Regulation of Cdc18 and Cdt1 Restricts S phase to Once Per Ceii Cycie in Fission Yeast
Thesis presented for the degree of
Doctor of Philosophy
University of London
by Stephanie Kim Yanow
Cell Cycle Laboratory
Imperial Cancer Research Fund
44 Lincoln’s Inn Fields, London
Supervisor; Dr. Paul Nurse
May, 2001 ProQuest Number: U642466
All rights reserved
INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.
ProQuest U642466
Published by ProQuest LLC(2015). Copyright of the Dissertation is held by the Author.
All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC.
ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 Abstract
In all eukaryotes, it is essential that cells maintain a strict control over S phase to ensure that DNA replication occurs once, and only once, per cell division cycle. To achieve this, cells must promote DNA replication during the G1 phase and then repress DNA replication during the G2 phase. In the fission yeast
Schizosaccharomyces pombe, two proteins required for the initiation of DNA replication, Cdcl8 and Cdtl, may be important for this control over DNA replication.
CdcI8 and Cdtl are both upregulated in G1 and have an essential function in initiation, and are then efficiently downregulated in G2.
In this thesis, I have tested whether the downregulation of these initiation factors is important to repress DNA synthesis in G2. I have found that the accumulation of high levels of Cdcl8 are sufficient to induce origin firing in G2 cells and drive re-replication in the absence of mitosis. This re-replication is potentiated by the co-expression of Cdtl, which may be mediated by the stabilisation of Cdcl8 on chromatin by Cdtl. Biochemical characterisation of these re-initiation events revealed that certain aspects of this re-replication are similar to those observed in wild type S phase cells, such as the requirement for the MCMs and the cyclin-dependent kinase
Cdc2. However, these cells fail to undergo complete and efficient replication of the chromosomes suggesting that Cdcl8 and Cdtl can override the normal controls that block initiation, but this mechanism does not fully mimic initiation in a G1 cell.
The findings presented in this thesis have identified and characterised multiple, overlapping mechanisms that downregulate Cdcl8 and Cdtl in G2. If these mechanisms are disrupted and Cdel8 and Cdtl are allowed to accumulate in G2, replication competence can be re-established and cells re-replicate. Therefore, Cdcl8 and Cdtl form the core of the control which licenses chromosomes for replication. Acknowledgements
I’d like to begin by thanking my supervisor, Paul Nurse, for giving me a chance in the first place. I thank him for his support and enthusiasm, and for playing the optimist in the face of my cynicism. It was an invaluable privilege to have Paul as a mentor, one which I will always appreciate and draw upon for inspiration.
I would like to say a special thanks to all the members of the Cell Cycle lab, past and present, for their endless help, for their friendship, and for making London home. In particular. I’d like to thank Zoi Lygerou for guiding me through the minefield of biochemistry, my neighbour José Ayté for always knowing the answers and for his patience in explaining them, thanks to Buzz Baum who taught me everything I know about yeast although I hadn’t realised it, and to Jacky Hayles for teaching me everything I know about yeast the second time around. Thank you to Anabelle Decottignies for her friendship and for the Belgian treats that have sustained me through the writing of this thesis. Thank you to Emma Greenwood for being a friend in and outside the lab, and for interesting discussions on the perplexities of CdcI8.
I am also grateful to my dear friends from home, Maija Harju, Rachel Somerfield, and Rosalyn Trigger, for indulging me in my rants and raves, for uplifting emails and welcomed diversions from the frustrations of science.
Most especially, I would like to thank my parents, Nycole and Joel Yanow, and my brother Stuart for their love, encouragement and interest, and for always standing by me from across the pond.
Finally, I would like to thank Wayne Sossin for introducing me to the wonders of lab life all those years ago, and for rescuing me from the cold room on my first day.
This PhD was funded by a scholarship from the Natural Sciences and Engineering Research Council of Canada, an Athlone-Vanier Fellowship from the British Council, an Overseas Research Studentship from University College London, by a grant to Paul Nurse from the Association for International Cancer Research, and by the Imperial Cancer Research Fund. This thesis is dedicated to my husband Bradley, for every moment shared and those that lie ahead. Table of Contents
Abstract...... 2 Acknowledgements...... 3 Table of Contents...... 5
List of Figures and Tables...... 8 List of Abbreviations:...... 10 Publications Arising From This Thesis...... 12 Notes on Collaborative Work...... 12 Chapter 1 : An Overview of the Cell Cycle ...... 14 1.1 General overview of the mitotic cell cycle ...... 15 1.2 The core cell cycle machinery ...... 17 1.2.1 Identification o fC d...... c2 17 1.2.2 The cyciins...... 19 1.2.3 Regulation of CDKs: phosphorylation...... 22 1.2.4 Regulation of CDKs: cyclin proteolysis...... 25 1.2.5 Regulation of CDKs: CDK inhibitors...... 27 1.2.6 The Cdc2 cycie...... 29 1.3 Regulation of S phase onset ...... 31 1.3.1 The repiicator sequence...... 31 1.3.2 The repiication initiator: ORC...... 34 1.3.3 Assembly of the pre-repllcative complex...... 36 1.3.4 Formation of the pre-initiation complex: ...... Cdc45 39 1.3.5 Activation of the pre-initiation complex: S-CDKs and Dbf4/Cdc7...... 40 1.4 Mechanisms that restrict S phase to once per cell cycle ...... 43 1.5 Specific aims ...... 49 Chapter 2: CdcIS Expression in G2 Cells Induces DNA Synthesis...... 55 Chapter Summary ...... 56 2.1 Introduction...... 57 2.2 Results ...... 58 2.2.1 Cdc18 and Cdtl are downregulated in G2...... cells 58 2.2.2 Cdc18 induces DNA synthesis in G2 cells...... 59 2.2.3 Replication origins re-fire illegitimately in G2 cells overexpressing...... Cdc1861 2.2.4 Association of initiation factors with chromatinduring re-replication...... from64 G2 2.2.5 Cdc21 is genetically required for re-repiication...... inG2 67 2.3 Discussion...... 68 Chapter 3: Cdt1 Potentiates the Re-replication Inducedby O d d 8 in G 2 ...... 87 Chapter Summary ...... 88 3.1 Introduction...... 89 3.2 Results...... 90 3.2.1 Cdt1 potentiates the re-repiication induced by O d...... d 8 in G 2 90 3.2.2 The effects of Cdt1 on origin ...... firing 92 3.2.3 Re-replication does not require continuing protein...... synthesis 95 3.2.4 Cdt1 does not promote Cdc21 chromatin association...... in G 2 97 3.3 Discussion...... 98 Chapter 4: The Role of Cdc2 in Re-replication ...... 120 Chapter Summary ...... 121 4.1 Introduction...... 122 4.2 Results...... 123 4.2.1 Cdc2 is required for O dd 8-induced re-repiication...... 123 4.2.2 inhibition of Cdc2 is not a pre-requisite for re-repiication...... 125 4.2.3 Two mechanisms repress DNA replication ...... in G2 127 4.2.4 Preliminary characterisation of Cdtl regulation...... 132 4.3 Discussion...... 133 Chapter 5: General Discussion...... 149 5.1 Discussion...... 150 5.1.1 The mechanism of re-initiation...... 150 5.1.2 Origin firing and the kinetics of re-repiication...... 154 5.1.3 Mechanisms to repress DNA synthesis in...... G2 159 Chapter 6: Materials and Methods ...... 166 6.1 Fission yeast physiology and genetics ...... 167 6.1.1 Nomenclature for gene names and proteins...... 167 6.1.2 Strain growth and maintenance...... 167 6.1.3 Nomenclature for integrants and plasmids...... 168 6.1.4 Strain construction...... 169 6.1.5 Transformation and integration of plasmids...... 170 6.1.6 induction of gene expression from the nmt promoter...... 170 6.1.7 Shift experiments with temperature-sensitive mutants...... 171 6.1.8 Physioiogical experiments with hydroxyurea...... 171 6.1.9 Fiow cytometric analysis...... 171 6.1.10 Ceil number determination...... 172 6.1.11 Visualisation o f nuclei by DAPi staining...... 172 6.1.12 Visualisation of GPP...... 172 6.2 Molecular Biology Techniques ...... 172 6.2.1 General techniques...... 172 6.2.2 Preparation of genomic DNA for two-dimensional gel electrophoresis...... 173 6.2.3 2D gel conditions...... 174 6.2.4 Southern blotting for 2D ...... gels 174 6.2.5 Probes for 2D gels...... 175 6.2.6 Ceil extract preparation...... 175 6.2.7 Chromatin association assay...... 176 6.2.8 Western blotting...... 176 Bibliography...... 178 List of Figures and Tables
Chapter 1 : An Overview of the Cell Cycle
Figure 1.1 The fission yeast mitotic cell cycle ...... 50 Figure 1.2 Regulation of the cyclin/CDK complex ...... 51 Figure 1.3 The quantitative model ...... 52 Figure 1.4 Assembly and activation of the pre-RC ...... 53 Table 1.1 Regulation of pre-RC components in eukaryotes ...... 54
Chapter 2: Cdc18 Expression in G2 Cells Induces DNA Synthesis
Figure 2.1 Characterisation of initiation factors in cdc25-22 cells...... 72 Figure 2.2 Overexpression of cdc18+ incdc25-22 cells...... 73 Figure 2.3 CdcIS induces DNA synthesis incdc25-22 arrested cells ...... 74 Figure 2.4 Two dimensional gel electrophoresis ...... 75 Figure 2.5 Replication intermediates detectable by 2D gel electrophoresis ...... 76 Figure 2.6 Schematic of the rDNA repeats containing ars3001 ...... 77 Figure 2.7 2D gel patterns for ars3001 ...... 78 Figure 2.8 Overexpression of CdcIS in cdc25-22 cells induces origin firing...... 79 Figure 2.9 Origin re-firing is restricted to ARS sequences...... SO Figure 2.10 Assay for chromatin associated proteins ...... 81 Figure 2.11 Chromatin association of initiation factors ...... 82 Figure 2.12 Association of CdcIS with chromatin is Orpi dependent ...... S3 Figure 2.13 Re-replication requires functional O rp i ...... 84 Figure 2.14 Odd 8 overexpression in cdc25-22 cdc21-M68 nmt1-cdc18+ cells...... 85 Figure 2.15 Cdc21 is required for re-replication in cdc25-22 nmt1-cdc18+ cells...... 86
Chapter 3: Cdt1 Potentiates the Re-repiication Induced by O dd8 in G2
Figure 3.1 Cdtl potentiates Cdcl 8-induced re-replication ...... 104 Figure 3.2 Cells co-expressing Cdtl and CdcIS in 02 exhibit a dramatic re-replication phenotype ...... 105 Figure 3.3 Kinetics of Cdtl - and Cdcl 8-induced re-replication in 0...... 2 106 Figure 3.4 Co-expression of Cdtl and CdcIS decreases cell viability ...... 107 Figure 3.5 Origin firing in cells overexpressing CdcIS and Cdtl...... 108 Figure 3.6 Replication intermediates accumulate in response to HU...... 109 Figure 3.7 Accumulation of stalled replication bubbles in re-replicating cells...... 110 Figure 3.8 Origin firing persists longer in cells expressing Cdtl and CdcIS...... I l l Figure 3.9 Effects of hydroxyurea on re-replication ...... 112 Figure 3.10 Origin specificity is maintained in Cdtl expressing cells...... 113 Figure 3.11 No bubbles accumulate in non-origin regions of re-replicating cells...... 114 Figure 3.12A Re-replicating cells do not require continuing protein synthesis...... 115 Figure 3.12B Cdcl 8 and Cdtl accumulate in the presence of cycloheximide ...... 116 Figure 3.13 Chromatin association of initiation factors in response to C dtl...... 117 Figure 3.14 Re-replication by Cdcl8 and Cdtl in a Cdc21 mutant...... 118 Figure 3.15 DNA synthesis can occur in the absence of functional Cdc21 in Cdtl and Cdcl 8 overexpressing cells ...... 119
Chapter 4; The Role of Cdc2 in Re-replication
Figure 4.1 Cdcl 8-induced re-replication requires Cdc2 ...... 137 Figure 4.2 Cdc2 is not required for Cdcl 8 to bind chromatin ...... 138 Figure 4.3 Cdcl8 can induce re-replication when Cig2 is co-expressed in G2...... 139 Figure 4.4 The C-terminus of Cdcl8 can induce re-replication in G2 as efficiently as the full-length protein...... 140 Figure 4.5 Rumi does not accumulate in cells re-replicating from G2...... 141 Figure 4.6A Cdtl expressed in G2 with the stable form of Cdcl8 induces re-replication ...... 142 Figure 4.6B Co-expression of Cdtl with the stable form of Cdcl 8 induces origin firing in G2143 Figure 4.7 Cdcl8 accumulates in the presence of C dtl...... 144 Figure 4.8 Cdtl expression in G2 allows the stable form of Cdcl 8 to accumulate ...... 145 Figure 4.9 Cdtl may stabilise exogenous wild type Cdcl 8 ...... 146 Figure 4.10 Orp2 is dephosphorylated and Cdtl is absent in cdc2-M26 orp2-proteinA arrested cells ...... 147 Figure 4.11 Cdtl is regulated differently from Cdcl 8 during mitosis ...... 148
Chapter 5: General Discussion
Figure 5.1 Two models for re-initiation ...... 163 Figure 5.2 Mechanisms that accelerate the kinetics of re-replication ...... 164 Figure 5.3 Repression of DNA synthesis in G2 requires downregulation of Cdcl 8 and Cdtl 165
Chapter 6: Materials and Methods
Table 6.1 Fission yeast strains...... 168 Table 6.2 Antibodies used for Western blotting...... 177 List of Abbreviations anaphase promoting complex/cyclosome (APC/C) autonomously replicating sequence (ARS) base pairs (bp)
Cell Cycle Laboratory (CCL) cell division cycle (cdc) cyclin-dependent kinase (CDK) cyclin-dependent kinase inhibitor (CKI) cyclin-dependent kinase-activating kinase (CAK) cycloheximide (CYH)
DNA synthesis phase (8 phase)
Escherichia coii (E.coii) green fluorescent protein (GFP) hydroxyurea (HU) maturation promoting factor (MPF) minichromosome maintenance protein (MCM) mitotic phase (M phase) origin recognition complex (ORC) origin recognition complex subunit from S.pombe (Grp) pre-initiation complex (pre-IC) pre-replicative complex (pre-RC) proliferating cell nuclear antigen (PCNA) replication protein A (RPA) restriction point (R-point) ribosomal DNA (rDNA)
10 s phase cyclin-dependent kinases (S-CDKs)
Saccharomyces cerevisiae (S. cerevisiae)
Schizosaccharomyces pombe {S.pombe) thiamine (T) two-dimensional (2D)
11 Publications Arising From This Thesis
Baum, B., Nishitani, H., Yanow, S. and Nurse, P. (1998) CdcIS transcription and proteolysis couple S phase to passage through mitosis.EMBO J 17, 5689-98.
Yanow, S.K., Lygerou, Z. and Nurse, P. (2001) Cdcl8/Cdc6 is sufficient to break the block over origin firing in G2 cells. (Submitted).
Yanow, S.K. and Nurse, P. (2001) De-regulation of Cdtl and CdcIS promotes persistent origin firing in fission yeast G2 cells. (Submitted).
Notes on Collaborative Work
My contribution to the work published by Baum et al., (1998) consists of experiments showing that the unphosphorylatable CdcIS mutant is stable in a cdc25-22 and nda2- km311 block. These results have not been presented in this thesis but form the basis for several experiments presented in Chapter 4.
The paper submitted for publication entitled “Cdcl8/Cdc6 is sufficient to break the block over origin firing in G2 cells” consists entirely of my own work. Zoi Lygerou contributed technical advice on the chromatin association assays.
12 “There is no light at the end of the tunnel, only a pack of matches handed down from one generation to the next.”
JonArno Lawson,Bad News, inThe Noon Whistle, 1996
13 Chapter 1 : An Overview of the Cell Cycle
14 Chapter 1 Introduction
1.1 General overview of the mitotic cell cycle
The faithful transmission of genetic material from one cell to another is essential for
the survival of all organisms. The fundamental events underlying this process are the
duplication and segregation of chromosomes followed by division of the cell to
generate two daughter cells containing identical copies of the parental DNA. In
eukaryotes, these events are confined to specific phases of the cell division cycle; the
duplication of chromosomes is restricted to the DNA synthesis phase (S phase) and
their segregation occurs during the mitotic phase (M phase). These phases are often
separated by two gap phases, named G1 and G2, which generally correspond to
periods of cell growth. The ordered progression of a newly divided cell from Gl-S-
G2-M forms the basis of the archetypal mitotic cell cycle.
In this chapter, I will provide an introduction to the mechanisms that control
the cell cycle and how these function to bring about the specific events of DNA
replication and mitosis. Our current view of how the cell cycle operates stems from
the work carried out in a variety of experimental systems from yeast to humans but
the fundamental concepts and mechanisms appear to be highly conserved. Since the
work presented in this thesis is entirely based on experiments carried out in the
fission yeast Schizosaccharomyces pombe, I will focus on the fission yeast cell cycle, but refer to work in other organisms for comparative purposes.
Once a cell becomes committed to the mitotic cell cycle, the process is irreversible. Therefore, cells must first evaluate whether the cell cycle is indeed the most viable option, a decision which takes place in G1 at a point referred to as Start in yeast (Hartwell et al ., 1974), and as the Restriction (R-) point in higher eukaryotes
(Pardee, 1974). In yeast. Start is classically defined as the period during which a cell maintains the ability to exit the mitotic cycle and initiate sexual development. If the
15 Chapter 1 Introduction
availability of nutrients is limited, cells may adopt an alternative developmental
pathway, conjugate, and enter the meiotic cell cycle. In higher eukaryotes, the R-point
is characterised by the ability of cells to respond to mitogens and at this stage cells
can decide to exit the cell cycle and remain in a quiescent state. Beyond this point,
cells become refractory to mitogenic signals and are committed to the mitotic cell
cycle.
After cells pass Start, DNA replication is initiated and cells enter S phase.
During this period, cells duplicate their chromosomes and cohesion is established
between the newly synthesised sister chromatids. In the G2 phase, cells undergo a
period of growth. In fission yeast, cells spend most of their life cycle in the G2 phase
and approximately double their mass before reaching the critical size required for
entry into mitosis (reviewed in Forsburg and Nurse, 1991a). The subsequent onset of
mitosis is marked by the loss of cohesion between sister chromatids, formation of a
bipolar spindle to which the kinetochores of each sister chromatid become attached,
and segregation of each chromatid to opposite poles. Upon exit from mitosis, the
spindle breaks down and cells form a septum which splits the cell in the middle by the process of cytokinesis. Fission yeast cells have a very short G1 period and
cytokinesis occurs at the same time as the S phase of the following cell cycle (figure
1.1).
This series of events is common to the mitotic cell cycles of most eukaryotic
organisms. Mammalian cells go through similar stages, except that the nuclear membrane is dissolved as cells enter mitosis. Also, the G1 phase is more critical in mammalian cells as extracellular signals must be integrated and cells decide whether to continue proliferating or exit the cell cycle and differentiate (reviewed in Planas-
Silva and Weinberg, 1997). InXenopus, early fertilised embryos undergo a series of
16 Chapter 1 Introduction
rapid cleavage divisions and have a modified cell cycle which consists merely of
alterating rounds of interphase, during which DNA replication takes place, and
mitosis, with no G1 or G2. After the midblastula transition, the G1 and G2 phases
appear and the mitotic cell cycle resembles the cycle described above for fission yeast
and mammalian cells (reviewed in Kirschner et al., 1985). In the budding yeast
Saccharomyces cerevisiae, the distribution of the G1 and G2 phases also differs from the fission yeast cell cycle. In these cells, a size control operates in G1 and represses the onset of S phase until cells reach a critical size. Once cells pass Start, they can then initiate mitotic events, such as spindle formation and budding, in parallel to
DNA replication. Therefore cells spend only a small, if any, part of the cell cycle in
G2. Also, budding yeast cells divide by a mechanism that allows the daughter cell to bud from the mother cell, instead of the symmetrical division that occurs in fission yeast and mammalian cells (reviewed in Forsburg and Nurse, 1991a).
1.2 The core cell cycle machinery
1.2.1 Identification of Cdc2
To understand the mechanics of the cell cycle requires the identification of the core components of the cell cycle machinery. The complementary findings of two different approaches, a genetical one and a biochemical one, led to the discovery of the master regulator of the eukaryotic cell cycle: the cyclin-dependent kinase (CDK).
The genetic approach involved the isolation of gene mutations that caused cell cycle arrest at the specific stage of the cell cycle when that gene product was required. In yeast, cells divide at approximately a constant size suggesting that cell growth is co ordinated with cell division (Mitchison and Creanor, 1971). While cell division is dependent on cells reaching a critical size, growth is not dependent on progression
17 Chapter 1 Introduction through the cell cycle (Mitchison, 1974). This observation formed the basis of genetic
screens of mutagenised yeast cells that continued to increase their cell size in the absence of cell division. Screens of this nature were carried out in both budding yeast
(Hartwell et a l, 1974) and fission yeast (Nurse et al., 1976; Nasmyth and Nurse,
1981), and led to the isolation of many conditional, temperature-sensitive mutants that underwent cell cycle arrest and displayed an elongated phenotype at the restrictive temperature, characteristic of the cdc (cell division cycle) phenotype
(Bonatti et a l, 1972).
Analysis of the transition points for these mutants identified the stage of the cell cycle at which the function of these genes was required and consequently led to the isolation of genes required for DNA synthesis, mitosis and cytokinesis. Of particular interest were mutations in the fission yeast cdc2 gene which exhibited defects in both DNA replication and nuclear division (Nurse and Thuriaux, 1980;
Nurse and Bissett, 1981). This unique property ofcdc2 mutants was similar to the phenotype observed for mutations in the CDC28 gene in budding yeast (Hartwell et ah, 1974) and complementation analysis showed that ectopic expression of the
CDC28 gene in fission yeast could complement the temperature-sensitive cell cycle arrest of the cdc2 mutant (Beach et a l, 1982). This functional homology was further highlighted by the isolation of a human clone that rescued the mutation in the fission yeast cdc2 gene (Lee and Nurse, 1987). These experiments therefore identified a conserved role for the cdc2 gene in the eukaryotic cell cycle.
Meanwhile, a biochemical approach was undertaken to examine the mechanism of oocyte maturation in the frog Rana pipiens. Injection of cytoplasm from mature oocytes into G2-arrested immature oocytes induced the first meiotic division by releasing a cytoplasmic factor termed ‘maturation promoting factor’
18 Chapter 1 Introduction
(MPF) (Masui and Markert, 1971; Smith and Ecker, 1971). MPF was subsequently
discovered as a mitotic inducer in somatic cells (Sunkara et ah, 1979; Kishimoto et
al., 1982). Using a cell-free system, MPF was purified by its ability to induce maturation in Xenopus oocytes in the absence of protein synthesis (Lohka et al.,
1988), and consisted of two proteins with molecular weights of 45KDa and 32KDa which also co-fractionated with histone HI kinase activity. Concurrently, molecular characterisation of the protein encoded by the cdc2 gene in fission yeast revealed that it encodes a 34KDa phosphoprotein that also has histone HI kinase activity (Simanis and Nurse, 1986). Given the requirement for MPF to induce mitosis and meiosis, and the analogous role for Cdc2 in fission yeast, antibodies against the conserved
PSTAIR motif in Cdc2 were tested against purified MPF and found to cross-react with a 34KDa protein, the Xenopus homologue of Cdc2 (Dunphy et al., 1988; Gautier et al., 1988). Similar experiments identified homologues of Cdc2 in starfish (Labbe et al., 1988) as well as a histone HI kinase activity purified from rat hepatoma cells with the same enzymatic properties as the kinase encoded by the CDC28 gene of S. cerevisiae (Langan et al., 1989). Collectively, these findings identified Cdc2/Cdc28 as a component of MPF and established Cdc2 as the key regulator of the onset of mitosis in all eukaryotes.
1.2.2 The cyciins
The Cdc2 kinase and its homologues are part of a family of cyclin-dependent kinases, or CDKs, that require the association of a cyclin partner. Cyciins were first identified in sea urchin eggs as highly unstable proteins that appeared following fertilisation and then oscillated with each subsequent cleavage division due to periodic proteolysis
(Evans et al., 1983). When MPF was purified from starfish oocytes, Cdc2 was
19 Chapter 1 Introduction associated with a 45KDa protein, Cyclin B, in a 1:1 stoichiometric complex (Labbe et al., 1989). Similarly, the antibody recognising the PSTAIR motif of Cdc2 in clam oocytes cross-reacted with two proteins corresponding to Cyclin A and Cyclin B
(Draetta et al., 1989). High kinase activity was associated with the Cdc2/Cyclin A and Cdc2/Cyclin B complexes at the onset of mitosis which was substantially decreased in interphase, suggesting that cyclin proteolysis may inactivate MPF to allow cells to exit from mitosis (Draetta et al., 1989).
The striking degree of functional similarity among Cdc2 homologues predicted that the cyciins would also constitute a highly conserved family of Cdc2- associated proteins. In fission yeast, at least five cyciins have been identified that interact with Cdc2: Cdcl3, Cigl, Cig2, Pud, Reml. The cdcl3 gene was cloned by complementation of the conditional cdcl 3-117 mutation and shares some sequence similarity with the cyciins identified in invertebrate systems (Booher and Beach,
1988; Hagan et a l, 1988). Cdc 13 is essential for mitotic entry and overexpression of both the fission yeast and human cdc2+ genes can suppress the temperature-sensitive phenotype of the c d c l3-117 mutant (Booher and Beach, 1988; Hagan et al., 1988) suggesting that Cdcl3 may form an active complex with Cdc2. Indeed, both Cdc2 and Cdc 13 co-immunoprecipitate each other and form a complex that is active at the onset of mitosis (Booher et al., 1989; Moreno et a l, 1989). As was shown for other cyciins, Cdc 13 protein levels oscillate throughout the cell cycle, peak at mitotic onset and are essentially undetectable as cells begin anaphase (Moreno et al., 1989).
The second cyclin, cigl, was cloned by a homology-based screen and plays a non-essential role in the transition from G1 to S phase (Bueno et a l, 1991). It forms a complex with Cdc2 and the associated kinase activity peaks in mitosis with similar kinetics to that observed for the Cdcl3/Cdc2 complex (Basi and Draetta, 1995). The
20 Chapter 1 Introduction cig2 gene was cloned by its ability to rescue a budding yeast strain lacking all three
G1 cyciins and independently as a suppressor of a temperature-sensitive mutation in the p a tl gene which regulates entry into the meiotic cell cycle (Bueno and Russell,
1993; Connolly and Beach, 1994; Obara-Ishihara and Okayama, 1994). Although cells deleted for cig2 are viable, cells exhibit a delay over the entry into S phase
(Bueno and Russell, 1993; Mondesert et al., 1996). The expression of both cig2 mRNA and protein is under strict cell cycle control and peaks at the onset of DNA replication (Connolly and Beach, 1994; Obara-Ishihara and Okayama, 1994;
Mondesert et al., 1996; Yamano et al., 2000). Similarly, the kinase activity associated with Cig2 peaks during S phase, consistent with its role in the initiation of DNA replication (Mondesert et al., 1996).
