Characterization and Evaluation of Androgen-Binding Protein, Sex Hormone-Binding Globulin, and Thyroxine- Binding Globulin in the Horse

Home , Bovine serum albumin, SAT2, Transthyretin

University of Kentucky UKnowledge

Theses and Dissertations--Veterinary Science Veterinary Science

2018

CHARACTERIZATION AND EVALUATION OF ANDROGEN-BINDING PROTEIN, SEX HORMONE-BINDING GLOBULIN, AND THYROXINE- BINDING GLOBULIN IN THE HORSE

Blaire O'Neil Fleming University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/etd.2018.353

Right click to open a feedback form in a new tab to let us know how this document benefits ou.y

Recommended Citation Fleming, Blaire O'Neil, "CHARACTERIZATION AND EVALUATION OF ANDROGEN-BINDING PROTEIN, SEX HORMONE-BINDING GLOBULIN, AND THYROXINE-BINDING GLOBULIN IN THE HORSE" (2018). Theses and Dissertations--Veterinary Science. 37. https://uknowledge.uky.edu/gluck_etds/37

This Master's Thesis is brought to you for free and open access by the Veterinary Science at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Veterinary Science by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT:

I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File.

I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.

I retain all other ownership rights to the copyright of my work. I also retain the right to use in future works (such as articles or books) all or part of my work. I understand that I am free to register the copyright to my work.

REVIEW, APPROVAL AND ACCEPTANCE

The document mentioned above has been reviewed and accepted by the student’s advisor, on behalf of the advisory committee, and by the Director of Graduate Studies (DGS), on behalf of the program; we verify that this is the final, approved version of the student’s thesis including all changes required by the advisory committee. The undersigned agree to abide by the statements above.

Blaire O'Neil Fleming, Student

Dr. Alejandro Esteller-Vico, Major Professor

Dr. Daniel K. Howe, Director of Graduate Studies CHARACTERIZATION AND EVALUATION OF ANDROGEN-BINDING

PROTEIN, SEX HORMONE-BINDING GLOBULIN, AND THYROXINE-BINDING

GLOBULIN IN THE HORSE

______

THESIS ______

A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in the College of Agriculture, Food and Environment at the University of Kentucky

By:

Blaire O’Neil Fleming

Lexington, Kentucky

Director: Alejandro Esteller-Vico, DVM, Ph.D

Lexington, Kentucky

CHARACTERIZATION AND EVALUATION OF

ANDROGEN-BINDING PROTEIN, SEX HORMONE-BINDING GLOBULIN,

AND THYROXINE-BINDING GLOBULIN

IN THE HORSE

The objectives of this study are to characterize two carrier proteins in the horse that significantly decrease in humans following anabolic androgenic steroid administration: sex hormone-binding globulin (SHBG) and thyroxine-binding globulin (TBG). For SHBG characterization, qPCR, RNA sequencing, and immunohistochemistry were performed on testes and equine livers. Free and total testosterone immunoassays were utilized to confirm the presence of a carrier protein in equine circulation. SHBG was detected in the testes using qPCR, RNA sequencing, and IHC, indicating the presence of the isoform androgen-binding protein (ABP). SHBG was not detected in any liver samples. Evidence of a carrier protein was shown by free testosterone being significantly lower than the total testosterone that was detected in stallions (p<0.0001) and pregnant mares (p<0.0001). TBG characterization was completed using an equine specific TBG ELISA. Equine serum was analyzed across seasons, reproductive statuses, sexes, and ages. TBG concentrations were also measured following anabolic steroid administration (Stanozolol) and increased endogenous androgen production via hCG administration in stallions and aromatase inhibition via Letrozole administration in pregnant mares. TBG did not significantly differ across season, reproductive status, sex, or age Alterations of androgen concentrations did not result in any significant changes to circulating TBG concentrations.

KEYWORDS: Anabolic, Biomarker, Sex Hormone-Binding Globulin, Thyroxine-

Binding Globulin, Horse

Blaire O’Neil Fleming

8-11-2018 CHARACTERIZATION AND EVALUATION OF ANDROGEN-BINDING PROTEIN,

SEX HORMONE-BINDING GLOBULIN, AND THYROXINE-BINDING GLOBULIN

IN THE HORSE

Blaire O’Neil Fleming

Dr. Alejandro Esteller-Vico Director of Thesis

Dr. Daniel K. Howe Director of Graduate Studies

8-11-2018

I would like to dedicate this thesis to my family and my fiancé, for always believing in

the scientist inside me. Mom, Dad, and Sissy; from the incessant questions of a child to the investigations of scholar, you have encouraged my passion and curiosity and helped

to guide me to the path I am on today.

DJ, you took a leap of faith by helping me follow my dreams. Without you, the

completion of this thesis would not have been possible.

ACKNOWLEDGEMENTS

The following thesis, while an individual work, would not have been possible without the insight and support from so many people. First, I must thank Dr. Alejandro

Esteller-Vico (Alex), my Thesis Chair and primary advisor. We worked together past many bumps in the road to complete a body of research that I am quite proud of. His assistance with this entire process has been invaluable. Alex has taught me so much in the realm of academia, as well as in life in general. He and this entire experience have made a lasting impact that have changed me as a scientist, for the better.

Next, I must thank Dr. Barry Ball for challenging me to be the most informed scientist that I can be. His guidance has caused me to become much more of an investigative researcher by looking into every possible area surrounding the topic at hand.

Being a part of his equine reproduction laboratory at the Maxwell H. Gluck Equine

Research Center has been an absolute privilege and I am honored to have had the opportunity to work with him. I must also thank Dr. Tom Curry for being a part of my thesis committee. Dr. Curry jumped on board at an interesting point during the completion of my degree and his insight from the human side of reproduction was very much appreciated. Of course, none of this would have been possible without the financial support provided by the Albert G. Clay Endowment, Shapiro Endowment, and Kentucky

Equine Drug Research Council. I thank these funding sources for the opportunity to be able to pursue this degree.

In addition to my committee and funding sources, the completion of this thesis would not have been possible without my friends and family. I have to thank my reproduction laboratory for assisting me in every step of this thesis. From teaching me

iii

new laboratory techniques to laughs during lunch, these amazing people made this

process an absolute joy. Dr. Kirsten Scoggin, your patience is everlasting and you never

once hesitated to answer the absurd amount of questions that I was able to come up with

over the past 3 years. Our entire lab owes our functionality and technique knowledge to

you. Dr. Yatta Boakari, you became my other half. We both always seemed to being

going through the same struggles at the same time and we made it through together. Your

friendship will continue to be precious to me. Dr. Shavahn Loux, you were beyond

helpful not only in interpreting RNA sequencing data, but also in being a sounding board

for any concerns I may have had. Michelle Wynn, you were a wonderful source of knowledge and friendship inside and outside of the lab. Dr. Mariano Carossino, you went out of your way to guide me through immunohistochemistry, no matter the day of the week. Dr. Hossam El-Sheikh Ali, you are probably the kindest person I have ever met.

You were always ready with words of encouragement and a smile. Dr. Pouya Dini, you would never allow me to present an idea without asking the hard questions. This made me a better presenter and researcher and for that, I thank you. Dr. Carleigh Fedorka, you became my big sister in science over the years. You were a wonderful friend and teacher, whether it be on the farm, in the lab, or in life. I started this journey with new colleagues and am leaving my Master’s degree with family. I am so thankful to have had the opportunity to meet every single one of you.

Now, it is time to thank the family that the good Lord gave me. To my parents,

Margaret and George Fleming, thank you for always pushing me to strive for the best.

You encouraged me to follow a scientific path from a young age and it grew into a passion that has taken me on some unexpected roads. I would not be where I am today if

iv you both had not instilled the importance of knowledge in me. To my papa, Tim O’Neil, thank you for always telling me to dream the impossible dream and fight the unbeatable foe. I am proud to say that I conquered my Master’s with your words of wisdom always present in my heart and mind. To my sister, Lauren (aka Sissy), having you in Lexington,

KY with me during my graduate career was an honest blessing. You were always there when I needed some sister time and support. I am not even sure how many times you just sat there to listen as I vented about this or that. Whether or not you understood what I was talking about, you never made me feel that I couldn’t tell you about it. Thank you for being present and for the threats of a sissy looking out for her little sister. To my fiancé,

DJ Arney, I don’t think I can put into words how much your support has meant to me.

Without questioning it once, you left everything you knew in Mississippi to help me follow my dreams in academia. You were there for the excitement and the tears that came along as part of this rollercoaster called graduate school. Thank you for loving me through it all and still deciding that you want to spend the rest of your life with me. These past 3 years were rewarding and quite challenging at times. The love and support of my family through it all has meant the world to me and I will be forever grateful.

To every person mentioned above, thank you for the support and guidance that lead to the body of work presented hereafter. You all have made a lasting impact on me and have helped to create memories that I will cherish for the rest of my life.

Table of Contents

Acknowledgements iii List of Tables viii List of Figures ix Chapter One: Introduction and Objectives 1 Chapter Two: Review of the literature 2 Anabolic Steroids 2 Sex Hormone-Binding Globulin 5 Androgen-Binding Protein 8 Thyroxine-Binding Globulin 9 Chapter 3: Expression and characterization of androgen-binding protein and sex hormone-binding globulin in the horse 13 Note 13 Abstract 13 Introduction 14 Materials and Methods 18 Animal Use and Tissue Collection 18 Experiments 1 & 2 18 Experiment 3 18 qPCR 19 RNA Sequencing 20 Immunohistochemistry 20 Testosterone Analysis 21 Total Testosterone Analysis 21 Heterologous SHBG Immunoassays 23 Statistical Analysis 23 Results 24 Experiment 1 24 Experiment 2 24 Experiment 3 24 Discussion 25 Figures 29 Chapter 4: Characterization of thyroxine-binding globulin in the horse and evaluation of circulating levels in response to increased androgen concentrations 34 Abstract 34 Introduction 35 Materials and Methods 38 Experiment 1: Characterization in circulation 38 Serum Collection 38 Experiment 2.1: Stanozolol Administration 38 Experiment 2.2: hCG Administration 39 Experiment 2.3: Letrozole Administration 39 TBG ELISA 40

Results 40 Experiment 1 40 Experiment 2 41 Discussion 41 Figures 47 Chapter 5: Summary and Conclusion 55 Appendices: 58 Appendix A: Sex hormone-binding globulin purification attempts 58 Introduction 58 Materials and Methods 58 Serum Samples 58 Ultrafiltration 58 Ammonium Sulfate Precipitation 58 Total Testosterone ELISA 59 Affinity Chromatography 59 SDS Page 60 Western Blot Analysis 60 Results and Discussion 61 Conclusion 62 Figures 63 Appendix B: Thyroxine-binding globulin expression in the horse 65 Materials and Methods 65 Tissue Collection 65 qPCR 65 RNA Sequencing 66 Results 67 Discussion and Conclusion 67 Figures 68 References 69 Vita 76

vii

List of Tables

Table 2.1: List of animals investigated for the presence of TBG, 11 as well as investigated properties of the protein

viii

List of Figures

Figure 2.1: Types of testosterone modifications for anabolic use 3

Figure 3.1: ABP/SHBG primers 29

Figure 3.2: ABP/SHBG amplification with qPCR 29

Figure 3.3: ABP transcript in comparison to well-known SAT2 transcript 30

Figure 3.4: Immunolocalization of ABP 31

Figure 3.5: Comparison of free and total testosterone in hCG stimulated stallions 32

Figure 3.6: Comparison of free and total testosterone in pregnant mares 33

Figure 4.1: Seasonal variation in TBG concentrations. 47

Figure 4.2: TBG concentrations based on reproductive status. 48

Figure 4.3: TBG concentrations based on gestational age. 49

Figure 4.4: TBG concentrations during the first year of life in colts and 50 fillies.

Figure 4.5: TBG concentrations based on age. 51

Figure 4.6: Effect of stanozolol administration on TBG concentrations. 52

Figure 4.7: Effect of increasing endogenous testosterone production via hCG administration on TBG concentrations. 53

Figure 4.8: Effect of testosterone aromatization inhibition via letrozole administration on TBG concentrations. 54

Figure A.1: Testosterone following ultrafiltration. 63

Figure A.2: SDS Page and SHBG Western Blot. 64

Figure B.1: SERPINA7 Expression using qPCR. 68

Figure B.2: SERPINA7 Expression using RNA Sequencing. 68

Chapter One: Introduction and Objectives

Equine athletics form a multi-faceted industry that is represented all over the world. Just like human athletics, fairness between competitors needs to be ensured. This is done by testing the athletes for performance-enhancing substances that could provide them with an advantage over other competitors [1]. The abuse of these substances with the specific intent to enhance performance is referred to as “doping”.

The current testing methods that are available have advantages and disadvantages, but all have the same goal – the detection of the specific substance that was administered.

While this is acceptable for the published list of banned substances, it leaves room for the use of novel or “designer” steroids, which can go undetected [2]. In human sports, a new means for identifying cases of doping was proposed in 2000 and is called “The Athlete

Biological Passport” [3].

The Athlete Biological Passport monitors changes within certain parameters in the body that are caused by the administration of some foreign substance [3]. These

parameters are called biomarkers and are indirect indicators of substance administration.

The biomarkers of interest for the purpose of this investigation are carrier proteins that

can be measured in serum or plasma, specifically sex hormone-binding globulin (SHBG)

and thyroxine-binding globulin (TBG). While these biomarkers have been verified and

characterized in humans, there is little to no literature regarding them in the horse.

The objectives for the current study are; 1) to find and characterize SHBG in

circulation and tissues in the horse and 2) to characterize circulating levels of TBG across

varying reproductive statuses, seasonal changes and with increased androgen levels.

Chapter Two: Review of the literature

Anabolic Steroids

In many human and equine sports, it is not uncommon for competitors to use various agents in order to gain an advantage over their opponents. The illegal use of these agents is referred to as “doping”. While there are many different categories of doping substances, the most commonly used are anabolic agents or anabolic androgenic steroids (AAS) [4]. AAS are structurally similar to testosterone and contain various modifications to improve their effects. Although they originate from androgens, the anabolic effects are the focus of these drugs. They cause an increase in muscle development, the production of red blood cells, and synthesis of proteins [5]. However, the use of AAS is prohibited in athletic competition when administered in levels much higher than therapeutically prescribed [4]. The guidelines for illegal substances and their use in human athletes are established by the World Anti-Doping Agency (WADA) [5].

