcgtc. tctgaaactic 6 O t cct gtgcag cct ctdgatt catttitcagt toc tatggca tdt cittggg t t cqccagact 12 O t cagacaaga ggctggagtg ggtcgctt Co attagtagtg gtggtgg tac Cacct act at 18O

Ctagacactg. taaagggc.cg attcaccatc. tccagagaga atgccaagga Caccctgtac 24 O Ctgcaaatga gtggtctgaa gtctgaagac acggccttgt attactgtac aagaggccala 3OO tggittact aa agtttgctta Ctgggggcaa gggactctgg to actgtct c tec agccaaa 360 acaa.ca.gc.cc catcggtcta t cc actggcc cctgttgttgttg gagatacaac tdgct cotcg 42O gtgactictag gatgcctggit Caagggitt at titcCctgagc cagtgacctt gacctggaac 48O tctggat.ccc tdtccagtgg togtgcacacic titcc.cagctg. tcc togcagtic tacct citac 54 O US 8,603, 478 B2 153 154 - Continued accct cagca gct cagtgac totaacct cq agcacctggc ccago cagtic cat cacctgc 6OO aatgtggc cc acccggcaag cagcaccalag gtgga caaga aaattgagcc cagagggcc C 660 acaatcaa.gc cct gtcct co atgcaaatgc cca.gcaccita acct cittggg toggaccatcc 72 O gtc.ttcatct tcc ctic caaa gat caaggat gtact catga t ct coctdag ccc catagt c 78O acatgtgtgg tdtggatgt gagcgaggat gacccagatg tccagat cag Ctggitttgtg 84 O aacaacgtgg aagtacacac agct Cagaca caaac ccata gagaggatta caa.cagtact 9 OO Ctc.cgggtgg tdagtgcc ct C cc catcCag caccaggact ggatgagtgg Caaggagttc 96.O aaatgcaagg toaacaacaa agacct coca gcgcc catcg agagaac cat citcaaaaccc 1 O2O aaagggit cag taagagct Co acaggtatat gtc.ttgcctic caccagaaga agagatgact 108 O aagaaacagg to actctgac Ctgcatggtc. acagact tca to ctgaaga catttacgtg 114 O gagtggacca acaacgggala aacagagcta alactacaaga acactgaac C agt cctggac 12 OO tctgatggitt Ctt actt cat gtacagdaag Ctgagagtgg aaaagaagala Ctgggtggaa 126 O agaaat agct act cotgttc agtggtccac gagggtctgc acaat cacca cacgactaag 132O agcttctic cc ggactic.cggg taala 1344

<210s, SEQ ID NO 101 &211s LENGTH: 448 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 101 Glu Val Lys Lieu Val Glu Ser Gly Gly Gly Lieu. Val Lys Pro Gly Ala 1. 5 1O 15

Ser Luell Llys Lieu. Ser Cys Ala Ala Ser Gly Phe Ile Phe Ser Ser Tyr 25 3O

Gly Met Ser Trp Val Arg Glin Thr Ser Asp Llys Arg Lieu. Glu Trp Val 35 4 O 45

Ala Ser Ile Ser Ser Gly Gly Gly Thir Thr Tyr Tyr Lieu. Asp Thir Wall SO 55 6 O

Lys Gly Arg Phe Thir Ile Ser Arg Glu Asn Ala Lys Asp Thr Leu Tyr 65 70 7s 8O

Lell Glin Met Ser Gly Lieu Lys Ser Glu Asp Thr Ala Lieu. Tyr Tyr Cys 85 90 95

Thir Arg Gly Glin Trp Lieu Lleu Lys Phe Ala Tyr Trp Gly Glin Gly Thr 105 11 O

Lell Wall Thr Val Ser Ala Ala Lys Thir Thir Ala Pro Ser Wall Tyr Pro 115 12 O 125

Lell Ala Pro Val Cys Gly Asp Thr Thr Gly Ser Ser Wall. Thir Lieu. Gly 13 O 135 14 O

Cys Luell Val Lys Gly Tyr Phe Pro Glu Pro Wall Thir Lieu. Thir Trp Asn 145 150 155 160

Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Wall Lieu. Glin 1.65 17O 17s

Ser Asp Leu Tyr Thr Lieu Ser Ser Ser Wall. Thir Wall. Thir Ser Ser Thr 18O 185 19 O

Trp Pro Ser Glin Ser Ile Thr Cys Asn. Wall Ala His Pro Ala Ser Ser 195 2O5

Thir Val Asp Llys Lys Ile Glu Pro Arg Gly Pro Thir Ile Llys Pro US 8,603,478 B2 155 156 - Continued

21 O 215 22O

Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn. Luell Lell Gly Gly Pro Ser 225 23 O 235 24 O

Wall Phe Ile Phe Pro Pro Lys Ile Lys Asp Wall Lell Met Ile Ser Luell 245 250 255

Ser Pro Ile Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro 26 O 265 27 O

Asp Wall Glin Ile Ser Trp Phe Val Asn Asn. Wall Glu Wall His Thir Ala 27s 285

Glin Thir Glin Thir His Arg Glu Asp Tyr Asn Ser Thir Lell Arg Wall Wall 29 O 295 3 OO

Ser Ala Luell Pro Ile Glin His Glin Asp Trp Met Ser Gly Glu Phe 3. OS 310 315 32O

Val Asn. Asn Lys Asp Lieu Pro Ala Pro Ile Glu Arg Thr 3.25 330 335

Ile Ser Pro Lys Gly Ser Val Arg Ala Pro Glin Wall Tyr Wall Lieu 34 O 345 35. O

Pro Pro Pro Glu Glu Glu Met Thr Llys Lys Glin Wall Thir Luell Thr Cys 355 360 365