Two other cyciins have been identified in fission yeast although far less is known about their function. The Puc 1 cyclin plays a role in mitotic exit by inhibiting
G1 arrest in response to nitrogen starvation, possibly by downregulating Ruml, an inhibitor of Cdc2 (Forsburg and Nurse, 1991b; Forsburg and Nurse, 1994; Martin-
Castellanos et al., 2000). The Reml cyclin has been identified as having a specific function in meiosis (J. Ayté, in preparation).
In budding yeast, two classes of cyciins associate with the Cdc28 kinase: the
Clns and the Clbs. The three Cln cyciins are required for passage through Start and their associated kinase activity peaks in late G1 (Tyers et al., 1993). Cells deleted for any one of the CLN genes are viable, suggesting overlapping functions within this class of cyciins (Richardson et al., 1989). However, deletion of all three genes induces cell cycle arrest in G1 (Richardson et al., 1989). Within the Clb class, there are six cyciins: Clb 1-4 are required for the assembly of mitotic spindles and their kinase activity appears during G2 (Fitch et al., 1992; Richardson et al., 1992; Schwob
21 Chapter 1 Introduction and Nasmyth, 1993), while Clb5 and Clb6 are required for entry into S phase and their associated kinase activity peaks at the Gl-S transition (Epstein and Cross, 1992;
Schwob and Nasmyth, 1993). Extensive redundancy exists within the Clb class and any one of the mitotic Clb cyciins can promote DNA replication, although cells containing only Clb5 or Clb6 cannot complete nuclear division and cytokinesis
(Schwob et al., 1994 and references therein). However, cells lacking all six Clb cyciins fail to enter S phase and die (Schwob et al., 1994) indicating that the Cln and
Clb cyciins cannot functionally substitute for each other.
While yeast cells have only one CDK at the core of the cell cycle, higher eukaryotes have several CDKs which are complexed to various cyciins at different stages of the cell cycle. Each of these complexes functions during a defined window of the cell cycle to carry out specific functions. The D-type cyciins become complexed with Cdk4 and Cdk6 during Gl, Cyclin E and Cyclin A become complexed with Cdk2 at the onset of S phase, and the A and B-type cyciins complex with Cdkl, the closest homologue of yeast Cdc2, during mitosis (reviewed in Sherr,
1996).
1.2.3 Regulation of CDKs: phosphorylation
In fission yeast, the identification of cdc2 as a rate-limiting determinant of mitotic onset formed the basis for the genetic characterisation of genes that regulate Cdc2 activity. Genes carrying mutations that disrupted the timing of mitosis, either by accelerating or delaying the onset of cell division, were isolated as candidate positive or negative regulators of Cdc2. One such mutant was isolated on the basis that cells entered mitosis at a reduced size (Nurse, 1975). This mutant was described phenotypically as ‘w e e ’ and the gene was thus named w eel. This w ee mutant accelerated progression through G2 and compensated for its small size by extending
22 Chapter 1 Introduction the Gl phase of the subsequent cell cycle. While these wee cells were viable, when combined with a dominant mutation in the cdc2 gene which also causes a wee phenotype, these mutations were additive and lethal to the cell (Russell and Nurse,
1987). The double mutants underwent mitotic catastrophe due to premature entry into mitosis in the absence of complete DNA replication and chromosome segregation.
Cells in which the weel gene was deleted exhibited a similar wee phenotype as was observed in the temperature-sensitive mutant wee 1-50, while overexpression of weel+ increased the size at which cells divided, suggesting that Weel delays mitotic onset and functions as a dose-dependent inhibitor of Cdc2. Thus, the weel gene likely functions as a negative regulator of Cdc2 activity to repress mitosis.
Another regulator of Cdc2 was identified by the phenotype of the temperature-sensitive mutant cdc25-22 which arrested at the G2/M boundary and failed to undergo mitosis (Fantes, 1979). The wee 1-50 mutation suppressed the cell cycle arrest of the cdc25-22 mutant and cells were phenotypically wee (Fantes, 1979) while overexpression ofcdc25+ also resulted in a wee phenotype (Russell and Nurse,
1986). In combination, overexpression of cdc25+ in a wee 1-50 background induced mitotic catastrophe (Russell and Nurse, 1986). These genetic interactions suggested that Cdc25 and Weel exert their effects on mitosis independently of each other, and identified the cdc25 gene as a positive regulator of mitosis that counteracts the inhibitory effects of weel.
The control mechanisms that regulate Cdc2 activity were further elucidated from the cloning and biochemical characterisation of all three genes: cdc2, cdc25, and weel. The Cdc2 kinase is a phosphoprotein that is differentially phosphorylated during the cell cycle at two amino acid residues, threonine 167 and tyrosine 15.
Threonine 167 is phosphorylated by a CDK-activating kinase (CAK) which is
23 Chapter 1 Introduction thought to stabilise the interaction between the cyclin and Cdc2 and is required for
Cdc2 to be fully activated at the onset of mitosis (Gould et al., 1991; Buck et al.,
1995; Ross et al., 2000). During interphase, Cdc2 is phosphorylated at both residues but tyrosine 15 becomes dephosphorylated as cells enter mitosis (Gould and Nurse,
1989). Mutation of this tyrosine residue to phenylalanine induces premature mitosis, demonstrating that the dephosphorylation at this site is important for activation of
Cdc2. The kinase activity associated with Cdc2 also fluctuates during the cell cycle and the peak of activity correlates with the dephosphorylation of tyrosine 15 upon entry into mitosis (Moreno et al., 1989). Activation of the kinase is dependent on the cdc25 gene product (Moreno et al., 1989) and in accordance with this, cdc25 mRNA and protein levels peak at the G2/M boundary (Moreno et al., 1990). Cdc2 is phosphorylated on tyrosine in cells blocked at G2/M in a cdc25-22 arrest but then is rapidly dephosphorylated whencdc25 function is restored and cells enter mitosis
(Gould and Nurse, 1989).
These findings implicate Cdc25 as the phosphatase that activates Cdc2 through dephosphorylation on tyrosine 15. This was further supported by the finding that fission yeast Cdc2 can be dephosphorylated in vitro and in vivo by a human protein-tyrosine phosphatase and that this is sufficient to activate the kinase (Gouldet al., 1990). In starfish, an increase in the kinase activity of Cdc2 correlates with its dephosphorylation (Labbe et al., 1989) and the addition of purified human Cdc25 protein is sufficient to trigger the dephosphorylation of Cdc2 and activate its kinase activity in vitro (Strausfeld et al., 1991). Similarly, purified Cdc25 from Drosophila and humans activates MPF in X e n o p u s extracts by inducing tyrosine dephosphorylation of Cdc2 (Kumagai and Dunphy, 1991; Gautieret al., 1991; Lee et
24 Chapter 1 Introduction ah, 1992). Together, these results support a conserved role for Cdc25 as an activator of the Cdc2 kinase by dephosphorylating the inhibitory tyrosine residue.
The cloning of w eel revealed that it encodes a protein kinase with dual specificity for serine and tyrosine residues (Featherstone and Russell, 1991; Parker et al., 1992). Given the strong genetic evidence that Cdc25 and Weel have opposing functions in Cdc2 regulation, it was tested whether Weel is the kinase that phosphorylates Cdc2 on tyrosine. Indeed, Weel was shown to phosphorylate Cdc2 on tyrosine in vitro which inhibited its associated histone HI kinase activity (Parker et al., 1992). Furthermore, in the absence of both w eel and a partially redundant gene m iki (Lee et al., 1994), Cdc2 remained dephosphorylated on tyrosine 15 and cells underwent a lethal mitosis (Lundgren et al., 1991).
Characterisation of Cdc25 and Weel as the key positive and negative regulators of Cdc2 activity explained how the balance between these proteins determines the timing of mitotic onset. However, each of these regulators is in turn under cell cycle control. The localisation of Cdc25 varies during the cell cycle; Cdc25 is retained in the cytoplasm during G1 and S phase by a 1435 protein, and is then released and imported into the nucleus during G2 (Zeng and Piwnica-Worms, 1999).
The Weel kinase is negatively regulated by the Niml/Cdrl and Cdr2 proteins
(Russell and Nurse, 1987; Parker et al., 1993; Breeding et al., 1998; Kanoh and
Russell, 1998) and Niml/Cdrl is itself negatively regulated by Nifl (Wu and Russell,
1997).
1.2.4 Regulation of CDKs: cyclin proteolysis
In early cleavage embryos MPF activity oscillates, peaking during mitosis and then rapidly decreasing. These fluctuations arise from the periodic proteolysis of the cyclin subunit and not due to changes in the levels of Cdc2. Truncation of the first 90 amino
25 Chapter 1 Introduction acids at the N-terminus of the sea urchin Cyclin B renders the protein indestructable and is sufficient to arrest cells in mitosis (Murray et al., 1989). This led to the identification of a 9 residue motif, termed the ‘destruction box’, within the amino terminus of cyclins that is sufficient for cyclin proteolysis via the ubiquitin-dependent pathway (Glotzer et al., 1991). This pathway recognises polyubiquitinated substrates which are then targeted to a 26S multisubunit protease complex called the proteasome
(Coux et al., 1996; Baumeister et al., 1998). Three enzymatic activities are required for the transfer of a protein to the proteasome: a ubiquitin-activating enzyme (El), a ubiquitin-conjugating enzyme (E2), and a ubiquitin ligase (E3) (Hershko et al., 1994;
King et al., 1995; Sudakin et al., 1995; Irniger et a l, 1995). While the El and E2 enzymes are constitutively active throughout the cell cycle, the ligase component is active only in mitotic extracts. This 20S ligase complex is required for mitotic events in all eukaryotes including sister chromatin separation, spindle elongation, and cyclin destruction and was thus termed the anaphase-promoting complex or cyclosome
(APC/C) (reviewed in Zachariae and Nasmyth, 1999). In budding yeast, activation of the APC/C is controlled by genes involved in the mitotic exit pathway, ultimately leading to the destruction of the Clb cyclins (reviewed in Morgan, 1999). Mutations in these genes arrests cells in mitosis with high CDK activity (Jaspersen et al., 1998;
Charles et al., 1998) supporting the fact that inactivation of the cyclin/CDK complex by cyclin destruction is necessary for cells to exit mitosis.
In fission yeast, the Cdcl3 cyclin contains a destruction box which is essential for its recognition by the APC/C during mitosis (Yamano et a l, 1998). Expression of a non-destructible Cdcl3 protein lacking this destruction box is sufficient to arrest cells in anaphase (Yamano et al., 1996). Cig2 is also degraded by the APC/C during anaphase in a destruction-box dependent fashion, although additional mechanisms
26 Chapter 1 Introduction exist to regulate Cig2 during other phases of the cell cycle (Yamano et al., 2000).
These results demonstrate that a conserved mechanism exists in all eukaryotes to irreversibly inactivate cyclin/CDK complexes at the end of mitosis.
1.2.5 Regulation of CDKs: CDK inhibitors
A third mechanism regulates the activity of CDKs during the cell cycle: direct inhibition by cyclin-dependent kinase inhibitors (CKIs). Probably the best characterised CKIs in yeast are Sid in budding yeast and Ruml in fission yeast. Sicl functions as both a substrate of Cdc28 (Reed et ah, 1985) and an inhibitor of Cdc28 kinase activity (Mendenhall, 1993). Sicl accumulates upon exit from mitosis until the onset of S phase, at which point it functions as a specific inhibitor of Clb-associated kinase activity (Schwob et al., 1994; Bai et al., 1996). Cln/CDKs are insensitive to
Sicl inhibition and when they become activated late in Gl, Cln/CDKs phosphorylate
Sicl which targets it for ubiquitin-mediated proteolysis (Verma et al., 1997). The destruction of Sicl relieves the inhibition of Clb/CDKs and promotes the onset of S phase (Verma et al., 1997). This mechanism of Sicl-dependent inhibition during Gl is thought to prevent premature activation of Clb/CDKs before activation of the
Cln/CDKs, ensuring that DNA replication and budding are initiated after passage through Start.
The Ruml protein functions in a homologous fashion to Sicl as a specific inhibitor of mitotic CDKs in Gl. Expression of Sicl in fission yeast complements all the defects of a ruml deletion and Ruml can substitute for Sicl in budding yeast
(Sanchez-Diaz et al., 1998). In fission yeast, Ruml is required in situations in which
Gl must be extended, for example in a wee 1-50 mutant, or to induce cell cycle arrest in Gl in the absence of the Start gene cdclO or under low nutrient conditions
(Moreno et al., 1994; Moreno and Nurse, 1994; Labib et al., 1995). Ruml
27 Chapter 1 Introduction accumulates during Gl (Benito et al., 1998) and specifically inhibits Cdcl3/Cdc2 kinase activity through direct interaction with the complex (Moreno and Nurse, 1994;
Correa-Bordes and Nurse, 1995; Jallepalli and Kelly, 1996; Martin-Castellanos et al.,
1996; Correa-Bordes and Nurse, 1997). Ruml also promotes the proteolysis of Cdcl3 in early G1-arrested cells (Correa-Bordes and Nurse, 1995; Correa-Bordes and Nurse,
1997). These mechanisms ensure that a cell arrested in Gl prior to Start maintains only a low level of Cdcl3/Cdc2 kinase activity to prevent premature entry into mitosis from Gl. During S phase and G2, Ruml is phosphorylated by Cigl/Cdc2 which targets the protein for ubiquitin-mediated proteolysis, and reverses the inhibition over mitosis (Correa-Bordes and Nurse, 1997; Benito et al., 1998).
Another CDK inhibitor in fission yeast is the Sucl protein. Although little is known about its specific function, it inhibits Cdcl3/Cdc2 kinase activity and is required as an additional mechanism to promote mitotic exit (Basi and Draetta, 1995).
Cells depleted of Sucl accumulate Cdcl3 and Cdcl3/Cdc2 kinase activity causing cells to arrest with condensed chromosomes. Sucl has also been shown to inhibit
MPF activity m Xenopus egg extracts (Dunphy et al., 1988).
In mammalian cells, a vast array of CKIs control the activities of various cyclin/CDK complexes. Generally, the CKIs can be classified into two families: the
INK4 proteins (pi6 , p i 5, p i8 , and p i9) and a second group consisting of p21^^^\
p2 7 KiPi^ and p57^^^^ (reviewed in Sherr, 1996). The INK4 inhibitors are specific for
Cyclin D-dependent kinase complexes and ectopic expression arrests cells in Gl. The
P 2 7 KIP1 negatively regulates Cyclin D-, E-, and A- dependent kinases and plays a critical role in the R-point transition. In response to mitogens, p27^^^^ is degraded, relieving inhibition over Cyclin E/Cdk2 and Cyclin A/Cdk2. These activated complexes can then trigger the R-point transition and promote the
28 Chapter 1 Introduction transcription of S phase genes (reviewed in Sherr, 1996). Recent work has also shown that the ubiquitin-dependent degradation of p27^^^^ requires the mammalian homologue of Sucl (Ganoth et a l, 2001). This supports an additional role for Sucl in the transition from Gl to S phase and suggests that CKIs may regulate the activity of other CKIs at different stages of the cell cycle.
In summary, eukaryotic cells have evolved several mechanisms to regulate the the cyclin/CDK complex at the core of the cell cycle machinery (illustrated in figure
1.2). Reversible mechanisms such as phosphorylation and inhibition by CKIs regulate entry into the cell cycle and promote the ordered progression of cell cycle events while irreversible proteolysis of mitotic cyclins ensures completion and exit from mitosis.
12.6 The Cdc2 cycle
In yeast, the cell cycle is controlled by a single CDK that becomes complexed to different cyclin partners during the cell cycle. Do the different cyclin/CDK complexes have distinct functions or is there redundancy in the system? In fission yeast, the answer to this question is yes on both counts. Cdcl3 complexed with Cdc2 can promote ordered progression through the entire cell cycle, but Cigl/Cdc2 and
Cig2/Cdc2 cannot (Fisher and Nurse, 1996). In the absence of Cigl and Cig2, CdcI3 can bring about the onset of both DNA replication and then mitosis (Fisher and
Nurse, 1996). In contrast, Cig2, and only partially Cigl, are capable of promoting
DNA replication in the absence of Cdcl3 but neither can promote mitosis. This suggests that the requirement for CDK activity to promote DNA replication is less specialised than that required for the onset of mitosis (Fisher and Nurse, 1996).
How does a single CDK promote alternating rounds of DNA replication and mitosis? One explanation is proposed by the quantitative model, in which the fission
29 Chapter 1 Introduction yeast cell cycle is generated by a single oscillation in Cdc2 kinase activity and the various events controlled by CDK activity, such as DNA replication and mitosis, are induced once a threshold of Cdc2 activity is reached (Fisher and Nurse, 1996). The quantitative model contends that when Gl cyclins activate Cdc2 to a sufficiently high level S phase will be induced, then when the Cdc2 activity associated with the mitotic cyclin accumulates during 02 and surpasses a higher threshold, mitosis will be induced (figure 1.3). Proteolysis and inhibition of the mitotic cyclin/Cdc2 complex upon exit from mitosis then re-sets the cycle back to Gl (Fisher and Nurse, 1996).
Validation of this model is supported not only by the finding that Cdcl3/Cdc2 can promote both S phase and mitosis (Fisher and Nurse, 1996), but also from studies on re-replication. Depletion of Cdcl3 in G2 induces fission yeast cells to undergo multiple discrete rounds of DNA replication without intervening mitoses (Hayles et al., 1994). In the absence of Cdcl3/Cdc2 complexes in G2, cells fail to accumulate enough kinase activity to undergo mitosis and instead re-set the cell cycle back to Gl and promote another round of S phase. This re-replication is dependent on the presence of Cigl or Cig2, either of which can support DNA replication although neither is sufficient to induce mitosis. Similarly, inactivation of certain temperature- sensitive mutant alleles of cdc2 by heat shock and nitrogen starvation and then restoring Cdc2 function allows cells to diploidise by re-setting the cell cycle from G2 back to Start (Broek et al., 1991; Hayles et al., 1994). This diploidisation is dependent on the ruml gene and in fact, overexpression of Ruml also induces extensive re-replication by directly inhibiting Cdcl3/Cdc2 kinase activity (Moreno and Nurse, 1994; Labib et al., 1995). As with the depletion of Cdcl3, Ruml-induced re-replication requires either the Cigl or Cig2 cyclins to initiate replication (Martin-
Castellanos et al., 1996). On the other hand, if Cdcl3 and Cdc2 are overexpressed in
30 Chapter 1 Introduction
Gl cells prior to Start, the increase in mitotic kinase activity will induce mitosis in the absence of DNA replication (Hayles et al., 1994). These results all support the quantitative model on the basis that the levels of Cdc2-associated kinase activity increase throughout the cell cycle and are sufficient to bring about the onset of DNA replication first, and then mitosis.
1.3 Regulation of S phase onset
One of the tenets of the quantitative model is that Cdc2-associated kinase activity is responsible for promoting both DNA replication and mitosis. If this is true, how is
DNA replication restricted to once per cell cycle? The current view is that specific substrates involved in the initiation of replication are recognised in Gl when Cdc2 activity is low and then other substrates are recognised in G2 when Cdc2 activity is higher. The function of the latter substrates would then repress the former.
Alternatively, the availability of substrates may be restricted to the Gl phase and modified or no longer accessible in G2. Although discrimination between these two mechanisms may prove difficult, and indeed they may not be exclusive, a discussion of the proteins required for the initiation of DNA replication will highlight the key substrates that are positively or negatively regulated by Cdc2 activity.
1.3.1 The replicator sequence
Prior to engaging in a discussion of the proteins involved in DNA replication, I would like to introduce the replicator sequences which are the physical sites at which initiation takes place. Given the size of eukaryotic genomes, the complete replication of chromosomes during a given S phase presents the cell with an enormous logistical task. To maximise the efficiency of DNA replication, eukaryotes have evolved a
31 Chapter 1 Introduction mechanism to initiate DNA synthesis from multiple sites along the chromosomes and thus engage thousands of replication forks to replicate individual segments of the genome. In yeast, replication origins were identified by their ability to confer transformation efficiency and stability to plasmids using the autonomously replicating sequence (ARS) assay (Stinchcomb et al., 1979). In budding yeast, two-dimensional gel electrophoresis of ARS-containing plasmids demonstrated that initiation occurred from sites within the ARS element (Brewer and Fangman, 1987; Huberman et al.,
1987) and that many of these same sequences serve as sites of initiation in their normal chromosomal location (reviewed in Diffley, 1995).
The ARS elements in budding yeast are approximately 100 base pairs (bp) in size and share several common features. They consist of four elements that are sufficient for ARS activity: an A element and three adjacent B elements (Marahrens and Stillman, 1992). The most important feature is the 1 Ibp AT-rich ARS consensus sequence that lies within the A element and is essential for origin function
(Marahrens and Stillman, 1992). The B elements are functionally distinct and consist of binding sites for initiator proteins. Interestingly, the unwinding of DNA at replication origins, referred to as ‘origin firing’, follows a specific temporal program in budding yeast, with some origins firing early in S phase and others firing later
(Yamashita et al., 1997; Friedman et al., 1997). The sequential firing of replication origins is determined by the chromosomal context of that origin and probably reflects its accessibility to initiation factors (Raghuraman et al., 1997). To co-ordinate the firing of early and late origins during S phase, a system of checkpoints is maintained that inhibits the firing of late origins in the presence of defects in DNA replication or stalled replication forks (Santocanale and Diffley, 1998). Therefore, the cell has
32 Chapter 1 Introduction evolved several mechanisms to regulate and orchestrate the activity of replication origins to bring about rapid and faithful replication of the entire genome.
In fission yeast, ARS elements and chromosomal origins are larger than their budding yeast counterparts. They are generally between 500 and lOOObp in size
(Clyne and Kelly, 1995; Dubey et al., 1996; Okuno et al., 1999; Kim and Huberman,
1998) and unlike the budding yeast origins, they do not exhibit strong sequence similarities or a consensus sequence that is conserved among all origins. However, they do share some structural similarities and consist of several redundant domains and AT-rich regions (Johnston and Barker, 1987; Maundrell et al., 1988; Zhu et al.,
1994; Clyne and Kelly, 1995; Dubey et al., 1996; Kim and Huberman, 1998; Okuno et al., 1999). The significance of these motifs in terms of molecular interactions remains unclear. A puzzling feature of fission yeast replication origins is that with one exception, the origin ars2004, no origin fires in every cell cycle (Okuno et al.,
1997). This may be due to the fact that fission yeast origins are often located in clusters of several origins within a 4-lOkb region (Zhu et al., 1994; Wohlgemuth et al., 1994; Okuno et al., 1997). Therefore, if one adjacent origin fires first then the neighbouring origin is likely to be passively replicated by the forks emerging from that origin rather than firing itself. In the ura4 locus, three origins are clustered within a 4kb region and deletion of one origin allows the adjacent origins to fire more efficiently (Dubey et al., 1994). What determines which origin in the cluster fires in each cell cycle remains an elusive and interesting question. As yet, there is no evidence for a temporal program of origin firing in fission yeast, although this could be due to the technical difficulties of addressing the timing of firing of individual origins within the short S phase of fission yeast.
33 Chapter 1 Introduction
In higher eukaryotes, the definition of a replication origin is quite
controversial since initiation sites have been mapped to specific sequence elements as
well as broad initiation zones. The best example of a sequence-specific replication
origin has been mapped to an 8kb sequence within the human p-globin locus
(Kitsberg et al., 1993; Aladjem et al., 1995). Deletion of this sequence, which occurs
in some patients with p-thalassemia, abolishes initiation in this region (Kitsberg et al.,
1993). However, firing of this origin also requires a sequence within the locus control
region that controls the expression of the globin genes and lies >50kb upstream of the
p-globin origin (Aladjem et al., 1995). Thus, even the most specific origin identified
to date requires additional c/^-acting sequences at great distances from the origin. In
Drosophila, similar properties of replication origins have been identified.
Amplification of the chorion genes has been shown by two-dimensional gel
electrophoresis to arise from initiation at several sites within the amplification locus
(Delidakis and Kafatos, 1989; Heck and Spradling, 1990), yet deletion analysis has
identified a specific 884bp sequence that is necessary and sufficient for initiation and
another 320bp sequence that functions as an enhancer of initiation activity at that
origin (Lu et a l, 2001). Together, these examples highlight the complexities
associated with defining replication origins in higher eukaryotes.
1.3.2 The replication initiator: ORC
Early studies on the initiation of DNA replication in eukaryotes were guided by a
model explaining the regulation of initiation in E.coli, the Replicon model, which proposed that the initiation of DNA replication is promoted by the interaction
between an initiator protein and a czj-acting sequence, the replicator (Jacob et al.,
1963). In budding yeast, the identification of ARS elements that function as replication origins instigated the search for factors that bind directly to origin
34 Chapter 1 Introduction
sequences. Using a footprinting assay, proteins were isolated that protected a region
of the replication origin A R S l from nuclease cleavage. The Origin Recognition
Complex (ORC) was identified by this assay as a complex that bound to A R Sl in
vitro (Bell and Stillman, 1992) and also generated the same footprintin vivo (Diffley
and Cocker, 1992). This complex consists of six subunits (Orel to 6) and
temperature-sensitive mutations or deletion of the genes encoding individual subunits
are lethal due to failure to initiate DNA synthesis (Micklem et a i, 1993; Bell et a i,
1993; Li and Herskowitz, 1993; Foss et a l, 1993; Loo et al., 1995; Bell et ah, 1995;
Fox et a l, 1995; Liang et a l, 1995; Hardy, 1996; Hori et a l, 1996). The binding sites
for ORC are likely to lie within the A and B1 domains of replication origins since
mutations in these elements of ARSl abolishes ORC binding and prevents the
intiation of DNA replication (Bell and Stillman, 1992; Rao and Stillman, 1995;
Rowley et a l, 1995). The ability of ORC to recognise replication origins both in vitro
and in vivo, and its essential role in initiation made ORC a prime candidate as a
replication initiator. However, genomic footprinting showed that ORC remains bound
to origins throughout the cell cycle (Diffiey et a l, 1994; Rowley et a l, 1995)
suggesting that while ORC is necessary for initiation, it is not sufficient.
A homologous ORC complex has been identified in fission yeast and consists
of six subunits (named Orpl to 6 for ORC subunits from S. ÿpm be) which are all
essential for DNA replication (Gavin et a l, 1995; Muzi-Falconi and Kelly, 1995;
Grallert and Nurse, 1996; Leatherwood et a l, 1996; Ishiai et a l, 1997; Lygerou and
Nurse, 1999; Moon et a l, 1999; Chuang and Kelly, 1999). As in budding yeast, several of the ORC subunits have been shown to bind to replication origins throughout the entire cell cycle (Lygerou and Nurse, 1999; Ogawa et a l, 1999).
While specific ORC-interaction domains have not been identified in fission yeast
35 Chapter 1 Introduction
origins, one of the subunits, Orp4, is characterised by AT-hooks which may be
important for binding to the AT-rich regions of origin DNA (Chuang and Kelly,
1999; Moon et al., 1999). ORC complexes have also been identified m Xenopus
(Rowles et al., 1996; Carpenter et al., 1996; Romanowski et a l, 1996; Carpenter and
Dunphy, 1998), Drosophila (Gossen et al., 1995; Gavin et al., 1995), and from
mammalian cells (Gavin et al., 1995; Natale et al., 2000). Thus, ORC appears to be a
conserved multisubunit complex that functions as a replication initiator in all
eukaryotes.