Currently, testing for such substances requires direct identification through the use of liquid or gas chromatography in conjunction with mass spectrometry [6]. While this is considered a state of the art approach, it cannot identify AAS that are unknown, causing certain products and metabolites to go undetected. The pharmaceutical industry continues to produce new drugs faster than anti-doping researchers can detect them.

As previously mentioned, anabolic steroids are primarily derived from testosterone with various modifications. These modifications are necessary to ensure that the substance will not be metabolized or absorbed before being able to generate it’s intended effects [5]. These modifications are classified into three different types based on the desired route of administration. A type A change results from the esterification of the

17ß-hydroxyl group and makes the compound better suited for injection. A type B modification is caused by the addition of an alkyl group to the 17α-position and makes the molecule active when administered orally. A type C change is the result of modifying the ring structure of testosterone and increases its potency while slowing its metabolism when taken orally. Most anabolic steroids contain a combination of either a type A or B modification in addition to a type C [5, 7].

Figure 2.1: Types of testosterone modifications for anabolic use [5]

When testosterone concentrations are that of normal circulating levels, it is reported that the receptors that respond to testosterone and 5α-dihydrotestosterone (DHT) are fully saturated. This gives rise to a theory that anabolic steroids may be acting through another receptor, the glucocorticoid receptor [8]. Corticosterone and cortisol are glucocorticoids (GCs) and when bound to their receptor influence protein breakdown. It is postulated that the “supraphysiological” concentrations of androgens following anabolic administration results in the displacement of GCs from their receptor [9], preventing muscle protein catabolism and resulting in muscle production [8].

In the early 2000’s a new approach to detecting the administration of banned

substances was proposed. This was called the “Athlete Biological Passport” [3]. The

Athlete Biological Passport suggests monitoring various biomarkers in order to detect the

administration of an outside substance. A biomarker is defined as “any measurable

parameter altered as a result of a challenge to an individual’s system” [10]. Currently, the

idea of an Equine Biological Passport is being brought to light [11]. While this would be

able to test for a much wider range of substance administration, biomarkers in horses

have yet to be as extensively established as in humans. In humans, there are two carrier

proteins that react similarly to the administration of AAS, SHBG and TBG.

A study conducted by Ruokonen et. al, measured SHBG concentrations in men

who self-administered AAS [12]. This study showed that within 8 weeks of beginning

AAS administration, SHBG levels dropped 80-90% compared to the control athletes.

These levels remained low and had still not returned to normal circulating levels at the conclusion of the study, which was after a 16-week administration withdrawal period.

Not only did this study show the significant decrease in SHBG due to AAS administration, but it also indicated that this significant difference was detectable 12 weeks after the administration ceased. This is ideal in a biomarker because it prevents the athlete from being able to train under the influence of AAS and bypass detection by ceasing drug administration shortly before competition.

In cattle, it has also been shown that SHBG could be used to detect the use of growth promoters. Mooney et. al used immobilized 1alpha-dihydrotestosterone (DHT) to detect SHBG binding capacity as an indirect indicator of SHBG concentrations [13].

SHBG has the highest affinity for DHT out of the steroid hormones present in circulation

[14]. Both treated male and female cattle showed significantly lower SHBG binding

capacities when compared to their respective control group.

Just as self-administration of AAS in men has shown a reduction in circulating

SHBG, it has also shown a significant decrease in TBG levels. Alén et. al, measure both

TBG and SHBG concentrations in athletes following AAS administration [15]. Within 4

weeks of beginning administration, TBG and SHBG levels dropped significantly in the

treated athletes. These concentrations remained low throughout the administration period,

as well as during the monitored 12-week withdrawal period. The fact that TBG also

remained low for several weeks without the administration of AAS makes it an ideal

biomarker. The mechanisms as to how these protein concentrations are affected by

exogenous steroid administration will be discussed in the following sections.

Sex Hormone-Binding Globulin

SHBG is a glycoprotein found in circulation of all vertebrate classes, except for

birds [16]. Sex hormones bind to SHBG and it regulates their bioavailability [17]. In

most vertebrates, androgens and estrogens circulate in three forms: bound to albumin,

bound to SHBG, and unbound/free [18]. While albumin binds to sex steroids, it also

binds to all classes of steroids with low affinity and without any real specificity [19]. In

doing so, albumin can increase the half-life of these hormones, but they can easily dissociate from the protein [20]. Steroids that are bound to albumin or free in circulation are considered to be bioavailable due to their ability to readily act on target tissues [21].

SHBG on the other hand, solely binds to sex hormones with a much higher affinity and is therefore considered the main regulator of their bioavailability, as well as their primary transporter [22]. SHBG can then ensure that there is a readily available pool of sex

hormones where and when they are needed [23]. In most species, SHBG has a higher affinity for androgens, however, salmon SHBG has a higher affinity for estrogens [22].

In addition to regulating the amount of sex hormone that can be used by tissues,

SHBG has been shown to interact with membrane receptors as part of a steroid signaling

pathway [24]. This has been well characterized in tissue explants and cultured cells from

the breast and prostate of humans [25]. SHBG assists steroids in intracellular signaling

via a G-protein without the steroids having to enter the cell [26]. When SHBG binds to

the specific membrane receptor, a complex is formed, RSHBG [27]. SHBG can only bind

to the membrane receptor when it is unbound, meaning that it does not have a sex hormone currently bound to it [26]. The RSHBG complex is then activated when the needed

estrogen or androgen binds to it, independent of estrogen or androgen receptor binding

[27] . This activation causes an increase in 3',5'-cyclic adenosine monophosphate (cAMP)

[28, 29], leading to many potential downstream effects. These effects have included

decreased progesterone receptor expression [30], increased prostate specific antigen

expression [31], protein kinase A activation [32], and induced apoptosis [33].

SHBG is primarily produced in the liver [34]. This is the form that is found in

circulation bound to sex steroids. The Shbg gene is also expressed in the testes where the

well-known isoform of SHBG, ABP, is transcribed [34]. The Shbg gene is also expressed

in a few other tissues that are hormonally reactive. In humans, this gene is also expressed

in the brain, prostate, breast, and endometrium [35, 36]. The transcript for ABP is present

in the brain of rats, however it does not seem to have any steroid-binding activity [37].

The rat brain also contains the form of SHBG found in the fetal liver, although it contains

a different N-terminal sequence that prevents this protein from being secreted or binding

to steroids [38].

The rat and mouse Shbg loci were found on chromosomes 10 and 11 [39, 40]. In

humans, chromosome 17 is homologous to chromosome 11 in mice, making it the

location of the Shbg gene [41]. The form of SHBG that is produced in the human liver is

considered to be the major transcript from the Shbg locus. This transcript is 4.3-kb and

eight exons long with the first exon containing the secretion signal peptide [22]. The

product of this transcription is a precursor protein containing 402 amino acids [17]. This

product is then cleaved at the amino-terminus, removing a 29 amino acid long peptide

[42-44], which results in the mature protein which contains 373 amino acids. This protein

is then glycosylated with one O-linked oligosaccharide moiety and two N-linked oligosaccharide chains that are biantennary [45]. While the human Shbg gene contains

eight exons, the number of exons in this gene can be variable between species. The

bovine gene, for instance, contains twelve exons [46] while the gene in rats contains eight

exons similar to the human gene [40].

The regulation of SHBG transcription and secretion has been a question for many

years. It has been shown that in castrated monkeys, the administration of testosterone

decreases circulating levels of SHBG, but the mRNA levels increased [47]. The direct

effect of androgens on hepatic production of SHBG has never been demonstrated,

indicating that the decrease in circulating concentrations of the protein is due to

posttranscriptional modifications [22]. The mechanism as to how estrogens regulate

SHBG production is more thoroughly described. The activation of estrogen receptors,

ERα and ERβ, causes the downregulation of peroxisome proliferator-activated receptor

gamma (PPARγ) [48]. PPARγ has been shown to downregulate the expression of SHBG

[49]. With estrogen receptor activation decreasing the amount of PPARγ, the concentration of SHBG is able to increase. The exact mechanism for the effects of androgens on SHBG concentrations has yet to be described.

Androgen-Binding Protein

Structural and immunochemical studies involving rabbit and human ABP and

SHBG found that the two proteins are almost indistinguishable when amino acid sequences are compared [34, 50-52]. While SHBG and ABP are both transcribed from the same gene (Shbg), the proteins themselves are different due to their glycosylation [42,

53]. Rabbit and rat ABP have been shown to contain the same N-linked oligosaccharide chains as human SHBG, but it is unclear if rat ABP also contains the O-linked chain [34].

ABP is transcribed from the Shbg gene and produced in Sertoli cells in the testis following stimulation from FSH [54]. Unlike SHBG, ABP is not secreted into systemic circulation in humans [55]. The transcript for human ABP lacks the secretion signal peptide by having an alternative coding exon 1 [22]. ABP remains in the testes to ensure a readily available pool of testosterone needed for spermatogenesis [55]. Roughly 20% of

ABP produced is secreted into the interstitial spaces, while 80% remains in the seminiferous tubules [56]. On the other hand, ABP in male rats is secreted into circulation from 20 to 40 days of age [57]. It is assumed that rat ABP in circulation has the same function as liver secreted SHBG, however this has not been investigated.

In the testes, ABP transports testosterone in seminiferous tubule fluid to the epididymis [56]. There ABP either dissociates and is taken up by the epididymal epithelium, or it progresses through the epididymis and is excreted in the seminal plasma

[16, 56]. ABP has been identified in the seminal plasma of caprine, bovine, and ovine,

but has not been detected in that of humans, porcine, or equine [58]. In addition to

providing a pool of testosterone for spermatogenesis, it has been reported that ABP helps

maintain spermatozoal fertilizing capabilities [59]. Hypophysectomized rats experienced decreased circulating levels of testosterone. Following pregnenolone injections, testosterone levels in circulation remained low, however testosterone levels in the rete testis were normal. Sperm fertilizing capabilities and ABP concentrations were measured in these rats. A positive correlation was seen between ABP concentrations in the epididymis and sperm fertilizing capabilities [59].

Thyroxine-Binding Globulin

Thyroxine-binding globulin is another glycoprotein that can be found in circulation in most large herbivorous and omnivorous mammals [60, 61]. Carnivores are able to obtain a sufficient amount of thyroid hormones from their prey while omni- and herbivores rely on the storage of large amounts of thyroid hormones to make up for potential low iodine supply [61]. TBG binds to and regulates the bioavailability of thyroxine (T4) and triiodothyronine (T3) [62]. Thyroid hormones circulate bound to albumin, TBG, transthyretin or free and unbound [62]. Like sex hormones, the free thyroid hormones are considered to be biologically active. Due to the lower binding affinity, thyroid hormones bound to albumin are considered to be bioavailable as well.

However, only 0.3% of T3 and 0.03% of T4 circulate unbound [60]. The affinity for thyroid hormones to TBG is 50 to 7000 times higher than their affinity for transthyretin or albumin, making TBG the primary regulatory of thyroid hormone bioavailability [60].

TBG is able to ensure that a readily available pool of thyroid hormones is present when

needed by target tissues [62].

A study conducted by Mendel et al. in 1987 showed that in addition to providing storage of thyroid hormones, TBG also assists in ensuring even distribution of thyroid hormones [63]. They examined the distribution of T4 within hepatic lobules in the rat in the presence of TBG and transthyretin and solely in the presence of albumin. In the absence of the thyroid hormone-binding proteins, T4 was taken up primarily by the peripheral cells within the lobule. However, when TBG and transthyretin were present,

T4 was taken up by all cells in a uniform manner [63].

TBG is a 54-kDa single polypeptide chain that is transcribed in the liver from the serine protease inhibitor superfamily (SERPINA7), which is located on the long arm of the X-chromosome[64]. The gene contains 5 exons, only four of which are encoding [64].

The pre-protein contains 415 amino acids and is considered to be an acidic glycoprotein

[60]. The mature molecule is a 395-amino acid protein that contains four N-linked oligosaccharides that assist in post translational folding [60]. The gene also contains multiple hepatic nuclear factor binding sites which further convey that transcriptional regulation is liver specific [64].

A study conducted by Larsson et al. in 1985 investigated the presence of TBG in

15 vertebrate species [65]. Of the 15 species investigated, they were able to detect the presence of TBG in 9 of them by way of T4 affinity chromatography, electrophoresis, and autoradiography. The full list of animals tested as well as the properties of TBG that were investigated are listed in Table 1.1.

Table 2.1: List of animals investigated for the presence of TBG, as well as investigated properties of the protein [65].

While TBG has been verified in quite a few species, including the horse [65], it has only been structurally characterized in rats, sheep, cattle, pigs, and humans [61].

Bovine TBG shows that 85.5% of its nucleotides are identical to that of human TBG and

82.8% of the amino acids are identical [61]. Sheep share 80% homology with the amino acid sequence of human TBG and 85% homology with its nucleotides [66]. Like bovine and ovine TBG, porcine TBG also shows greater than 80% homology with human TBG in its amino acid (82.6%) and nucleotide (85.7%) sequences [61]. This high degree of interspecies sequence retention is an indication of the important role that TBG plays.

Circulating levels of TBG are affected by changes in steroid hormone concentrations by way of post-translational modifications. It has been shown that the administration of exogenous estrogens increases the sialic acid content of TBG which reduces its clearance rate in the liver, therefore increasing the circulating concentrations of TBG [67]. Currently, there are no studies that have specifically investigated the

mechanism in which exogenous androgens decrease TBG concentrations. However, it is

postulated that androgens would decrease the sialic acid content of TBG, resulting in an

increased clearance rate in the liver and decreasing TBG concentrations in circulation

[68].

The following investigation was conducted with the objectives of characterizing

SHBG and TBG in the horse. For SHBG, analysis of tissue expression was completed as well as examining the existence of a carrier protein in circulation. Since TBG has already been verified in the horse [65], the characterization of this protein was a little bit more in

depth. TBG concentrations were investigated in regard to varying reproductive statuses,

sexes, ages, and increased androgen concentrations. By characterizing SHBG and TBG,

they could potentially be used as biomarkers in equine athletics.