Met Wall Thir Asp Phe Met Pro Glu Asp Ile Tyr Wall Glu Trp Thir Asn 37 O 375

Asn Gly Thr Glu Lieu. Asn Tyr Lys Asn Thr Glu Pro Wall Lieu. Asp 385 390 395 4 OO

Ser Asp Gly Ser Tyr Phe Met Tyr Ser Lys Lieu. Arg Wall Glu Llys Llys 4 OS 41O 415

Asn Trp Wall Glu Arg Asn. Ser Tyr Ser Cys Ser Wall Wall His Glu Gly 425 43 O

Lell His Asn His His Thr Thr Lys Ser Phe Ser Arg Thir Pro Gly Lys 435 44 O 445

SEQ ID NO 102 LENGTH: 660 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 102 caacttgtgc ticacticagtic atc.tt cagcc tottt ct coc tgggagcct c agcaaaactic 6 O acgtgcacct tgagtagt ca gcacactacg tacac cattg aatggitatica gcaactgc.ca 12 O citcaa.gc.ctic ctaagtatgt gatggagctt aagaaagatg gaa.gc.cacag Cacaggtgtt 18O gggatt CCtg atcgcttctic tggat.ccagc tctggtgctg atcgctacct tact catt to c 24 O aacatc.ca.gc Ctgaagatga agcaatatac atctgtggtg tgggtgagac aattgaggac 3OO caatttgttgt atgtttitcgg cggtggcacc alaggt cactg tcc tagg to a gcc caagt cc 360 actic coactic t caccgtgtt t coacct tcc. tctgaggagc t caaggaaaa caaagccaca Ctggtgttgtc. tgattt coaa cittitt coccg agtggtgttga Cagtggcctg gaaggcaaat ggtacaccita t cacccaggg tgtggacact toaaatcCCa cCaaagaggg caacaagttc 54 O atggc.ca.gca gct tcc taca tittgacat cq gaccagtgga gat ct cacaa cagttitt acc tgtcaagtta Cacatgaagg gga cactgtg gagaa.gagtic tgtct cotgc agaatgtctic 660

<210s, SEQ ID NO 103 &211s LENGTH: 220 US 8,603,478 B2 157 158 - Continued

212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 103 Gln Leu Val Lieu. Thr Glin Ser Ser Ser Ala Ser Phe Ser Lieu. Gly Ala 1. 5 1O 15 Ser Ala Lys Lieu. Thr Cys Thr Lieu Ser Ser Gln His Thr Thr Tyr Thr 2O 25 3O Ile Glu Trp Tyr Glin Gln Leu Pro Leu Lys Pro Pro Llys Tyr Val Met 35 4 O 45 Glu Lieu Lys Lys Asp Gly Ser His Ser Thr Gly Val Gly Ile Pro Asp SO 55 6 O Arg Phe Ser Gly Ser Ser Ser Gly Ala Asp Arg Tyr Lieu. Thir Ile Ser 65 70 7s 8O Asn. Ile Glin Pro Glu Asp Glu Ala Ile Tyr Ile Cys Gly Val Gly Glu 85 90 95 Thir Ile Glu Asp Glin Phe Val Tyr Val Phe Gly Gly Gly Thr Llys Val 1OO 105 11 O Thr Val Lieu. Gly Glin Pro Llys Ser Thr Pro Thr Lieu. Thr Val Phe Pro 115 12 O 125 Pro Ser Ser Glu Glu Lieu Lys Glu Asn Lys Ala Thr Lieu Val Cys Lieu. 13 O 135 14 O Ile Ser Asn Phe Ser Pro Ser Gly Val Thr Val Ala Trp Lys Ala Asn 145 150 155 160 Gly Thr Pro Ile Thr Glin Gly Val Asp Thr Ser Asn Pro Thr Lys Glu 1.65 17O 17s Gly Asn Llys Phe Met Ala Ser Ser Phe Lieu. His Lieu. Thir Ser Asp Glin 18O 185 19 O Trp Arg Ser His Asn Ser Phe Thr Cys Glin Val Thr His Glu Gly Asp 195 2OO 2O5 Thr Val Glu Lys Ser Lieu. Ser Pro Ala Glu. Cys Lieu. 21 O 215 22O

<210s, SEQ ID NO 104 &211s LENGTH: 132O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 104 gaggtgcagc titcaggagtic aggacctago Ctcgtgaaac Cttct Cagac totgtcc ct c 6 O acctgttatgtcactgg.cga ctic catcacc agtgattact ggaattggat coggaaattic 12 O c caggaaata aacttgagta catgggatat at cagotaca gtgg tag cac titact acaat 18O c catct ct ca aaagttctgaat ct c catcact cqagacacat ccaagaacca gttctacctt 24 O cggttgaatt ctdtgactac tdaggacaca gccacatatt actgtgcaag aaccolatata 3OO Cttacgattg Ctt actgggg cca agggact Ctggt cactg. it ct ctgcagc caaaacgaca 360 cc cc catctg. tctato cact ggc.ccctgga tictogctg.ccc aaactaactic catggtgacc 42O Ctgggatgcc tigtcaaggg ctattitcc ct gagcc agtga cagtgacct g gaact ctgga 48O t ccctgtcca gcggtgtgca cacct tcc.ca gctgtcc tigc agtctgacct ctacact citg 54 O agcagcticag tactgtc.cc ctic cagdacc tigcc.ca.gcg aga.ccgt cac Ctgcaacgtt 6OO