1.3.3 Assembly of the pre-replicative complex
While the footprinting assay proved useful for the identification of ORC in budding
yeast, it also led to the significant observation that the pattern of nuclease protection
of the origin AR Sl in vivo was different in Gl and G2 cells (Diffiey et a i, 1994). In
Gl cells, the protected region was extended by approximately 50bp and a site that
was hypersensitive to nucleases in G2 cells was lost. This change in the pattern of nuclease protection defined an origin as being in a ‘pre-replicative’ state in Gl as
opposed to a ‘post-replicative’ state in G2. The transition from the post-replicative pattern to the pre-replicative pattern occurred during mitosis and suggested that the extension of nuclease protection was due to the binding of a complex of proteins referred to as the pre-replicative complex, or pre-RC, to replication origins upon exit from mitosis (Diffley et al., 1994). Since ORC is bound to origins throughout the cell cycle (Diffley et al., 1994; Rowley et al., 1995; Aparicio et al., 1997; Tanaka et al.,
1997; Liang and Stillman, 1997), other proteins must be recruited to the replication origins in Gl to form the pre-RC.
One of these proteins is the initiation factor Cdc6, which was first isolated as a temperature-sensitive mutant that failed to undergo S phase (Hartwell, 1976) and was
36 Chapter 1 Introduction
later shown to be defective in origin firing (Liang et al., 1995). In the absence of
Cdc6 pre-R.Cs cannot form or be maintained, demonstrating that Cdc6 contributes to
the extended footprint observed in Gl cells and is required for the assembly and
maintenance of the complex (Diffley et al., 1994; Santocanale and Diffley, 1996;
Cocker et a l, 1996). As cells exit from mitosis, Cdc6 protein accumulates and binds
to replication origins via ORC (Piatti et al., 1995; Liang et al., 1995; Tanaka et a l,
1997; Weinrich et al., 1999). This interaction is required for the assembly of the pre-
RC but is not sufficient to reconstitute the extended footprint in vitro (Mizushima et
a l, 2000).
Both Cdc6 and ORC are required to recruit a heterohexameric complex
composed of the six minichromosome maintenance proteins (MCMs) to replication
origins (Lei et a l, 1996; Donovan et a l, 1997; Aparicioet a l, 1997; Tanaka et a l,
1997; Liang and Stillman, 1997). The MCM genes were isolated as mutants defective
in the maintenance of mitotically stable minichromosomes (Maine et a l, 1984), each
of which has a non-redundant function that is essential for the initiation of DNA
replication (Maine et a l, 1984; Hennessy et a l, 1990; Yan et a l, 1993; Donovan et
a l, 1997). The binding of MCMs to chromatin correlates with the presence of the pre-RC; they bind to chromatin upon exit from mitosis in an ORC- and Cdc6-
dependent fashion, and then become dissociated during S phase (Liang and Stillman,
1997; Donovan et a l, 1997; Aparicioet a l, 1997; Tanaka et a l, 1997; Young and
Tye, 1997; Weinreich et a l, 1999; Feng et a l, 2000). While the exact biochemical function of the MCM complex remains speculative, evidence suggests that it is the replicative helicase that unwinds DNA ahead of the replication fork. By chromatin immunoprécipitation experiments, MCMs appear to travel with the replication forks
(Aparicio et a l, 1997; Tanaka et a l, 1997) and genetic data shows that MCMs are
37 Chapter 1 Introduction
required for fork progression (Labib et a l, 2000). However, no helicase activity has
been detected in vitro with purified MCM complexes. The MCM complex has been
purified from fission yeast and shown by electron microscopy to form a
heterohexameric complex with a globular shape and central cavity that could
assemble around the DNA duplex (Adachi et a l, 1997). Consistent with this, helicase
activity is associated with a purified subcomplex of MCMs in vitro (Lee and Hurwitz,
2001).
Cdcl8, the fission yeast homologue of Cdc6, is also essential for DNA
replication (Nasmyth and Nurse, 1981; Kelly et al., 1993). Cdcl8 is periodically
expressed, accumulates in cells upon exit from mitosis and becomes associated with
chromatin, possibly through a direct interaction with Orpl (Kelly et al., 1993;
Nishitani and Nurse, 1995; Grallert and Nurse, 1996; Muzi-Falconi et al., 1996;
Nishitani et al., 2000). As in budding yeast, Cdcl8 and ORC are then required for the
recruitment of the MCM complex onto chromatin (Ogawa et al., 1999; Nishitani et
al., 2000; Kearsey et al., 2000). However, they are not sufficient for the loading of
MCMs and another essential initiation factor, Cdtl, is also required (Hofmann and
Beach, 1994; Nishitani et al., 2000). Cdtl accumulates in cells at the end of mitosis
and binds to chromatin at the same time as Cdcl8 (Nishitani et al., 2000). While
Cdcl8 and Cdtl interact, they are not dependent on each other for their association
with chromatin (Nishitani et al., 2000). Instead, depletion of either protein disrupts
the ability of the MCMs to bind to chromatin and cells fail to initiate replication.
The conservation of pre-RC components from yeast to higher eukaryotes
extends beyond ORC. Cdc6 and the MCM subunits have been cloned and shown to perform similar functions to their yeast homologues (Kelman et al., 1999; Coleman et
al., 1996; Kimura et al., 1994; Musahl et al., 1995; Kimura et a l, 1996; Madine et
38 Chapter 1 Introduction
ah, 1995; Hendrickson et al., 1996; Coué et al., 1996; Williams et al., 1997; Petersen
et al., 1999; Berger et al., 1999; Maiorano et al., 2000). Similarly, homologues of
Cdtl have been identified in X enopus, humans, and Drosophila, although a
homologue of Cdtl in budding yeast has not yet been published (Maiorano et al.,
2000; Whittaker et al., 2000). Immunodepletion of either Cdc6, Cdtl or the MCMs
abolishes DNA replication 'mXenopus egg extracts as does microinjection of Cdc6or
MCM antibodies into mammalian cells, supporting an essential role for Cdc6, Cdtl
and the MCMs in the initiation of DNA replication in higher eukaryotes (Chong et
al., 1995; Madine et a l, 1995; Kubota et a l, 1995; Romanowski et al., 1996;
Coleman et a l, 1996; Kubota et a l, 1997; Maiorano et a l, 2000; Todorov et al,
1994; Kimura et a l, 1994; Hateboer et a l, 1998). As was shown in fission yeast, :he
association of Cdc6 and Cdtl with chromatin 'mXenopus egg extracts is dependent on
ORC (Romanowski et a l, 1996; Rowles et a l, 1996; Coleman et a l, 1996) and the
association of the MCMs with chromatin is dependent on ORC, Cdc6, and Cdtl
(Maiorano et a l, 2000). Collectively, these results suggest that a complex analogous
to the yeast pre-RC, consisting of ORC, Cdc6, Cdtl and the MCMs, is sequentially
assembled onto chromatin prior to the onset of S phase to bring about the initiation of
DNA replication.
1.3.4 Formation of the pre-initiation compiex: Cdc45
The initiation of DNA replication can be described as a two-step mechanism: the first step is the assembly of a pre-RC onto all origins, while the second step involves the transition of the pre-RC to a pre-initiation complex (pre-IC) which then induces origin firing (Zou and Stillman, 1998). In budding yeast, the transition from a pre-RC to a pre-IC is dependent on the loading of the Cdc45 protein onto replication origins which occurs according to the temporal order of origin firing (Aparicioet a l, 1999;
39 Chapter 1 Introduction
Zou and Stillman, 2000). Cdc45 is an initiation factor that is required for DNA
replication but is not a component of the pre-RC, since cells maintain a pre-RC
footprint in the temperature-sensitive cdc45 mutant (Hopwood and Dalton, 1996;
Owens et al., 1997). Cdc45 homologues have also been cloned from fission yeast.
Drosophila, Xenopus, and mammalian cells (Miyake and Yamashita, 1998; Loebel et
al., 2000; Mimura and Takisawa, 1998; Kukimoto et al., 1999) and appear to have a
conserved function. The function of Cdc45 may be to provide the crucial link
between the pre-RC and the replication machinery. Cdc45 physically and genetically
interacts with several members of the MCM complex and its association with origins
is dependent on the prior assembly of a pre-RC (Hopwood and Dalton, 1996; Zou and
Stillman, 1998; Zou and Stillman, 2000; Miyake and Yamashita, 1998; Mimura and
Takisawa, 1998; Mimura et al., 2000; Loebel et al., 2000; Kukimoto et al., 1999).
Once Cdc45 becomes associated with the pre-RC on a given origin, it is then required for the subsequent loading of replication protein A (RPA), the replicative polymerase alpha, and proliferating cell nuclear antigen (PCNA) (Tanaka and Nasmyth, 1998;
Aparicio et al., 1999; Zou and Stillman, 2000; Mimura and Takisawa, 1998; Mimura et al., 2000; Loebel et a l, 2000; Kukimoto et al., 1999). Independently, Cdc45 is also required to load polymerase epsilon at origins, suggesting that it coordinates the recruitment of the replication machinery required for both leading and lagging strand
DNA synthesis (Aparicio et al., 1999; Mimura et al., 2000). In addition, Cdc45 has an essential function in elongation and appears to travel with the replication forks after origin firing (Aparicio et al., 1997; Tercero et al., 2000).
13.5 Activation of the pre-initiation complex: S-CDKs and Dbf4/Cdc7
The transition from a pre-RC to a pre-IC and the subsequent firing of origins is dependent on the activity of S phase-promoting kinases. While the specific cascade of
40 Chapter 1 Introduction
events that lead to origin unwinding are not entirely clear, two sets of kinases are
involved in the assembly and activation of the pre-IC: the Dbf4/Cdc7 kinase and the
S phase CDKs (S-CDKs) (Donaldson et a l, 1998; Bousset and Diffley, 1998; Zou
and Stillman, 1998; Zou and Stillman, 2000). The Dbf4/Cdc7 kinase, which has been
identified in budding yeast, fission yeast, Xenopus, and mammalian cells, consists of
a catalytic subunit, Cdc7 (Hskl in fission yeast), which is present at constant levels
throughout the cell cycle, and a regulatory subunit, Dbf4 (Dfpl in fission yeast),
which is periodically expressed (Donaldson et al., 1998; Bousset and Diffley, 1998;
Masai et al., 1995; Brown and Kelly, 1998; Takeda et al., 1999; Sato et al., 1997;
Jiang and Hunter, 1997; Jiang et al., 1999; Pasero et al., 1999; Weinreich and
Stillman, 1999). Dbf4 accumulates late in Gl, becomes associated with Cdc7, and
binds to replication origins (Dowell et al., 1994; Weinreich and Stillman, 1999;
Takeda et al., 1999; Brown and Kelly, 1999; Jiang et al., 1999). Accordingly, the
kinase activity of Cdc7 is stimulated by Dbf4 and accumulates during S phase
(Brown and Kelly, 1998; Takeda et a l, 1999; Weinreich and Stillman, 1999; Jiang
and Hunter, 1997; Jiang et al., 1999; Nougarède et a l, 2000).
Prior to origin firing, both the S-CDKs and Dbf4/Cdc7 promote the loading of
Cdc45 onto chromatin which marks the transition from the pre-RC to the pre-IC (Zou
and Stillman, 1998; Zou and Stillman, 2000). A similar requirement for S-CDKs to
load Cdc45 has been identified in Xenopus (Mimura and Takisawa, 1998). The
Dbf4/Cdc7 complex has also been shown to phosphorylate Mcm2 in vitro in all
organisms and in vivo in fission yeast and in mammalian cells (Lei et a l, 1997;
Weinreich and Stillman, 1999; Brown and Kelly, 1998; Jares and Blow, 2000; Satoet a l, 1997; Jiang et a l, 1999). Phosphorylation of Mcm2 may be biologically important for initiation since a temperature-sensitive mutation in the budding yeast
41 Chapter 1 Introduction
dbf4 gene suppresses a mutation inmcm2 and restores the origin firing defect of the
mcm2 mutant (Lei et a l, 1997). Also, binding of Mcm2 to chromatin requires the B2
element of A R S l which contains a putative DNA-unwinding element (Lin and
Kowalski, 1997; Zou and Stillman, 2000). Other potential substrates for Dbf4/Cdc7
include additional members of the MCM complex, Cdc45, RPA, and polymerase
alpha (Lei et a l, 1997; Weimeich and Stillman, 1999; Nougarède et a l, 2000; Jares
and Blow, 2000). Although the functional significance of these phosphorylation
events remains unclear, these results suggest that the phosphorylation of various
components of the pre-IC by Dbf4/Cdc7 may alter the architecture of the pre-IC to
bring about unwinding of DNA at the origin. Substrates of the S-CDKs include
Cdc6/Cdcl8 and Cdc21/MCM4 (Elsasser et a l, 1996; Jallepalli et a l, 1997; Baum et
a l, 1998; Hendrickson et a l, 1996), although these are not likely to be important for
initiation since, at least in budding yeast, a pre-RC is maintained in a cdc28 mutant
(Diffley et a l, 1994). However, in Xenopus, release of Cdc6 from chromatin is
promoted by Cyclin A/Cdc2 and is a pre-requisite for initiation (Hua and Newport,
1998).
In summary, the onset of DNA replication requires the ordered assembly of a pre-replicative complex at all origins in Gl, followed by the transition to a pre
initiation complex which is catalysed by the activities of the S-CDKs and Dbf4/Cdc7 kinases, and the subsequent recruitment of the replication machinery to the sites of
initiation. The activities which ultimately lead to the physical unwinding of DNA at the origin are currently unknown. While many of the molecular events and interactions remain to be elucidated, a model for these steps is proposed in figure 1.4, based primarily on the work from budding yeast but also incorporating the features conserved in other organisms.
42 Chapter 1 Introduction
1.4 Mechanisms that restrict S phase to once per ceii cycie
The stepwise assembly and activation of the pre-RC is consistent with the features of replication control that were first observed in a classic series of mammalian cell fusion experiments. In these experiments, nuclei were synchronised at various cell cycle stages, fused, and assessed for replication in the heterokaryon (Rao and
Johnson, 1970). Fusion of Gl nuclei with S phase nuclei advanced entry of the Gl nuclei into S phase, suggesting that soluble factors within the S phase nuclei promoted the initiation of DNA replication. In contrast, fusion of G2 nuclei with S phase nuclei had no effect on the G2 nuclei, showing that the G2 nuclei were refractory to the S phase-promoting factors and that conversion of the nuclei from a replication incompetent to competent state occurred between G2 and Gl. This re setting of the nuclei is likely to reflect the assembly of initiation factors onto origins that takes place from late mitosis to Gl/S. Similarly, the S phase-promoting factors that induce initiation are likely to be the S-CDKs and Dbf4/Cdc7 which regulate the firing of individual origins of replication.
What is less understood, however, is the transition of nuclei from a replication competent state in Gl to a replication incompetent state in G2. A significant advance in how to address this issue stemmed from the proposal of a licensing model in
Xenopus (Harland and Laskey, 1980). According to this model, a licensing factor is issued at the onset of S phase which renders chromatin competent to replicate and is then removed by replication forks as DNA synthesis proceeds during S phase. The observation that permeabilisation of the nuclear envelope in Xenopus egg extracts was sufficient to allow re-replication to occur when incubated with a fresh extract provided a valuable extension to this model. It was proposed that the licensing factor was excluded from the nucleus during interphase and could only gain access to
43 Chapter 1 Introduction
chromatin when nuclear envelope breakdown occurred at the onset of mitosis (Blow and Laskey, 1988). Biochemical purification of the factors required for licensing revealed that Cdtl and the MCM complex fulfilled the criteria of bona fide licensing factors. They associate with chromatin prior to initiation, dissociate during replication, and can only bind to chromatin in G2 if the nuclear membrane has been permeabilised (Kubota et a l, 1995; Chong et a l, 1995; Madine et a l, 1995; Coué et a l, 1996; Hendrickson et a l, 1996; Thommes et a l, 1997; Kubota et a l, 1997;
Maiorano et a l, 2000; Tada et a l, 2001). Licensing is also dependent on ORC and
Cdc6, which are required, together with Cdtl, for the binding of MCMs onto chromatin (Rowles et a l, 1996; Romanowski et a l, 1996; Coleman et a l, 1996;
Maiorano et a l, 2000). This link between the yeast pre-RC and licensing mXenopus suggests that the dissociation of these initiation factors from origins during S phase is important to prevent the establishment of replicative competence in G2.
In all organisms, several replication initiation factors are regulated or modified during S phase, although little is known about their biological relevance to the repression of DNA synthesis after origin firing has occurred. In Xenopus and mammalian cells, it is likely that the most critical mechanism that prevents re replication is the inhibition of Cdtl by geminin. Geminin specifically binds to and inhibits Cdtl, preventing the association of MCMs with chromatin (McGarry and
Kirschner, 1998; Wohlschlegel et a l, 2000; Tada et a l, 2001). Geminin is only present from late S phase to anaphase, and thereby ensures that Cdtl is inhibited after origin firing and prevents licensing until after cells undergo mitosis (McGarry and
Kirschner, 1998). A second mechanism that may be important to prevent re replication is the phosphorylation of Cdc6. InXenopus, Cdc6 is phosphorylated and becomes dissociated from chromatin at the onset of S phase (Hua and Newport, 1998;
44 Chapter 1 Introduction
Findeisen et a l, 1999). In mammalian cells, the expression of Cdc6 is essentially
constant but its localisation throughout the cell cycle changes (Williams et a l, 1997;
Jiang et a l, 1999). Cdc6 is mostly nuclear in Gl cells and then translocated to the
cytoplasm at the onset of S phase due to phosphorylation by Cyclin A/Cdk2 (Saha et a l, 1998; Fujita et a l, 1999; Petersen et a l, 1999; Berger et a l, 1999; Jiang et a l,
1999; Herbig et a l, 2000). Other evidence suggests that S-CDKs promote the degradation of a soluble pool of Cdc6, while a fraction of endogenous Cdc6 remains chromatin-bound throughout the cell cycle (Coverley et a l, 2000). The significance of Cdc6 phosphorylation remains difficult to interpret since microinjection of the phosphorylation mutants of Cdc6 inhibits DNA replication instead of promoting re replication (Jiang et a l, 1999; Herbig et a l, 2000). It is therefore likely that regulation of Cdtl is more critical to prevent re-replication in mammalian cells.
Other initiation factors are also modified during the cell cycle, including components of the ORC and MCM complexes. In hamster cells, the stability of Orel on chromatin changes during the cell cycle; Orel is tightly associated with chromatin during interphase but becomes unstable and dissociates from chromatin during mitosis (Natale et a l, 2000). The importance of this regulation is not evident but most likely plays a role in determining origin selection in a given cell cycle (Natale et a l,
2000). In Xenopus, Orel, Orc2, and MCM4 are hyperphosphorylated in mitotic extracts which also correlates with their dissociation from chromatin (Romanowski et a l, 1996; Carpenter et a l, 1996; Hendrickson et a l, 1996; Coué et a l, 1996; Tugal et a l, 1998; Findeisen et a l, 1999; Tada et a l, 2001). These results suggest that several mechanisms may be required to dis assemble the pre-RC during S phase and prevent re-replication.
45 Chapter 1 Introduction
In budding yeast, high levels of Clb/Cdc28 kinase activity in G2 are sufficient to prevent re-replication. Depletion of Clb/Cdc28 activity by expression of Sicl in
G2/M-arrested cells re-sets the cell cycle back to Gl and allows new pre-RCs to form, although transient repression of Clb/Cdc28 is then required to allow cells to undergo one additional round of DNA replication (Dahmann et a l, 1995; Noton and
Diffiey, 2000). This re-replication is dependent onde novo synthesis of Cdc6 which can only occur when kinase activity is low (Piatti et a l, 1996; Noton and Diffley,
2000). Consistent with this, phosphorylation of Cdc6 by Clb/Cdc28 during S phase and G2 targets the protein for degradation, suggesting that downregulation of Cdc6 by Clb/Cdc28 may be important to block re-replication (Piatti et al., 1996; Elsasser et al., 1996; Deitweiler and Li, 1997; Elsasser et al., 1999). However, expression of
Cdc6 lacking the Cdc28 phosphorylation sites can still complement a CDC6 deletion and cells do not re-replicate (Elsasser et al., 1999; Drury et al., 2000). This implies that regulation of other initiation factors also contributes to the block over re replication. A strong candidate is the MCM complex, since some re-replication can occur in a cdc6-3 mutant in which MCMs are persistently associated with chromatin
(Liang and Stillman, 1997). During S phase, Clb/Cdc28 activity promotes export of the MCMs from the nucleus and re-entry is dependent on the inactivation of Cdc28 at the end of mitosis (Labib et al., 1999; Nguyen et al., 2000). Therefore, degradation of
Cdc6 and re-localisation of the MCMs both ensure that these initiation factors are not available or accessible to chromatin in G2. The cell cycle regulation of other initiation factors, such as the phosphorylation state of Orp6 and the accumulation of Dbf4, may also play important roles in preventing the re-firing of origins in G2 (Liang and
Stillman, 1997; Pasero et al., 1999; Weinrich and Stillman, 1999). However, de
46 Chapter 1 Introduction
regulation of neither of these factors is sufficient to induce re-replication in budding
yeast cells.
In fission yeast, a different set of controls is likely to exist to prevent re
replication, the most important of which is the regulation of Cdcl8. As with its
budding yeast homologue, Cdcl8 expression is tightly cell cycle regulated, both transcriptionally and post-translationally. Gene expression is controlled by the transcription factor CdclO which induces transcription of Cdcl8 during mitosis, peaks at Gl/S, and is then repressed during S phase and in G2 (Kellyet al., 1993;
Muzi-Falconi et al., 1996; Baum et al., 1998). Despite the accumulation of Cdcl8 transcripts during mitosis, Cdcl8 protein fails to accumulate due to the activity of the mitotic CDK, Cdcl3/Cdc2 (Baum et al., 1998). As Cdcl3/Cdc2 levels drop in anaphase, Cdcl8 accumulates and peaks at Gl/S (Nishitani and Nurse, 1995; Baum et al., 1998). During S phase, Cdcl8 is then phosphorylated by Cdc2 and targeted for ubiquitin-mediated degradation (Jallepalli et al., 1997; Brown et a l, 1997; Kominami and Toda, 1997; Jallepalliet al., 1998; Lopez-Gironaet al., 1998). The evidence that this strict regulation of Cdcl8 expression is critical to prevent re-replication is the uncoupling of S phase from mitosis when Cdcl8 is overexpressed, leading to DNA synthesis in the absence of mitosis (Nishitani and Nurse, 1995).
The regulation of Cdtl may also be important to prevent re-replication as co expression of Cdtl with low levels of Cdcl8 induces re-replication (Nishitaniet al.,
2000). Cdtl is known to be transcriptionally regulated by CdclO and its expression follows a similar profile to the expression of Cdcl8 (Hofmann and Beach, 1994;
Baum et al., 1998). However, little is known about the regulation of the Cdtl protein in fission yeast, except that it accumulates in Gl cells and is undetectable in G2 cells
(Nishitani et al., 2000). It is likely that Cdtl is regulated differently from its
47 Chapter 1 Introduction
mammalian counterparts since no homologue of geminin has been identified in
fission yeast.
Regulation of other initiation factors, such as the MCMs, is probably not
critical the the block to re-replication since the localisation of the MCMs does not
change during the cell cycle and the complex is constitutively nuclear (Sherman and
Forsburg, 1998; Pasion and Forsburg, 1999; Kearsey et al., 2000). Instead, MCMs
can only associate with chromatin from late mitosis to Gl/S since chromatin binding
is dependent on the presence of CdclS and Cdtl (Ogawaet al., 1999; Kearsey et al.,
2000; Nishitani et al., 2000). Thus, the regulation of CdclS and Cdtl appear to be the
major contributors to the block to re-replication in fission yeast. A comparison of the
mechanisms that regulate initiation factors in budding yeast, fission yeast, and
metazoa, is presented in Table 1.1.
According to the quantitative model, S phase is restricted to once per cell
cycle due to the increase in Cdc2 kinase activity to a level that inhibits the initiation
of replication (figure 1.3). Does Cdc2 direct this control toward the disassembly of
the pre-RC or the prevention of new pre-RCs? The regulation of CdclS suggests that
both processes may be under Cdc2 control. Newly transcribed CdclS fails to
accumulate in the presence of high kinase and Cdc2 also promotes the degradation of
available CdclS in S phase and 02 by phosphorylation (Jallepalliet al., 1997; Baum
et al., 199S). Thus, the pre-RC is only assembled during Gl when the kinase activity
is low and then disassembled and prevented from re-assembling when the kinase
activity is high. When CdclS is overexpressed, this two-step mechanism for replication control is clearly aborted. It is possible that high levels of CdclS saturate the degradation machinery rendering the protein refractory to inhibition by Cdc2. The accumulation of CdclS may then promote the continous re-loading of MCMs on
48 Chapter 1 Introduction
DNA that has already been replicated. However, the mechanism by which CdclS can promote re-replication has not been examined in detail and is poorly understood.
Also, the specific cell cycle stage during which CdclS can promote re-replication is largely unknown. Re-replication may be confined to cells within S phase, when other initiation factors are available and the replication machinery is also already in place.
However, since MCMs are present in the nucleus throughout the cell cycle, it may be equally important to downregulate CdclS in G2. While it is known that CdclS is necessary for the formation of pre-RCs, it is not known whether CdclS is also sufficient to promote the formation of new pre-RCs in G2 and recruit the replication machinery even though the cell contains fully replicated DNA. Therefore, CdclS, and possibly Cdtl, may be important determinants of whether chromatin is in a replicative-competent state, as in a Gl cell, or a replicative-incompetent state which defines a cell as being in G2.