Chapter 3: Characterization of androgen-binding protein and sex hormone-binding

globulin in the horse

B.O. Fleming, A. Esteller-Vico, S.E. Loux, K.E. Scoggin, B.A. Ball

Note

The original objective of this study was to identify and characterize SHBG in the horse for the potential use as a biomarker for AAS abuse. The results obtained showed that SHBG was not present in circulation in the horse. However, through the process of searching for SHBG, the isoform ABP was verified in equine testes. Therefore, the following chapter will focus on ABP expression in the horse and evidence for an alternative carrier protein for androgens in circulation as opposed to specific SHBG characterization in the horse.

Abstract

The regulation of androgen bioavailability is an area that has not been well described or investigated in the horse. In most vertebrate species, androgen-binding protein (ABP) is the primary androgen regulator in the testes and sex hormone-binding globulin (SHBG) is the primary regulator in circulation. ABP and SHBG have yet to be identified in the horse. The objectives of this study were to 1) characterize the expression of ABP/SHBG in stallion testis, pregnant mare, fetal, and stallion liver through the use of qPCR and RNA sequencing, 2) visualize immunolocalization of ABP/SHBG in pre-, peri-, and post-pubertal equine testes and mare liver with immunohistochemistry, 3) provide evidence of a carrier protein in circulation by comparing free and bound testosterone concentrations in pregnant mares and human chorionic gonadotropin (hCG) - stimulated stallions with free testosterone and total testosterone immunoassays, as well as

to investigate the presence of SHBG in circulation using heterologous immunoassays.

RNA was isolated from liver [mare (n=1), fetus (n=1), stallion (n=1)], and testis (n=3).

This RNA was then sequenced at the University of Illinois. For qPCR, RNA was isolated from testis (n=7) and equine liver [mare (n=3), fetal (n=2), stallion (n=2)] and reverse transcribed. Primers for SHBG (XM_001918151.3) were generated using NCBI and qPCR was performed. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and beta-2

microglobulin (B2M) were used as reference genes. RNA sequencing showed a five-exon

transcript (Chr 11: 50589067..50591923) in stallion testis, which would be ABP. ABP

was amplified in the testis using qPCR ∆Ct = 4.179 ± 0.591 (mean ± SEM) and shown to

be approximately 4000x greater than any amplification seen in the liver samples (16.480

± 0.632). Immunolocalized ABP was seen in the seminiferous tubules and the interstitial

spaces of the testis with IHC. No positive staining for SHBG/ABP was seen in the liver.

Both the hCG-stimulated stallions and pregnant mares had significantly less free

testosterone than total testosterone as determined by immunoassay. This provides

evidence of a carrier protein in circulation in the horse. SHBG fell below the level of

detection of the heterologous SHBG assays that were utilized. Although ABP is present

in the equine testis, these results do not support the presence of SHBG in blood and

suggest that there is a carrier protein for androgens in circulation in the horse other than

SHBG.

Introduction

The regulation of bioactive androgens in vertebrates is important due to the

physiological roles that they play [21]. In males, testosterone is necessary for

spermatogenesis and the development of secondary sex characteristics [21, 69].

Compared to males, the function of androgens is not as well characterized in females,

however they seem to be primarily used as precursors for estrogen synthesis throughout

the body and within the ovary [70]. Low testosterone levels in men have been associated

with poor sperm parameters and poor cardiovascular health [71]. In women, androgen

dysregulation can result in polycystic ovarian syndrome [72], which can lead to

metabolic as well as reproductive issues [73]. In order to control the effects of androgens

within the body, bioavailable androgen levels are regulated by androgen binding protein

(ABP) and sex hormone-binding globulin (SHBG) in many species [22, 55].

ABP is a carrier protein that is produced and secreted by Sertoli cells [54] and has

been identified in the human, dog, monkey, rat, rabbit, ram, bull, and goat [16]. It is not secreted into systemic circulation and remains in the testes to ensure that there is a readily

available pool of testosterone for spermatogenesis [55]. One third of androgens in

testicular blood circulate bound to ABP, while the remaining fraction is free and unbound

[74]. This protein transports testosterone via the seminiferous tubule fluid into the

epididymis, where it dissociates and is taken up by epithelial cells [56]. In addition to

supporting spermatogenesis, it is reported that ABP might help in maintaining the

fertilization ability of spermatozoa in the epididymis [59]. In a study conducted using

hypophysectomized rats that received pregnenolone injections, the rats had low

circulating levels of testosterone, but normal testosterone levels in the rete testis. Sperm

fertilizing capabilities were also measured and there was a positive correlation seen

between sperm fertilizing capabilities and ABP concentrations in the luminal

compartments and epididymis [59]. In some species, ABP is not taken up but will be

excreted in the seminal plasma instead [16]. ABP has been identified in the seminal

plasma of caprine, bovine, and ovine, but is not present in that of humans, porcine, or

equine [58]. While the absence of ABP in equine seminal plasma has been reported, its

presence in stallion testes has yet to be investigated.

In many vertebrates, ABP is an isoform of a protein that can be found in

circulation to provide a readily available pool of sex hormones. This protein is call sex

hormone-binding globulin (SHBG) [17]. Testosterone circulates in three known forms; free and unbound, bound to albumin, or bound to SHBG [21]. In order for testosterone to be able to act on its target tissues it must be considered “bioavailable”, which is testosterone that is either bound to albumin or free and unbound in circulation [18].

SHBG binds to androgens with high affinity making it difficult for them to dissociate until needed [23]. The affinity between androgens and albumin is weaker than that of

SHBG, which allows the hormone to easily dissociate from albumin and join the free fraction to be used by its target [20]. Because testosterone cannot dissociate as easily from SHBG, this causes SHBG to be the primary regulator of bioavailability in the species where SHBG is present [22].

Unlike ABP, SHBG is present in both males and females. In women, concentrations of SHBG are approximately 50% higher than in men, which results in less bioavailable testosterone [21, 22]. Also, the concentration of SHBG increases during

pregnancy in women and other mammals including mice, rabbits, and rats [75, 76]. This coincides with the peak of testosterone that occurs during pregnancy [40, 77]. This increase in SHBG in maternal circulation is due to its production from the fetal liver in order to decrease the bioavailability of circulating testosterone [77]. This reduction in

16 bioavailability of androgens is proposed to both protect the dam from androgens produced by the fetus and protect the fetus from exposure to sex steroids [77].

While the function of SHBG is known and well described, it’s expression is variable between species. In humans, cattle, sheep, dogs, nonhuman primates, and many more species, SHBG has been identified in the liver and in circulation [13, 16, 78, 79]. In rats, SHBG is expressed in the liver of neonates, but within weeks of birth the expression declines and ceases in adulthood [80]. Salmon have a unique SHBG related gene that is found in their muscle, ovary and gill, but is not expressed in their liver or testes [22]. In elephants, camels, donkeys, and pigs there is no transcript for SHBG found in the liver, indicating that it is not used as the primary carrier for androgens in circulation for these animals [81-83]. While there is a gene for SHBG found in the equine genome [84], there are contradictory reports that it is not found in circulation in horses [82, 84, 85]. By way of radioactive steroid labelling in conjunction with ammonium sulfate precipitation followed by electrophoresis, it was concluded that SHBG was not present in the horse

[82, 85]. However, Wenn et. al discusses concerns about radiolabeled steroid dissociation during the electrophoretic procedure, which has led to the claim that SHBG was not present in other species before [82].

Though ABP and SHBG have been verified and somewhat described in many mammals [22], the horse is not one of them. Therefore, the objectives of this study were to; 1) characterize the expression of ABP/SHBG in stallions testi, pregnant mare, fetal, and stallion liver through the use of qPCR and RNA sequencing, 2) visualize immunolocalization of ABP/SHBG in pre-, peri-, and post-pubertal equine testes and mare liver with immunohistochemistry, 3) provide evidence of a carrier protein in

circulation by comparing free and bound testosterone concentrations in circulation of pregnant mares and hCG-stimulated stallions with free testosterone and total testosterone immunoassays, as well as investigate the presence of SHBG in circulation using heterologous immunoassays.

Materials and Methods

Animal Use and Tissue Collection:

Experiments 1 & 2:

Testes were collected post mortem from seven stallions (>3 years) and by way of castration from four peri-pubertal (2 years) and six pre-pubertal (>1 year) colts. Livers were collected post mortem from two fetuses (10 months gestation), three pregnant mares

(>3 years) and three stallions. Post mortem tissues were fixed in neutral buffered formalin for IHC or RNA later for qPCR and RNA sequencing, while tissues collected via castration were fixed in formalin then transferred to methanol for IHC.

Experiment 3:

Blood was collected from pregnant mares (n=18) via jugular venipuncture using blood tubes containing no anticoagulant (Butler Animal Health Supply, Dublin, OH).

Stallions (n=4) received intravenous injections of 5000 international units of hCG as per standard protocol (University of Kentucky IACUC 2013-1088). Blood was collected from the treated stallions as well as control stallions (n=4) prior to injection as well as 1,

2, 6, 12, 24, 48, 72, 96 hours, and 10 days post hCG. Blood was then spun down at room temperature at 1,200 RCF rpm for 20 minutes until separated. Serum was then collected, aliquoted and stored at -20°C until analysis.

18 qPCR:

Tissue samples stored in RNAlater were weighed out to 75 mg to be used for total

RNA extraction by means of Trizol reagent following manufacturer’s instructions

(Invitrogen, Carlsbad, CA, USA). Following extraction, RNA was precipitated with isopropanol and 3M sodium acetate and then quantitated with a NanoDrop spectrophotometer (ThermoFisher, Wilmington, DE, USA). Further analysis was performed on samples with a 260/280 ratio greater than 1.8 and a 260/230 ratio greater than 2.0. RNA was DNase treated using the DNA-free kit (Applied Biosystems). Two micrograms of RNA were then reverse transcribed to cDNA using TaqMan Reverse

Transcription Reagents; 5µL 10x TaqMan RT buffer, 11µL 25mM MgCl2, 10µL deoxyNTPs Mixture (2.5mM), 2.5µL oligo d(T)16 primers, 1.25µL MultiScribe Reverse

Transcriptase (Invitrogen). Reagents were added to RNA samples before being placed in the MasterCycler thermocycler (Eppendorf). The cycle started with a 10-minute incubation period at 25°C, followed by reverse transcription for 30 min. at 48°C and inactivation for 5 minutes at 95°C. The resulting complimentary DNA was amplified with SYBR Green Master Mix (Applied Biosystems) using the ViiA 7 Real-Time PCR

System (Applied Biosystems, Grand Island, NY, USA) under the following cycle conditions: incubation for 10 minutes at 95°C, 45 cycles of 15 seconds at 95°C and 60 seconds at 60°C. All reactions were performed in duplicate with GAPDH and B2M as reference genes due to reported stability in analyzed tissue types [86-88]. ∆Ct values were analyzed. Primers were generated using Primer Blast from the National Center for

Biotechnology Information (/www.ncbi.nlm.nih.gov/tools/primer-blast/) (Figure 1).

RNA Sequencing:

Isolation of RNA from testis and liver was performed using RNeasy Mini Kit

(Qiagen, Gaithersburg, MD, USA) per manufacturer’s instructions. RNA from mare

(n=2) and fetal (n=2) livers were pooled together into a single sample. RNA extracted from stallion (n=3) testes were pooled. Integrity, purity and concentration of RNA was analyzed by NanoDrop (Thermo Fisher Scientific; Hampton, NH) and Bioanalyzer

(Agilent, Santa Clara, CA, USA). All samples had a 230/260 ratio > 1.8, a 260/280 ratio

> 2.0 and an RNA integrity number > 8.0.

Library preparation was performed using TruSeq mRNA Sample Prep kit

(Illumina, San Diego, CA USA), as per manufacturer’s instructions. Libraries were quantitated via qPCR and then sequenced on a HiSeq 4000, using a HiSeq 4000 sequencing kit, version 1 (Illumina), generating 150 bp paired-end reads. Resultant

FASTQ files were demultiplexed with the bcl2fastq v2.17.1.14 Conversion software

(Illumina).

Following sequencing, reads were trimmed for adapters and quality using

TrimGalore v0.4.4 (Babraham Bioinformatics; www.bioinformatics.babraham.ac.uk), with quality evaluated via FastQC v0.11.4 (Babraham Bioinformatics). Reads were mapped to EquCab2.0 using STAR-2.5.2b (github.com/alexdobin/STAR) using coordinates from NCBI. Presence or absence of reads was determined visually using

Integrated Genome Viewer v2.3.97 (The Broad Institute; https://data.broadinstitute.org).

Immunohistochemistry:

Staining for immunohistochemical analysis was performed using an automated staining system (Bond-maX; Leica Biosystems, Newcastle Upon Tyne, UK). The

primary antibody used for the detection of ABP was mouse monoclonal and generated

using amino acids at the C-terminus of human SHBG (sc-377031, Santa Cruz) and

diluted to 1:100 using Bond Primary Antibody Diluent (Leica Biosystems; Wetzlar,

Germany). Slides were made with 5µm sections of paraffin embedded tissues. The

staining protocol followed was that provided by the manufacturer (Leica Biosystems) as

previously described [89].The slides underwent an initial automated dewaxing and

rehydration step before undergoing a heat-induced (20 min at 100°C) antigen retrieval using an EDTA-based ready-to-use solution with a pH 8.8 (Leica Biosystems). Following antigen retrieval, slides were incubated with 3% hydrogen peroxide (5 minutes), diluted primary antibody (15-30 minutes), a post-primary blocking reagent containing 3% BSA

(minimize nonspecific polymer binding, 8 minutes), horseradish peroxidase-labeled

polymer (8 minutes), and diaminobenzidine substrate (10 minutes). Washing took place

between each step using Bond Wash Solution 10x diluted to 1x working solution with

distilled water.

Testosterone Analysis:

Serum from pregnant mares and stallions was analyzed for total and free

testosterone concentrations. Total testosterone was measured using an in-house ELISA as

described below. Free testosterone was analyzed using a commercially available

radioimmunoassay per manufacturer’s instructions (Siemens Free Testosterone Coat-A-

Count Kit; Dublin, Ireland).

Total Testosterone Analysis

The testosterone antibody (Clinical Endocrinology Laboratory, University of

California, Davis, California, USA) was diluted in sodium bicarbonate buffer (Sigma, St.

