Compiler Construction
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Buffered Shift-Reduce Parsing*
BUFFERED SHIFT-REDUCE PARSING* Bing Swen (Sun Bin) Dept. of Computer Science, Peking University, Beijing 100871, China [email protected] Abstract A parsing method called buffered shift-reduce parsing is presented, which adds an intermediate buffer (queue) to the usual LR parser. The buffer’s usage is analogous to that of the wait-and-see parsing, but it has unlimited buffer length, and may serve as a separate reduction (pruning) stack. The general structure of its parser and some features of its grammars and parsing tables are discussed. 1. Introduction It is well known that the LR parsing is hitherto the most general shift-reduce method of bottom-up parsing [1], and is among the most widely used. For example, almost all compilers of mainstream programming languages employ the LR-like parsing (via an LALR(1) compiler generator such as YACC or GNU Bison [2]), and many NLP systems use a generalized version of LR parsing (GLR, also called the Tomita algorithm [3]). In some earlier research work on LR(k) extensions for NLP [4] and generalization of compiler generator [5], an idea naturally occurred that one can make a modification to the LR parsing so that after each reduction, the resulting symbol may not be necessarily pushed onto the analysis stack, but instead put back into the input, waiting for decisions in the following steps. This strategy postpones the time of some reduction actions in traditional LR parser, partly deviating from leftmost pruning (Leftmost Reduction). This may cause performance loss for some grammars, with the gained opportunities of earlier error detecting and avoidance of false reductions, as well as later handling of ambiguities, which is significant for the processing of highly ambiguous input strings like natural language sentences. -
Efficient Computation of LALR(1) Look-Ahead Sets
Efficient Computation of LALR(1) Look-Ahead Sets FRANK DeREMER and THOMAS PENNELLO University of California, Santa Cruz, and MetaWare TM Incorporated Two relations that capture the essential structure of the problem of computing LALR(1) look-ahead sets are defined, and an efficient algorithm is presented to compute the sets in time linear in the size of the relations. In particular, for a PASCAL grammar, the algorithm performs fewer than 15 percent of the set unions performed by the popular compiler-compiler YACC. When a grammar is not LALR(1), the relations, represented explicitly, provide for printing user- oriented error messages that specifically indicate how the look-ahead problem arose. In addition, certain loops in the digraphs induced by these relations indicate that the grammar is not LR(k) for any k. Finally, an oft-discovered and used but incorrect look-ahead set algorithm is similarly based on two other relations defined for the fwst time here. The formal presentation of this algorithm should help prevent its rediscovery. Categories and Subject Descriptors: D.3.1 [Programming Languages]: Formal Definitions and Theory--syntax; D.3.4 [Programming Languages]: Processors--translator writing systems and compiler generators; F.4.2 [Mathematical Logic and Formal Languages]: Grammars and Other Rewriting Systems--parsing General Terms: Algorithms, Languages, Theory Additional Key Words and Phrases: Context-free grammar, Backus-Naur form, strongly connected component, LALR(1), LR(k), grammar debugging, 1. INTRODUCTION Since the invention of LALR(1) grammars by DeRemer [9], LALR grammar analysis and parsing techniques have been popular as a component of translator writing systems and compiler-compilers. -
Backtrack Parsing Context-Free Grammar Context-Free Grammar
Context-free Grammar Problems with Regular Context-free Grammar Language and Is English a regular language? Bad question! We do not even know what English is! Two eggs and bacon make(s) a big breakfast Backtrack Parsing Can you slide me the salt? He didn't ought to do that But—No! Martin Kay I put the wine you brought in the fridge I put the wine you brought for Sandy in the fridge Should we bring the wine you put in the fridge out Stanford University now? and University of the Saarland You said you thought nobody had the right to claim that they were above the law Martin Kay Context-free Grammar 1 Martin Kay Context-free Grammar 2 Problems with Regular Problems with Regular Language Language You said you thought nobody had the right to claim [You said you thought [nobody had the right [to claim that they were above the law that [they were above the law]]]] Martin Kay Context-free Grammar 3 Martin Kay Context-free Grammar 4 Problems with Regular Context-free Grammar Language Nonterminal symbols ~ grammatical categories Is English mophology a regular language? Bad question! We do not even know what English Terminal Symbols ~ words morphology is! They sell collectables of all sorts Productions ~ (unordered) (rewriting) rules This concerns unredecontaminatability Distinguished Symbol This really is an untiable knot. But—Probably! (Not sure about Swahili, though) Not all that important • Terminals and nonterminals are disjoint • Distinguished symbol Martin Kay Context-free Grammar 5 Martin Kay Context-free Grammar 6 Context-free Grammar Context-free -