1.5 Specific aims
In this thesis, I have attempted to identify the mechanisms that repress DNA synthesis in G2 cells, with the following aims:
1. To test whether the accumulation of CdclS in G2 cells is sufficient to induce re replication.
2. To determine the importance of Cdtl regulation for re-replication control.
3. To characterise the mechanisms by which CdclS and Cdtl induce re-replication.
4. To determine the contribution of Cdc2 to CdclS- and Cdtl-induced re-replication.
49 (• D
C
Figure 1.1 The fission yeast mitotic ceil cycle The two major events of the mitotic cell cycle are the duplication and segregation of chromosomes which take place during S phase and M phase, respectively. These phases are flanked by two gap phases, G1 and G2. In fission yeast, the G2 phase constitutes approximately 70% of the cell cycle while M, Gl, and S make up 10% each. Since the G1 phase is short, septation and cytokinesis occur at the same time as DNA replication of the subsequent cell cycle. During the cell cycle, cells approximately double in mass before dividing. A B Cyclin Cyclin (Rum 1
Cdc2 Cdc2
T167 Y15 Y15
T167
Cyclin Active cyclin/CDK Cdc2 complex Y15
T167 Cv -in) Cdc25
Wee1 Cyclin
C D Cyclin
Cdc2
T167 Y15
Figure 1.2 Regulation of the cyclin/CDK complex At least four mechanisms regulate the activity of the cyclin/CDK complex: phosphory lation on threonine 167 of Cdc2 (A), inhibition by a CKI (B), phosphorylation on tyrosine 15 of Cdc2 (C), and cyclin proteolysis (D). (CAK: CDK-activating kinase, PP: protein phosphatase). high
CM O medium low G1 G2 Cdc13/Cdc2 activity Cig2/Cdc2 activity Total Cdc2 activity Figure 1.3 The quantitative model Illustration of the quantitative model for CDK activity in fission yeast. This model pro poses that CDK activity must be low prior to S phase, then reach a threshold of CDK activity to promote S phase and a higher threshold to promote mitosis. Once the thresh old is reached for S phase, this level of CDK activity then inhibits replication until the CDK activity decreases upon exit from mitosis. In a normal cell cycle, S phase is pro moted by Cig2/Cdc2 activity which peaks at Gl/S and mitosis is promoted by Cdc 13/Cdc2 activity which accumulates during G2. If Cdcl3 is deleted, cells can re-set the cycle back to Gl and Cig2/Cdc2 can promote another round of S phase but cannot surpass the threshold of activity required for mitosis. If Cig2 is deleted, Cdc 13 is suffi cient to promote both S phase and mitosis. replication origin Late M I :dc6/18) Cdt1 ORC Early G1 I MCMs dc6/18) Cdt1 ORC Pre-RC Dbf4/Cdc7 Clb/Cdc28 Dfp1/Hsk1 Cig2/Cdc2 G l/S MClVIs ;dc6/18) Cdt1 ORC Pre-IC t Cdt1 Cdc6/18 ORC ORC Figure 1.4 Assembly and activation of the pre-RC Schematic illustrating the steps involved in the assembly of the pre-replicative complex (pre-RC), the transition to the pre-initiation complex (pre-IC), and origin firing. pre-RC Regulation Regulation Regulation component in S. cerevisiae in S. pombe in metazoa Always associated Always associated Orel is unstable in M (m) ORC with chromatin with chromatin Orel and Orc2 only bind chromatin in interphase (x) Periodically expressed Periodically expressed Constitutively expressed Binds chromatin M-G1 Binds chromatin M-G1/S Nuclear localisation ^dc6/1^ Degraded atG1/S Degraded during 8 phase is regulated by Stability regulated Stability regulated phosphorylation (m) by phosphorylation by phosphorylation Unstable on chromatin in S-G2-M (x) No homologue Periodically expressed Inhibited by geminin cdt1 yet characterised Binds chromatin M-G1/S during late S-M (x and m) MCMs Constitutively expressed Constitutively expressed Constitutively expressed Nuclear in M/G1 Always nuclear Always nuclear Cytoplasmic S/G2 Binds chromatin G1/S Binds chromatin G1/S Binds chromatin G1/S (x and m) Table 1.1 Regulation of pre-RC components in eukaryotes This table highlights the major mechanisms that regulate components of the pre-RC during the cell cycle in budding yeast, fission yeast, in mammalians cells (m) and Xenopus (x). Chapter 2: Cdc18 Expression in G2 Cells Induces DNA Synthesis 55 Chapter 2 Cdc18 expression in G2 cells Chapter Summary The Cdcl8/Cdc6 protein is essential for the initiation of DNA replication in eukaryotic cells. In the fission yeast, Schizosaccharomyces pombe, Cdc 18 is normally absent in G2 cells due to periodic transcription and proteolysis. In this chapter, I have found that ectopic overexpression of Cdc 18 in G2 cells is sufficient to drive cells into DNA replication without mitosis. Two-dimensional gel electrophoresis demonstrated that high levels of Cdc 18 induces de novo origin firing in G2. At the origin arsSOOl, initiation is restricted to the ARS sequence and is not detected in flanking regions, suggesting that replication in G2 involves the re-firing of origins normally used in S phase. Biochemical characterisation revealed that Cdc 18 binds to chromatin when overexpressed and binding of Cdc 18 with chromatin is dependent on Orpl. The MCM Cdc21 is required although a significant increase in the association of Cdc21 with chromatin was not observed in re-replicating cells. In addition, the initiation factor Cdtl was undetectable in cells re-replicating from G2. Together, these results support a major role for the downregulation of Cdc 18 in G2 to restrain the onset of DNA replication by preventing the re-firing of origins. 56 Chapter 2 Cdc18 expression in G2 cells 2.1 Introduction In eukaryotic cells, the onset of DNA replication is tightly regulated to ensure S phase is properly initiated during the Gl phase and is restricted to once per cell cycle. This is achieved through a combination of cellular controls that render the chromosomes competent to undergo replication only when cells are in S phase. A hallmark of replication-competent chromosomes is the presence of pre-replicative complexes (pre-RCs) that assemble onto origins of replication in Gl (Diffley et a l, 1994), and consist of at least the ORC, Cdcl8/Cdc6, Cdtl, and MCM proteins (Diffley et al., 1994; Santocanale and Diffley, 1996; Aparicio et a l, 1997; Tanaka et ah, 1997; Mizushima et a l, 2000). ORC is constitutively associated with chromatin throughout the yeast cell cycle (Diffley et al., 1994; Aparicio et al., 1997; Liang and Stillman, 1997; Tanaka et al., 1997; Lygerou and Nurse, 1999; Ogawa et al., 1999) and functions as a ‘landing pad’ for Cdcl8/Cdc6 (Liang et a l, 1995; Grallert and Nurse, 1996) which can then, together with Cdtl, recruit the MCM complex onto chromatin (Aparicio et a l, 1997; Donovan et a l, 1997; Tanaka et a l, 1997; Ogawa et a l, 1999; Maiorano et a l, 2000; Nishitani et a l, 2000; Kearsey et a l, 2000). Since the major function of Cdcl8/Cdc6 appears to be the loading of the MCM complex, this implies that it may be necessary to dissociate Cdcl8/Cdc6 from chromatin once initiation occurs to prevent further re-loading of MCMs. In fission yeast, overexpression of Cdc 18 induces extensive re-replication without intervening mitoses (Nishitani and Nurse, 1995; Muzi-Falconi et a l, 1996). At present, little is known about the mechanism by which Cdc 18 brings about this increase in DNA content. It is possible that re-replication is confined to cells within S phase, as persistent high levels of Cdc 18 might allow continuous re-loading of MCMs 57 Chapter 2 Cdc18 expression in G2 cells on DNA that has already been replicated. However, since fission yeast MCMs are constitutively nuclear (Sherman and Forsburg, 1998; Pasion and Forsburg, 1999), as are those in many higher eukaryotes (Kimura et al., 1994; Todorov et a l, 1994), it may be equally important to downregulate Cdc 18 during G2 to prevent the re establishment of replication-competent DNA once S phase is complete. In this chapter, I have addressed the role of Cdc 18 regulation in G2 by overexpressing Cdc 18 in G2-arrested cells. I have found that high levels of Cdc 18 are sufficient to drive re-replication and induce origin firing in G2. I have also investigated the roles of other proteins required for initiating replication in G2 cells including the MCM Cdc21 and Cdtl. 2.2 Results 2.2.7 Cdc7 8 and Cdt1 are downregulated in G2 cells During the initial characterisation of the Cdc 18 and Cdtl proteins (Nishitani and Nurse, 1995; Nishitani et al., 2000), it was discovered that both proteins are downregulated in G2 cells. To confirm this result, cdc25-22 cells were arrested for four hours at the restrictive temperature of 37°C to accumulate cells in the G2 phase of the cell cycle. The kinetics of cdc25-22 cells arrested in G2 are shown in figures 2.1 A and 2.IB. The cell number in the population (figure 2.1 A) fails to increase significantly between two and six hours at 37°C indicating that these cells are no longer dividing. Similarly, the percentage of binucleates in the culture (figure 2.IB) which represents cells that are either in mitosis, Gl, or S phase, decreases to less than 5% after two hours at 37°C. These cdc25-22 cells can efficiently maintain the block over mitosis until six hours at 37°C, after which time they begin to leak through the 58 Chapter 2 Cdc18 expression in G2 cells block and attempt to divide. Boiled extracts were prepared from these cdc25-22 cells arrested for four hours, run on SDS-PAGE, and Western blotted for Cdc 18 and Cdtl. Both proteins were barely detectable in these G2-arrested cells (figure 2.1C). In contrast, when extracts were prepared from the same cells that had been synchronously released back into the cell cycle and collected at the Gl/S boundary, increased levels of Cdc 18 and Cdtl were detected. This is consistent with the published results which describe the periodicity of Cdc 18 and Cdtl levels throughout the cell cycle (Nishitani and Nurse, 1995; Nishitani et al., 2000). While Cdc 18 and Cdtl are downregulated in G2, the MCMs remain constitutively nuclear (Sherman and Forsburg, 1998; Pasion and Forsburg, 1999). This was confirmed by tagging the endogenous Cdc21 gene, which encodes a subunit of the MCM complex, with green fluorescent protein (GFP) at its C-terminus in a cdc25-22 strain and monitoring the localisation of this fusion protein by live imaging of GFP. Consistent with published results (Kearsey et al., 2000), Cdc21-GFP was detected in the nuclei of all cells growing exponentially, and also in cells arrested in G2 by shifting the cells to 37°C for four hours (figure 2.ID). Together, these results characterise a G2 cell as having low levels of Cdc 18 and Cdtl, yet with Cdc21 in its nucleus, and suggests that the repression of DNA synthesis may be due to limiting amounts of Cdc 18 and Cdtl and not MCMs. 2.2.2 Cdc18 induces DNA synthesis in G2 ceils To determine whether downregulation of Cdc 18 is important to block re-replication after the completion of S phase, Cdc 18 was ectopically expressed in cells arrested in G2 (the role of Cdtl will be discussed in detail in Chapter 3). cdc 18+ was expressed under the control of the regulatable nm tl promoter in cdc25-22 cells (cdc25-22 nmtl- cdcI8+', kindly given by H. Nishitani). The nmt promoter is induced when thiamine 59 Chapter 2 Cdc18 expression in G2 cells (T) is removed from the media and requires approximately 15 hours for full expression of the gene under its control. To ensure that the inducible Cdc 18 was expressed only once all cells have arrested in G2, the n m tl promoter was de repressed for 11 hours at 25°C before shifting the culture to 37°C. Under these conditions the endogenous Cdc 18 was degraded after two hours at 37°C as cells arrested in G2 while the ectopically expressed Cdc 18 accumulated after four hours at 37°C (figure 2.2A and 2.2B). These cells maintained an effective block over mitosis throughout the incubation at 37°C; after two hours at 37°C, there was no further increase in cell number and the percentage of binucleate cells remained less than 5% (figure 2.2C and 2.2D). These cells maintained a more efficient block over mitosis than the control strain (figure 2.1), perhaps due to a reduction of Cdc2 kinase activity due to the higher levels of Cdc 18 (Nishitani and Nurse, 1995). I next assessed whether high levels of Cdc 18 in G2 cells was sufficient to induce re-replication. Using FACS analysis, the DNA content of the cdc25-22 and cdc25-22 nmtl-cdcl8+ strains was monitored after the shift to 37°C in the absence of thiamine. In the control strain, cells arrested with a 2C DNA content as expected for G2 cells, and there was no further increase in DNA content during the eight hour incubation at 37°C (figure 2.3A). It should be noted that the FACS peak in these cells drifted towards the right as they persisted in the block due to an autofluorescence artefact as a consequence of cell elongation (Sazer and Sherwood, 1990). In contrast, when Cdc 18 was overexpressed in the cdc25-22 block, the DNA content began to increase after five hours at 37°C and cells accumulated an apparent 16C peak after eight hours at 37°C (figure 2.3B, note the log scale). Given the effect of cell elongation on apparent DNA content, these cells have undergone at least two doublings of DNA content (equivalent to 8C) by the end of the time course. This 60 Chapter 2 Cdc18 expression in G2 cells increase in DNA content coincides with the accumulation of Cdc 18 protein (see figure 2.2B) suggesting that overexpression of Cdc 18 is driving these cells to re- replicate from G2, 2.2.3 Replication origins re-fire illegitimately in G2 ceils overexpressing O dd8 While FACS analysis revealed a bulk increase in DNA content, I next determined whether this was arising due to de novo origin firing, in these G2 cells. To detect origin firing, I used the technique of neutral-neutral two-dimensional (2D) gel electrophoresis (Friedman and Brewer, 1995) (outlined in figure 2.4). This technique involves the preparation of genomic DNA from cells, digestion of the DNA with restriction enzymes, and then separation of the restriction fragments by two stages of gel electrophoresis in agarose gels. The first gel (‘first dimension’) is run at low voltage and in the absence of ethidium bromide to separate fragments primarily on the basis of mass. The entire lane of the gel containing the restriction fragments of various sizes is excised, rotated 90° , and re-cast in a second agarose gel. This second gel (‘second dimension’) is run at higher voltage in the presence of 0.3pg/ml of ethidium bromide and separates fragments on the basis of both mass and shape. Linear fragments will migrate along a diagonal arc (‘arc of linears’) while fragments containing structural complexity will be retarded in the gel and migrate above the arc of linears. Southern blotting of the second dimension gel and probing with a fragment of interest reveals replication or recombination intermediates detected within a specific region of the genome. Figure 2.5 illustrates the typical structures corresponding to passive replication of a fragment (‘simple Y’ or ‘fork arc’), origin firing (‘bubble arc’), and recombination and/or termination intermediates (‘X-spike’). The replication origin analysed in these studies is named arsSOOl and has been mapped to a 600bp sequence within the non-transcribed spacer region of the 61 Chapter 2 Cdc18 expression in G2 cells ribosomal DNA (rDNA) repeats upstream of the rDNA genes (figure 2.6). This origin was identified by its autonomously replicating sequence (ARS) activity in plasmid transformation assays (Kim and Huberman, 1998) and by the detection of replication bubbles by 2D gels within a 3kb fragment with this sequence in its central third (Sanchez et al., 1998). Both assays confirmed that origin activity was restricted to this 600bp sequence and not detected in other regions of the 10.9kb rDNA repeat. The two probes used in subsequent 2D gel analyses are shown in figure 2.6 and are referred to as probe A and probe B. Probe A recognises arsSOOl within its central third and probe B recognises a non-origin region of the rDNA repeat spanning the 5.8S and 25S genes. The rDNA repeats are present in approximately a hundred copies in each cell and are mostly arranged in a tandem array along chromosome III. Since each repeat is likely to be identical, hybridisation of a 2D gel with a probe for arsSOOl will recognise the hundred copies of this origin and reveal a composite of the replication intermediates present in the entire array of rDNA repeats. This is exemplified in figure 2.7 in which genomic DNA was prepared from wild type, exponentially growing cells, run on a 2D gel, and probed for arsSOOl (probe A). A fork arc, bubble arc, and an X-spike were all detected in these cells (figure 2.7A and 2.7B). This reflects the fact that arsSOOl is not functional as a replication origin in every copy of the rDNA repeat. If every single origin fired, then only a bubble arc would ever be detected. Instead, for each origin that does not fire, a fork will be detected travelling through the origin region. Based on the ratio of the intensity of the bubble arc compared to the ascending portion of the fork arc, the efficiency of origin firing can be estimated. Depending on the position of the initiation site within the fragment probed for, the descending portion of the fork arc may also include forks emerging 62 Chapter 2 Cdc18 expression in G2 cells from the initiation site. For arsSOOl the efficiency is conservatively estimated at 30- 50% since the hybridisation signal of the bubble arc is approximately equal to the signal from the ascending portion of the fork arc. This is consistent with the estimate published by Sanchez et al., (1998). Using 2D gels as an assay for origin firing, I tested whether arsSOOl was re firing in G2 cells when Cdc 18 was overexpressed. Genomic DNA was extracted from the cdc25-22 control and cdc25-22 nmtl-cdcl8+ cells before the shift to 37°C and every two hours thereafter. Digested DNA was run on 2D gels and probed for arsSOOl (figure 2.8). In both strains, the typical pattern of replication intermediates (see figure 2.7B) was detected in cells before the shift to 37°C. In the control strain, replication intermediates were no longer detected by two hours after the shift to 37°C and for the remainder of the block, consistent with all cells arresting in G2 (figure 2.8, upper panel). In the strain overexpressing Cdcl8, replication intermediates were not detected at two and four hours at 37°C, but as Cdc 18 began to accumulate by five hours, both replication forks and initiation bubbles appeared and persisted as cells re replicated (figure 2.8, lower panel). This result demonstrates that high levels of Cdc 18 can induce origin firing at arsSOOl from the G2 phase of the cell cycle. I consistently observed that the ratio between the bubble and fork arcs changed as cells re-replicated. At five hours, the ratio was roughly similar to that observed in exponentially growing cells (see the zero and five hour time points in figure 2.8, lower panel) suggesting that the origin firing in G2 occurs with approximately the same efficiency as in a normal S phase. However, as cells increased their DNA content, the bubble arc became progressively weaker and was dominated by a stronger fork arc. From this I propose that efficient origin firing is limited to early stages of the experiment (see Discussion). 63 Chapter 2 Cdc18 expression in G2 cells To test whether initiation during re-replication was restricted to origin sequences, 2D gels were hybridised with a probe specific for a non-origin region 3’ to ars3001 that has been shown previously to lack ARS activity (Kim and Huberman, 1998; Sanchez et al., 1998). Consistent with this, only a fork arc was detected at the zero time point when cells were asynchronously growing at 25°C (figure 2.9). No replication intermediates were detected within the first four hours after the shift to 37°C, although by six hours a strong fork arc was detected which persisted throughout the block, but never a bubble arc. I conclude that the DNA synthesis occurring in this region of DNA in response to high levels of Cdc 18 only arises from initiation at the defined ARS origin region and not from adjacent sequences. 2.2.4 Association of initiation factors with chromatin during re-repiication from G2 During Gl, components of the pre-replicative complex become sequentially associated with chromatin in preparation for origin firing at the onset of S phase (Ogawa et al., 1999; Kearsey et a l, 2000; Nishitani et al., 2000). To determine whether components of the pre-RC become re-associated with chromatin in cdc25-22 nmtl-cdcl8+ arrested cells that are induced to re-replicate, an assay was used to purify proteins associated with chromatin. This assay was developed by Lygerou and Nurse, (1999) and modified slightly (see Materials and Methods). An outline of the purification steps involved in this assay is illustrated in figure 2.10. The protocol first involves the preparation of spheroplasts which are then lysed by Triton to generate the Total cell lysate. Centrifugation through a sucrose gradient allows the separation of the Triton extractable fraction and the pellet which contains a crude chromatin fraction. The pellet is then treated with DNasel in the presence of low salt to solubilise proteins associated with chromatin. After centrifugation, the supernatant fraction is enriched for chromatin associated proteins. The total cell lysate,Triton 64 Chapter 2 Cdc18 expression in G2 cells extractable and chromatin fractions were then run on SDS-PAGE and Western blotted for various initiation factors. I first examined whether Cdc 18 itself becomes associated with cliromatin when overexpressed. Total cell lysates,Triton extractable and purified chromatin fractions were prepared fromcdc25-22 and cdc25-22 nmtl-cdc 18+ cells every two hours throughout the incubation at 37°C and equal amounts of each, as judged by the respective loading controls, were run on SDS-PAGE (figure 2.11). As a control for the increased chromatin association of Cdc 18, Cdtl, and Cdc21 which is observed in preparation for a normal S phase,cdc25-22 cells were arrested for four hours at 37°C then shifted back to the permissive temperature of 25°C to allow cells to synchronously re-enter the cell cycle. Cells were collected sixty minutes after the shift to 25°C which corresponds to the Gl/S phase. Fractionation of these cells and Western blotting confirmed that increased Cdcl8, Cdtl and Cdc21 became associated with chromatin in Gl/S cells relative to the cdc25-22 arrested cells. In the cdc25-22 cells, very little Cdc 18 was detected in either the total cell lysate,Triton extractable, or the chromatin fraction, consistent with the majority of endogenous Cdc 18 being downregulated in the G2 arrest. In the cdc25-22 nmtl- cdcl8+ cells, Cdc 18 accumulated to high levels in the total cell lysates and Iriton extractable fractions between four and six hours at 37°C in the absence of thiamine. Concurrently, a significant fraction of Cdc 18 became associated with chromatin when it was overexpressed in these G2 cells. When the Cdc21 protein was assessed, levels of Cdc21 in the total cell lysate remained constant in the control, consistent with Cdc21 levels being constant during the cell cycle (Maiorano et al., 1996). Similarly, Cdc21 levels did not change in the Cdc 18-overexpressing cells. In the chromatin fraction, a low level of Cdc21 binding was detected during the G2 block which 65 Chapter 2 Cdc18 expression in G2 cells increased only a small amount upon overexpression of Cdcl8. This marginal increase is not as significant as the increase observed in a normal Gl cell. When the Westerns were re-blotted for the Cdtl protein, no Cdtl was detectable in any of the fractions in the G2-arrested cells regardless of Cdc 18 overexpression. This is in striking contrast to the accumulation and chromatin association of Cdtl in a normal Gl cell. From these results I conclude that a large fraction of overexpressed Cdcl8, but only little Cdc21 and apparently no Cdtl, becomes associated with chromatin at the re-initiation of replication in G2 cells. To address the possibility that the apparent increase in Cdc 18 binding to chromatin was an artefact due to excess Cdc 18 protein in the cell, a similar time course was followed with a strain overexpressing Cdc 18 in an o rp l-4 temperature- sensitive mutant (orpl-4 nmtl-cdcl8+; kindly given by H. Nishitani). O rp l + encodes one of the subunits of the Origin Recognition Complex. When the amount of Cdc 18 in the total cell lysate was compared in the o rp l-4 mutant and cdc25-22 mutants, the levels of expression were similar in both strains (figure 2.12). However, in the orpl-4 mutant only a small fraction of the Cdc 18 in the total cell lysate was apparently associated with chromatin. This indicates that my assay for the association of high levels of Cdc 18 with chromatin in the cdc25-22 strain is specific and that binding of Cdc 18 to chromatin requires Orpl. To assess whether overexpression of Cdc 18 in the orpl-4 mutant can induce re-replication, the DNA content of these cells was analysed by FACS (figure 2.13). At the restrictive temperature, this mutant did not re-replicate and cells arrested with a 1C DNA content (figure 2.13A). This arrest was irreversible since shifting the cells back to the permissive temperature of 25°C after five hours at 37°C did not induce re replication (figure 2.13B). It was confirmed that the inability of these cells to re- 66 Chapter 2 Cdc18 expression in G2 cells replicate was due to a requirement for functional Orpl since orpl-4 nmtl-cdcl8+ cells could re-replicate when Cdc 18 expression was induced at the permissive temperature (figure 2.13C). These results support the conclusion that Orpl is required for CdclS-induced re-replication and for Cdc 18 to bind to chromatin. 2.2.5 Cdc21 is genetically required for re-replication in G2 In wild type cells, Cdc 18 is required for the loading of Cdc21 onto chromatin (Kearsey et al., 2000; Nishitani et al., 2000). Since high levels of Cdc 18 do not result in a major increase in the loading of Cdc21 onto chromatin in G2 cells, I tested whether Cdc21 was required for re-replication. A strain was constructed which carries temperature-sensitive mutations in both the cdc25 and cdc21 genes, and has the cdc 18+ gene integrated into the genome regulated by the nm tl promoter {cdc25-22 cdc21-M68 nmtl-cdcl8+). These cells were grown at 25°C in the absence of thiamine for 11 hours and then shifted to 37°C, as described in figure 2.2A. Western blotting showed that Cdc21 became destabilised in this mutant four hours after shifting cells to 37°C, and that ectopically expressed Cdc 18 accumulated within these cells after six hours at 37°C (figure 2.14). DNA content of these cells was monitored by FACS during the eight hour time course at 37°C and remained constant with a 2C peak (figure 2.15A), with some drift of the FACS peak due to cell elongation. A similar drift was also detected when Cdcl8 expression was repressed in the presence of thiamine at 37°C (figure 2.15B) supporting the conclusion that Cdc 18 fails to induce re-replication in these cells. This inability to re-replicate was not reversible since shifting the cdc25-22 cdc21-M68 nmtl-cdcl8+ cells to 25°C after five hours at 37°C did not induce re-replication (figure 2.15C). This was due to a requirement for functional Cdc21 protein since Cdc 18 could induce re-replication in this strain when grown at the permissive temperature (25°C) (figure 2.15D). The Cdc25 protein is not 67 Chapter 2 Cdc18 expression in G2 cells required for re-replication since overexpression of Cdc 18 induces re-replication in cdc25-22 arrested cells (figure 2.3B). These results suggest that while there are only low amounts of Cdc21 associated with chromatin in the presence of high levels of CdclS, Cdc21 is nevertheless essential for Cdc 18 to induce re-replication incdc25-22 arrested cells. 2.3 Discussion In this chapter, I have found that if high levels of Cdc 18 accumulate in G2, these cells are driven to replicate DNA that has already completed replication in the previous S phase. Therefore, accumulation of high levels of Cdc 18 has the capability to re license chromatin in G2 and recruit the replication machinery to bring about additional DNA synthesis. The increase in DNA content of these re-replicating G2 cells is unlikely to arise from random initiation events. Using 2D gel electrophoresis, origin firing was only detected within the ars3001 locus and never at flanking sequences, suggesting that normal S phase origin specificity is maintained during re replication initiated in G2 cells. I also found that when Cdc 18 first accumulates in G2 cells, the efficiency of origin firing is similar to that which is detected in wild type cells and indicates that the controls which determine origin usage for ars3001 during S phase also apply to cells that fire illegitimately in G2. Interestingly, as the G2 cells continued to re-replicate, the ratio of the bubble arc to the fork arc diminished substantially implying that origin firing may be progressively more inefficient. There are least two explanations for the decrease in origin firing in these cells. One possibility is that there are a limited number of pre- RCs that can assemble onto origins to bring about initiation. Evidence from budding yeast estimates that one ORC complex is assembled per origin (Rowley et a l, 1995). 