Louis, MO) to a dilution of 1:9,000. Fifty microliters of diluted antibody were added to each well of a 96-well plate, with the exception of two wells to be used as blank controls.

The plates were then sealed tightly and stored at 4°C for at least 48 hours or until needed.

Two hundred microliters of serum were mixed with 1 mL of diethyl ether (Fisher

Scientific; Hampton, NH) in a borosilicate glass tube and vortexed for 45 sec. The tubes were then place in liquid nitrogen until the aqueous phase was frozen, and the ether layer was then decanted off into a fresh borosilicate glass tube and left in a fume hood overnight to allow evaporation of the ether solvent. Samples were reconstituted in phosphate buffered saline containing 0.1% bovine serum albumin (Sigma, St. Louis, MO) and horseradish peroxidase (HRP) conjugated testosterone (Clinical Endocrinology

Laboratory, University of California, Davis, CA) at a dilution of 1:60,000.

Standard stocks were developed by weighing out lyopholized testosterone

(Steraloids: Newport, RI) and dissolving it methanol. This was then used to create a nine- point standard curve between 0.02 and 10 ng/mL. The appropriate volume of stock solution was pipetted into clean boroslicate glass tubes and allowed to dry. One milliliter of the HRP-conjugated buffer was added to the standard tubes, and they were vortexed for 30 seconds for reconstitution. Samples were reconstituted in 250 µL of HRP- conjugated buffer and vortexed for 15 seconds.

Plates that were previously coated in antibody were used for standard and sample plates. All plates were washed before use. For the standard plate and sample plates, 50 microliters of phosphate buffered saline containing 0.1% bovine serum albumin were added to each well. To the standard plate, 50 microliters of HRP conjugated buffer were added to the first three and last three columns with 50 microliters of each standard added

in replicates of eight across the center. To the sample plates, HRP conjugated buffer was

added as previously mentioned with 50 µL of each sample added in duplicate in the

center of the plate. Pooled stallion serum was used as a high testosterone control with

pooled gelding serum used as a low testosterone control.

All plates were incubated for 2 hours at room temperature and then washed three

times. One hundred microliters of substrate (2, 2’-azino-bis-3-ethylbenzothiazoline-6-

sulfonic acid (ABTS) in citric acid with H2O2; Sigma, St. Louis, MO) was added to each

well across all plates. Plates were then incubated for an hour before the addition of 100

µL of stop solution to each well (EDTA in hydrofluoric acid; Sigma, St. Louis, MO).

Plates were read using the Epoch microplate spectrometer (BioTek; Winooski, VT).

Heterologous SHBG Immunoassays:

SHBG analysis was performed using a heterologous, commercially-available,

human SHBG assay (human SHBG Quantikine ELISA Kit (R&D Systems; Minneapolis,

MS)) and a chemiluminescence SHBG assay (Immulite 2000 platform; Seimens Medical

Solutions USA)). Analysis was performed using stallion, open mare, and pregnant mare serum and manufacturer’s instructions were followed.

Statistical Analysis:

Statistical analyses were performed using JMP software (JMP ® , Version 12.

SAS Institute Inc., Cary, NC). Data was checked for equal variance using Bartlett’s Test.

For qPCR, mRNA expression was analyzed using a one-way ANOVA and is represented

as ∆Ct or the difference between the Ct of the housekeeping genes and the gene of

interest. Total testosterone concentrations following ultrafiltration were analyzed by way

of a nonparametric Wilcoxon’s Rank Test. All data are represented as mean ± SEM

unless otherwise specified. The level of significance was set to 0.05.

Results

Experiment 1:

When compared to all mare, fetal and stallion livers, significant expression of

ABP was seen in all testis samples using qPCR (P<0.001) (4.179 ± 0.591). Amplification

seen in the equine liver samples was considered to be negligible, due to all Ct values

being > 36 (16.480 ± 0.632) (Figure 2). Using RNA sequencing, no transcript for SHBG

was found (Chr 11: 50589067..50591923) in the pooled mare/fetal liver or in the stallion

liver (FPKM = 0). A transcript was found in the pooled stallion testes, indicating the

presence of ABP (FPKM = 2.3307). This transcript had five exons compared to the predicted protein transcript in EquCab2.0, which shows eight exons (Figure 3).

Experiment 2:

Equine heart, liver, and pre-, peri-, and post-pubertal testes were all evaluated with immunohistochemistry using a mouse anti-human SHBG antibody (Figure 4). No positive staining for ABP/SHBG was seen in the equine heart, as expected. ABP was immunolocalized in the seminiferous tubules, Sertoli cell, interstitial spaces, and Leydig cells of all examined testes using IHC. Staining in the pre-pubertal testes looked to be

slightly less localized than that of the peri- and post-pubertal testes. No positive staining

was visible in the liver, indicating the absence of the SHBG protein (Figure 4).

Experiment 3:

In the stallions stimulated with hCG, there was an increase in both free and total

testosterone in serum following the injection (Figure 5). Even with this increase, the free

testosterone was still significantly lower (p < 0.0001) than the total testosterone in

circulation. In pregnant mares a large increase of testosterone was detected using the total

testosterone immunoassay as expected during pregnancy (Figure 6). However, regardless

of gestational time point, no testosterone was detected with the free testosterone RIA in

the pregnant mare (p < 0.0001).

The heterologous SHBG assays were utilized due to the 79% homology between

human SHBG and equine SHBG. Cross reaction between the equine SHBG and antibody

was possible. However, all samples fell below the level of detection in both of the

heterologous SHBG assays. All controls and standard curves fell within the range set by

the manufacturer protocol.

Discussion

This study has shown that ABP is in fact present in stallion testes and that

testosterone circulates bound to a protein in the horse. Until now, some of the only

information regarding ABP in the horse was that it was not detected in equine seminal

plasma [58]. This did not necessarily indicate that the protein was not present within the

testes. There are multiple species in which the protein is present within the testis, but

taken up in the epididymis [58]. While epididymal uptake has yet to be studied in the stallion, it would seem that this is the case, because the protein is not present in seminal

plasma but both mRNA and protein are detectable for ABP in the testes.

ABP was found in the testis of the stallion using three separate methodologies.

ABP was first seen in stallion testes through cDNA amplification using qPCR. This

amplification was seen in all of the testis samples, while amplification in any of the tested

liver samples proved to be negligible. However, this did not necessarily indicate that

SHBG was not present in equine liver. Regarding ABP and SHBG in the rabbit, one

study found that the amount of ABP present in the testis increased into adulthood, whereas the amount of SHBG present in the liver decreased [90].

When looking at the data generated through RNA sequencing, it is shown that the

transcript for ABP is present at the predicted locus in the testis. It is also shown that while

this gene was predicted to contain eight exons as in humans (Hammond, et al. 1989),

whereas the actual equine transcript only contains five exons. Variation in exon number

is seen across species. While human SHBG contains eight and equine ABP contains five,

bovine SHBG contains twelve exons [46]. However, this transcript was not present at the

predicted locus in the liver, which explains the lack of SHBG amplification using qPCR.

Sertoli cells are the site of production for ABP in most mammals following

stimulation from FSH [54]. From there, roughly 80% of ABP produced remains in the

seminiferous tubules while 20% is secreted into the interstitial spaces [56]. The findings

of this study coincide with previously reported ABP localization. Through the use of

immunohistochemistry, it is shown that ABP is present in the seminiferous tubule lumen

as well as in the interstitial spaces of the pre- and peri-pubertal colt testis and post-

pubertal stallion testis. IHC failed to show any indication of SHBG in the liver, which

would further indicate its absence in the horse. Although it was shown that the gene for

SHBG was present in the equine transcriptome, it was not specified as to where this

transcript was located. The study was conducted by sequencing 43 pooled equine tissues

with the testis being one of them [84]. The results of this current investigation indicate

that the SHBG transcript found was that of ABP.

When comparing the free and total testosterone ELISA data in pregnant mares

and stallions stimulated with hCG, it is apparent that testosterone is circulating bound to a carrier. In pregnant women, it has been shown that only 0.23% of the testosterone present during gestation is unbound [91] and this is evident in the pregnant mare as well.

Although all samples fell below the level of detection using the heterologous SHBG assays, it was thought that equine SHBG could have failed to cross react despite having

79% homology with human SHBG. In order for there to be a high chance of cross reactivity, the two species need to have 80% homology [92]. However, data from qPCR and RNA sequencing shows that the transcript for SHBG is not present in the liver of the horse, which explains the lack of detection using the assays. This also supports previous claims of the lack of SHBG found in equine serum [82, 85].

In most species, androgens circulate in three forms; free, bound to SHBG, and bound to albumin [21]. Humans, little brown bats, goats, sheep, cattle, some fish and amphibians are just a few that have SHBG as an androgen carrier in circulation [13, 16,

78, 79]. In species that do not have SHBG, such as elephants and donkeys, androgens primarily circulate bound to albumin [81]. While this investigation has provided evidence of androgens circulating bound to a protein, it cannot yet be concluded that this protein is albumin. It has been reported that testosterone circulates bound to progesterone-binding globulin in the horse [93]. A study conducted by [91] found that while testosterone circulates bound to SHBG and albumin, a small percentage can be bound to corticosteroid-binding globulin (CBG). Further research needs to be conducted in order to identify the specific steroid carrier for the horse; however, we can confidently conclude that there is a carrier present.

This study was able to characterize the expression of ABP in the equine testis, which had not been previously reported. ABP was shown in the seminiferous tubule lumen and in the interstitial spaces of the testis of pre- and peri-pubertal colts, as well as post-pubertal stallions through IHC. Expression was also found in the testis trough qPCR and the gene transcript identified with RNA sequencing. This study also provided evidence of a steroid carrier in circulation in both stallions and pregnant mares. Although, it has been concluded that SHBG is not the carrier in circulation, due to the lack of transcript in the equine liver.

Figures

Primer Direction Sequence

Forward TCTTGGCTCAGCTTTCACCT

Reverse CTGGTTCAAGACCACCCTGG

Figure 3.1: ABP/SHBG primers. Primers were generated using Primer Blast from the National Center for Biotechnology Information (/www.ncbi.nlm.nih.gov/tools/primer- blast/).

P<0.0001

Ct ∆ Average Average

Tissue

Figure 3.2: ABP/SHBG amplification with qPCR. Bar graph showing mean ∆ Ct ± SEM of SHBG expression in mare, fetal and stallion liver (n=7) and testis (n=7). GAPDH and B2M were used to calculate ∆ Ct and significance was set to P < 0.05. Significant difference is indicated using *.

Figure 3.3: ABP transcript in comparison to well-known SAT2 transcript. Sashimi plots generated using Integrated Genomics Viewer showing SHBG transcript using EquCab2.0 (Chr 11: 50589067..50591923) in comparison to the well-defined transcript for spermidine/spermine N1-acetyltransferace family member 2 (SAT2). The transcript for SAT2 is visible in all samples. No transcript is seen at the location for SHBG in pooled mare/fetal liver (A) and stallion liver (B). A 5-exon transcript is seen at the locus for SHBG in the pooled stallion testis (C), indicating the presence of ABP.

A B

C D

E F

Figure 3.4: Immunolocalization of ABP. Immunohistochemical staining in equine heart (A), liver (B), pre-pubertal colt testis (C & D), peri-pubertal colt testis (E), post-pubertal stallion testis (F), The equine heart (A) was utilized as a negative control. Positive staining for ABP/SHBG is visualized with brown stain. Slides were stained with 1:100 diluted antibody and viewed at 20x magnification.

Figure 3.5: Comparison of free and total testosterone in hCG stimulated stallions. Graph showing the comparison of free and total testosterone in stallions (n=4) that received an injection of hCG (5000 IU). Free testosterone is represented in pg/mL and total testosterone is represented in ng/mL. Free testosterone is shown in blue and total testosterone is shown in red. Total testosterone was significantly higher than free testosterone at all measured time points (p < 0.0001).

Free vs. Total Testosterone in Pregnant Mares Total 1 Free

0.8

0.6

0.4

0.2

Testosterone (ng/mL) 0 971 1122 1283 1424 1755 1896 2037 2208 2359 25010 26511 28512 30013 31314 Gestational Age

Figure 3.6: Comparison of free and total testosterone in pregnant mares. Graph showing the comparison of free and total testosterone in the pregnant mare (n=18). Testosterone is represented in ng/mL. Free testosterone is shown in blue and total testosterone is shown in red. Total testosterone was significantly higher than free testosterone at all measured time points (p < 0.0001).

Chapter 4: Characterization of thyroxine-binding globulin in the horse and

evaluation of circulating levels in response to increased androgen concentrations

B.O. Fleming, A. Esteller-Vico, S.E. Loux, K.E. Scoggin, B.A. Ball

Abstract

In human and equine sports, it is known that competitors sometimes administer

foreign substances in order to enhance their performance. Currently in equine athletes,

testing for these substances is accomplished to the specific identification of the substance

administered through the use of gas chromatography/liquid chromatography tandem mass

spectrometry While this methodology is very sensitive, if a novel substance is administered it can bypass detection. The World Anti-Doping Agency has proposed the use of biomarkers in human athletics as a way to indirectly measure anabolic androgenic steroid abuse. One protein that is significantly affected by this administration is thyroxine-binding globulin (TBG). TBG has been identified in the horse but has yet to be fully characterized. This study measured TBG concentrations in relation to seasonal changes [mares (n=5), stallions (n=5), geldings (n=5)] and across varying reproductive

statuses [fillies (n=3), colts (n=3), non-pregnant mares (n=5), pregnant mares (n=5),

stallions (n=5), geldings (n=5)] and ages. TBG concentrations were also analyzed

following exogenous androgen administration (Stanozolol) and increased endogenous

androgen production (hCG or aromatase inhibitor administration). TBG concentrations

did not differ significantly across seasons in mares, stallions, or geldings. There was no

significant effect of reproductive status, sex, or age on circulating TBG concentrations.

Stanozolol administration did not significantly alter TBG concentrations. Increased

endogenous androgen production via hCG administration in stallions and aromatase

inhibitor (Letrozole) administration in pregnant mares did not have an effect on

circulating TBG concentrations. While this investigation did not yield any effects on

TBG concentrations following alteration of androgen levels, it is possible that more

potent steroids and higher concentrations could illicit a noticeable change.