Adaptive LL(*) Parsing: the Power of Dynamic Analysis
Adaptive LL(*) Parsing: The Power of Dynamic Analysis Terence Parr Sam Harwell Kathleen Fisher University of San Francisco University of Texas at Austin Tufts University [email protected] [email protected] kfi[email protected] Abstract PEGs are unambiguous by definition but have a quirk where Despite the advances made by modern parsing strategies such rule A ! a j ab (meaning “A matches either a or ab”) can never as PEG, LL(*), GLR, and GLL, parsing is not a solved prob- match ab since PEGs choose the first alternative that matches lem. Existing approaches suffer from a number of weaknesses, a prefix of the remaining input. Nested backtracking makes de- including difficulties supporting side-effecting embedded ac- bugging PEGs difficult. tions, slow and/or unpredictable performance, and counter- Second, side-effecting programmer-supplied actions (muta- intuitive matching strategies. This paper introduces the ALL(*) tors) like print statements should be avoided in any strategy that parsing strategy that combines the simplicity, efficiency, and continuously speculates (PEG) or supports multiple interpreta- predictability of conventional top-down LL(k) parsers with the tions of the input (GLL and GLR) because such actions may power of a GLR-like mechanism to make parsing decisions. never really take place [17]. (Though DParser [24] supports The critical innovation is to move grammar analysis to parse- “final” actions when the programmer is certain a reduction is time, which lets ALL(*) handle any non-left-recursive context- part of an unambiguous final parse.) Without side effects, ac- free grammar. ALL(*) is O(n4) in theory but consistently per- tions must buffer data for all interpretations in immutable data forms linearly on grammars used in practice, outperforming structures or provide undo actions. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Lexing and Parsing with ANTLR4
Lab 2 Lexing and Parsing with ANTLR4 Objective • Understand the software architecture of ANTLR4. • Be able to write simple grammars and correct grammar issues in ANTLR4. EXERCISE #1 Lab preparation Ï In the cap-labs directory: git pull will provide you all the necessary files for this lab in TP02. You also have to install ANTLR4. 2.1 User install for ANTLR4 and ANTLR4 Python runtime User installation steps: mkdir ~/lib cd ~/lib wget http://www.antlr.org/download/antlr-4.7-complete.jar pip3 install antlr4-python3-runtime --user Then in your .bashrc: export CLASSPATH=".:$HOME/lib/antlr-4.7-complete.jar:$CLASSPATH" export ANTLR4="java -jar $HOME/lib/antlr-4.7-complete.jar" alias antlr4="java -jar $HOME/lib/antlr-4.7-complete.jar" alias grun='java org.antlr.v4.gui.TestRig' Then source your .bashrc: source ~/.bashrc 2.2 Structure of a .g4 file and compilation Links to a bit of ANTLR4 syntax : • Lexical rules (extended regular expressions): https://github.com/antlr/antlr4/blob/4.7/doc/ lexer-rules.md • Parser rules (grammars) https://github.com/antlr/antlr4/blob/4.7/doc/parser-rules.md The compilation of a given .g4 (for the PYTHON back-end) is done by the following command line: java -jar ~/lib/antlr-4.7-complete.jar -Dlanguage=Python3 filename.g4 or if you modified your .bashrc properly: antlr4 -Dlanguage=Python3 filename.g4 2.3 Simple examples with ANTLR4 EXERCISE #2 Demo files Ï Work your way through the five examples in the directory demo_files: Aurore Alcolei, Laure Gonnord, Valentin Lorentz. 1/4 ENS de Lyon, Département Informatique, M1 CAP Lab #2 – Automne 2017 ex1 with ANTLR4 + Java : A very simple lexical analysis1 for simple arithmetic expressions of the form x+3. -
LLLR Parsing: a Combination of LL and LR Parsing