68 Chapter 2 Cdc18 expression in G2 cells If ORC determines the maximum number of origins that can be functional per cell, then the first round of replication in G2 cells would use origins normally. If no more ORC complexes could be assembled, then as the DNA content increased the fraction of origins used per chromosome would decrease exponentially. Likewise, if fewer initiation events occur within each rDNA repeat then proportionally more forks will be detected due to passive replication ofarsSOOl. Another possibility is that some other factor is unstable in G2 cells which leads to inefficient assembly of pre-RCs onto origins. I have shown that while high levels of CdclS can bind to chromatin in G2, there is only a very limited increase in the binding of the MCM Cdc21 to chromatin and no detectable Cdtl. I have shown genetically that Cdc21 is required for re-replication from G2, consistent with data showing that cdc21-M68 cells overexpressing CdclS cannot continue to re-replicate when shifted to the restrictive temperature (Kearsey et al., 2000). While I detected only low levels of Cdc21 biochemically associated with chromatin, Kearsey et al., (2000), clearly detected association of Cdc21-GFP with chromatin in re-replicating cells using an in situ chromatin assay. The discrepancy between these results could be explained by a difference in the cell cycle stage during which CdclS accumulated. In the experiments presented here, CdclS was specifically overexpressed in G2 cells whereas in the experiments conducted by Kearsey et a l, (2000), CdclS was overexpressed in exponentially growing cells which will consist initially of approximately 10% of the cells in Gl/S phase which might increase as cells proceed through the cycle and accumulate in this phase. It is therefore possible that Cdc21 can be more efficiently loaded onto chromatin within these Gl/S phase cells. Perhaps in the presence of high levels of CdclS in G2 cells the association of Cdc21 with chromatin is transient, and although sufficient to bring about origin firing, this 69 Chapter 2 Cdc18 expression in G2 cells association becomes more unstable as cells persist in the G2 block. An explanation for this could be the lack of Cdtl, especially since Cdtl is essential for the recruitment of MCMs onto chromatin during a normal Gl (Nishitani et al., 2000). In G2 cells, Cdtl appears to be absent or present at very low levels which may hinder efficient loading of MCMs onto chromatin by CdclS. This hypothesis was tested and the role of Cdtl regulation in these re-replicating G2 cells is the focus of the experiments described in Chapter 3. One question that remains outstanding is whether Cdtl is required for CdclS-induced re-replication in G2 cells. At present there are no temperature-sensitive mutants of Cdtl available which would allow me to address this. Another feature of the re-replication induced by CdclS in G2 is the kinetics of DNA replication are much slower than in normal wild type cells. In fission yeast, S phase usually lasts between 10 and 15 minutes whereas the doubling time in these re- replicating cells, as judged by the FACS data shown in figure 2.3, is approximately two hours. Lack of synchrony in these experiments may be partly responsible but another possibility is that the low level of Cdc21 binding to chromatin is affecting the fork rate. MCM complexes from fission yeast and human cells have been shown to have helicase activity in vitro (Ishimi, 1997; Lee and Hurwitz, 2001), and it has been shown in budding yeast that MCMs travel with replication forks and are required for elongation (Aparicio et al., 1997; Tanaka et al., 1997; Labib et a l, 2000). If MCMs are also important for fork progression in fission yeast, then perhaps the instability of Cdc21 on chromatin could account for the slow replication rate in these G2 cells. Taken together, these possibilities are not mutually exclusive and limiting amounts of ORC, Cdtl, and transient association of Cdc21 could contribute to the inefficiency of origin firing and DNA synthesis during re-replication in G2. 70 Chapter 2 Cdc18 expression in G2 cells In conclusion, I propose that in fission yeast CdclS plays a key role in the cell cycle control of S phase and its downregulation is critical to prevent re-replication in G2 cells. High levels of CdclS can abrogate this control and induce origin firing and re-replication, which is ultimately lethal to the cell. While CdclS overexpression is sufficient for re-replication in G2, other factors such as Cdtl and Cdc21 may be limiting and reduce the efficiency of re-replication. 71 B 65000 jo 40 - 8 #m 30- S 40000 0 1 20- o c g 1 0 - ûî 25000 Hours at 37°C Hours at 37“C cdc25 block Gl/S exponential cdc25 block Cdc18 Cdtl Tubulin Figure 2.1 Characterisation of initiation factors in cdc25-22 ceils (A) Measurements of cell number and (B) percentage of binucleates in a culture of cdc25-22 cells following the shift to 37°C. (C) cdc25-22 cells were arrested for four hours at 37°C to accumulate cells in G2 (‘cdc25 block’) and synchronously released into the cell cycle by shifting to 25°C and collected after sixty minutes (‘Gl/S’). Boiled extracts were run on SDS-PAGE and Western blotted for CdclS and Cdtl. Tubulin serves as a loading control. (D) Live imaging of cdc25-22 cdc21-GFP cells growing exponentially (left) or arrested in G2 after four hours at 37°C (right). B Hours at 37°C Hours at 37°C: 0 2 4 6 I I____ I____ L 0 2 4 6 8 Grow at 25°C Cdc 18 begins to Cdc18 mm Î accumulate Shift to 37°C 11 13 15 17 19 Hours without thiamine 20000 CO S 40- S g 30- E =3 =3 C C 12500- 0) O 8000 Hours at 37°C Hours at 37°C Figure 2.2 Overexpression ofcdcl8+ in cdc25-22 cells (A) Schematic of experimental system. cdc25-22 nmtl-cdcl8+ cells were grown at 25°C for 11 hours in the absence of thiamine to induce the expression of CdclS, then shifted to 37°C for eight hours. (B) The expression of CdclS was monitored by Western blotting. The arrow indicates the CdclS protein. Tubulin serves as a loading control. (C) Measurements of cell number and (D) percentage of binucleates in a culture of cdc25- 22 nmtl-cdcl8+ cells following the shift to 37°C. B cdc25-22 cdc25-22 nmt1-cdc18+ 8 6 o o oh- co co 5 m CD £2 £" Z) 3 4 o O 2 0 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) Figure 2.3 CdclS induces DNA synthesis incdc25-22 arrested cells FACS analysis of (A) cdc25-22 and (B) cdc25-22 nmtl-cdcl8+ cells shifted to 37°C in the absence of thiamine as described in figure 2.2A. Note the DNA content is plotted on a log scale. Purify genomic DNA Digest with restriction enzymes First dimension: Kb 10 — Separate fragments 5 — based on mass Second dimension: Kb Kb Separate fragments based on shape Arc of linears Southern blot: Kb Figire 2.4 Two dimensional gel electrophoresis Schtmatic diagram outlining the protocol for two dimensional gel electrophoresis of genomic DNA. Simple Y Bubble X-splke o Figure 2.5 Replication intermediates detectable by 2D gel electrophoresis Diagram illustrating the typical patterns of replication intermediates detectable by 2D gel electrophoresis. The numbered diagrams in the box indicate the expected shapes of the intermediates which give rise to the patterns shown at the top. Adapted from Fried man and Brewer, 1995. The black circle corresponds to linear, unreplicating DNA. repeat^ rDNA repeat (10.9kb) -^rDNA ars3001 ars3001 25S Ie T S I 17S I I I I 25S r 5.8S Probe A Probe B Hindlll Kpnl EcoRI EcoRI 3kb 3.4kb Figure 2.6 Schematic of the rDNA repeats containingarsSOOl The rDNA repeats are 10.9kb in size and arranged in a tandem array of at least a hun dred copies on chromosome III. Each repeat contains the replication originarsSOOl (in red) and the rDNA genes. Probes used in subsequent 2D gel analyses are mapped to the region detected by each probe. The enzymes used to digest both the genomic DNA and the rDNA fragment used as the probe are indicated. Probe A detects a 3kb region containing ars3001 within its central third. Probe B detects a 3.4kb region spanning the 5.8S and 25S genes. B X Figure 2.7 2D gel patterns forarsSOOl (A) Schematic of the replication intermediates detectable by 2D gel electrophoresis. (B) 2D gel of genomic DNA prepared from exponentially growing wild type cells digested with Hindlll and Kpnl and hybridised with probe A to detect arsSOOl. Probe A Hindlll —------Kpnl 3kb cdc25-22 Hours at 37°C: cdc25-22 nmt1-cdc18+ Hours at 37°C: Figure 2.8 Overexpression of CdclS incdc25-22 cells induces origin firing 2D gel electrophoresis of DNA extracted from cdc25-22 cells (top panel) andcdc25- 22 nmtl-cdcl8+ cells (lower panel) probed for arsSOOl. Samples were collected fol lowing the shift to 37°C in the absence of thiamine. Probe B EcoRI cdc25-22 nmt1-cdc18+ Hours at 37°C: Figure 2.9 Origin re-firing is restricted to ARS sequences 2D gel of DNA extracted from cdc25-22 nmtl-cdcl8+ cells probed with a fragment which recognises a non-origin sequence downstream of arsSOOl (probe B). Samples were collected every two hours following the shift to 37°C in the absence of thiamine. Spheroplasts Triton lysis Total Cell Lysate Centrifugation through sucrose Supernatant Pellet Triton Extractable DNasel digestion Centrifugation Supernatant Pellet Chromatin Associated Insoluble Figure 2.10 Assay for chromatin associated proteins Diagram illustrating the steps involved in the purification of chromatin associated proteins. Total cell lysate cdc25-22 cdc25-22 nmt1-cdc18+ G1/S 2 4 6 8 2 4 6 8 Cdc18 Cdc21 Cdt1 Tubulin Triton extractable (X-1 o o) cdc25-22 cdc25-22 nmt1-cdc18+ G1/S 2 4 6824 68 Cdc18 — . Cdc21 —• Cdt1 Chromatin cdc25-22 cdc25-22 nmt1-cdc18+ G1/S 2 4 6824 68 ■ ^ Cdc18 Cdc21 Cdt1 Coomassie Figure 2.11 Chromatin association of initiation factors Total cell lysate,Triton extractable and chromatin fractions were prepared from cdc25- 22 and cdc25-22 nmtl-cdcJ8+ cells every two hours after shifting to 37°C in the absence of thiamine. As a positive control, these fractions were also prepared from cdc25-22 cells synchronised in Gl/S as described in figure 2.1C. Samples were run on SDS-PAGE and Western blotted for CdclS, Cdc21, and Cdtl. Tubulin serves as a loading control for the total cell lysate and Triton extractable fractions, and Coomassie staining serves as a control for the chromatin fraction. Total cell lysate cdc25-22 orp1-4 nmt1-cdc18+ nmt1-cdc18+ 02468 02468 Cdc18 SÊ. E Tubulin Chromatin cdc25-22 orp1-4 nmt1-cdc18+ nmt1-cdc18+ 02468 02468 Cdc18 Coomassie Figure 2.12 Association of CdclS with chromatin is Orpl dependent CdclS was overexpressed in cdc25-22 and o rpl-4 temperature-sensitive mutants as described in figure 2.2A. Cells were shifted to 37°C for eight hours in the absence of thiamine and samples collected every two hours. Total cell lysate and chromatin frac tions were run on SDS-PAGE and Western blotted for CdclS. Tubulin and Coomassie staining serve as loading controls for the total cell lysate and chromatin fractions, respectively. B 8 8 o 6 o 6 o o r>- M. co CO ro 4 00 4 CO =} o 2 2 0 0 1 2 4 8 16 1 2 4 8 16 DNA Content (G) DNA Content (G) 29.5 A > V cS P 03 m <0 CO 25 .5 E CO ^ 8 c 11 1 2 4 8 16 DNA Content (G) Figure 2.13 Re-repiication requires functional Orpl (A) F ACS analysis of orpl-4 nmtl-cdclS^ cells shifted to 37°C in the absence of thia mine. (B) FACS analysis of cells described in (A) shifted back to the permissive tem perature of 25°C after five hours at 37°C. (C) FACS analysis of orpl-4 nmtl-cdcI8+ cells following the induction of CdclS expression at the permissive temperature of 25°C. cdc25-22 cdc21-M68 nmt1-cdc18+ Hours at 37°C: 0 Cdc18 Cdc21 Cdtl Tubulin Figure 2.14 CdclS overexpression incdc25-22 cdc21-M68 nmtl-cdcl8+ cells cdc25-22 cdc21-M68 nmtl-cdcJ8+ cells were shifted to 37°C in the absence of thia mine as described in figure 2.2A. Boiled extracts were prepared every two hours fol lowing the shift to 37°C and Western blotted for CdclS, Cdc21, and Cdtl. Tubulin serves as a loading control. B 8 8 o 6 o 6 o o coM. COM- CO 4 CO 4 (/) (/) 2 2 0 0 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) 8 29.5 o 6 S o o c o < U L O 00 CM 5 "S< 0 ■*—‘ CO CO 4 E2 3 J ï O .5 E 2 w) ,S5 0 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) Figure 2.15 Cdc21 is required for re-replication in cdc25-22 nnUl-cdcl8-^ cells FACS analysis of cdc25-22 cdc21-M68 nmtl-cdclS^ cells shifted to 37°C (A) in the absence of thiamine or (B) in the presence of thiamine. (C) FACS analysis of cells described in (A) shifted back to the permissive temperature of 25°C after five hours at 37°C. (D) FACS analysis of cdc25-22 cdc21-M68 nmtl-cdcl8+ cells following the induction of CdclS expression at the permissive temperature of 25°C. Chapter 3: Cdt1 Potentiates the Re-replication Induced by Cdc18 in G2 87 Chapter 3 Effects of Cdt1 on re-replication Chapter Summary In this chapter, I have shown that the downregulation of Cdtl contributes to the repression of DNA replication in G2. While Cdtl on its own does not induce replication in a G2 cell, co-expression with CdclS induces extensive DNA synthesis. This re-replication is approximately four times faster than the re-replication observed with CdclS alone, with a doubling time estimated at 30 minutes. In these cells, origin firing was not found to be more efficient and is also restricted to defined ARS sequences. This suggests that the total number of origins that fire is similar to that observed during CdclS-induced re-replication. However, origin firing may persist longer in cells co-expressing both Cdtl and CdclS. This re-replication is also resistant to cycloheximide indicating that it can occur independently of continued protein synthesis. Levels of Cdc21 associated with chromatin were not found to increase significantly in cells co-expressing Cdtl, although as shown for CdclS- induced re-replication, cells nevertheless maintain a genetic requirement for functional Cdc21. While Cdtl may not promote the association of Cdc21 with chromatin when expressed in G2 cells, it may contribute to the enhanced re replication by stabilising CdclS on chromatin. Chapter 3 Effects of Cdt1 on re-replication 3.1 Introduction Critical to restricting S-phase to once per cell cycle is the regulation of factors that license chromosomes for replication. An essential property of licensing factors is that they promote the onset of DNA replication in G1 but are not functional in G2. In Chapter 2 ,1 described how overexpression of CdclS induces illegitimate origin firing and re-replication in G2 cells. This demonstrated that the downregulation of CdclS that normally occurs in G2 is essential for the repression of DNA synthesis. However, the DNA synthesis observed was slow and inefficient, suggesting that other initation factors may have been limiting. In particular, the MCM Cdc21 did not significantly accumulate on chromatin and the initiation factor Cdtl was not detectable in cells re- replicating from G2. In higher eukaryotes, Cdtl is inhibited in G2 by the protein geminin which prevents the association of MCMs with chromatin (McGarry and Kirschner, 1998; Wohlschlegel et a l, 2000; Tada et al., 2001). While a yeast homologue of geminin has not been discovered, this finding suggests that Cdtl may be an additional target for the block to re-replication in G2 in yeast. In this chapter, I have tested the effect of co-expression of Cdtl and CdclS in cdc25-22 arrested cells to determine whether the downregulation of Cdtl in G2 constitutes a second mechanism used by the cell to repress DNA replication in G2 cells. 89 Chapter 3 Effects of Cdt1 on re-replication 3.2 Results 3.2 .1 Cdt1 potentiates the re-replication induced by Cdc18 in G2 By crossing the cdc25-22 nmtl-cdcl8+ strain used in Chapter 2 with a ura4-D18 strain, I was able to select for cells that can re-replicate in the absence of thiamine at 37°C and are auxotrophic for uracil. This strain was then transformed with either an empty pREP4 vector which serves as a control or a plasmid expressing pREP4-c Thus, both CdclS and Cdtl are expressed from the strongest nmt promoter and are induced in the absence of thiamine (please refer to the Materials and Methods chapter for an explanation of the nomenclature used for plasmids and integrants expressing genes under the nmt promoters). As explained in Chapter 2, the timing of expression was adjusted to ensure that the proteins accumulated at least four hours after shifting the cells to the restrictive temperature of 37°C, at which time cells have fully arrested in G2. In cdc25-22 cells transformed with the plasmid pKEVA-cdtl+ I failed to detect any re-replication in the G2 arrest as judged by FACS analysis (figure 3.1). Cells arrested with a 2C DNA content as was observed for the cdc25-22 control (figure 2.3A). This demonstrates that, unlike CdclS, Cdtl is not sufficient to induce re replication on its own. The middle panel shows the FACS analysis ofcdc25-22 nmtl- cdcl8+ cells transformed with the empty vector, pREP4, and shifted to 37°C in the absence of thiamine. As described in Chapter 2, DNA synthesis is de-repressed in cells expressing high levels of CdclS in G2 and cells in this strain accumulate with 4- SC DNA content. In contrast, cells expressing both CdclS and Cdtl in G2, as shown in the right panel, were capable of undergoing extensive re-replication. Cells accumulated apparently 64C DNA content after 4 hours of overexpression of CdclS and Cdtl (see Western blot in figure 3.13). Consistent with this finding, DAPI 90 Chapter 3 Effects of Cdt1 on re-replication staining of these cells detected significantly more DNA in cells overexpressing both Cdtl and CdclS compared to those with CdclS alone (figure 3.2). The FACS analysis of cells co-expressing CdclS and Cdtl in G2 suggests that the bulk of the DNA synthesis is occurring between six and eight hours at 37°C with only one more doubling between eight and ten hours. This led me to investigate the kinetics of re-replication during the six to eight hour window to estimate the rate of doubling of DNA content. Time points were taken at ten minute intervals during this period of extensive re-replication (figure 3.3). As observed by FACS, there appears to be a continuous accumulation of DNA within this time window with the bulk of the cells exhibiting a doubling time of approximately 30 minutes. Once cells accumulated 32-64C DNA content they did not replicate further suggesting that the replication system is saturated with this amount of DNA. A small portion of the cells never re replicated and remained with a 2C DNA content. These cells may have lost the plasmid expressing Cdtl but continue to overexpress CdclS which should lead to an increase in DNA content to at least SC. It is not clear why re-replication has not occurred in these cells. This analysis of the re-replication kinetics has shown that Cdtl accelerates the re-replication observed with CdclS alone. It also revealed that the FACS profile of these cells does not exhibit discrete peaks of DNA corresponding to multiple complete rounds of replication. To test this further, the viability of these re- replicating cells was assessed to determine whether any viable diploids or tetraploids could be recovered during the time course. Cells were plated in the presence of thiamine at 25°C at various time points after inducing re-replication at 37°C. A viability curve was determined for the cdc25-22, cdc25~22 nmtl-cdcl8+ pREP4, and cdc25-22 nmtl-cdcl8+ pKE?4-cdtl+ strains by calculating the ratio of viable cells 91 Chapter 3 Effects of Cdt1 on re-replication over the number of cells plated and normalising to the zero time point for each strain (figure 3.4). cdc25-22 cells were found to recover efficiently from the G2 arrest even after ten hours at 37°C. In contrast, viability decreased in cells overexpressing CdclS once cells began to accumulate >2C DNA. Viability was even more severely compromised in cells undergoing extensive re-replication due to the presence of Cdtl. These results are consistent with the re-replicating cells not fully replicating entire chromosomes. 3.2.2 The effects of Cdt1 on origin firing To bring about an increase in DNA content, CdclS and Cdtl must be inducing origins to fire on regions of DNA that have already been replicated. Given the increase in the kinetics of re-replication when Cdtl is co-expressed with CdclS, 1 tested whether there was an increase in the efficiency of origin firing in these cells. Using 2D gel electrophoresis, 1 examined the replication intermediates at the originars3001 during re-replication. In the strain expressing only CdclS (figure 3.5, upper panel), replication forks and bubbles reappeared after cells had been arrested at 37°C for six hours, as was shown in Chapter 2, figure 2.S. In the strain expressing both Cdtl and CdclS, a similar pattern of origin firing was detected throughout the time course. There was no evidence to support an increase in the efficiency of origin firing which could account for the rapid kinetics of re-replication in these cells. As was observed for the strain overexpressing CdclS alone, the intensity of the bubble arc, relative to the fork arc, diminished as cells increased their DNA content. One difference, however, was that the replication forks were far more prominent at the ten hour time point in the cells expressing Cdtl. This may suggest that the forks persist longer in these cells compared to those expressing CdclS alone. 92 Chapter 3 Effects of Cdt1 on re-replication One possible distinction between the strain expressing only CdclS and the one expressing both CdclS and Cdtl is that Cdtl increases the frequency of re-firing of a given origin. If Cdtl increases the efficiency with which a pre-RC can re-form at an origin that has just fired then this would allow more rapid DNA synthesis. This would also be consistent with the finding that these cells do not accumulate DNA in genome equivalents. To address this possibility, the replication bubbles were analysed by 2D gels after treatment of cells with hydryoxyurea (HU), an inhibitor of DNA synthesis. In wild type cells, replication bubbles can expand for several kilobases in the presence of HU and then arrest as large bubbles (Santocanale and Diffley, 1998). By 2D gel analysis, the accumulation of these large, stalled replication bubbles is detected as a region of increased intensity within the upper portion of the bubble arc. This was observed in wild type cells treated for 3.5 hours with HU and probed for arsSOOl (figure 3.6, designated by arrow). After washing out the HU and releasing the cells back into the cell cycle, the stalled replication bubbles were resolved and after 30 minutes, the intensity of the bubble arc was once again uniform. If cells expressing both Cdtl and CdclS re-fired origins more rapidly then perhaps more replication bubbles would stall in the presence of HU and a more intense signal would be detected compared to cells expressing CdclS alone. In the first experiment, HU was added to cells after four hours at 37°C and genomic DNA was prepared from both strains after six, eight, and ten hours at 37°C (figure 3.7). When probed for arsSOOl, 2D gels from both strains revealed the accumulation of stalled bubbles after six hours at 37°C. No dramatic difference was detected between the two strains and in both cases, the stalled bubbles were not efficiently maintained after eight hours at 37°C. 93 Chapter 3 Effects of Cdt1 on re-replication In the second experiment, HU was added to cells after seven hours at 37°C and 2D gels run from samples prepared at the eight and ten hour time points and probed for arsSOOl (figure 3.8). When HU was added at this later time point, only very weak replication bubbles were detected at eight hours in the strain overexpressing CdclS alone and the entire bubble arc was undetectable by ten hours. In contrast, stalled bubbles accumulated in cells overexpressing both Cdtl and CdclS and were still detectable at ten hours, although weaker. While these results do not support the hypothesis that Cdtl is allowing origins to fire more frequently, they instead suggest that cells overexpressing both Cdtl and CdclS are continuing to fire origins at later time points, even though a bubble arc was barely detectable in the 2D gel shown in figure 3.5. Perhaps origin firing persists longer in the presence of Cdtl. This is also supported by the observation that the fork arcs are more easily detected at later time points in cells expressing Cdtl (figure 3.5). One caveat to these results and their interpretation is that the FACS analysis of these cells suggests that HU is largely ineffective at blocking DNA synthesis during re-replication (figure 3.9). Addition of HU to CdclS expressing cells after four hours at 37°C was marginally effective but some cells did succeed at accumulating between 4-SC DNA content in the presence of the drug. Addition of HU at seven hours appears to have no effect compared to the untreated strain. In cells expressing both Cdtl and CdclS, there is clearly a distinction between the effect of HU at four and seven hours. Addition of HU at four hours inhibited most of the replication in these cells, although approximately 50% of the cells accumulated between 4-SC DNA content. However, when HU was added at seven hours, cells accumulated between 16-32C DNA content. This represents less re-replication than was observed in the untreated cells but suggests that a significant fraction of the re-replication observed in 94 Chapter 3 Effects of Cdt1 on re-replication these cells is resistant to HU. A possible explanation for this result is that HU is not effective at high temperature which is discussed in greater detail in the Discussion section of this chapter. Another hypothesis for the ability of Cdtl to promote more rapid re replication is that high levels of Cdtl together with CdclS allow random initiation events to occur at non-origin sequences within the genome. To test this, 2D gels from the cells expressing both Cdtl and CdclS were hybridised with a probe (probe B) recognising a non-origin sequence downstream of arsSOOl (figure 3.10). In these cells, only replication forks, and never replication bubbles, were detected in this region. To confirm that no initiation events occurred in this region, HU was added to cells after four hours at 37°C to stall replication bubbles and 2D gels were hybridised with probe B. As seen in the untreated cells, only replication forks were detected in both strains (figure 3.11). This demonstrates that the specificity of origin firing is maintained throughout the extensive re-replication in these cells. 3.2.3 Re-replication does not require continuing protein synthesis Re-replication by CdclS in exponentially growing cells was shown to occur independently of continuing protein synthesis (Nishitani and Nurse, 1995). To determine whether the re-replication observed in the presence of CdclS and Cdtl in G2 can also proceed in the absence of continued protein synthesis, cells were treated with the protein synthesis inhibitor cycloheximide (CYH) and re-replication was monitored by FACS (figure 3.12A). Untreated cells accumulated approximately 32C DNA content after ten hours at 37°C while addition of lOOpg/ml cycloheximide after four hours at 37°C blocked at least S0% of the re-replication in these cells. In contrast, addition of cycloheximide at six hours only marginally blocked re replication and after ten hours at 37°C cells accumulated a DNA content of 16C. 95 Chapters Effects of Cdt1 on re-replication Before the addition of the drug, at six hours, a shoulder could already be detected in the FACS profile suggesting that re-replication had been initiated by this time point. These results indicate that protein synthesis is required to initiate re-replication in G2, presumably for the ectopic expression of CdclS and Cdtl, but additional continuing protein synthesis is not required once these proteins have accumulated to sufficiently high levels. To test this hypothesis further, the levels of CdclS and Cdtl in these cells were determined (figure 3.12B). Boiled extracts were prepared from untreated and treated cells, run on SDS-PAGE and Western blotted for CdclS and Cdtl. Even after four hours of treatment with cycloheximide, CdclS and Cdtl showed no significant decrease in protein levels. Addition of cycloheximide at four hours, which blocks re replication, still allowed CdclS and Cdtl to accumulate to high levels by eight and ten hours. Addition of cycloheximide at six hours appeared to have no effect on CdclS or Cdtl and the protein levels are similar to those detected in untreated cells. This was surprising since the half-life of CdclS is approximately 15 minutes (Baum et al., 199S). Therefore CdclS levels are expected to decrease substantially after addition of cycloheximide due to rapid turn-over of the protein. In contrast, Cdtl is a more stable protein (Nishitani et al., 2000) and a less significant effect was expected for Cdtl. Since Cdtl cannot induce re-replication alone, it is ultimately the accumulation of CdclS that determines whether a G2 cell will re-replicate at all. One possible explanation for these results is that CdclS is more stable when overexpressed in G2 cells perhaps due to saturation of the proteolytic machinery or due to a direct effect of cycloheximide. 