Introduction

Drastic alterations in the concentration of circulating androgens cause many

physiological changes in the body [7]. One notable effect, is the measurable change in

circulating levels of various carrier proteins [11]. In human sports, the changes in these

protein levels has been used to help identify whether or not athletes have been

administered performance enhancing substances, specifically anabolic androgenic

steroids (AAS). This method of identification is referred to as the Athlete Biological

Passport, where an athlete’s own reference range for a specific protein is used to determine if there is any significant deviation from their norm [3]. These proteins are

referred to as biomarkers and have eased the identification of illegal substance use in

human athletes [2].

In equine athletics, the current testing methods for banned substances are

expensive and require the identification of the specific substance administered [1]. This

can cause novel substances referred to as “designer steroids” to go undetected, allowing a

competitor to continue competing following the administration of a performance

enhancing substance [3]. Currently, there are no biomarkers for the use of AAS in the

horse. However, a carrier protein of interest that has been shown to significantly decrease

in circulating levels following AAS administration in humans is thyroxine-binding globulin (TBG) [15].

TBG concentrations have been shown to react to changes in steroid

concentrations in human athletes and in dogs [15, 94]. A study conducted by Alén in

1987, showed that following self-administration of exogenous androgens, human athletes saw as much as an 80% reduction in circulating levels of TBG [15]. This reduction

remained throughout the administration period and took several weeks following

withdrawal to return to pre-administration levels. Just as androgens cause a decrease in

TBG levels, estrogens have been shown to significantly increase TBG levels [95].

Pregnant women and women taking birth control have higher circulating levels of TBG

compared to non-pregnant women and those not on contraceptives [68, 95, 96]. A study

has shown that TBG could be measured as an indicator as to whether or not women have

been taking their prescribed contraceptives as instructed [95].

Circulating androgen concentrations can be changed by way of a few different methods [97]. The first method is by administering an exogenous androgen source such as anabolic androgenic steroids [98, 99]. This increases the concentration of androgens in circulation without causing the body to increase its own androgen production. The second method is by increasing endogenous production of androgens. A common way of doing this is by administering human chorionic gonadotropin (hCG) causing an increase in LH production, which leads to increased testosterone production [100, 101]. Another way to endogenously increase androgen production is by inhibiting testosterone’s aromatization to estrogen. This is accomplished by orally administering an aromatase inhibitor such as

Letrozole [97, 102]. Regardless of the method utilized to increase androgens in circulation, this increase should result in a decrease in circulating TBG concentrations.

TBG binds thyroxine (T4) and triiodothyronine (T3) [103]. It is produced and

secreted in the liver and is affected by exogenous steroid administration by way of post-

translational modifications [68]. It has been shown that the administration of exogenous estrogens increases the sialic acid content of TBG which reduces its clearance rate in the liver, therefore increasing the circulating concentrations of TBG [67]. Currently, there are no studies that have specifically investigated the mechanism in which exogenous androgens decrease TBG concentrations. However, it is postulated that androgens would decrease the sialic acid content of TBG, resulting in an increased clearance rate in the liver and decreasing TBG concentrations in circulation [68].

While TBG has been verified in the horse [65], there were no other studies identified which addressed this protein or its normal circulating levels in the horse. The hypotheses for this study are that TBG concentrations will not differ between sexes or ages, concentrations will increase throughout gestation, and concentrations will significantly decrease following an increase in circulating androgens. The objectives of this study are; 1) to characterize normal circulating concentrations of TBG across seasons, as well as the effects of reproductive status, sex, and age, 2) to examine the effects of increased androgen concentrations via exogenous androgen administrations

(Stanozolol) in stallions and increased endogenous androgen production (hCG administration in stallions and Letrozole administration in pregnant mares).

Materials and Methods

Experiment 1: Characterization in circulation

Serum Collection:

Animals were kept in pastures and provided grain daily per University of

Kentucky Institutional Animal Care and Use Committee protocol (#2016-2358). Bi-

weekly blood samples (20mL) were collected from 28 horses of varying ages and

reproductive statuses beginning in September 2016 and ending in August 2017 [ 3 colts,

3 fillies, 5 pregnant mares (>3 years), 5 open mares (> 3 years), 5 stallions (>3 years), 5

geldings (2 years)]. Samples were drawn via jugular venipuncture using non-heparinized

tubes (Butler Animal Health Supply, Dublin, OH) and spun down at 1,200 RCF for 20

minutes at room temperature. The separated serum was then collected, aliquoted and

stored at -20°C until analysis via ELISA.

Experiment 2.1: Stanozolol Administration

Stallions (n=6), non-pregnant mares (n=6), and geldings (n=6) were randomly

assigned to treatment groups [Control (n=9); Treated (n=9)] with three stallions, three

mares, and three geldings per group. All received a single intramuscular injection of 1.5

mg/kg Stanozolol (Steraloids; Newport, RI) in an aqueous solution (Doc Lane’s

Veterinary Pharmacy; Lexington, KY) each week for 3 weeks [99]. Stanozolol injections

were administered on days 0, 7 and 14. Blood was collected prior to the first injection

(day 0) and for the following 7 days. Blood samples were collected prior to the remaining

2 injections (day 7 and day 14) and 28, 42, 70, and 99 days after the final injection. Blood

samples were processed and stored as mentioned above. Animals use was approved by

38 the University of Kentucky Animal Use Care and Use Committee (Protocol #: 2016-

2358).

Experiment 2.2: hCG Administration

The samples analyzed for this study were obtained from a previously conducted study. Briefly, stallions (n=4) received single intravenous injection of 5,000 IU of hCG

(Choluron, Intervet Inc, USA) as per standard protocol (University of Kentucky IACUC

#2013-1088). Four additional stallions were utilized as controls. Blood was collected from the treated stallions and control stallions prior to injection as well as 96 hours and

10 days post injection. Blood samples were processed and stored as above.

Experiment 2.3: Letrozole Administration

All animal use was approved by University of Kentucky Institutional Animal

Care and Use Committee protocol (#2013-1067). Serum samples for this experiment were obtained from a previously published study [102]. Briefly, twelve pregnant mares were randomly assigned to groups [control (n=6); treated (n=6)] at 240 days of gestation.

Mares in the treatment group were orally administered 500 mg of letrozole (Aurum

Pharmatech LLC, Howell, NJ 07731) every 4 days until parturition. Control mares received and oral placebo at the same interval as the mares treated with Letrozole.

Blood samples were collected via jugular venipuncture 1 week before treatment began and on the day of treatment administration until day 315 of gestation. Blood samples were then collected daily until parturition. Serum was processed and stored as above.

TBG ELISA:

Serum was analyzed using the equine specific Thyroxine-Binding Globulin

ELISA kit (MyBioSource, Inc.; San Diego, CA). Samples were run in singlet and all manufacturer instructions were followed. Reagents were brought to room temperature 30 minutes prior to use in corresponding assay step. When protocol called for protection from light, all ceiling lights were turned off in the laboratory and remained off until assay completion. Pooled serum from pregnant mares (n=5) and pooled serum from geldings

(n=5) were used as low and high controls. Inter-assay CV’s were 13% and 12% with intra-assay CV’s being 8% and 13% respectively.

Statistical Analysis:

Statistical analyses were performed using JMP software (JMP ®, Version 12. SAS

Institute Inc., Cary, NC). All data sets were analyzed using nonparametric analysis via

Wilcoxon Each Pair Test. All data are represented as mean ± SEM unless otherwise specified. The level of significance was set to 0.05.

Results

Experiment 1

There were no significant differences between TBG concentrations in geldings, nonpregnant mares, or stallions throughout the year of bimonthly serum collection

(Figure 4.1; p>0.05). Reproductive status did not have a significant effect on circulating concentrations of TBG (Figure 4.2; p>0.05). Gestational age did not have a significant effect on TBG concentrations in pregnant mares (Figure 4.3; p>0.05). TBG concentrations did not significantly differ throughout the first year of life in colts and

fillies (Figure 4.4; p>0.05). There were no significant differences in TBG concentrations

based on age of the animal (Figure 4.5; p>0.05).

Experiment 2

Exogenous androgen administration with Stanozolol did not significantly alter the

levels of TBG in circulation of geldings, mares, or stallions when compared to the control

group (Figure 4.6; p>0.05). Increasing endogenous levels of androgens via hCG

administration did not have a significant effect on TBG concentrations when compared to

the control stallions (Figure 4.7; p>0.05). See Figure 3.5 for reference of testosterone

increase following hCG administration. Increasing endogenous androgens in the

circulation of pregnant mares by inhibiting testosterone aromatization to estrogen via oral

administration of Letrozole did not have a significant effect on TBG concentrations when

compared to the control group (Figure 4.8; p>0.05).

Discussion

TBG is a carrier protein found in circulation in most vertebrates that is shown to

be greatly affected by changes in circulating sex hormones [15, 68, 95]. While this

protein has the potential to be utilized as a biomarker for illegal substance administration

in athletes, it has not been as extensively characterized as other carrier proteins that could

serve the same purpose, such as sex hormone-binding globulin. Although TBG has previously been verified in the horse [65], there is no other literature regarding this protein other than confirming its existence. One objective of this study was to characterize levels of TBG in horses based on factors such as seasonal change, reproductive status, age, and sex.

Horses are seasonal breeders that experience changes in circulating hormone

concentrations throughout the year [104, 105]. Given the many previously published reports on TBG concentrations being affected by endogenous changes in hormone concentrations, it was hypothesized that TBG concentrations would significantly differ throughout the year in horses. Surprisingly, time of year did not have a significant effect

on the circulating levels of TBG in any of the animals that were analyzed across season

Given the difference in testosterone and estrogen concentrations between males

and females [21, 22], it could be assumed that TBG concentrations would differ based on

sex and reproductive status. However, literature in humans has shown that there is no

significant difference in TBG concentrations based on sex [106]. Males and females have

roughly the same circulating concentrations. Also, these concentrations are not affected

by age in post-pubertal humans [106]. Based upon our data, these findings hold true in

the horse. There were no differences in TBG levels between colts, fillies, geldings,

nonpregnant mares, pregnant mares, or stallions.

Mares experience a rise in estrogen concentrations throughout pregnancy [102]

just as humans do. In pregnant women, this increase in estrogens is associated with an

increase in TBG concentrations [107-109]. TBG levels also rise in women who are taking

oral contraceptives [68, 95]. Our data in the horse, did not identify any significant

differences between any of the analyzed gestational time points in pregnant mares or

compared to nonpregnant mares.

It is unclear as to why there are no differences in TBG concentrations throughout

gestation in the pregnant mare. When examining the data in Figure 3, it looks as though

there is an increase in TBG concentrations as gestation progresses. However, the standard

errors in this data set are obviously quite large and could be preventing any tendency or

statistical differences from being reported during analysis. Increasing the number of

pregnant mares in the sampling group could decrease the standard error size and improve

the statistical analysis.

A study conducted by Elmlinger in 2001 looked into changes in T4, T3, free T3,

free T4, TBG and thyroid-stimulating hormone (TSH) in humans from birth to adulthood

[110]. This study examined males and females from the age of 1 day to 19 years and

grouped them according to their stage of sexual maturation based on the Tanner stages

[111]. It was found that TBG concentrations increased by around 60% following the

neonatal period and began to decrease around puberty. TBG was the only thyroid parameter examined to show a significant decrease between Tanner stages 1 and 5 in both males and females, indicating that TBG concentrations decreased as both males and females progressed to and through puberty.

As previously mentioned the current study has shown that there are no significant

differences between ages in horses, which is line with findings in humans [106]. The

current study also investigated the possibility of changes in TBG concentrations in fillies

and colts during their first year of life. No significant differences were found between any

of the time points analyzed during the first year of life in fillies and colts. Sampling of

these animals began when they were between 12 – 15 weeks of age. It is possible that

horses could also experience an increase in TBG concentrations during their neonatal

period [110]; however, the current study did not begin sampling until after this stage of their lives.

The second objective of this study was to determine if increased androgen

concentrations, induced by exogenous or endogenous means, could illicit a significant

change in circulating TBG levels. Stanozolol administration was a way to increase

androgens in circulation exogenously. In human body builders, it is commonly known

that this administration causes a significant decrease in TBG concentrations [15, 68]. This

does not seem to be the case in the equine model at a dose of 1.5 mg/kg once a week for

three weeks. TBG concentrations were not significantly affected by the administration of

stanozolol. Stanozolol is a weak AAS and has some estrogenic properties, which could contribute to the lack of effect observed [112]. Also, most athletes who abuse AAS use

some sort of cocktail containing multiple steroids at high concentrations [5, 12, 15].

This is the first study to investigate the effects of exogenous androgen

administration on TBG concentrations in the horse. When AAS are administered with the

intent of enhancing performance, they are given at a concentration much higher than that

intended for therapeutic use [98]. The current investigation tripled the amount of

stanozolol administered by Soma et al. in 2000 in an attempt to illicit a response in TBG

concentrations [99]. It is possible that this steroid alone and at the given dose was not

enough to elicit a response in TBG concentrations.

The current study investigated two separate means of increasing endogenous

androgen production through hCG administration in stallions and by preventing

testosterone aromatization to estrogen in pregnant mares. Both of these methods

produced significant increases in testosterone concentrations in circulation [102];

however, no significant changes in TBG concentrations were observed. These results do

not coincide with reported findings in humans.

hCG administration caused an acute increase in testosterone levels that returned

to baseline by 10 days post injection (see Figure 3.5). It is possible that this limited time

increase in testosterone production was not long enough to effect TBG levels in

circulation. If an athlete is abusing anabolic steroids, they will continue to administer the

AAS for a long enough period of time to be able to experience the desired results rather than rely on a single injection [12, 15].

When examining the effects of sex or age, TBG concentrations in the horse have been shown to follow somewhat of the same pattern as reported in humans. It is possible that there could be an increase in TBG during the equine neonatal period, but this is beyond the scope of this study and would require further investigation. The findings of this study differ in the effects of gestation and increased androgen concentrations on TBG levels when compared to human literature. There is little literature regarding TBG in species other than the human, which is why this report focuses on humans as a point of comparison. It is unknown why the horse has failed to show the expected patterns and responses in TBG concentrations. This point deserves further investigation. It is possible that the lack in significance seen is due to the large standard errors present in all of the data sets. There is the potential that increasing the sample sizes for these analyses could decrease the standard errors and give an improved understanding of TBG characterization in the horse.