LLLR Parsing: a Combination of LL and LR Parsing Boštjan Slivnik University of Ljubljana, Faculty of Computer and Information Science, Ljubljana, Slovenia [email protected] Abstract A new parsing method called LLLR parsing is defined and a method for producing LLLR parsers is described. An LLLR parser uses an LL parser as its backbone and parses as much of its input string using LL parsing as possible. To resolve LL conflicts it triggers small embedded LR parsers. An embedded LR parser starts parsing the remaining input and once the LL conflict is resolved, the LR parser produces the left parse of the substring it has just parsed and passes the control back to the backbone LL parser. The LLLR(k) parser can be constructed for any LR(k) grammar. It produces the left parse of the input string without any backtracking and, if used for a syntax-directed translation, it evaluates semantic actions using the top-down strategy just like the canonical LL(k) parser. An LLLR(k) parser is appropriate for grammars where the LL(k) conflicting nonterminals either appear relatively close to the bottom of the derivation trees or produce short substrings. In such cases an LLLR parser can perform a significantly better error recovery than an LR parser since the most part of the input string is parsed with the backbone LL parser. LLLR parsing is similar to LL(∗) parsing except that it (a) uses LR(k) parsers instead of finite automata to resolve the LL(k) conflicts and (b) does not perform any backtracking. -
Parser Generation Bottom-Up Parsing LR Parsing Constructing LR Parser
CS421 COMPILERS AND INTERPRETERS CS421 COMPILERS AND INTERPRETERS Parser Generation Bottom-Up Parsing • Main Problem: given a grammar G, how to build a top-down parser or • Construct parse tree “bottom-up” --- from leaves to the root a bottom-up parser for it ? • Bottom-up parsing always constructs right-most derivation • parser : a program that, given a sentence, reconstructs a derivation for • Important parsing algorithms: shift-reduce, LR parsing that sentence ---- if done sucessfully, it “recognize” the sentence • LR parser components: input, stack (strings of grammar symbols and • all parsers read their input left-to-right, but construct parse tree states), driver routine, parsing tables. differently. input: a1 a2 a3 a4 ......an $ • bottom-up parsers --- construct the tree from leaves to root stack s shift-reduce, LR, SLR, LALR, operator precedence m LR Parsing output Xm • top-down parsers --- construct the tree from root to leaves .... s1 recursive descent, predictive parsing, LL(1) X1 parsing s0 Copyright 1994 - 2000 Carsten Schürmann, Zhong Shao, Yale University Parser Generation: Page 1 of 28 Copyright 1994 - 2000 Carsten Schürmann, Zhong Shao, Yale University Parser Generation: Page 2 of 28 CS421 COMPILERS AND INTERPRETERS CS421 COMPILERS AND INTERPRETERS LR Parsing Constructing LR Parser How to construct the parsing table and ? • A sequence of new state symbols s0,s1,s2,..., sm ----- each state ACTION GOTO sumarize the information contained in the stack below it. • basic idea: first construct DFA to recognize handles, then use DFA to construct the parsing tables ! different parsing table yield different LR • Parsing configurations: (stack, remaining input) written as parsers SLR(1), LR(1), or LALR(1) (s0X1s1X2s2...Xmsm , aiai+1ai+2...an$) • augmented grammar for context-free grammar G = G(T,N,P,S) is next “move” is determined by sm and ai defined as G’ = G’(T,N ??{ S’}, P ??{ S’ -> S}, S’) ------ adding non- • Parsing tables: ACTION[s,a] and GOTO[s,X] terminal S’ and the production S’ -> S, and S’ is the new start symbol. -
Compiler Design
CCOOMMPPIILLEERR DDEESSIIGGNN -- PPAARRSSEERR http://www.tutorialspoint.com/compiler_design/compiler_design_parser.htm Copyright © tutorialspoint.com In the previous chapter, we understood the basic concepts involved in parsing. In this chapter, we will learn the various types of parser construction methods available. Parsing can be defined as top-down or bottom-up based on how the parse-tree is constructed. Top-Down Parsing We have learnt in the last chapter that the top-down parsing technique parses the input, and starts constructing a parse tree from the root node gradually moving down to the leaf nodes. The types of top-down parsing are depicted below: Recursive Descent Parsing Recursive descent is a top-down parsing technique that constructs the parse tree from the top and the input is read from left to right. It uses procedures for every terminal and non-terminal entity. This parsing technique recursively parses the input to make a parse tree, which may or may not require back-tracking. But the grammar associated with it ifnotleftfactored cannot avoid back- tracking. A form of recursive-descent parsing that does not require any back-tracking is known as predictive parsing. This parsing technique is regarded recursive as it uses context-free grammar which is recursive in nature. Back-tracking Top- down parsers start from the root node startsymbol and match the input string against the production rules to replace them ifmatched. To understand this, take the following example of CFG: S → rXd | rZd X → oa | ea Z → ai For an input string: read, a top-down parser, will behave like this: It will start with S from the production rules and will match its yield to the left-most letter of the input, i.e. -