96 Chapter 3 Effects of Cdt1 on re-replication 3.2.4 Cdt1 does not promote Cdc21 chromatin association in G2 Based on the results presented in Chapter 2, I hypothesised that the low level of Cdc21 association with chromatin may be due to limiting amounts of Cdtl in G2 cells. Given the extensive re-replication observed when Cdtl is co-expressed with CdclS in G2, I tested whether the presence of Cdtl in these cells facilitates the assocation of the MCM Cdc21 with chromatin. Total cell lysates and fractions enriched for chromatin associated proteins were prepared from G2-arrested cells expressing either CdclS alone or together with Cdtl (figure 3.13). The ectopically expressed CdclS and Cdtl proteins accumulated in the total cell lysates with the same timing and to high levels. Concurrently, both proteins became associated with chromatin. Interestingly, I observed that in the absence of Cdtl, CdclS initially bound to chromatin efficiently, as shown in figure 2.11, but then began to dissociate at later time points. However, in the presence of Cdtl, the levels of CdclS associated with chromatin remained constant. This suggests that Cdtl may stabilise CdclS on chromatin and this may contribute to more efficient and rapid re-replication. When Cdc21 was examined, Cdc21 chromatin association did increase slightly in the presence of Cdtl but not significantly more than that observed when only CdclS was expressed. The low level of Cdc21 chromatin association may mean that there is a lesser requirement for Cdc21 association during re-replication induced by CdclS and Cdtl in G2 cells. To address this, the double mutant cdc25-22 cdc21-M68 nmtl-cdcl8+ strain was transformed with pREP4 or pRE?4-cdtl+ to genetically determine whether Cdc21 is required for the extensive re-replication induced by Cdtl (figure 3.14). FACS analysis of cells transformed with pREP4, and thus expressing only CdclS, and shifted to 37°C in the absence of thiamine showed no indication of DNA 97 Chapter 3 Effects of Cdt1 on re-replication synthesis, confirming the result presented in figure 2.15A. When Cdtl was expressed in this strain, the majority of the re-replication was suppressed at the restrictive temperature but apparently 8C cells were still observed, allowing for the effect of drift in the FACS profile, suggesting that one doubling of DNA content has occurred in these cells over the four hours of protein expression. This may reflect a genetic interaction between high levels of Cdtl and the temperature-sensitive Cdc21 mutant. Western blotting of boiled extracts prepared from these experiments suggested that Cdc21 may be partially stabilised in the presence of Cdtl which could account for the limited DNA synthesis observed in this mutant (figure 3.14B). Indeed, replication intermediates were detected by 2D gels after six hours at 37°C in cells expressing Cdtl and CdclS in the double mutant but not in those expressing CdclS alone (figure 3.15). Importantly, however, is the finding that the ability of G2 cells to accumulate DNA contents as high as 64C is mostly inhibited in the absence of functional Cdc21, supporting the conclusion that Cdc21 is required for the efficient re-replication induced by high levels of Cdtl and CdclS in G2 cells. 3.3 Discussion In this chapter I have identified a second control operating in G2 cells to repress DNA synthesis which functions to downregulate the initiation factor Cdtl. While re replication was observed when CdclS was expressed to high levels in G2 cells and Cdtl levels were low, the presence of Cdtl in G2 dramatically potentiates this re replication. Cells rapidly accumulate as much as 64C DNA content within four hours of expression of both proteins with a doubling time of approximately 30 minutes, four fold faster than the rate estimated when CdclS is expressed alone. What is the nature of this re-replication? It is unlikely that CdclS and Cdtl are promoting repeated 98 Chapters Effects ofCdt1 on re-replication rounds of a normal S phase. By FACS analysis broad peaks of DNA content were detected, unlike the discrete peaks which correspond to complete genome duplications in cells deleted for cdclS (Hayles et al., 1994). Also, viability is severely compromised in re-replicating cells and co-expression of Cdtl enhances the lethality of cells expressing only CdclS. This suggests that cells are not undergoing complete rounds of replication which would generate viable diploids or tetraploids, at least at early stages of re-replication. Instead I propose that cells are either initiating replication only within specific regions of the genome or the processivity of the replication forks is hindered in some way, giving rise to regions that are either overreplicated or underreplicated. To test this, density transfer experiments could be used to quantify the copy number of various regions of the genome. How does Cdtl accelerate re-replication? One possibility is that the efficiency of origin firing is increased, thereby allowing more origins to fire within a given chromosome and thus increasing the number of replication forks available to synthesise DNA. By 2D gel analysis, I found no evidence to support this hypothesis. Once re-replication was initiated, the origin firing patterns appeared very similar to those observed in CdclS-induced re-replication. When replication intermediates first re-appeared, the ratio of the bubble arc to the fork arc was similar to that of wild type S phase cells and then as cells re-replicated, the bubble arc decreased in intensity relative to the stronger fork arc. This suggests that the efficiency of firing was unchanged in the presence of Cdtl. One possibility is that the cells expressing CdclS and Cdtl were actually re- replicating within a very narrow time window and the bulk of DNA replication was essentially complete by the next timepoint. By FACS analysis, cells increased their DNA content from 2C to 32C within a two hour interval. If this DNA synthesis 99 Chapter 3 Effects of Cdt1 on re-replication occurred within the first 30 minutes, any changes in the origin firing efficiency could have been missed in the two hour interval between timepoints. However, when DNA content was monitored by FACS at ten minute intervals, the kinetics of re-replication appeared to be constant over a two hour period arguing that the changes in 2D gel patterns observed between six and eight hours probably reflect a continuous decrease in the efficiency of origin firing. If the efficiency decreased proportionally to the DNA content one may have expected that since the DNA content was higher at eight hours in cells expressing Cdcl8 and Cdtl compared to those expressing Cdcl8 alone, that the origin firing efficiency would be even more substantially decreased, possibly to the level detected at ten hours in the Cdcl8 strain. This was not the case and when cells were treated with the drug hydroxyurea after seven hours at 37°C, origin firing was detected at eight and ten hours in cells expressing Cdcl8 and Cdtl but not in cells expressing only Cdcl8. This suggested that origin firing persists longer in cells expressing Cdtl and Cdcl8 even though an obvious difference in the ratio of bubble arcs to fork arcs was not observed during the re-replication timecourse in untreated cells. Furthermore, HU was not very effective at blocking DNA synthesis in these re- replicating cells, as judged by the FACS analysis from these experiments. It is likely that HU is not as effective at temperatures as high as 37°C (H.Murakami, unpublished results) and although a high concentration was used (24mM compared to 1 ImM used in wild type cells growing at 32°C), it may be interesting to repeat these experiments with even higher concentrations of HU or find an alternative means of inhibiting DNA synthesis in these cells. This may reveal a more dramatic difference in the ability of the two strains to fire origins during re-replication. Taken together, these results at least provide a preliminary indication that Cdtl may allow origin firing to persist longer and therefore allow cells to accumulate more DNA. 100 Chapter 3 Effects of Cdt1 on re-replication Another explanation for the accelerated DNA synthesis in cells expressing both Cdcl8 and Cdtl, which is not excluded by the one presented above, is that Cdtl may induce initiation events within non-origin sequences. However, when 2D gels were probed for a region downstream of arsSOOl, no replication bubbles were detected, even upon treatment with HU which would at least partially arrest replication bubbles within this region. From these experiments, I conclude that the rules restricting initiation to defined ARS sequences in wild type S phase cells also apply in cells induced to re-replicate. Another characteristic of re-replication induced by Cdcl8 and Cdtl described in this chapter is that it is not dependent on continuing protein synthesis. While treatment of cells with cycloheximide before the accumulation of Cdcl8 and Cdtl inhibited re-replication, addition two hours later allowed re-replication to proceed to nearly the same extent as observed in untreated cells. In addition, both Cdcl8 and Cdtl were stabilised in the presence of cycloheximide regardless of addition of the drug early or later in the time course. This may suggest that the synthesis of other proteins limits the ability of Cdcl8 and Cdtl to induce re-replication. These proteins could be positive regulators of the onset of DNA replication which are essential for initiation in G2 yet are dispensable once DNA synthesis begins. For example, the cyclin Cig2 accumulates in cdc25-22 arrested cells (P.Zarzov, manuscript in preparation) and it is possible that Cig2 synthesis is required for the initiation of replication in the presence of high levels of Cdcl8 and Cdtl. However, once re replication is induced, the synthesis of Cig2 or other proteins is no longer necessary and cells can continue to re-replicate in the presence of cycloheximide. Ultimately, the hypothesis which formed the basis of this chapter was whether Cdtl, when co-expressed with Cdcl8 in G2 cells, would promote the association of 101 Chapter 3 Effects of Cdt1 on re-replication Cdc21 with chromatin. Given the dramatic phenotype of cells expressing Cdtl, it was initially expected that the increase in DNA synthesis arose due to more efficient recruitment of the MCMs onto chromatin. Surprisingly, this hypothesis was not upheld. The levels of Cdc21 associated with chromatin remained low regardless of co-expression of Cdtl. As proposed in Chapter 2, this may reflect a requirement for other pre-RC components, perhaps in addition to Cdtl, to stabilise the association of Cdc21 with chromatin. Alternatively, the levels of Cdc21 associated with chromatin may be difficult to determine if Cdc21 is continuously being loading and then displaced from chromatin during replication. This issue will be explored in more depth, in light of all the results, in the General Discussion at the end of this thesis. Despite the low levels of Cdc21 chromatin association, cells still maintained a genetic requirement for functional Cdc21 to re-replicate. When Cdtl and Cdcl8 were expressed in the Cdc21 mutant, cells managed to double their DNA content but did not undergo the extensive re-replication observed when Cdc21 is functional. Western blotting suggested that the mutant Cdc21 protein may be stabilised in the presence of Cdtl although the effect was minimal. However, this may support the idea that in the presence of Cdtl and Cdcl8 there is a lesser requirement for Cdc21 to bring about DNA synthesis. It is known that the cdc21-M68 allele does not effectively arrest cells in G1 as expected given its essential function in DNA replication. Instead, cells arrest with an apparent 2C DNA content as if the bulk of DNA synthesis has occurred (Coxon et al., 1992). This mutant may therefore support a low level of activity which is sufficient for re-replication when Cdcl8 and Cdtl are overexpressed. Another interesting finding is the observation that Cdcl8 may have been stabilised on chromatin in the presence of Cdtl. In the absence of Cdtl, Cdcl8 was partially removed from chromatin at later time points in the re-replication 102 Chapter 3 Effects of Cdt1 on re-replication experiments. This decrease in chromatin association of Cdcl8 was not observed in figure 2.11, probably because the effect is more pronounced at the later time point of ten hours. A role for Cdtl in stabilising Cdcl8 is also supported by the finding that the association of Cdcl8 with chromatin during a normal Gl/S is decreased when Cdtl expression is repressed in wild type cells (Nishitaniet a l, 2000). While the result presented in this chapter constitutes a preliminary observation, experiments described in Chapter 4 also uncovered a role for Cdtl in stabilising Cdcl8. In conclusion, these results demonstrate that Cdcl8 and Cdtl are sufficient to initiate DNA synthesis in G2 and must form the core of the control which licenses chromosomes for replication. Since Cdtl cannot induce re-replication on its own, these results suggest that Cdtl may be an important co-factor which facilitates replication promoted by Cdcl8. Indeed this is supported by the suggestion that Cdcl8 is stabilised on chromatin in the presence of Cdtl. However, other components of the pre-RC, such as the MCMs, may also be important for re-replication. Expression of Cdcl8 and Cdtl in G2 may only be able to support the partial assembly of a pre-RC that is unstable in the absence of other initiation factors which could contribute to inefficient and incomplete genome duplication. 103 cdc25-22 cdc25-22 nmt1-cdc18+ cdc25-22 nmt1-cdc18+ + pREP4-cdt1+ + pREP4 + pREP4-cdt1+ 10 o 8 o CO 6 TO Z) 4 o 2 0 1 2 4 8 16 1 2 4 8 16 1 2 4 8 16 32 64 DNA Content (C) Figure 3.1 Cdtl potentiates Cdcl8-induced re-replication FACS analysis of cdc25-22 cells transformed with pREP4-cJr/+ (left), cdc25-22 nmtl- cdcl8+ cells transformed with pREP4 (middle), and cdc25-22 nmtl-cdcl8+ cells transformed with pREP4-cdtJ+ (right) shifted to 37°C in the absence of thiamine. cdc25-22 nmt1-cdc18+ cdc25-22 nmt1-cdc18+ + pREP4 + pREP4-cdt1+ Hours at 37°C: 10 Figure 3.2 Cells co-expressing Cdtl and Cdcl8 in G2 exhibit a dramatic re replication phenotype DAPI staining of cdc25-22 nmtl-cdcl8+ pREP4 cells (left) and cdc25-22 nmtl- cdcl8+ pREP4-c Oh 2h * J 4h I 7h50' 6h 7h lOh I I I I I I 7h20' 2 4 8163264 DNA content (C) I I I I I I 2 4 8163264 2 4 8163264 DNA content (C) DNA content (C) Figure 3.3 Kinetics of Cdtl- and Cdcl8- induced re-replication in G2 FACS analysis of cdc25-22 nmtl-cdcl8+ TpREPA-cdtl+ cells shifted to 37°C in the absence of thiamine. Samples were taken at ten minute intervals during the period between six and eight hours at 37°C. 1.00 Legend — e— cdc25-22 cZJ £= 0 . 10- ■ cdc25-22 nmt1-cdc18+ O + pREP4 8 0} _o )-22 nmt1-cdc18+ CO ■ > + pREP4-cdt1 + o È ^ 0.01 Hours at 37°C Figure 3.4 Co-expression of Cdtl and Cdcl8 decreases cell viability Viability of cdc25-22, cdc25-22 nmtl-cdcl8+ pREP4, and cdc25-22 nmtl-cdcl8+ pREP4-c<7/7+ cells shifted to 37°C in the absence of thiamine and then plated in the presence of thiamine at 25°C at various time points after the shift. Viability is repre sented by the fraction of colonies over the number of cells plated and has been normalised to the zero time point for each strain. Probe A Hindlll —------Kpnl 3kb cdc25-22 nmt1-cdc18+ pREP4 Hours at 37X: I. 10 cdc25-22 nmt1-cdc18+ pREP4-cdt1+ Hours at 37°C; Figure 3.5 Origin firing in cells overexpressing Cdcl8 and Cdtl 2D gel electrophoresis of DNA extracted from cdc25-22 nmtl-cdcl8+ pREP4 cells (upper panel) andcdc25-22 nmtl-cdcl8+ pRE?4-cdtl+ cells (lower panel) probed for arsSOOl. Samples were collected every two hours following the shift to 37°C in the absence of thiamine. Probe A Hindlll —------Kpnl 3kb Release HU block 15 min 30 min 45 min Figure 3.6 Replication intermediates accumulate in response to HU Wild type, exponentially growing cells were treated with 1 ImM HU for 3.5 hours at 32°C (HU block), then washed and resuspended in fresh media in the absence of HU to release cells back into the cell cycle. Genomic DNA was run on a 2D gel and probed for arsSOOl. Arrow indicates the stalled replication bubbles that accumulate in the presence of HU. Probe A Hindlll —------Kpnl 3kb cdc25-22 nmt1-cdc18+ pREP4 Hours at 37°C: 10 +HU at 4h cdc25-22 nmt1-cdc18+ pREP4-cdt1+ Hours at 37°C: 8 +HU at 4h 3.7 Accumulation of stalled replication bubbles in re-replicating cells 2D gel electrophoresis of DNA extracted from cdc25-22 nmtl-cdcl8+ cells (upper panels) and cdc25-22 nmtl-cdcI8+ pREP4-cdtI + cells (lower panels) shifted to 37°C in the absence of thiamine and treated with 24mM HU at 4 hours after the shift. 2D gels were probed for arsSOOl. Probe A Hindlll —------Kpnl 3kb cdc25-22 nmt1-cdc18+ pREP4 Hours at 37®C: 8 10 +HU at 7h cdc25-22 nmt1-cdc18+ pREP4-cdt1+ Hours at 37®C: 8 10 +HU at 7h 3.8 Origin firing persists longer in cells expressing Cdtl and CdclS 2D gel electrophoresis of DNA extracted from cdc25-22 nmtl-cdcl8+ cells (upper panels) and cdc25-22 nmtJ-cdcl8+ pRE?4-cdtl+ cells (lower panels) shifted to 37°C in the absence of thiamine and treated with 24mM HU at 7 hours after the shift. 2D gels were probed for arsSOOL cdc25-22 nmt1-cdc18+ cdc25-22 nmt1-cdc18+ + pREP4 + pREP4-cdt1+ 10 10 8 o 8 o o oh» CO 6 CO 6 CD CD to (/) 4 4 2 2 0 0 1 2 4 8 16 1 2 4 8 16 32 64 DNA Content (C) DNA Content (C) 10 10 o 8 o 8 è 6 h 6 CD CD ÇA) 4 + HU ÇA) 4 + HU 2 2 0 0 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) 10 y \ 10 8 8 p + HU o + HU h - CO k 6 k 6 CD | CD (A) Î 2 3 4 4 o X 2 /L 2 0 0 1 / 2 4 8 16 1 2 4 8 16 32 64 DNA Content (C) DNA Content (C) Figure 3.9 Effects of hydroxyurea on re-replication FACS analysis of cdc25-22 nmtl-cdcl8+ pR£P4 cells (left) andcdc25-22 nmtl- cdcl8+ pREP4-cJi‘7+ cells (right) shifted to 37°C in the absence of thiamine (top), treated with 24mM hydroxyurea (HU) at 4 hours after the shift (middle), or treated with 24mM HU at 7 hours after the shift (bottom). Probe B EcoRI cdc25-22 nmt1-cdc18+ pREP4-cdt1+ Hours at 37°C: 0 ' 2 4 6 8 10 . • . • _ 1_____ Figure 3.10 Origin specificity is maintained in Cdtl expressing cells 2D gel electrophoresis of DNA extracted from ^ cdc25-22 nmtl-cdcl8+ pREP4-c^/r7+ cells , , probed for a non-origin sequence downstream of arsSOOl. Samples were collected every two hours following the shift to 37°C in the absence of thiamine. Probe B EcoRi cdc25-22 nmt1-cdc18+ pREP4 Hours at 37°C: 10 +HU at 4h cdc25-22 nmt1-cdc18+ pREP4-cdt1+ Hours at 37°C: 8 10 +HU at 4h 3.11 No bubbles accumulate in non-origin regions of re-replicating cells 2D gel electrophoresis of DNA extracted from cdc25-22 nmtl-cdcl8+ pREP4 cells (upper panels) andcdc25-22 nmtl-cdcI8+ pREP4-c<7/7+ cells (lower panels) shifted to 37°C in the absence of thiamine and treated with 24mM HU at 4 hours after the shift. 2D gels were probed for a non-origin sequence downstream of arsSOOl. L o + CYH k J CO at4h (/) A + CYH at 6h u L 10 Il I I I 1 I I I I 1 I I I I 2 4 81632 2 4 81632 2 4 81632 DNA Content (C) Figure 3.12A Re-replicating cells do net require continuing protein synthesis FACS analysis of cdc25-22 nmtl-cdclS^ pREP4-c6^7+ cells shifted to 37°C in the absence of thiamine (left column), treated with 100 pl/ml of cycloheximide (CYH) at 4 hours (middle column), or 6 hours (right column) after the shift to 37°C. B cdc25-22 nmt1-cdc18+ + pREP4-cdt1+ + CYH + CYH at 6h I------1 Hours at 37°C: 0 8 10 8 10 8 10 Cdc18 Cdt1 Tubulin Figure 3.12B CdclS and Cdtl accumulate in the presence of cycloheximide Boiled extracts were prepared fromcdc25-22 nmt]-cdcl8+ pRE?4-cdtJ+ cells shifted to 37°C in the absence of thiamine and treated with 100 pl/ml of cycloheximide (CYH) at 4 hours or 6 hours after the shift to 37°C. Samples were run on SDS-PAGE and Western blotted for CdclS and Cdtl. Tubulin serves as a loading control. Total cell lysate cdc25-22 nmt1 -cdc18+ cdc25-22 nmt1 -cdc18+ +pREP4 +pREP4-cdt1+ 0 2 4 6 8 10 0 2 4 6 8 10 Cdc18 Cdt1 Cdc21 Tubulin Chromatin cdc25-22 nmt1-cdc18+ cdc25-22 nmt1-cdc18+ +pREP4 +pREP4-cdt1+ 0 2 4 6 8 10 0 2 4 6 8 10 Cdc18 Cdt1 a# • m# Cdc21 Coomassie Figure 3.13 Chromatin association of initiation factors in response to Cdtl Total cell lysates and chromatin fractions were extracted from cdc25-22 nmtl-cdcl8+ cells transformed with either pREP4 or pREP4-ct/^/+ every two hours following the shift to 37°C in the absence of thiamine. Samples were run on SDS-PAGE and West ern blotted for CdclS, Cdtl, and Cdc21. Tubulin and Coomassie staining serve as loading controls for the total cell lysates and chromatin fractions, respectively. cdc25-22 cdc21-M68 cdc25-22 cdc21-M68 nmt1-cdc18+ nmt1-cdc18+ +pREP4 +pREP4-cdt1+ 10 10 p 8 p 8 r— M. CO 6 CO 6 CO (/) (/) 4 4 2 2 0 0 1 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) B cdc25-22 cdc21 -M68 cdc25-22 cdc21 -M68 nmt1-cdc18+ nmt1-cdc18+ + pREP4 +pREP4-cdt1+ Hours at 37°C: 0 2468 10 0 2468 10 Cdc18 Cdtl Cdc21 Tubulin Figure 3.14 Re-replication by CdclS and Cdtl in a Cdc21 mutant (A) FACS analysis of cdc25-22 cdc21-M68 nmtl-cdcl8+ pREP4 and cdc25-22 cdc21- M68 nmtl-cdcl8+ pRE?4-cdtJ+ cells shifted to 37°C in the absence of thiamine. (B) Boiled extracts were prepared from samples in (A), run on SDS-PAGE and Western blotted for CdclS, Cdtl, and Cdc21. Tubulin serves as a loading control. cdc25-22 cdc21-M68 nmt1-cdc18+ pREP4 Hours at 37°C: 0 6 m cdc25-22 cdc21-M68 nmt1-cdc18+ pREP4-cdt1+ Hours at 37°C: 0 6 Figure 3.15 DNA synthesis can occur in the absence of functional Cdc21 in Cdtl and CdclS overexpressing cells 2D gels of genomic DNA extracted from cdc25-22 cdc21-M68 nmtl-cdcl8+ pREP4 cells (top panels) andcdc25-22 cdc21-M68 nmtl-cdcl8+ pREP4-cJr7+ cells (bottom panels) at time zero and at 6 hours after the shift to 37°C in the absence of thiamine. 2D gels were probed for arsSOOl. Chapter 4: The Role of Gdc2 in Re-replication 120 Chapter 4 The role of Cdc2 Chapter Summary In this chapter I have addressed the role of the cyclin-dependent kinase Cdc2 in promoting or inhibiting re-replication induced by high levels of CdclS. Re-replication fails to occur in a strain carrying a mutation in the cdc2 gene thus identifying a positive function for Cdc2 in promoting CdclS-induced re-replication. However, Cdc2 does not influence the ability of CdclS to bind to chromatin when overexpressed. On the other hand, the presence of excess Cig2 or the overexpression of a truncated form of CdclS which does not interact with Cdc2 has no effect on re replication, suggesting that complete inhibition of kinase activity is not a pre-requisite for re-replication. This is also supported by the finding that Ruml does not significantly accumulate in re-replicating cells. Also in this chapter I have discovered that low level expression of an unphosphorylatable form of CdclS together with Cdtl is sufficient to induce replication in G2 cells. This phenotype correlates with the stabilisation of CdclS when Cdtl is co-expressed, thus identiflying two mechanisms that repress DNA replication in G2 and evidence for cross-talk between these pathways. While additional factors may also be targets of these pathways, the phosphorylation state of the initiation factor Orp2 is unlikely to play a role in preventing re-replication in G2 cells. Finally, a preliminary result indicates that Cdtl protein is regulated differently from CdclS during the cell cycle. 121 Chapter 4 The role of Cdc2 4.1 Introduction CDKs play both positive and negative roles in DNA replication (reviewed in Wuarin and Nurse, 1996). In fission yeast, Cdc2 is required at the onset of S phase (Nurse and Bissett, 1981) yet certain mutations in cdc2, deletion of the mitotic cyclin CdclS, or overexpression of the CDK inhibitor Ruml, all induce re-replication (Brock et a l, 1991; Hayles et a l, 1994; Moreno and Nurse, 1994) suggesting that inhibition of kinase activity is necessary for cells to induce re-replication. However, the re replication observed in these situations differs significantly from the re-replication induced by high levels of CdclS. Cells deleted for CdclS or mutated for cdc2 undergo multiple complete rounds of re-replication and effectively re-set the cell cycle from G2 back to Start. Re-replication is dependent on the product of the cdclO gene, presumably in order to re-synthesise sufficient amounts of CdclS and Cdtl. When CdclS is overexpressed, re-replication is independent of CdclO suggesting that it is activating a cascade of events downstream of Start (Nishitani and Nurse, 1995) and may have different requirements for Cdc2. It is known that when the full-length CdclS protein is overexpressed, it can bind directly to Cdc2 and inhibit kinase activity (Nishitani and Nurse, 1995; Greenwood et a l, 199S). However, when a truncated form of CdclS which does not affect kinase activity is overexpressed in exponentially growing cells, re-replication can proceed as efficiently as with the full- length protein (Greenwood et a l, 199S). In G2 cells, the kinase activity is expected to be at a level that exceeds that of a G1 cell yet is not sufficiently high to induce mitosis. In the experiments described in this chapter I was therefore interested in determining the requirements for Cdc2 activity or inhibition in CdclS-induced re replication in G2 arrested cells. 122 Chapter 4 The role of Cdc2 In wild type cells, CdclS is phosphorylated by Cdc2 during S phase which promotes its proteolysis (Jallepalliet al., 1997; Baum et ah, 1998; Lopez-Gironaet ah, 1998). Since the accumulation of high levels of CdclS is sufficient to drive cells to re-replicate, mutation of its six CDK consensus sites was expected to stabilise the protein and induce re-replication. While these mutations succeeded in stabilising the protein, no re-replication was observed when the stable protein was expressed at relatively physiological levels (Jallepalli et ah, 1997; Baum et ah, 1998). This suggested that other key factors were limiting even in the presence of stable Cdcl8. Given the results presented in Chapter 3 ,1 proposed that the levels of Cdtl in the cell may provide an additional restraint on re-replication even when Cdcl8 cannot be phosphorylated. This hypothesis forms the basis for several experiments presented in this chapter. 4.2 Results 4.2.1 Cdc2 is required for Cdc18-induced re-replication To identify whether Cdc2 plays a positive role in re-replication induced by high levels of Cdcl8, the cdcl8+ gene was expressed under the control of the n m tl promoter in a strain carrying a temperature-sensitive mutation in thecdc2 gene. This strain, cdc2-M26 nmtl-cdcl8+, was shifted to the restrictive temperature of 37°C in the absence of thiamine, as previously described in figure 2.2A and the DNA content was monitored by FACS (figure 4.1 A). Within two hours of shifting cells to 37°C, approximately 10% of the cells arrested with a 1C DNA content, while the rest of the population had a 2C peak. This 1C peak arises from cells unable to enter S phase in the absence of Cdc2 (Nurse and Bissett, 1981). After Cdcl8 accumulated in these 123 Chapter 4 The role of Cdc2 cells, the 1C peak gradually shifted to the right and cells arrested with a DNA content apparently between 1C and 2C at the end of the experiment. There was no evidence of re-replication in these cells, despite overexpression of CdclS. This demonstrates that functional Cdc2 is required for CdclS-induced re-replication. The role of Cdc2 at the onset of S phase is unclear, although it is thought to phosphorylate key substrates within the pre-initiation complex to bring about origin firing. This function is likely to be reversible, unlike the requirements for Orpl and Cdc21 upon which other initiation factors are dependent for their sequential recruitment to the pre-RC. To test this, cdc2-M26 nmtl-cdcl8+ cells were shifted to 37°C in the absence of thiamine for five hours and then shifted back to the permissive temperature of 25°C (figure 4.IB). The FACS analysis from this experiment suggests that cells are capable of initiating some DNA synthesis when shifted back to 25 °C. However, a stronger effect of drift was detected at four hours, prior to shifting the cells back to the permissive temperature, thus making the interpretation less clear. Also, 15% of cdc2-M26 cells diploidise following treatment at 36°C for four hours and re-plating at 25°C (Broek et a l, 1991) suggesting that the re-replication observed in the cdc2-M26 nmtl-cdcl8+ strain after shifting back to the permissive temperature may be independent of CdclS overexpression. As a positive control for re-replication in this strain, the expression of CdclS was induced in cdc2-M26 nmtl-cdcl8+ cells at 25°C (figure 4.1C) and FACS analysis showed that these cells could efficiently increase their DNA content within approximately the same generation times as shown for the experiments at 37°C. Taken together, these experiments support a role for Cdc2 in promoting re-replication in response to high levels of CdclS. The inability of the cdc2 mutant to re-replicate could be explained if CdclS depends on Cdc2 to bind to chromatin. To examine this, total cell lysates and 124 Chapter 4 The role of Cdc2 chromatin fractions were prepared from cells overexpressing Cdcl8 in both thecdc2- M26 and cdc25-22 blocks (figure 4.2A). Cdcl8 was overexpressed to the same level in the total cell lysates of both strains and accumulated with similar kinetics. In the chromatin fraction, comparable amounts of Cdcl8 were associated with chromatin in both mutants. These results demonstrate that Cdcl8 can bind to chromatin in the absence of Cdc2 but this is not sufficient to bring about re-replication. When the chromatin fraction from the cdc2-M26 nmtl-cdcl8+ cells was re blotted for Cdc21, an interesting observation emerged (figure 4.2B). While Cdc21 was associated with chromatin in these cells, higher molecular weight forms of Cdc21 were also detected. These forms correspond to hyperphosphorylation of Cdc21 and are normally detected during S phase in wild type cells (Nishitani et ah, 2000; and figure 2.11, lane ‘Gl/S’). These results suggest that Cdc2 may inhibit the phosphorylation of Cdc21. Interestingly, these phosphorylated forms were never observed in cdc25-22 nmtl-cdcl8+ re-replicating cells (see figure 2.11) possibly reflecting a difference between the cells expressing Cdc 18 in the cdc2 versus cdc25 mutants and their ability to re-replicate. 