There are many future studies that could stem from these results. A study that includes more potent AAS at higher concentrations and for longer administration periods would give better insight into the effects of exogenous steroid administration on TBG concentrations. Also, the effects of multiple injections of hCG rather than a single

45 injection would be worth examining. Currently, the concentrations of T3 and T4 are being examined from the horses that were included in the Stanozolol study. The analysis of these hormones could give additional insight into the effects of exogenous androgen administration. While humans experience of brief effect on T4 concentrations following

AAS administration [113], this hormone quickly returns to normal levels and any lasting effects cannot be detected. Whether or not this is the case in the horse has yet to be investigated.

Figures

January March May July September November

Figure 4.1: Seasonal variation in TBG concentrations. Bi-monthly concentrations of TBG in geldings (n=5), nonpregnant mares (n=5), and stallions (n=5). Data are represented as mean ± SEM. There were no significant differences seen between any of the months nor the grouping of the horses.

Figure 4.2: TBG concentrations based on reproductive status. Box plot showing TBG concentrations based on reproductive status; colt (n=3), filly (n=3), gelding (n=5), nonpregnant mare (n=5), pregnant mare (n=4), stallion (n=5). There were no significant differences seen between any of the reproductive statuses.

Figure 4.3: TBG concentrations based on gestational age. TBG concentrations in pregnant mares (n=5) based on gestational age. Time point 0 indicates before pregnancy. Data are represented as mean ± SEM. There are no significant differences between concentrations of TBG during gestation.

September November January March May July

Figure 4.4: TBG concentrations during the first year of life in colts and fillies. TBG concentrations during the first year of life in colts (n=3) and fillies (n=3). Colts are represented in blue and fillies are represented in red. Data is represented as mean ± SEM. There were no significant differences seen between any of the months or the sexes of the animals.

Figure 4.5: TBG concentrations based on age. Group A contained horses < 2 years of age (n=8), Group B contained horses between 3 – 9 years of age (n=5), Group C contained horses between 10 – 19 years of age (n=6), Group D contained horses between 20 – 25 years of age (n=3). There was no significant difference between TBG concentrations in any of the age groups.

Figure 4.6: Effect of stanozolol administration on TBG concentrations. The control group (n=9) is represented in blue and the treated group (n=9) is represented in red. Data is represented as mean ± SEM. Day 0 indicates baseline concentrations prior to administration. The drug was administered after blood collection on days 0, 7, and 14. There were no significant differences in TBG concentrations between the control and treated groups at any of the analyzed time points.

Pre-administration 4 days 10 days

Figure 4.7: Effect of increasing endogenous testosterone production via hCG administration on TBG concentrations. The control group (n=4) is represented in blue and the treated group (n=4) is represented in red. Data is represented as mean ± SEM. 0 hours indicates baseline concentrations prior to hCG administration. There were no significant differences in TBG concentrations between the control and treated groups at any of the analyzed time points.

Figure 4.8: Effect of testosterone aromatization inhibition via letrozole administration on TBG concentrations. The control group (n=6) is represented in blue and the treated group (n=6) is represented in red. Data is represented as mean ± SEM. Baseline concentrations were collected at 8 months of gestation prior to drug administration. There were no significant differences in TBG concentrations between the control and treated groups at any of the analyzed time points during gestation.

Chapter 5: Summary and Conclusion

A biomarker for anabolic androgenic steroid (AAS) abuse in the horse would

allow for a much wider array of AAS detection in equine athletes. While this

investigation did not yield a definitive biomarker, it is a start into a new and necessary

realm of research. The characterization of carrier proteins affected by AAS

administration would be ideal for an indirect indicator of substance abuse.

Although this study has further confirmed the absence of SHBG in equine

circulation, it did indicate the presence of a carrier protein for androgens. Albumin is

already known to be present in circulation in the horse and is known to bind to sex

hormones. However, it cannot be concluded that albumin is the only carrier protein

present. Speculation into the identity of other carrier proteins is beyond the scope of this

study but deserves to be investigated.

This study was also able to identify the presence of ABP in stallion testes, even though the absence of ABP in stallion seminal plasma has been reported. It would therefore be assumed that ABP would be absorbed by the epididymal epithelium; however, this concept deserves further investigation as well. Seeing as ABP remains in the testes in most species, it would not be a viable biomarker for AAS administration in the horse. Although ABP has been reported in circulation in the rat, the absence of a band around the molecular weight of ABP (44kDa) when examined via ammonium sulfate precipitation, DHT affinity chromatography and western blot, indicates that ABP is not secreted into circulation in the stallion (see Appendix A). Further investigation into the actual peptide sequence of the protein is necessary for confirmation of secretion inhibition.

5 5

TBG was detected and measured through the use of the Horse Thyroxine-Binding

Globulin Assay kit from MyBioSource. Although this study was unable to detect any significant differences in TBG concentrations following changes in circulating levels of androgens, this does not necessarily mean that TBG would not be a viable biomarker for

AAS abuse in the horse. Increasing the administered dose of exogenous androgens or utilizing a more potent AAS could have more of a significant impact compared to what was demonstrated in this study.

This study was able to show that TBG seems to follow some of the same characterization as to what has been reported in humans. There are no significant differences in sex, age, or season; however, it would have been expected to see significant changes in TBG concentrations throughout gestation in the pregnant mare. It is possible that the lack of significance was due to the variation present in the data. This aspect deserves further investigation either to reduce the standard error by increasing sample size or by looking into possible causes for the lack of TBG increase with increasing estrogen concentrations. The lack of significant differences found throughout the year would give a good base of measurement to detect significant changes due to outside influence. Currently, T3 and T4 concentrations are being analyzed to determine whether or not these levels are affected by anabolic steroid administration in the horse.

While the possibility of an Equine Biological Passport in equine athletics has been proposed, potential biomarkers have not been as extensively studied and characterized as in humans. It has been confirmed that SHBG would not be a viable biomarker for AAS abuse in the horse, however there is still the possibility that TBG could be utilized. This was just the beginning into the characterization of TBG as a potential biomarker in the

56 horse. It is time to start fully investigating other potential biomarkers and pushing toward the complete development of the Equine Biological Passport.

Appendices:

Appendix A: Sex hormone-binding globulin purification attempts

Introduction:

As stated in chapter 3, SHBG was not detected in circulation in the horse. The

following methods and results are what took place during the attempted purification of

equine SHBG, before RNA sequencing showed the lack of Shbg transcript in the liver.

While these results further confirm the presence of a carrier protein for androgens in

circulation in the horse, the lack of Shbg transcript in the liver helps to explain the lack of

SHBG detection using the following methods.

Materials and Methods:

Serum Samples

Serum from stallions and pregnant mares was used for ultrafiltration, ammonium

sulfate precipitation, ELISA, affinity chromatography, SDS page, and western blot

analysis.

Ultrafiltration

Amicon Ultra-4 and Ultra-15 filters with a molecular weight cut-off of 10 kDa were used and the appropriate volume of sample was concentrated. The ultrafiltration centrifuge tubes were centrifuged per manufacturer instruction. The filtrate (fraction that passed through the filter) and the concentrate (fraction retained by the filter) were collected and stored for later analysis.

Ammonium Sulfate Precipitation

A saturated ammonium sulfate solution (SASS) was prepared and used throughout the protocol. Various volumes of SASS were added drop-wise to serum at

4°C to reach the desired saturation percentage. This solution was then centrifuged at

10,000xg at 4°C for 10 minutes. The heavy pellet was resuspended and stored for later

analysis. Additional SASS was added to the supernatant to reach an additional 10%

saturation. The above centrifugation was repeated and the produced pellet was collected,

resuspended in buffer, and stored for later use and analysis

Total Testosterone ELISA

The ELISA was performed as mentioned in chapter 3. Various samples were

analyzed: ultrafiltration filtrate and concentrate, ammonium sulfate precipitation pellets

and supernatants.

Affinity Chromatography

DHT-Carboxymethyloxime (CMO)or DHT-Hemisuccinate (Hemi) was bound to

CarboxyLink agarose resin per manufacturer instruction. Total column volume was 4 mL. Columns were stored at 4°C and allowed to reach room temperature before any experimentation. Serum was added to the column and allowed to incubate for 1 hour at room temperature. The columns were then washed with 10 column volumes of buffer. 1 column volume of DHT in the appropriate buffer was added to the columns which were then incubated at 4°C overnight. The following day, 1 column volume of DHT was added to the column and the flow-through was collected. The columns were then incubated for

3 hours at room temperature. This incubation was repeated once more and all flow-

through was collected, pooled, concentrated via ultrafiltration and stored for later analysis

via SDS page and western blot. Columns were washed with a high salt buffer and stored

at 4°C for later use.

SDS Page

MiniProtean precast 10% polyacrylamide gels were used for electrophoresis.

Purified equine albumin was used as a control. Samples were diluted 1:1 using the

appropriate dye and boiled at 95°C for 5 minutes. The samples were then loaded onto the

precast gel and run at 200V (constant) for 35-40 minutes. The gels were then placed in

coomassie blue stain and incubated for 1 hour at room temperature on a plate rocker.

They were rinsed 3x with ddH2O and then incubated overnight at room temperature in a

10% acetic acid solution. The following day, gels were again rinsed 3x and preserved in a

10% glycerol solution.

Western Blot Analysis

Following SDS page, the gels were loaded into cassettes with a nitrocellulose

membrane and run for 1 hour at 100V to allow for protein transfer from gel to the

membrane. An ice block was placed in the cassettes with a stir bar to prevent overheating

during the transfer process. The membranes were collected and blocked for 30 minutes at

room temperature using 5% non-fat dried milk in the appropriate buffer. The membrane

was rinsed and incubated with the primary antibody (1:100 mouse monoclonal anti-

human SHBG) at 4ºC overnight. The next day the membrane was rinsed 3 times for 10

minutes each and incubated with the secondary antibody (goat anti-mouse HRP conjugated) for 1 hour at room temperature. Finally, the membrane was rinsed and incubated for 5 minutes with detection solution before analyzing using a chemiluminescent detector.

Results and Discussion:

Ultrafiltration was performed in order to separate testosterone that is bound to carrier proteins from testosterone found free in circulation. The filtrate and concentrate were analyzed using the total testosterone ELISA to see where the majority of testosterone fell. In all samples, most of the testosterone was retained in the concentrate, indicating that it is bound to a carrier protein.

Ammonium sulfate precipitation was performed in order to isolate bound testosterone and remove unwanted proteins. This was performed in increment cuts of

10% saturation. The pellets and supernatants from each 10% cut were analyzed using the same total testosterone ELISA. It was found that the majority of testosterone was isolated between 45% and 65% ammonium sulfate saturation. These cuts were then run using

SDS page in order to visualize what and how many proteins were retained. There were many proteins on the gel, so these fractions were further purified using affinity chromatography.

Affinity chromatography was also performed on whole stallion and pregnant mare serum. The concentrated flow-through was again analyzed using SDS page. These samples revealed 3 distinct protein bands. These samples were then analyzed with a western blot and the heterologous antibody cross reacted with the equine albumin control.

Seeing as albumin is the most abundant protein in the body, it is not unusual for there to be some albumin contamination during protein purification for antibody production. The antibody also cross-reacted with a second unknown band. These samples were sent to the

UK proteomics core facility for excision and protein sequencing, however SHBG was not one of the resulting proteins.

Conclusion:

Results from the total testosterone ELISA following ultrafiltration and ammonium sulfate precipitation indicate that there is a carrier protein for sex hormones in circulation in the horse. The 3 distinct bands that resulted from running the ammonium sulfate fractions through affinity chromatography indicate that there may be 3 proteins in circulation that bind to androgens in the horse. Due to the crossreaction of the heterologous SHBG antibody with the purified equine albumin control and the presence of a protein at the same molecular weight in the affinity chromatography fractions, we can confidently conclude that albumin is one of these 3 proteins. As for what the other 2 proteins may be, the results from the UK proteomics lab generated a list of over 200 proteins, in addition to albumin. This indicates that the affinity chromatography may not have been as specific as initially thought.

Figures:

Figure A.1: Testosterone following ultrafiltration. Testosterone concentrations were obviously higher in the fraction retained by the filter when compared to the fraction of serum that passed throught the filter. Data shown is represented at mean ± SEM. Stallion and pregnant mare data were combined for the sake of general comparison.

1 2 3 4 5 6 7 1 2 3

A B

75 kDa

50 kDa

Figure A.2: SDS Page and SHBG Western Blot. The SDS page (A) and western blot (B) were completed after ammonium sulfate precipitation followed by DHT affinity chromatography. Western blot was conducted using a mouse monoclonal anti-human SHBG antibody. Lane A1 = purified equine albumin, A2 = Stallion serum CMO, A3 = Stallion Hemi, A4 = Whole Stallion Serum, A5 = Pregnant Mare CMO, A6 = Pregnant Mare Hemi, A7 = Whole Pregnant Mare Serum: B1 = purified equine albumin, B2 = Stallion CMO, B3 = Pregnant Mare CMO.

Appendix B: Thyroxine-binding globulin expression in the horse

Materials and Methods

Tissue Collection:

Livers were collected from three stallions (> 3 years), three pregnant mares (>3

years), and two fetuses (<10 months gestation). Testes were collected from seven post- pubertal stallions. Tissues were fixed in RNA later for qPCR and RNA sequencing. All tissues were collected post mortem. qPCR:

mRNA was extracted from the collected tissues using the reagent Trizol

(Invitrogen, Carlsbad, CA, USA). The RNA was then precipitated using 3M sodium acetate and isopropanol before being quantitated using NanoDrop (Thermo Fisher

Scientific; Hampton, NH). Samples with a 230/260 ratio greater than 1.8 and a 260/280 ratio greater than 2.0 were utilized for further analysis. The DNA-free kit by Applied

Biosystems was used to DNase treat the RNA. TaqMan Reverse Transcription Reagents were used to reverse transcribe RNA to cDNA; 1.25µL MultiScribe Reverse

Transcriptase, 2.5µL oligo d(T)16 primers, 10µL deoxyNTPs Mixture (2.5mM), 11µL

25mM MgCl2, 5µL 10x TaqMan RT buffer (Invitrogen). Following the addition of the

reverse transcription agents, RNA samples were placed in the MasterCycler thermocycler

(Eppendorf); 10-minute incubation period at 25°C, followed by reverse transcription for

30 minutes at 48°C and inactivation for 5 minutes at 95°C. SYBR Green Master Mix

(Applied Biosystems) was used to amplify the resulting cDNA via the ViiA 7 Real-Time

PCR System (Applied Biosystems, Grand Island, NY, USA) under the following cycle

conditions: incubation for 10 minutes at 95°C, 45 cycles of 15 seconds at 95°C and 60

seconds at 60°C. All of the reactions were performed in duplicate. GAPDH and B2M

were used as reference genes due to reported stability across the tissue types that were

analyzed [86-88]. ∆Ct values were analyzed. Primers were generated using Primer Blast

from the National Center for Biotechnology Information

(/www.ncbi.nlm.nih.gov/tools/primer-blast/).