A Simple, Possibly Correct LR Parser for C11 Jacques-Henri Jourdan, François Pottier
A Simple, Possibly Correct LR Parser for C11 Jacques-Henri Jourdan, François Pottier To cite this version: Jacques-Henri Jourdan, François Pottier. A Simple, Possibly Correct LR Parser for C11. ACM Transactions on Programming Languages and Systems (TOPLAS), ACM, 2017, 39 (4), pp.1 - 36. 10.1145/3064848. hal-01633123 HAL Id: hal-01633123 https://hal.archives-ouvertes.fr/hal-01633123 Submitted on 11 Nov 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 14 A simple, possibly correct LR parser for C11 Jacques-Henri Jourdan, Inria Paris, MPI-SWS François Pottier, Inria Paris The syntax of the C programming language is described in the C11 standard by an ambiguous context-free grammar, accompanied with English prose that describes the concept of “scope” and indicates how certain ambiguous code fragments should be interpreted. Based on these elements, the problem of implementing a compliant C11 parser is not entirely trivial. We review the main sources of difficulty and describe a relatively simple solution to the problem. Our solution employs the well-known technique of combining an LALR(1) parser with a “lexical feedback” mechanism. It draws on folklore knowledge and adds several original as- pects, including: a twist on lexical feedback that allows a smooth interaction with lookahead; a simplified and powerful treatment of scopes; and a few amendments in the grammar. -
CLR(1) and LALR(1) Parsers
CLR(1) and LALR(1) Parsers C.Naga Raju B.Tech(CSE),M.Tech(CSE),PhD(CSE),MIEEE,MCSI,MISTE Professor Department of CSE YSR Engineering College of YVU Proddatur 6/21/2020 Prof.C.NagaRaju YSREC of YVU 9949218570 Contents • Limitations of SLR(1) Parser • Introduction to CLR(1) Parser • Animated example • Limitation of CLR(1) • LALR(1) Parser Animated example • GATE Problems and Solutions Prof.C.NagaRaju YSREC of YVU 9949218570 Drawbacks of SLR(1) ❖ The SLR Parser discussed in the earlier class has certain flaws. ❖ 1.On single input, State may be included a Final Item and a Non- Final Item. This may result in a Shift-Reduce Conflict . ❖ 2.A State may be included Two Different Final Items. This might result in a Reduce-Reduce Conflict Prof.C.NagaRaju YSREC of YVU 6/21/2020 9949218570 ❖ 3.SLR(1) Parser reduces only when the next token is in Follow of the left-hand side of the production. ❖ 4.SLR(1) can reduce shift-reduce conflicts but not reduce-reduce conflicts ❖ These two conflicts are reduced by CLR(1) Parser by keeping track of lookahead information in the states of the parser. ❖ This is also called as LR(1) grammar Prof.C.NagaRaju YSREC of YVU 6/21/2020 9949218570 CLR(1) Parser ❖ LR(1) Parser greatly increases the strength of the parser, but also the size of its parse tables. ❖ The LR(1) techniques does not rely on FOLLOW sets, but it keeps the Specific Look-ahead with each item. Prof.C.NagaRaju YSREC of YVU 6/21/2020 9949218570 CLR(1) Parser ❖ LR(1) Parsing configurations have the general form: A –> X1...Xi • Xi+1...Xj , a ❖ The Look Ahead -
7.2 Finite State Machines Finite State Machines Are Another Way to Specify the Syntax of a Sentence in a Lan- Guage
32397_CH07_331_388.qxd 1/14/09 5:01 PM Page 346 346 Chapter 7 Language Translation Principles Context Sensitivity of C++ It appears from Figure 7.8 that the C++ language is context-free. Every production rule has only a single nonterminal on the left side. This is in contrast to a context- sensitive grammar, which can have more than a single nonterminal on the left, as in Figure 7.3. Appearances are deceiving. Even though the grammar for this subset of C++, as well as the full standard C++ language, is context-free, the language itself has some context-sensitive aspects. Consider the grammar in Figure 7.3. How do its rules of production guarantee that the number of c’s at the end of a string must equal the number of a’s at the beginning of the string? Rules 1 and 2 guarantee that for each a generated, exactly one C will be generated. Rule 3 lets the C commute to the right of B. Finally, Rule 5 lets you substitute c for C in the context of having a b to the left of C. The lan- guage could not be specified by a context-free grammar because it needs Rules 3 and 5 to get the C’s to the end of the string. There are context-sensitive aspects of the C++ language that Figure 7.8 does not specify. For example, the definition of <parameter-list> allows any number of formal parameters, and the definition of <argument-expression-list> allows any number of actual parameters.