4.2.2 Inhibition of Cdc2 is not a pre-requisite for re-replication Since Cdc2 is required for re-replication, the next question is whether the levels of Cdc2 activity are important in determining its ability to promote re-replication. Speiciflcally, I wanted to test whether increasing the Cdc2-associated kinase activity by increasing the levels of the cyclin Cig2 would have an inhibitory effect on re replication. Cig2 was expressed under the control of the intermediate strengthnmt41 promoter in the cdc25-22 nmtl-cdcl8+ strain. Cells were shifted to 37°C in the absence of thiamine to induce expression of both Cig2 and Cdc 18 in the G2 arrest and DNA content was monitored by FACS (figure 4.3). Despite an increase in the levels 125 Chapter 4 The role of Cdc2 of Cig2 as shown by Western blotting (figure 4.3 A), the accumulation of high levels of Cdc 18 was sufficient to induce re-replication in these cells (figure 4.3B). This highlights a flexibility of these cells to respond to high levels of Cdc 18 regardless of the level of Cig2 cyclin. However, Cdc2 kinase activity was not measured and it remains possible that the excess Cig2 in these cells did not form an active complex with Cdc2, leaving the kinase activity unaffected. An alternative approach was used to further address the question of whether too much kinase can inhibit Cdcl8-induced re-replication in G2. In these experiments, a truncated form of Cdc 18, lacking the N-terminal 55 amino acids, was expressed in cdc25-22 cells. High levels of Cdc 18 have been shown to bind to and partially inhibit Cdc2 activity via these amino acids at its N-terminus (Greenwood et a i, 1998). When these amino acids are deleted, the kinase activity of Cdc2 remains uninhibited in the presence of high levels of Cdc 18 and cells can re-replicate. I tested whether this truncated form of Cdc 18 was sufficient to induce re-replication in cdc25- 22 arrested cells (figure 4.4). cdc25-22 cells were transformed either with a plasmid expressing the full-length cdc 18+ gene under the control of pREP3 (figure 4.4A) or with a plasmid expressing the truncated form ofcdclS, cdcl8-d55, under the control of pREP3 (figure 4.4B). Cells were shifted to 37°C in the absence of thiamine and the DNA content was monitored by FACS. After ten hours at 37°C both strains re replicated to the same extent, accumulating cells with 8-16C DNA content. This result demonstrates that re-replication in G2 cells can occur without direct binding of Cdc2 by Cdc 18 leading to inhibition of Cdc2 protein kinase activity. One additional possibility is that the re-replication observed in G2 cells might be influenced by the accumulation of Rum 1, an inhibitor of Cdc2 (Moreno and Nurse, 1994). To verify this, total cell lysates were prepared fromcdc25-22 nmtl-cdcl8+ 126 Chapter 4 The role of Cdc2 cells transformed with pREP4 or pREP4-c^/^7+ shifted to 37°C in the absence of thiamine, and thus undergoing extensive re-replication in G2. Samples were run on SDS-PAGE and Western blotted with an antibody against Ruml (figure 4.5). There was a small accumulation of Ruml when CdclS was overexpressed with a slight increase in cells co-expressing CdclS and Cdtl, although this accumulation occurred at ten hours at 37°C at which time the bulk of DNA synthesis had already taken place in these cells. Also, Ruml levels did not exceed the amount of Ruml that accumulated in cdc 10-129 cells which arrest in G1 and do not undergo re-replication at the restrictive temperature (Nasmyth and Nurse, 19S1). From this, I conclude that Ruml is unlikely to contribute to the G2 re-replication induced by CdclS even when Cdtl is co-expressed. 4.2.3 T m mechanisms repress DNA replication in G2 One of the paradoxes regarding the role of CdclS proteolysis in preventing re replication in G2 is that expression of a stable form of CdclS, with mutations in the six CDK phosphorylation sites, does not induce re-replication when expressed at low levels (Jallepalli et al., 1997; Baum et a l, 199S). The results presented in Chapter 3 suggest that Cdtl may be an important co-factor for CdclS to re-initiate replication, particularly if the levels of CdclS are low. This raised the possibility that co expression of Cdtl with the stable form of CdclS expressed under the control of a weak promoter may be sufficient to promote replication in G2. To test this, cdc25-22 cells were transformed with a plasmid expressing the stable form of CdclS (cdclSP) under the control of the weakest nmt promoter, REPSl, either alone or together with the plasmid pREP4-cdtl+. Cells were shifted to 37°C in the absence of thiamine and the DNA content was monitored by FACS (figure 4.6A). Consistent with previous reports, expression of CdclSP did not induce re-replication, even in G2 cells. 127 Chapter 4 The role of Cdc2 However, co-expression of high levels of Cdtl allowed DNA synthesis to occur. The re-replication in these cells was not as extensive as was observed when Cdtl was expressed in the presence of high levels of CdclS which could be due to plasmid loss or reflect a threshold of CdclS protein that is required for Cdtl to promote more extensive re-replication. Nevertheless, DNA synthesis did occur in cells expressing Cdtl together with CdclSP as confirmed by 2D gel analysis (figure 4.6B). After eight hours at 37°C, replication intermediates consisting primarily of replication forks and only a very weak bubble arc, were detected only in those cells co-expressing Cdtl and not in cells expressing CdclSP alone. When the protein levels of CdclS and Cdtl were examined in these cells by Western blotting, it was discovered that CdclS accumulated in the presence of Cdtl (figure 4.7A). Only low levels of CdclS were present in cells expressing CdclSP alone but a significant increase was observed after six hours at 37°C in cells expressing pREP4-c<7r7+. This result supports the previous observation made in Chapter 3 that Cdtl may play a role in stabilising CdclS when expressed in G2 cells. In addition, the accumulation of CdclS was not observed in cdc25-22 cells transformed with pREP4-c<7/7+ in the absence of CdclSP (figure 4.7B) demonstrating that the effect is dependent on the presence of unphosphorylated CdclS. Surprisingly, when these extracts were Western blotted for Cdtl, no protein could be detected even in cells expressing pREP4-c(7/^7+. An extract prepared from cdc25-22 cells transformed with pREP4-c<7^7+ served as a positive control for the Cdtl antibody, suggesting that detection of the overexpressed Cdtl protein was not impaired in this Western blot. This experiment was repeated several times and always yielded the same result. Clearly this presents a paradox since the pREP4-c(7^7 + plasmid must be present in these cells since a phenotype is observed by FACS and 2D 128 Chapter 4 The role of Cdc2 gels, and an effect on CdclS stability is only detected in these cells, but there is apparently no detectable Cdtl. The finding that the low level of endogenous wild type CdclS does not accumulate in cdc25-22 cells expressing Cdtl alone (figure 4.7B) suggests that it is the unphosphorylated form of CdclS that accumulates when Cdtl is co-expressed. To prove this more conclusively, cdc25-22 cells were transformed with a plasmid expressing CdclSP with a ‘Myc’ tag fused to its N-terminus, either alone or with pREP4-c^//7+. This would allow the discrimination between the endogenous wild type form of CdclS and the ectopically expressed CdclSP due to the difference in molecular weight imposed by the Myc tag. Cells were shifted to 37°C in the absence of thiamine and analysed by FACS and Western blotting. The FACS analysis showed that cells expressing ^^2EV%\-myc-cdcl8P did not re-replicate although significant drift was detected in these cells (figure 4.SA). Cells co-expressing pREP4-cJr7 + appeared to re-replicate to a low level and only one doubling of DNA content was observed, although it is difficult to estimate the contribution of drift to this FACS profile. It is possible that addition of the ‘myc’ tag hinders the ability of CdclSP to promote re-replication. By Western blotting, the endogenous CdclS was present only at low levels both in the absence and in the presence of Cdtl, while CdclSP accumulated more efficiently when Cdtl was co-expressed (figure 4.SB). It should be noted that several cross-reacting bands were detected at eight and ten hours at 37°C in cells expressing only CdclSP. These could represent modification of the endogenous CdclS, athough they were not observed in cells expressing untagged CdclSP or Cdtl alone (figure 4.7A and 4.7B). They are unlikely to correspond to the Myc-CdclSP since they were not detected upon re-blotting for the Myc epitope (figure 4.SB). Western blotting for Myc did, however, reveal that CdclSP accumulated more rapidly 129 Chapter 4 The role of Cdc2 and to higher levels in the presence of Cdtl. In these cells, the expression of high levels of Cdtl protein could be easily detected, unlike the experiment shown in figure 4.7A. The distinction between these two strains remains unclear and will be explored further in the Discussion at the end of this chapter. The next question was whether Cdtl would have a similar effect on wild type CdclS levels if additional wild type CdclS was ectopically expressed. To test this, cdc25-22 cells were transformed with pREPSl-ct/c75+ in the absence or presence of Cdtl (figure 4.9). After shifting these cells to 37°C in the absence of thiamine, no re replication was observed even when Cdtl was co-expressed (figure 4.9A). An unusual shift of the FACS peak to the left was consistently observed in both strains at eight hours and the significance of this is unclear. It is possible that the FACS peak at eight hours is aberrant in some way and that the shift in the peak at six hours in cells co-expressing Cdtl with wild type CdclS reflects a doubling of DNA content in these cells. 2D gel analysis would be required to clarify the interpretation of this result. By Western blotting (figure 4.9B), the levels of CdclS remained low in the absence of Cdtl expression, although the same cross-reacting bands observed in figure 4.SB were observed again. In cells co-expressing Cdtl, a small increase in CdclS levels was observed. This accumulation may be sufficient to induce a doubling of DNA content in G2 cells although it’s unlikely to be sufficient to induce the re-replication observed when CdclSP was co-expressed with Cdtl in figure 4.6A. However, it is possible that Cdtl affects the stability of CdclS that is unphosphorylated and that a pool of wild type CdclS would also be susceptible to this effect and contribute to re replication especially when exogenous CdclS is expressed. Finally, unlike the result presented in figure 4.7A, the accumulation of Cdtl could be detected in those cells expressing pREP4-c^7/7+. 130 Chapter 4 The role of Cdc2 These results suggest that there are at least two mechanisms in G2 cells to repress DNA synthesis. One mechanism targets CdclS for proteolysis via CDK- dependent phosphorylation while a second mechanism functions to downregulate Cdtl. Additional targets of these inhibitory mechanisms may also exist and one candidate initiation factor, Orp2, was tested. In X enopus, Orc2 is specifically phosphorylated in metaphase extracts (Carpenteret a l, 1996) and in fission yeast, Orp2 is phosphorylated in mitosis and rapidly dephosphorylated as cells exit mitosis (Lygerou and Nurse, 1999), suggesting that the phosphorylation state of Orp2 may prevent re-initiation until cells exit from mitosis. I wanted to determine the phosphorylation state of Orp2 incdc25-22 arrested cells to assess whether Orp2 phosphorylation may also be important to repress DNA replication in G2, To detect Orp2 by Western blotting, a strain was used in which Orp2 was tagged at its C- terminus with Protein A (strain kindly given by Z.Lygerou). Unfortunately, when this strain was crossed into a cdc25-22 background, cells were very sick and did not efficiently arrest in G2 (data not shown). As an alternative approach to arrest cells in G2, the Orp2-Protein A strain was crossed into a cdc2-M26 background which caused less stress to the cell (strain kindly given by Z.Lygerou). As described earlier in this chapter, cdc2-M26 cells arrested initially at both G1 and G2 due to the requirement for Cdc2 at the onset of S phase and for entry into mitosis (Nurse and Bissett, 1981). However, the cells arrested in G1 gradually entered S phase and after two hours at 37°C began to arrest with an apparent 2C DNA content suggesting they were in a G2- like state (figure 4.10A). Under these conditions, the phosphorylation state of Orp2 was examined every hour after shifting the cdc2-M26 cells to 37°C (figure 4.1 OB). Extracts were Western blotted for Protein A to detect Orp2, as well as CdclS and Cdtl. At time zero, Orp2 was primarily detected in the slower migrating form, after 131 Chapter 4 The role of Cdc2 one hour it was equally distributed between the phosphorylated and dephosphorylated forms, while at two to four hours it was primarily present in the dephosphorylated form. This result suggests that once cells arrest in G2, Orp2 accumulates mostly in the dephosphorylated form. Based on this result, I thought it unlikely that Orp2 phosphorylation in fission yeast plays an important role in the repression of DNA synthesis in G2. In this mutant background I also found that CdclS levels accumulated slightly, presumably due to the absence of Cdc2 activity to phosphorylate CdclS and target it for proteolysis, and secondly, that Cdtl became undetectable suggesting that its turn-over may not be regulated by Cdc2. 4.2.4 Preliminary characterisation of Cdt1 regulation Cdtl was originally identified as a target of the transcription factor Cdc 10 (Hofmann and Beach, 1994). Cdc 10 also regulates the transcription of CdclS and Northern blot analysis has shown that the transcripts of both genes appear at the same time during mitosis and accumulate in a metaphase arrest in an nda3-km211 mutant (Baum et a l, 199S). Despite the accumulation of CdclS mRNA, the protein fails to accumulate in this metaphase arrest due to the high level of Cdc2-associated kinase activity in the cell. Upon release from this metaphase arrest, CdclS protein rapidly accumulates. To test whether Cdtl protein is regulated in a similar fashion during mitosis, nda3-km ll cells were arrested in metaphase for six hours and then released into the cell cycle and harvested fifteen minutes after the release as cells began to exit mitosis. Western blotting of CdclS confirmed that the protein levels were low in the arrest and accumulated significantly as cells completed mitosis. In contrast, the Cdtl protein was already present during the arrest and the level remained constant after the release. 132 Chapter 4 The role of Cdc2 This suggests that while Cdtl transcription is regulated similarly to CdclS, the Cdtl protein is subject to different cell cycle controls. 4.3 Discussion The results presented in this chapter strongly support a positive role for Cdc2 in promoting re-replication. Cells failed to re-replicate in the absence of functional Cdc2 and inhibition of the kinase, either by Ruml or direct interaction with CdclS, was not a pre-requisite for re-replication. This differs from budding yeast in which re replication first requires the inhibition of CDKs by the expression of the inhibitor Sicl. Then, analogously to the findings presented here, Sicl must be transiently de repressed to allow sufficient kinase activity to accumulate to promote the onset of DNA replication (Dahmann et al., 1995; Noton and Diffley, 2000). The specific function of Cdc2 in promoting re-replication remains unclear. Interestingly, CdclS retained the ability to bind to chromatin in the absence of Cdc2 suggesting that the pre-RCs assembled on chromatin but origins failed to fire. The nature of the Cdc2 inhibition appeared to be reversible, indicating that it is inducing a change in the phosphorylation state of the pre-RC or of some other component dependent upon pre-RC formation. Surprisingly, highly phosphorylated forms of Cdc21 accumulated on chromatin in the Cdc2 mutant. This suggests that the phosphorylation of Cdc21 is inhibited by Cdc2 and is difficult to reconcile with reports from Xenopus demonstrating that Cdc21/MCM4 is a direct substrate of Cdc2/cyclinB (Hendrickson et a l, 1996). \n Xenopus, phosphorylation of Cdc21 decreases its affinity for chromatin and is thought to be important to prevent the re assembly of functional pre-RCs once origin firing occurs in S phase. In fission yeast, Cdc21 is highly phosphorylated in cells undergoing S phase (Nishitaniet al., 2000) 133 Chapter 4 The role of Cdc2 but it is unclear whether this phosphorylation is important for promoting replication or serves to repress replication after origins have fired. It is possible that phosphorylation of Cdc21 blocks re-replication and this inhibition can be overcome by restoring Cdc2 function. This would correlate with the findings in Chapters 2 and 3 that the low levels of Cdc21 associated with chromatin during re-replication are in a dephosphorylated state as compared to the ‘Gl/S’ control. Cdc21 in fission yeast contains two putative CDK consensus sequences, S/T-P-X-R/K, and mutation of these sites would determine whether the phosphorylated Cdc21 represents a form required for initiation of DNA replication or to prevent re-replication, or has no function at all. It would also be interesting to discover the kinase that phosphorylates Cdc21 in the absence of Cdc2. In the experiments addressed so far, CdclS has always been expressed at significantly high levels. The requirement for Cdc2 for re-replication is difficult to reconcile with its physiological role in targeting CdclS for proteolysis during a normal S phase which contributes to the block over re-replication in 02. Presumably the high levels of CdclS saturate the proteolytic machinery and therefore override the ability of Cdc2 to promote the efficient degradation of CdclS. Under physiological conditions, if CdclS is made resistant to Cdc2-dependent proteolysis by mutation of its CDK phosphorylation sites, re-replication still fails to occur (Jallepalliet al., 1997; Baum et al., I99S). In this chapter I discovered that Cdtl is likely to be limiting in cells which have low, yet stable, levels of CdclS. Co-expression of Cdtl with the stable form of CdclS in 02 cells, which normally have no Cdtl or CdclS, is sufficient to induce DNA synthesis. This result is important since it identifies a second pathway that acts independently of CDK dependent phosphorylation of CdclS to repress replication in 02. These experiments have also provided some insight into 134 Chapter 4 The role of Cdc2 the mechanisms underlying these pathways since the expression of Cdtl had the effect of stabilising unphosphorylated CdclS. This was also observed in Chapter 3 when overexpressed CdclS was stabilised on chromatin in the presence of Cdtl. In this experiment, a pool of the overexpressed CdclS may remain unphosphorylated and be susceptible to stabilisation by Cdtl. Taken together, these results suggest two mechanisms exist to regulate the stability of CdclS: one mechanism acts through CDK-dependent phosphorylation and the second functions to degrade unphosphorylated CdclS when Cdtl is absent. One oddity that arose from these experiments was the finding that Cdtl protein could not be detected in cells expressing the pREP4-c This may imply that the re-replication observed is a direct consequence of the accumulation of CdclS, and not Cdtl, and explain why the re-replication observed by FACS is not as extensive as that observed when both CdclS and Cdtl accumulate to high levels. These results are consistent with the roles of CdclS and Cdtl as the primary targets for the block to re-replication in G2 cells. One other initiation factor was examined, Orp2, to assess whether its phosphorylation state may be important for repressing replication in G2. However, Orp2 appears to be present in a dephosphorylated state in G2-like cells as it is in cells exiting from mitosis and preparing for the next S phase. Clearly it would be better to determine the phosphorylation state of Orp2 incdc25-22 arrested cells before dismissing a putative 135 Chapter 4 The role of Cdc2 role for Orp2 phosphorylation in inhibiting re-replication. However, CdclS and Cdtl appear to be the most important factors for this cell cycle control in G2. In a final word, the finding that de-regulation of Cdtl in G2 can support replication when expressed with the stable form of CdclS begs the question, how is Cdtl regulated during the cell cycle? As an initial step toward answering this question, the Cdtl protein was found to be stable in metaphase-arrested cells, unlike CdclS. This implies that Cdtl may be refractory to degradation targeted by Cdc2 and be regulated in a way independent of CdclS. In support of this, Cdtl does not accumulate in a po p l mutant (T. Toda, personal communication) suggesting that it is not targeted for proteolysis by the SCF. Future work will be focused on identifying the mechanism that degrades Cdtl and blocks re-replication in G2. 136 B 8 8 p 6 p 6 r^ CO CO -l^ 2 5 "C TO 4 TO 4 c/5 V) 2 2 0 0 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) 29.5 CD o TO CD CCD E TO O 1 2 4 8 16 DNA Content (C) Figure 4.1 Cdcl8-induced re-replication requires Cdc2 (A) FACS analysis of cdc2-M26 nmtl-cdcl8+ cells shifted to 37°C after 11 hours in the absence of thiamine at 25°C as described in figure 2.2A. (B) FACS analysis of cells described in (A) shifted back to the permissive temperature of 25°C after five hours at 37°C. (C) FACS analysis of cdc2-M26 nmtl-cdcl8+ cells following the induction of CdclS expression at the permissive temperature of 25°C. Total cell lysate cdc25-22 cdc2-M26 nmt1-cdc18+ nmt1-cdc18+ Hours at 37°C: 0246802468 ü â J Cdc18 Loading control Chromatin cdc25-22 cdc2-M26 nmt1-cdc18+ nmt1-cdc18+ Hours at 37“C: 02468 02468 Cdc18 Loading control B Chromatin cdc25-22 cdc2-M26 nmt1-cdc18+ nmt1-cdc18+ Hours at 37"C: 02468 02468 Cdc21 Loading control Figure 4.2 Cdc2 is not required for CdclS to bind chromatin (A) Total cell lysates and chromatin fractions were prepared from cdc25-22 nmtl- cdcl8+ and cdc2-M26 nmtJ-cdcl8+ cells every two hours after the shift to 37°C in the absence of thiamine. Samples were run on SDS-PAGE and Western blotted for CdclS. Cdc2 and Coomassie staining serve as loading controls for the total cell lysates and chromatin fractions, respectively. (B) Chromatin fractions from (A) were re-blotted for Cdc21. cdc25-22 nmt41-cig2+ nmt1-cdc18+ Hours at 37°C: 0 2 4 6 8 10 Cdc18 Cig2 Tubulin B cdc25-22 nmt41-cig2+ nmt1-cdc18+ 10 o 8 o CO 6 TO CO 4 2 0 1 1 2 4 8 16 32 DNA Content (C) Figure 4.3 CdclS can induce re-replication when Cig2 is co-expressed in G2 (A) Boiled extracts were prepared from cdc25-22 nmt41-cig2+ nmtl-cdcl8+ cells shifted to 37°C in the absence of thiamine, run on SDS-PAGE and Western blotted for CdclS and Cig2. Tubulin serves as a loading control. (B) FACS analysis of the sam ples described in (A). B cdc25-22 cdc25-22 pREP3-cdc18+ pREP3-cdc18-d55 10 10 o 8 o 8 oh- oM- ro 6 CO 6 CD tfi coCD 4 4 2 2 0 0 1 2 4 8 16 32 1 2 4 8 16 32 DNA Content (C) DNA Content (C) Figure 4.4 The C-terminus of CdclS can induce re-replication in G2 as efficiently as the full-length protein FACS analysis of cdc25-22 cells transformed with (A) pR£P3-ct/c7S+ or (B) pREP3- cdcl8-d55 shifted to 37°C in the absence of thiamine. cdc25-22 nmt1-cdc18+ cdc25-22 nmt1-cdc18+g + pREP4 + pREP4-cdt1+ cs T*.o Hours at 37X: 0 2 4 6 8 1 0 0 2 4 6 8 10 Ruml Tubulin Figure 4.5 Ruml does not accumulate in cells re-replicating from G2 Boiled extracts were prepared fromcdc25-22 nmtl-cdcl8+ pREP4 and cdc25-22 nmtl- cdcl8+ pKEP4-cdtJ+ cells every two hours after the shift to 37°C in the absence of thi amine. Sanples were run on SDS-PAGE and Western blotted for Ruml. An extract prepared fomcdclO-129 arrested cells was used as a positive control. Tubulin serves as a loading control. cdc25-22 cdc25-22 + pREP81-cdc18P + pREP81-cdc18P + pREP4-cdt1+ 10 10 o 8 o 8 o or- 6 co 6 co ro (/) co 4 4 2 2 0 0 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) Figure 4.6A Cdtl expressed in G2 with the stable form of CdclS induces re replication FACS analysis of cdc25-22 cells transformed with pREPS\-cdcI8P (left) or both pRE?S\-cdcI8P and pREP4-c Hours at 37°C: 0 8 cdc25-22 + pREP81-cdc18P + pREP4-cdt1+ Hours at 37°C: 0 Figure 4.6B Co-expression of Cdtl with the stable form of CdclS induces origin firing in G2 2D gel of genomic DNA extracted from cdc25-22 cells transformed with pREPSl- cdclSP (upper panels) or both pREP81-c Hours at 37X: 0 2 4 6 8 10 0 2468 10 10 Cdc18 Cdt1 Tubulin B cdc25-22 + REP4-cdt1+ Heurs at 37°C: 0 2 4 6 8 10 Lr ~ Cdc18 Cdt1 Tubulin Figure 4.7 CdclS accumulates in the presence of Cdtl A) Boiled extracts were prepared from cdc25-22 cells transformed with pREPSl- cdclSP or both pREP^\-cdcI8P and pRE?4-cdtJ + shifted to 37°C in the absence of thiamine. Samples were run on SDS-PAGE and Western blotted for CdclS and Cdtl. An extract prepared fromcdc25-22 pREP4-cJr7+ cells after 10 hours at 37°C serves as a positive control for the Cdtl blot (from experiment shown in B). (B) Boiled extracts prepared fromcdc25-22 pRE?A-cdtl+ cells shifted to 37°C in the absence of thiamine were run on SDS-PAGE and Western blotted for CdclS and Cdtl. Tubulin serves as a loading control. cdc25-22 cdc25-22 + pREP81-myc-cdc18P + pREP81-myc-cdc18P + pREP4-cdt1+ 10 10 o 8 o 8 o CO 6 CO 6 CD ro CO 4 co 4 2 2 0 0 1 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) B cdc25-22 cdc25-22 + pREP81-myc-cdc18P + pREP81-myc-cdc18P + pREP4-cdt1+ Hours at 37X: 02 4 6 8 10 02 4 6 8 10 Cdc18 Myc Cdt1 Tubulin Figure 4.8 Cdtl expression in G2 allows the stable form of CdclS to accumulate (A) FACS analysis of cdc25-22 cells transformed with pRE?S\-myc-cdcI8P (left) or both pRE?^ \-myc-cdc 18P and pRE?A-cdtl+ shifted to 37°C in the absence of thia mine. (B) Boiled extracts prepared from cells collected in (A) were run on SDS- PAGE and Western blotted for CdclS, Myc, and Cdtl. Tubulin serves as a loading control. cdc25-22 cdc25-22 + pREP81-cdc18+ + pREP81-cdc18+ + pREP4-cdt1+ 10 10 o 8 o 8 r- or^ co 6 CO 6 CD c/5 Î23 4 4 O 2 2 0 0 1 2 4 8 16 1 2 4 8 16 DNA Content (C) DNA Content (C) B cdc25-22 cdc25-22 + pREP81 -cdc18+ + pREP81 -cdc18+ + pREP4-cdt1+ Hours at 37X: 02 4 6 8 10 02 4 6 8 10 Cdc18 Cdt1 Tubulin Figure 4.9 Cdtl may stabilise exogenous wild type CdclS (A) FACS analysis of cdc25-22 cells transformed with pREP81-ci/c75+ (left) or both pREP81-c^/c/(5+ and pREP4-cJr7+ shifted to 37°C in the absence of thiamine. (B) Boiled extracts prepared from cells collected in (A) were run on SDS-PAGE and Western blotted for Cdc 18 and Cdtl. Tubulin serves as a loading control. B Hours at 37°C 4 1 2 3 4 o 3 Orp2-Protein A M. CO Cdc18 CO 2 C/3 Cdtl 1 Tubulin 0 1 2 4 8 16 DNA Content (C) Figure 4.10 Orp2 is dephosphorylated and Cdtl is absent incdc2-M26 orp2- proteinA arrested cells (A) FACS analysis of cdc2-M26 orp2-proteinA cells arrested at 37°C for four hours. (B) Boiled extracts prepared from cells in (A) were run on SDS-PAGE and Western blotted for Protein A, CdclS, and C dtl. Tubulin serves as a loading control. nda3-km311 o O o Cj Cdc18 Cdt1 Cdc2 Figure 4.11 Cdtl is regulated differently from CdclS during mitosis Boiled extracts were prepared fromnda3-km3J 1 cells arrested for 6 hours at 18°C then shifted to 32°C for 15 minutes. Samples were run on SDS-PAGE and Western blotted for Cdc 18 and Cdtl. Cdc2 serves as a loading control. Chapter 5; General Discussion 149 Chapter 5 General discussion 5.1 Discussion 5.1.1 The mechanism of re-initiation Does Cdcl8 induce re-replication by a mechanism similar to that which controls initiation in a wild type cell? Normally, ORC, Cdcl8, Cdtl and the MCMs are all required for the initiation of DNA replication. ORC remains bound to chromatin throughout the cell cycle (Lygerou and Nurse, 1999; Ogawa et al., 1999), while Cdcl8 and Cdtl bind to chromatin when they accumulate in late mitosis and G1 (Nishitani et al., 2000). Together, these two proteins then recruit the MCMs to chromatin (Ogawa et al., 1999; Kearsey et al., 2000; Nishitani et al., 2000). In this thesis, I have examined whether similar requirements for ORC, Cdtl, and the MCM Cdc21 apply to Cdcl8-induced re-replication. One feature of re-replication that was similar to initiation in wild type cells is that Cdcl8 became re-associated with chromatin when overexpressed. In exponentially growing cells, this association was dependent on Orpl suggesting that a requirement for Orpl is maintained during re replication. However, this dependency on Orpl was not tested in the double mutant cdc25-22 o rp l-4 which would be necessary to conclude that Orpl is required for re replication in G2 cells. The behaviour of Cdtl was less consistent with the normal events leading to S phase onset. Cdtl was essentially undetectable in re-replicating cells, presumably due to inhibition of Cdc 10-dependent transcription in G2 (Baum et al., 1998). Whether this signifies that Cdtl is not required for Cdcl8-induced re-replication in G2 can only be tested with a temperature-sensitive c d tl mutant or by repressing the expression of cdtl with an inducible promoter other than nmt, neither of which are currently available. It is possible, however, that Cdtl is not required for re-replication 150 Chapter 5 General discussion since Cdc 18 and Cdtl interact when overexpressed and both proteins were originally isolated as partial suppressors of a mutation incdc 10, suggesting that when expressed to high levels, Cdc 18 may be able to substitute for or bypass the requirement for Cdtl. On the other hand, the same cannot be true for Cdtl since overexpression of Cdtl does not induce re-replication in the absence of Cdc 18. In the experiments presented here, Cdtl appears to play an auxiliary role by potentiating the re replication induced by Cdc 18. Another feature of G2 re-replication that is different from initiation in wild type cells is that the association of Cdc21 with chromatin was not significantly increased in response to high levels of Cdc 18. A small increase in Cdc21 chromatin association was detected but not to the same extent as that observed in a synchronous population of Gl/S cells. Cdc21 was nevertheless required for re-replication suggesting that other factors may have been limiting for the chromatin binding of Cdc21 in G2 cells. One likely candidate was Cdtl since it is required for the association of Cdc21 with chromatin in wild type cells. However, co-expression of Cdtl in G2 cells did not result in an increase in Cdc21 chromatin association, despite the more extensive re-replication that took place in these cells. This indicates that Cdtl accelerated re-replication by a mechanism independent of increased MCM loading onto chromatin. Interestingly, when Cdtl was overexpressed in the cdc21 temperature-sensitive mutant, some stabilisation of the Cdc21 mutant protein was detected. This could mean that Cdtl interacts directly with Cdc21 and possibly that high levels of Cdtl sequester soluble Cdc21, preventing it from associating with chromatin. Cdc 18 also interacts with Cdc21 when ectopically expressed (Grallert and Nurse, 1996), supporting the hypothesis that Cdcl8, Cdtl, and Cdc21 may aggregate as a soluble complex when Cdc 18 and Cdtl are present at very high levels. 