RNA Sequencing:

Isolation of RNA from testis and liver was performed using RNeasy Mini Kit

(Qiagen, Gaithersburg, MD, USA) per manufacturer’s instructions. RNA from fetal (n=2)

and mare (n=2) livers were pooled. Extracted RNA from stallion (n=3) testes were

pooled. Purity, concentration, and integrity of RNA was analyzed by NanoDrop (Thermo

Fisher Scientific; Hampton, NH) and Bioanalyzer (Agilent, Santa Clara, CA, USA). All

samples had a 230/260 ratio greater than 1.8, a 260/280 ratio greater than 2.0 and an

RNA integrity number greater than 8.0.

Using TruSeq mRNA Sample Prep kit (Illumina, San Diego, CA USA), library

preparation was performed as per manufacturer’s instructions. Libraries were then

quantitated via qPCR and sequenced on a HiSeq 4000, using a HiSeq 4000 sequencing kit, version 1 (Illumina), generating 150 bp paired-end reads. Resultant FASTQ files

were demultiplexed with the bcl2fastq v2.17.1.14 Conversion software (Illumina).

Sequenced reads were trimmed for adapters and quality using TrimGalore v0.4.4

(Babraham Bioinformatics; www.bioinformatics.babraham.ac.uk) and quality was

evaluated via FastQC v0.11.4 (Babraham Bioinformatics). Reads were mapped to

EquCab2.0 using STAR-2.5.2b (github.com/alexdobin/STAR) using coordinates from

NCBI. Integrated Genome Viewer v2.3.97 (The Broad Institute;

66 https://data.broadinstitute.org) was used to visually determine the absence or presence or reads.

Results:

qPCR was performed in order to characterize the expression of TBG in fetal, mare, and stallion livers. Stallion testes were used as a negative control. TBG was detected in all liver samples with the highest expression being in the fetal liver. No TBG was detected in the testis. These results were further confirmed through RNA sequencing.

The TBG transcript was seen in all liver samples. No transcript was found in the testes, as expected.

Discussion and Conclusion:

These results follow what has been reported for TBG expression in the human and other species. While the presence TBG has been detected in other tissues in humans,

TBG mRNA was only found in the liver. These findings further confirm the presence of

TBG in the horse, by showing transcript expression in the liver as expected.

Figures:

Figure B.1: SERPINA7 Expression using qPCR. Bar graph showing SERPINA7 expression using qPCR. Data shown is delta Ct expressed as mean ± SEM.

Figure B.2: SERPINA7 Expression using RNA Sequencing. Expression of SERPINA7 is shown in pooled mare and fetal liver (A) (FPKM = 251.371) and pooled stallion liver (B) (FPKM = 17.3737). This gene shows 4 exons as predicted in the reference sequence (C).

References: 1. Houghton, E. and S. Maynard, Some aspects of doping and medication control in equine sports. Handb Exp Pharmacol, 2010(195): p. 369-409. 2. Robinson, N., et al., The athlete biological passport: an effective tool in the fight against doping. Clin Chem, 2011. 57(6): p. 830-2. 3. Sottas, P.E., et al., The athlete biological passport. Clin Chem, 2011. 57(7): p. 969-76. 4. Bird, S.R., et al., Doping in sport and exercise: anabolic, ergogenic, health and clinical issues. Ann Clin Biochem, 2016. 53(Pt 2): p. 196-221. 5. Mottram, D.R. and A.J. George, Anabolic steroids. Baillieres Best Pract Res Clin Endocrinol Metab, 2000. 14(1): p. 55-69. 6. Chan, G.H., et al., Targeted Metabolomics Approach To Detect the Misuse of Steroidal Aromatase Inhibitors in Equine Sports by Biomarker Profiling. Anal Chem, 2016. 88(1): p. 764-72. 7. Wilson, J.D., Androgen abuse by athletes. Endocr Rev, 1988. 9(2): p. 181-99. 8. Wu, F.C., Endocrine aspects of anabolic steroids. Clin Chem, 1997. 43(7): p. 1289-92. 9. Rockhold, R.W., Cardiovascular toxicity of anabolic steroids. Annu Rev Pharmacol Toxicol, 1993. 33: p. 497-520. 10. Teale, P., et al., Biomarkers: unrealized potential in sports doping analysis. Bioanalysis, 2009. 1(6): p. 1103-18. 11. Cawley, A.T. and J. Keledjian, Intelligence-based anti-doping from an equine biological passport. Drug Test Anal, 2017. 9(9): p. 1441-1447. 12. Ruokonen, A., et al., Response of serum testosterone and its precursor steroids, SHBG and CBG to anabolic steroid and testosterone self-administration in man. J Steroid Biochem, 1985. 23(1): p. 33-8. 13. Mooney, M.H., et al., Biosensor-based detection of reduced sex hormone-binding globulin binding capacities in response to growth-promoter administrations. Anal Chim Acta, 2009. 637(1-2): p. 235-40. 14. Pugeat, M., et al., Clinical utility of sex hormone-binding globulin measurement. Horm Res, 1996. 45(3-5): p. 148-55. 15. Alen, M., et al., Androgenic-anabolic steroid effects on serum thyroid, pituitary and steroid hormones in athletes. Am J Sports Med, 1987. 15(4): p. 357-61. 16. Westphal, U., Steroid-protein interactions II. Monogr Endocrinol, 1986. 27: p. 1- 603. 17. Khan, M.S., et al., Secretion of testosterone-estradiol-binding globulin by a human hepatoma-derived cell line. J Clin Endocrinol Metab, 1981. 53(2): p. 448- 9. 18. Wheeler, M.J., The determination of bio-available testosterone. Ann Clin Biochem, 1995. 32 ( Pt 4): p. 345-57. 19. Baker, M.E., Albumin, steroid hormones and the origin of vertebrates. J Endocrinol, 2002. 175(1): p. 121-7. 20. Melmed, S., Williams textbook of endocrinology. 2016: Elsevier Health Sciences. 21. Shea, J.L., P.Y. Wong, and Y. Chen, Free testosterone: clinical utility and important analytical aspects of measurement. Adv Clin Chem, 2014. 63: p. 59-84.

22. Hammond, G.L., Diverse roles for sex hormone-binding globulin in reproduction. Biol Reprod, 2011. 85(3): p. 431-41. 23. Emadi-Konjin, P., J. Bain, and I.L. Bromberg, Evaluation of an algorithm for calculation of serum "bioavailable" testosterone (BAT). Clin Biochem, 2003. 36(8): p. 591-6. 24. Rosner, W., et al., Sex hormone-binding globulin: anatomy and physiology of a new regulatory system. J Steroid Biochem Mol Biol, 1991. 40(4-6): p. 813-20. 25. Kahn, S.M., et al., Sex hormone-binding globulin is synthesized in target cells. J Endocrinol, 2002. 175(1): p. 113-20. 26. Rosner, W., et al., Sex hormone-binding globulin mediates steroid hormone signal transduction at the plasma membrane. J Steroid Biochem Mol Biol, 1999. 69(1- 6): p. 481-5. 27. Hryb, D.J., et al., The control of the interaction of sex hormone-binding globulin with its receptor by steroid hormones. J Biol Chem, 1990. 265(11): p. 6048-54. 28. Nakhla, A.M., M.S. Khan, and W. Rosner, Biologically active steroids activate receptor-bound human sex hormone-binding globulin to cause LNCaP cells to accumulate adenosine 3',5'-monophosphate. J Clin Endocrinol Metab, 1990. 71(2): p. 398-404. 29. Porto, C.S., et al., Receptors for androgen-binding proteins: internalization and intracellular signalling. J Steroid Biochem Mol Biol, 1995. 53(1-6): p. 561-5. 30. Fazzari, A., et al., The control of progesterone receptor expression in MCF-7 breast cancer cells: effects of estradiol and sex hormone-binding globulin (SHBG). Mol Cell Endocrinol, 2001. 172(1-2): p. 31-6. 31. Nakhla, A.M., N.A. Romas, and W. Rosner, Estradiol activates the prostate androgen receptor and prostate-specific antigen secretion through the intermediacy of sex hormone-binding globulin. J Biol Chem, 1997. 272(11): p. 6838-41. 32. Fortunati, N., et al., Sex steroid binding protein exerts a negative control on estradiol action in MCF-7 cells (human breast cancer) through cyclic adenosine 3',5'-monophosphate and protein kinase A. Endocrinology, 1996. 137(2): p. 686- 92. 33. Catalano, M.G., et al., Sex hormone-binding globulin antagonizes the anti- apoptotic effect of estradiol in breast cancer cells. Mol Cell Endocrinol, 2005. 230(1-2): p. 31-7. 34. Cheng, C.Y., et al., There are two forms of androgen binding protein in human testes. Comparison of their protomeric variants with serum testosterone-estradiol binding globulin. J Biol Chem, 1985. 260(9): p. 5631-40. 35. Sinnecker, G., et al., Immunohistochemical detection of a sex hormone binding globulin like antigen in tissue sections of normal human prostate, benign prostatic hypertrophy and normal human endometrium. Steroids, 1988. 52(4): p. 335-6. 36. Sinnecker, G., et al., Immunohistochemical localization of sex hormone-binding globulin in normal and neoplastic breast tissue. Horm Metab Res, 1990. 22(1): p. 47-50. 37. Wang, Y.M., et al., The androgen-binding protein gene is expressed in male and female rat brain. Endocrinology, 1990. 127(6): p. 3124-30.

38. Sullivan, P.M., Y.M. Wang, and D.R. Joseph, Identification of an alternate promoter in the rat androgen-binding protein/sex hormone-binding globulin gene that regulates synthesis of a messenger RNA encoding a protein with altered function. Mol Endocrinol, 1993. 7(5): p. 702-15. 39. Joseph, D.R., M.C. Adamson, and C.A. Kozak, Genetic mapping of the gene for androgen-binding protein/sex hormone-binding globulin to mouse chromosome 11. Cytogenet Cell Genet, 1991. 56(2): p. 122-4. 40. Sullivan, P.M., et al., Alternative processing of androgen-binding protein RNA transcripts in fetal rat liver. Identification of a transcript formed by trans splicing. J Biol Chem, 1991. 266(1): p. 143-54. 41. Berube, D., et al., Localization of the human sex hormone-binding globulin gene (SHBG) to the short arm of chromosome 17 (17p12----p13). Cytogenet Cell Genet, 1990. 54(1-2): p. 65-7. 42. Gershagen, S., A. Lundwall, and P. Fernlund, Characterization of the human sex hormone binding globulin (SHBG) gene and demonstration of two transcripts in both liver and testis. Nucleic Acids Res, 1989. 17(22): p. 9245-58. 43. Hammond, G.L., et al., The cDNA-deduced primary structure of human sex hormone-binding globulin and location of its steroid-binding domain. FEBS Lett, 1987. 215(1): p. 100-4. 44. Que, B.G. and P.H. Petra, Characterization of a cDNA coding for sex steroid- binding protein of human plasma. FEBS Lett, 1987. 219(2): p. 405-9. 45. Avvakumov, G.V., et al., Study of the carbohydrate moiety of human serum sex hormone-binding globulin. Biochim Biophys Acta, 1983. 760(1): p. 104-10. 46. Zimin, A.V., et al., A whole-genome assembly of the domestic cow, Bos taurus. Genome Biol, 2009. 10(4): p. R42. 47. Kottler, M.L., et al., Effect of testosterone on regulation of the level of sex steroid- binding protein mRNA in monkey (Macaca fascicularis) liver. J Mol Endocrinol, 1990. 5(3): p. 253-7. 48. Lin, Y.M., et al., Activation of estrogen receptors with E2 downregulates peroxisome proliferator-activated receptor gamma in hepatocellular carcinoma. Oncol Rep, 2013. 30(6): p. 3027-31. 49. Haffner, S.M., et al., Association of decreased sex hormone binding globulin and cardiovascular risk factors. Arteriosclerosis, 1989. 9(1): p. 136-43. 50. Cheng, S.L. and N.A. Musto, Purification and characterization of androgen binding protein from rabbit epididymis. Biochemistry, 1982. 21(10): p. 2400-5. 51. Cheng, C.Y., et al., Human testicular androgen-binding protein shares immunodeterminants with serum testosterone-estradiol-binding globulin. Endocrinology, 1984. 114(4): p. 1395-401. 52. Kotite, N.J., et al., Comparison of rabbit epididymal androgen binding protein and serum testosterone estradiol binding globulin--II. Immunological properties. J Steroid Biochem, 1986. 25(2): p. 171-6. 53. Hammond, G.L., et al., The human sex hormone-binding globulin gene contains exons for androgen-binding protein and two other testicular messenger RNAs. Mol Endocrinol, 1989. 3(11): p. 1869-76. 54. Hagenas, L., et al., Sertoli cell origin of testicular androgen-binding protein (ABP). Mol Cell Endocrinol, 1975. 2(5): p. 339-50.

55. Ritzen, E.M., et al., Androgen binding and transport in testis and epididymis. Vitam Horm, 1975. 33: p. 283-95. 56. Haschek, W.M. and C.G. Rousseaux, Handbook of toxicologic pathology. 2013: Elsevier. 57. Joseph, D.R., Structure, function, and regulation of androgen-binding protein/sex hormone-binding globulin. Vitam Horm, 1994. 49: p. 197-280. 58. Jegou, B. and F. Le Gac-Jegou, Androgen-binding protein in the seminal plasma of some mammalian species. J Endocrinol, 1978. 77(2): p. 267-8. 59. Anthony, C.T., B.J. Danzo, and M.C. Orgebin-Crist, Investigations on the relationship between sperm fertilizing ability and androgen-binding protein in the hypophysectomized, pregnenoloneenolone-injected rat. Endocrinology, 1984. 114(4): p. 1419-25. 60. Pappa, T., A.M. Ferrara, and S. Refetoff, Inherited defects of thyroxine-binding proteins. Best Pract Res Clin Endocrinol Metab, 2015. 29(5): p. 735-47. 61. Janssen, O.E., et al., Characterization and primary structures of bovine and porcine thyroxine-binding globulin. Mol Cell Endocrinol, 2002. 186(1): p. 27-35. 62. Oppenheimer, J.H., Role of plasma proteins in the binding, distribution and metabolism of the thyroid hormones. N Engl J Med, 1968. 278(21): p. 1153-62. 63. Mendel, C.M., et al., Thyroid hormone-binding proteins in plasma facilitate uniform distribution of thyroxine within tissues: a perfused rat liver study. Endocrinology, 1987. 120(5): p. 1742-9. 64. Hayashi, Y., et al., Human thyroxine-binding globulin gene: complete sequence and transcriptional regulation. Mol Endocrinol, 1993. 7(8): p. 1049-60. 65. Larsson, M., T. Pettersson, and A. Carlstrom, Thyroid hormone binding in serum of 15 vertebrate species: isolation of thyroxine-binding globulin and prealbumin analogs. Gen Comp Endocrinol, 1985. 58(3): p. 360-75. 66. Tsykin, A. and G. Schreiber, Sheep thyroxine-binding globulin: cDNA sequence and expression. Mol Cell Endocrinol, 1993. 98(1): p. 91-7. 67. Ain, K.B., Y. Mori, and S. Refetoff, Reduced clearance rate of thyroxine-binding globulin (TBG) with increased sialylation: a mechanism for estrogen-induced elevation of serum TBG concentration. J Clin Endocrinol Metab, 1987. 65(4): p. 689-96. 68. Tahboub, R. and B.M. Arafah, Sex steroids and the thyroid. Best Pract Res Clin Endocrinol Metab, 2009. 23(6): p. 769-80. 69. Roser, J.F., Endocrine and paracrine control of sperm production in stallions. Anim Reprod Sci, 2001. 68(3-4): p. 139-51. 70. Davison, S.L. and R. Bell, Androgen physiology. Semin Reprod Med, 2006. 24(2): p. 71-7. 71. Omu, A.E., Sperm parameters: paradigmatic index of good health and longevity. Med Princ Pract, 2013. 22 Suppl 1: p. 30-42. 72. Ehrmann, D.A., R.B. Barnes, and R.L. Rosenfield, Polycystic ovary syndrome as a form of functional ovarian hyperandrogenism due to dysregulation of androgen secretion. Endocr Rev, 1995. 16(3): p. 322-53. 73. Teede, H., A. Deeks, and L. Moran, Polycystic ovary syndrome: a complex condition with psychological, reproductive and metabolic manifestations that impacts on health across the lifespan. BMC Med, 2010. 8: p. 41.

74. Jarow, J.P., et al., Bioactivity of androgens within the testes and serum of normal men. J Androl, 2005. 26(3): p. 343-8. 75. Ng, K.M., M.T. So, and W.M. Lee, Expression of rabbit sex hormone-binding globulin during pregnancy and prenatal development and identification of a novel isoform. Endocrinology, 2005. 146(4): p. 1965-72. 76. Abramovich, D.R., C.M. Towler, and H. Bohn, The binding of sex steroids in human maternal and fetal blood at different stages of gestation. J Steroid Biochem, 1978. 9(8): p. 791-4. 77. Janne, M., et al., Expression and regulation of human sex hormone-binding globulin transgenes in mice during development. Endocrinology, 1999. 140(9): p. 4166-74. 78. Kouretas, D., et al., Sex-hormone binding globulin from sheep serum: purification and effects of pregnancy and treatment with exogenous estradiol. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol, 1999. 123(3): p. 233-9. 79. Mickelson, K.E. and P.H. Petra, Purification of the sex steroid binding protein from human serum. Biochemistry, 1975. 14(5): p. 957-63. 80. Joseph, D.R., S.H. Hall, and F.S. French, Rat androgen-binding protein: evidence for identical subunits and amino acid sequence homology with human sex hormone-binding globulin. Proc Natl Acad Sci U S A, 1987. 84(2): p. 339-43. 81. Bardin, C.W., et al., Extracellular androgen binding proteins. Annu Rev Physiol, 1981. 43: p. 189-98. 82. Wenn, R.V., et al., Distribution of testosterone-estradiol binding globulin (TeBG) in the higher vertebrates. Endokrinologie, 1977. 69(2): p. 151-6. 83. Renoir, J.M., C. Mercier-Bodard, and E.E. Baulieu, Hormonal and immunological aspects of sex steroid-binding plasma protein of primates. J Reprod Fertil Suppl, 1980. Suppl 28: p. 113-9. 84. Hestand, M.S., et al., Annotation of the Protein Coding Regions of the Equine Genome. PLoS One, 2015. 10(6): p. e0124375. 85. Renoir, J.M., C. Mercier-Bodard, and E.E. Baulieu, Hormonal and immunological aspects of the phylogeny of sex steroid binding plasma protein. Proc Natl Acad Sci U S A, 1980. 77(8): p. 4578-82. 86. Klein, C., J. Rutllant, and M.H. Troedsson, Expression stability of putative reference genes in equine endometrial, testicular, and conceptus tissues. BMC Res Notes, 2011. 4: p. 120. 87. Lisowski, P., et al., Evaluation of reference genes for studies of gene expression in the bovine liver, kidney, pituitary, and thyroid. J Appl Genet, 2008. 49(4): p. 367-72. 88. Matouskova, P., et al., Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity. PLoS One, 2014. 9(1): p. e86033. 89. Fedorka, C.E., et al., Expression and localization of cysteine-rich secretory protein-3 (CRISP-3) in the prepubertal and postpubertal male horse. Theriogenology, 2017. 87: p. 187-192. 90. Weddington, S.C., et al., Androgen binding protein (ABP) in rabbit testis and epididymis. Steroids, 1974. 24(1): p. 123-34.

91. Dunn, J.F., B.C. Nisula, and D. Rodbard, Transport of steroid hormones: binding of 21 endogenous steroids to both testosterone-binding globulin and corticosteroid-binding globulin in human plasma. J Clin Endocrinol Metab, 1981. 53(1): p. 58-68. 92. Prager, E.M., The sequence-immunology correlation revisited: data for cetacean myoglobins and mammalian lysozymes. J Mol Evol, 1993. 37(4): p. 408-16. 93. Petra, P.H., The plasma sex steroid binding protein (SBP or SHBG). A critical review of recent developments on the structure, molecular biology and function. J Steroid Biochem Mol Biol, 1991. 40(4-6): p. 735-53. 94. Van der Walt, J.A., L.A. Van der Walt, and P.H. Le Roux, Functional endocrine modification of the thyroid following ovariectomy in the canine. J S Afr Vet Assoc, 1983. 54(4): p. 225-9. 95. Westhoff, C.L., K.A. Petrie, and S. Cremers, Using changes in binding globulins to assess oral contraceptive compliance. Contraception, 2013. 87(2): p. 176-81. 96. Pedersen, C., et al., Late pregnancy thyroid-binding globulin predicts perinatal depression. Psychoneuroendocrinology, 2016. 65: p. 84-93. 97. Waller, C.C. and M.D. McLeod, A review of designer anabolic steroids in equine sports. Drug Test Anal, 2017. 9(9): p. 1304-1319. 98. Basaria, S., Androgen abuse in athletes: detection and consequences. J Clin Endocrinol Metab, 2010. 95(4): p. 1533-43. 99. Soma, L.R., et al., Pharmacokinetics of boldenone and stanozolol and the results of quantification of anabolic and androgenic steroids in race horses and nonrace horses. J Vet Pharmacol Ther, 2007. 30(2): p. 101-8. 100. Cowan, D.A., et al., Effect of administration of human chorionic gonadotrophin on criteria used to assess testosterone administration in athletes. J Endocrinol, 1991. 131(1): p. 147-54. 101. Parlevliet, J.M., et al., Effect of GnRH and hCG administration on plasma LH and testosterone concentrations in normal stallions, aged stallions and stallions with lack of libido. Vet Q, 2001. 23(2): p. 84-7. 102. Esteller-Vico, A., et al., Endocrine changes, fetal growth, and uterine artery hemodynamics after chronic estrogen suppression during the last trimester of equine pregnancy. Biol Reprod, 2017. 96(2): p. 414-423. 103. Spencer, C.A., Assay of Thyroid Hormones and Related Substances, in Endotext, L.J. De Groot, et al., Editors. 2000: South Dartmouth (MA). 104. Roser, J.F. and J.P. Hughes, Seasonal effects on seminal quality, plasma hormone concentrations, and GnRH-induced LH response in fertile and subfertile stallions. J Androl, 1992. 13(3): p. 214-23. 105. Huszenicza, G., et al., Relationship between thyroid function and seasonal reproductive activity in mares. J Reprod Fertil Suppl, 2000(56): p. 163-72. 106. Kojima, N., et al., Age- and sex-related differences of serum thyroxine binding globulin (TBG) in healthy subjects. Acta Endocrinol (Copenh), 1983. 104(3): p. 303-6. 107. Glinoer, D., et al., Regulation of maternal thyroid during pregnancy. J Clin Endocrinol Metab, 1990. 71(2): p. 276-87.

108. Glinoer, D., The regulation of thyroid function in pregnancy: pathways of endocrine adaptation from physiology to pathology. Endocr Rev, 1997. 18(3): p. 404-33. 109. Glinoer, D., Increased TBG during pregnancy and increased hormonal requirements. Thyroid, 2004. 14(6): p. 479-80; author reply 480-1. 110. Elmlinger, M.W., et al., Reference intervals from birth to adulthood for serum thyroxine (T4), triiodothyronine (T3), free T3, free T4, thyroxine binding globulin (TBG) and thyrotropin (TSH). Clin Chem Lab Med, 2001. 39(10): p. 973-9. 111. Emmanuel, M. and B.R. Bokor, Tanner Stages, in StatPearls. 2018: Treasure Island (FL). 112. Fragkaki, A.G., et al., Structural characteristics of anabolic androgenic steroids contributing to binding to the androgen receptor and to their anabolic and androgenic activities. Applied modifications in the steroidal structure. Steroids, 2009. 74(2): p. 172-97. 113. Olvey, D.N., R.E. Cutler, and J.T. Dowling, Thyroxine-Binding by the Throxine- Binding Globulin as a Measure of the Anabolic Activity of Congeners of Testosterone. Metabolism, 1965. 14: p. 891-8.

Vita

Blaire O’Neil Fleming

Education

2015 Mississippi State University, Starkville, Mississippi Bachelor of Science Department of Animal Science

Experience

2015 – 2018 Graduate Research Assistant Maxwell H. Gluck Equine Center University of Kentucky Department of Veterinary Science

2013 – 2014 Undergraduate Research Assistant Mississippi State University Department of Animal Science

Presentations

Effects of dietary melatonin supplementation on total serum nitrites and antioxidant capacity of late gestating Holstein heifers. Invitational Research Paper Undergraduate Student Oral Competition. ASAS-ADSA Midwest Conference. March 2014, Des Moines, IA.

Effects of dietary melatonin supplementation on total serum nitrites and antioxidant capacity of late gestating Holstein heifers. Undergraduate Research Symposium at Mississippi State University. April 2014, Starkville, MS.

Sex Hormone-Binding Globulin in the horse. Conference of the Center for Clinical and Translational Science, 35th Annual Symposium in Women’s Health and Reproductive Science. April 2016, Lexington, KY.

Awards

1st Place. Invitational Research Paper Undergraduate Student Oral Competition. ASAS- ADSA Midwest Conference. March 2014, Des Moines, IA. 2nd Place. Undergraduate Research Symposium at Mississippi State University in the Biological Sciences and Engineering section. April 2014, Starkville, MS.

Publications

Abstracts

Fleming, B. O., K. E. Brockus, C. G. Hart, and C. O. Lemley. 2014. Effects of supplementing Holstein heifers with dietary melatonin during late gestation on serum antioxidant capacity and anti-Müllerian hormone of offspring. Journal of Animal Science. (Accepted). Fleming, B. O., K. E. Brockus, C. G. Hart, and C. O. Lemley. 2014. Effects of dietary melatonin supplementation on total serum nitrites and antioxidant capacity of late gestating Holstein heifers. Journal of Animal Science. 92 (Supplement 2):244. Fleming, B.O., A. Esteller-Vico, K. E. Scoggin, B. A. Ball. 2017. Evaluation and characterization of sex hormone-binding globulin (SHBG) and thyroxine-binding globulin (TBG) in the horse: Potential biomarkers for anabolic-androgenic steroid abuse. Society for the Study of Reproduction 50th Annual Meeting

A. Esteller-Vico, P. Dini, T. Kalbfleisch, B.O. Fleming, B.A. Ball. 2017. Novel sex determination of early equine embryos: genotyping, variant discovery and sexually dimorphic gene expression of Chromosome X using Next Generation Sequencing data. Society for the Study of Reproduction 50th Annual Meeting

Peer Reviewed Publications

Brockus, K. E., C. G. Hart, B. O. Fleming, T. Smith, S. H. Ward, and C. O. Lemley. 2016. Effects of supplementing Holstein heifers with dietary melatonin during late gestation on growth and cardiovascular measurements of their offspring. Reproduction in Domestic Animals. 51:240-247.

Publications in Preparation

B.O. Fleming, A. Esteller-Vico, S.E. Loux, K.E. Scoggin, B.A. Ball. Characterization of androgen-binding protein and sex hormone-binding globulin in the horse

B.O. Fleming, A. Esteller-Vico, S.E. Loux, K.E. Scoggin, B.A. Ball. Characterization of thyroxine-binding globulin in the horse and evaluation of circulating levels in response to increased androgen concentrations

B. A. Ball, G. M. Davolli, Alejandro Esteller-Vico, Blaire Fleming, Michelle A. Wynn, A. J. Conley. Inhibin-A and Inhibin-B in stallions: Seasonal changes and changes after down-regulation of the hypothalamic-pituitary-gonadal axis