151 Chapter 5 General discussion Alternatively, Cdel8 and Cdtl may not be sufficient for the association of Cdc21 with chromatin and other unidentified factors play a role in this step. These factors may be important either to load the MCMs onto chromatin or to stabilise their association with chromatin. If only low levels of Cdc21 become associated with chromatin during re- replieation, does this provide any evidence about MCM function? There is much controversy over the function of the MCMs in DNA replication. MCM subcomplexes purified from fission yeast, Methanobacterium thermoautotrophicum, human, and mouse cells have been shown to have helicase activity in vitro (Lee and Hurwitz, 2001; Kelman et al., 1999; Ishimi, 1997; You et al., 1999). In contrast, MCMs in mammalian cells do not co-localise with replication foci in vivo, leading to the proposal that the MCMs are not the replicative helicase but instead serve as a marker for unreplicated DNA (Todorov et al., 1994; Krude et al., 1996). This contradicts work in budding yeast which strongly supports a role for the MCMs at the replication fork (Aparicio et al., 1997; Tanaka et al., 1997; Labib et al., 2000), although no helicase activity has yet been detected in vitro. In fission yeast, it is likely that the MCMs do function as the replicative helicase based on the in vitro data. However, the proeessivity of the MCM complex alone is not sufficient to unwind long stretches of duplex DNA (Lee and Hurwitz, 2001). Addition of single-stranded DNA binding protein from E.coli stimulates the helicase activity of the MCM complex in vitro, as does the presence of 3’ or 5’ single-stranded DNA tails, demonstrating that the MCMs have optimal helicase activity on duplex DNA that has been partially unwound. In E.coli, the DnaA protein locally unwinds DNA at the origin prior to recruiting the helicase DnaB, a step which may be analogous to an early event in the initiation of eukaryotic DNA replication 152 Chapter 5 General discussion (reviewed in Diffley, 1996). ORC is functionally similar to DnaA and may catalyse an unwinding step as a pre-requisite for MCM activation. Other proteins may also be required in vivo for the MCMs to have maximal helicase activity. Candidates include RPA and Cdc45, both of which interact directly with several subunits of the MCM complex (Hopwood and Dalton, 1996; Zou and Stillman, 1998; Zou and Stillman, 2000). RPA is a fission yeast single-stranded DNA binding protein and may stimulate the helicase activity of the MCMs analogously to* the effect observed with E.coli single-stranded DNA binding protein in vitro. In budding yeast, the association of Cdc45 with chromatin is dependent on both Cdc6 and the MCMs (Owens et al., 1997; Zou and Stillman, 1998) and once bound, Cdc45 then interacts with RPA and the polymerases and travels with the replication forks (Aparicioet al., 1997; Aparicio et a l, 1999; Tercero et al., 2000; Zou and Stillman, 2000). In fission yeast it is not known whether similar interactions take place in S phase but it raises the possibility that during re-replication, high levels of Cdc 18 may be sufficient to load Cdc45 and RPA onto origins to form an efficient helicase and compensate for minimal amounts of MCMs associated with chromatin. One of the caveats of the experiments presented in this thesis is that re replication was induced with Cdc 18 and Cdtl significantly overexpressed. It is therefore possible that certain steps leading to initiation are bypassed in the presence of high levels of these initation factors. This may be particularly relevant to the findings with Cdc21, thereby precluding any definite conclusions on the physiological mechanism of re-initiation. Nevertheless, the fact that these factors are sufficient to induce re-replication, particularly in a 02 cell in which other initiation factors and the replication machinery may not be readily available, is informative about the controls that restrict S phase to once per cell cycle. Clearly these two 153 Chapter 5 General discussion proteins have the potential to override the controls that repress DNA synthesis in G2 and must be downregulated to prevent re-replication. A useful model for re-replication in a physiological context is the amplification of the chorion genes during development inDrosophila. In the follicle cells, the chorion genes are amplified about 80-fold in order to produce enough chorion protein for a normal eggshell (Orr-Weaver, 1991). Several initiation factors are required for amplification and co-localise with sites of re-initiation, including ORC, Cdtl, and Cdc45 (Landis et al., 1997; Calvi et al., 1998; Royzman et al., 1999; Whittaker et al., 2000; Loebel et a l, 2000). Interestingly, the MCMs do not co- localise with sites of amplification (Royzman et al., 1999) which may have significant implications on the interpretation of the role of Cdc21 chromatin binding in Cdc 18-induced re-replication in fission yeast G2 cells. Ultimately, techniques such as chromatin immunoprécipitation or footprinting would be required to determine whether complete pre-RCs are re-formed at origins during replication in G2 cells. 5. L2 Origin firing and the kinetics of re-replication In order for a cell to increase its DNA content, origin firing must occur on replicated DNA. The re-firing of replication origins can arise via two different mechanisms or a combination of both. One mechanism involves the continuous re-firing of the same replication origins. This is analogous to the ‘onion-skin’ model of origin firing that underlies amplification of the chorion genes in Drosophila (Osheim et al., 1988) (figure 5.1 A). A second mechanism involves the firing of different subsets of origins in each round of re-initiation (figure 5. IB). In this model, a given origin will fire and replicate the flanking DNA, while an adjacent origin fires in the next round of initiation and passively replicates the first origin. This may be particularly applicable to fission yeast origins since they are usually found in clusters (Zhu et al., 1994; 154 Chapter 5 General discussion Wohlgemuth et al., 1994; Okuno et al., 1997). One origin may fire within the cluster and replicate the others, then a second origin within the cluster will be the one to fire, and so on. Using 2D gel analysis of replication intermediates at arsSOOl, I attempted to characterise the mechanism of origin re-firing during re-replication. If origins were firing via the ‘onion-skin’ model of re-initiation, I expected to detect novel structures of replication intermediates corresponding to nested replication bubbles. Although the migration of such structures in 2D gels could not be predicted, it was expected that they would emerge from the original bubble arc and be retarded in both the first dimension and second dimension gels due to their increased mass and complexity. In the experiments presented here, no abnormal or novel replication intermediates were observed during re-replication. One limitation of these experiments is that the timing may be critical and there may be a temporal lag between the first initiation event and each subsequent re-firing of that origin, by which time the replication forks from the first bubble will have already traveled outside the region detected by the probe. Whereas these results argue somewhat against the ‘onion-skin’ model, I was unable to directly address the second hypothesis, that different subsets of origins are used in each round of initiation. In theory, 2D gels should be able to address this model but detection of single-copy origins, instead of arsSOOl which is present in approximately one hundred copies per cell, would be essential. For example, it would have been useful to have a 2D gel analysis of the three replication origins within the ura4 cluster. Normally one origin fires predominantly and forks emerging from that origin passively replicate the two adjacent origins (Dubey et al., 1994). It would have been interesting to determine whether that origin is the sole origin to fire during re replication or whether the other two origins become activated. Unfortunately, I was 155 Chapter 5 General discussion unable to reproducibly detect replication intermediates at single-copy DNA sequences. While the proposed models of re-initiation could not be directly distinguished, other unexpected changes in the pattern of origin firing within the rDNA region were observed during re-replication. When re-initiation first occurred in the G2-arrested cells, ars3001 fired with the same efficiency that was observed in wild type S phase cells. Surprisingly, as cells increased their DNA content, fewer initiation events were detected at this origin. This was observed not only as a weaker signal for the bubble arc but also as a corresponding increase in the signal for the fork arcs. This suggests that origin firing does not persist efficiently as cells re-replicate and that the total number of origins that fire per chromosome decreases as cells accumulate more DNA. This is especially evident at arsSOOl since a hundred copies of the origin can be detected simultaneously. For example, if 40% of the origins fire within the array of repeats, then for every forty bubbles detected, sixty forks will also be detected due to passive replication through origins in the neighbouring repeats. If the efficiency of origin firing decreases to 20% then for every twenty bubbles, eighty forks will be detected. This effect correlates with the changes in the pattern of origin firing observed when Cdc 18 is overexpressed. One caveat is that if the number of origins that fire per chromosome decreases by half, then it should take twice as long for the DNA content to double, but judging from the FACS profile cells maintained a two hour doubling period throughout the time course of re-replication. However, interpretation of these results was hindered by the lack of synchrony in these experiments which prevented gross changes in the doubling time from being discerned. Despite this, origin firing did appear to become less efficient, although the reason for this effect is unclear. It may be due to limiting amounts of Cdc21 on 156 Chapter 5 General discussion chromatin, or reflect a requirement for other initiation and/or replication factors which may not be present in sufficient quantities to sustain replication of increasing amounts of DNA. One of the advantages of using ars3001 to characterise origin firing is that I could address a second aspect of re-replication, the kinetics. When Cdtl was co expressed with Cdc 18, more rapid re-replication was observed and the doubling time was reduced from two hours to thirty minutes. This acceleration of DNA synthesis could arise in at least four ways: either from an increase in the number of origins that fire simultaneously thereby reducing the amount of DNA synthesised by each replication fork (figure 5.2A), by increasing the frequency with which origins re-fire from one round of replication to the next (figure 5.2B), by inducing initiation from non-origin regions, or by increasing the rate of proeessivity of the replication forks. Since arsSOOl is present in multiple copies per cell, these questions could be addressed by examining changes in the pattern of replication intermediates within the megabase array of rDNA. If the number of origins that fire simultaneously were to increase then the ratio of replication bubbles to replication forks at arsSOOl would also increase. This was not the case. The pattern of replication intermediates was similar to that observed when Cdc 18 was expressed alone; efficient origin firing was detected at first, then the bubble arc weakened in relation to the fork arc. Again, this suggested that the efficiency of replication progressively diminished during re replication and that Cdtl was not inducing more origins to fire per round of initiation. On the other hand, Cdtl may be influencing the frequency with which origins re-flre. If origins re-fired more quickly then treatment with HU as cells began to re- replicate should detect a greater accumulation of stalled bubbles in cells expressing C dtl. While the 2D gel technique is not very quantitative, no obvious differences in 157 Chapter 5 General discussion the intensity of the signal arising from stalled bubbles were observed between cells expressing Cdc 18 alone and together with Cdtl. However, origin firing did appear to persist longer in the presence of Cdtl since treatment with HU at later times during re-replication detected the accumulation of stalled replication bubbles only in cells co-expressing Cdtl. These bubbles probably represented only a very small percentage of replication origins since bubbles were not detected at these later time points in the absence of HU. Nevertheless, Cdtl may promote a low level of initiation that persists longer during re-replication. More quantitative analyses which measure the concentration of stalled bubbles in the presence or absence of Cdtl after treatment with HU would be required to support this conclusion. Another possibility is that an increase in the frequency of origin re-firing was missed due to the time course undertaken in these experiments. 2D gel analysis at closer intervals during re replication may have revealed a burst of initiation events which were not detected in the time course used in these experiments. Since time points were taken every two hours, cells may have undergone rapid re-initiation during the first two hours of Cdc 18 and Cdtl accumulation and reached saturation with no further origin firing. This is consistent with the FACS analysis from these experiments which showed that the bulk of DNA synthesis occurred within the first two hours of Cdc 18 and Cdtl accumulation. However, this is inconsistent with the FACS analysis which examined the six to eight hour window at more narrow time points which failed to detect any changes in the rate of DNA synthesis during this period. The third option is that Cdtl induces initiation events from within non-origin sequences. Evidence in support of this was never obtained even in the presence of HU, suggesting that control of origin firing is strictly confined to defined origin sequences. The final possibility is that Cdtl increases the rate of fork movement. The 158 Chapter 5 General discussion average fork rate in budding yeast is estimated at approximately 3kb/minute (Rivin and Fangman, 1980). Based on the assumption that this rate also applies to fission yeast, then if every single copy of arsSOOl fired simultaneously within each 10.9kb repeat, it would take approximately 1.5 to 2 minutes for the entire rDNA array to be replicated as each fork would synthesise 5.5kb of flanking DNA. I have estimated that in a normal S phase, 40% of the origins fire, implying that the time required to replicate the entire array is increased to 5 minutes as each fork now synthesises approximately 15kb of DNA. If the rate of fork progression were to double, for example, in the presence of Cdtl, then it would take only 2.5 minutes to replicate the array. This hypothesis remains untested but could be addressed with density substitution experiments to compare the fork rate in cells expressing Cdc 18 alone or together with Cdtl. However, this explanation is unlikely since Cdtl is not required for elongation (Nishitani et a i, 2000; Maiorano et al., 2000). From this set of experiments, the question of how Cdtl enhances and accelerates the re-replication induced by Cdc 18 remains unresolved. It is a tantalising question, and given the dramatic effect on re-replication the answer is likely to be revealing about the function of Cdtl in promoting S phase in wild type cells. 5.1.3 Mechanisms to repress DNA synthesis in G2 In this work, I have identified two mechanisms that inhibit DNA replication in G2 cells. One mechanism involves the Cdc2-dependent phosphorylation of Cdc 18 and a second mechanism prevents the accumulation of Cdtl. While it was known that phosphorylation of Cdc 18 rendered the protein unstable during S phase, phosphorylation mutants that were stabilised in S and G2 failed to undergo re replication (Jallepalliet al., 1997; Baum et a l, 1997) suggesting that this mechanism is not sufficient to prevent re-replication in G2. Likewise, Cdtl is not normally 159 Chapter 5 General discussion present in G2, due to transcriptional repression and perhaps degradation, and accumulation of Cdtl in G2 cells is not sufficient to induce re-replication. But when combined, the accumulation of Cdc 18 and Cdtl in G2 can de-repress DNA synthesis. In addition, the expression of Cdtl allowed the stable form of Cdc 18 to accumulate further, providing evidence for a novel mechanism regulating Cdc 18 levels. This also suggested that the accumulation of Cdc 18 in the presence of Cdtl may be the stimulus for re-replication. From these results, a model can be proposed in which the degradation of Cdc 18, by Cdc2-dependent phosphorylation, and the degradation or transcriptional repression of Cdtl, collectively prevents the formation of new pre- replicative complexes that would re-establish replication competence in G2 (figure 5.3). These two pathways are analogous to the mechanisms that prevent licensing in Xenopus extracts. Here, CDKs and geminin are required to block re-replication (Mahbubani et al., 1997; Hua et al., 1997; Me Garry and Kirschner, 1998; Wohlschlegel et a l, 2000; Tada et a l, 2001). Depletion of geminin in metaphase extracts stimulated licensing of sperm nuclei by promoting the association of MCMs with chromatin (Tada et a l, 2001). However, licensing did not proceed to the same extent as in an interphase extract since high CDK activity in the metaphase extract inhibited the association of ORC and Cdc6 with chromatin. While inhibition of CDKs was insufficient to re-license chromatin in metaphase extracts, when combined with the depletion of geminin, licensing was restored to the same level as in interphase extracts. These findings suggested that geminin plays a major role in preventing licensing by inhibiting Cdtl in metaphase, and that CDKs contribute a minor role by de-stabilising Cdc6 and ORC on chromatin. Both mechanisms are essential to limit licensing to once per cell cycle, emphasising the strong parallels between the 160 Chapter 5 General discussion mechanisms that inhibit re-replication in fission yeast and metazoa. However, the relative contributions of the CDK-dependent and independent mechanisms differ; in fission yeast the regulation of Cdc 18 is likely to play the major role in blocking re replication since overexpression of Cdc 18 in G2, but not Cdtl, is sufficient to induce DNA synthesis. While de-regulation of Cdc 18 is sufficient to induce extensive re-replication in fission yeast, overexpression of Cdc6 in budding yeast is not. Intriguingly, overexpression of Cdc6 in fission yeast can apparently induce re-replication independently of endogenous Cdc 18 (Sanchez et al., 1999). This highlights the fact that there are fundamental differences in the re-replication controls of the two yeasts. Budding yeast can undergo limited re-replication if Cdc28 activity is depleted in G2 cells (Dahmann et al., 1995; Noton and Diffley, 2000) but substrates in addition to Cdc6 must also be negatively regulated by Cdc28 since mutation of the phosphorylation sites fails to induce re-replication (Elsasseret al., 1999; Drury et al., 2000). By a mechanism unique to budding yeast, Cdc28 also regulates the localisation of the MCMs throughout the cell cycle. MCMs are imported into the nucleus during late mitosis and G1 when Clb/Cdc28 activity is low, and are then actively exported from the nucleus during S phase when Clb/Cdc28 activity increases (Labib et al., 1999; Nguyen et al., 2000). However, regulation of MCMs and Cdc6 are unlikely to be the only targets of Clb/Cdc28 activity since nuclear retention of MCMs together with stabilisation of Cdc6 does not promote re-replication (referred to in Nguyen et al., 2000, unpublished). Budding yeast clearly uses multiple overlapping mechanisms to prevent re-replication. Even when all the substrates of Cdc28 are de-regulated by depletion of kinase activity in G2, cells can only undergo one extra round of DNA replication (Dahmann 161 Chapter 5 General discussion et al., 1995). This is in contrast to the re-replication observed when Cdc 13 is depleted or Ruml is overexpressed in fission yeast cells and is likely to reflect a significant difference in the organisation of the cell cycles of the two yeasts. Budding yeast cells have only a short or non-existent G2 period during which the mitotic kinases accumulate to high levels for much of the cell cycle. This rapid increase in kinase activity promotes the onset of mitotic events shortly after the completion of DNA replication. This is in parallel to the duplication of the spindle pole body and assembly of the mitotic spindle, events which are also initiated at S phase onset. Thus, once DNA replication is initiated, cells undergo a rapid transition to a mitotic- like state. This is an important difference from fission yeast cells which spend a larger portion of the cell cycle in G2 when the kinase activity is not high enough to initiate mitotic events. However, as shown in the work presented here, G2 cells contain sufficient Cdc2 activity to promote re-replication if Cdc 18 and Cdtl are present. This is clearly a lethal situation for the cell and is avoided by the degradation of Cdc 18 by Cdc2-dependent phosphorylation and by repressing the accumulation of Cdtl. Together, these mechanisms ensure that a G2 cell is maintained in a replication incompetent state and restrict S phase to once, and only once, per cell cycle. 162 ARS1 ARS2 ARS3 B ARS1 ARS2 ARS3 I I Figure 5.1 Two models for re-initiation In the first model (A), re-initiation arises fi-om re-firing of the same replication origin. In the second model (B), different origins are used for each round of re-initiation. See text for more details. A ARS1 ARS2 ARS3 + Cdc18 + Cdc18 + Cdt1 B + Cdc18 I f=120 min + Cdc18 + Cdt1 I f=30 min Figure 5.2 Mechanisms that accelerate the kinetics of re-replication In the first model (A), Cdtl promotes more origins to fire simultaneously. In the second model (B), Cdtl decreases the time delay (t) between rounds of origin firing. See text for more details. ORC ORC Cdc2 Odd Cdc18 G2 Figure 5.3 Repression of DNA synthesis in G2 requires downregulation of Cdc 18 and Cdtl Illustration of two mechanisms that function to prevent re-initiation in G2 cells. One mechanism degrades Cdc 18 via Cdc2-dependent phosphorylation, and a second uncharacterised mechanism prevents the accumulation of Cdtl. Disruption of both inhibitory pathways allows cells to re-replicate in G2. Chapter 6; Materials and Methods 166 Chapter 6 Materials and methods 6.1 Fission yeast physiology and genetics 6.1.1 Nomenclature for gene names and proteins Throughout this thesis, I have adopted the following nomenclature when referring to genes. For fission yeast genes, the name of the gene is in lower case letters and italicised (eg. cdc2). The wild type allele is designated by a + sign (eg. cdc2+). The mutant form of the gene is in lower case and italicised, with an allele number when specified (eg. cdc2-33). The protein encoded by the gene has the first letter in upper case and the rest of the gene name in lower case (eg. Cdc2). For budding yeast genes, the name of the gene and the wild type allele are in upper case letters and italicised (eg. CDC28). The mutant form of the gene is in lower case letters and italicised, with an allele number when specified (eg. cdc28-4). The protein encoded by that gene has the first letter in upper case and the rest of the gene name in lower case (eg. Cdc28). When referring to homologous genes or proteins in fission yeast and budding yeast, the two names may be divided by a forward slash (eg. cdc2/CDC28). For genes and proteins in metazoa, the nomenclature used for fission yeast has been applied. 6.1.2 Strain growth and maintenance All strains were derived from the wild types 972h- and 975h+. Media and growth conditions are as previously described (Moreno et al., 1991). Techniques used to grow and maintain fission yeast strains, to store and revive frozen cultures, to check phenotypes, to perform and analyse genetic crosses by tetrad analysis or random spore analysis were performed as previously described (MacNeill and Fantes, 1993; Moreno and Nurse, 1994). 167 Chapter 6 Materials and methods Table 6.1 Fission yeast strains Genotype ______Strain location wild type, 912 A " CCL collection cdc25-22 k ' CCL collection cdc25-22 cdc21-GFP This study cdc25-22 leul-22 nmtl-cdcl8+ k" CCL collection orpl-4 leul-22 nmtl-cdcl8+ k ~ CCL collection cdc25-22 cdc21-M68 leul-32 nmtl-cdcl8+ This study cdc25-22 ura4-D18 k^ CCL collection cdc25-22 leul-32 nmt 1-cdc 18+ ura4-D18 This study cdc25-22 cdc21-M68 leul-32 nmtl-cdcl8+ ura4-D18This study cdc2-M26 leu 1-32 nmtl-cdcl8+ CCL collection cdc25-22 nmt41-cig2+ leul-32 nmtl-cdcl8+ This study cdc25-22 leul-32 k ' CCL collection cdc25-22 leul-32 ura4-D18 k" CCL collection cdc2-M26 ura4-D18 orp2+::ura4+ leul+::orp2-ProtAZoi Lygerou nda3-km311 CCL collection 6.1.3 Nomenclature for integrants and plasmids To distinguish between genes expressed on plasmids and those integrated within the chromosome, a specific nomenclature has been used. When a gene is expressed on a plasmid, the gene name is preceded by a small ‘p’ and the name of the plasmid. For plasmids expressing the gene from one of thenmt promoters, the name of the plasmid reflects the strength of the promoter used. For example, pREP4-cJc75+ signifies that the wild type cdc 18 gene was expressed by the full-strength nmt promoter. There are three versions of the nmt promoter which can be ordered by strength: REP4>REP42>REP82. Plasmids containing the ura4 gene as a marker use the numbers 4, 42, and 82, while plasmids containing the gene leul as a marker use the numbers 1, 3, 41, 81, which can be ordered by strength: REP 1 =REP3>REP41 >REP81. When the gene of interest has been integrated into the chromosome under the control of the nmt promoter, the promoter is designated by 168 Chapter 6 Materials and methods nm t followed by the strength of that promoter. The strongest nmt promoter is designated as n m tl or 5, whereas the medium strength and weak promoters are designated nmt41 or 42, and nmtSl or 82, respectively, depending on the marker used for selection. 6.1.4 Strain construction To generate a strain in which the cdc21 gene was tagged at the C-terminus with GFP, PCR was used to amplify from a plasmid containing the GFP gene and the kanamycin resistance cassette, using oligos flanked by sequence homologous to the cdc21 gene immediately 5’ to the stop codon and within the 3’ untranslated region. Forward oligo: ttggaaaggcgaggacgtattaaggttattaccagtgctggacatcgcattgtacgttcaattgcacagactgatcg gatccccgggttaattaa. Reverse oligo: aacaaaaagaacgtgtgtatatataacaagaaagacattcgtattatgct ctgtagtctttgattttcaacaacggaattcgagctcgtttaaac. The PCR product was transformed into the cdc25-22 strain and the presence of the cassette was selected for by resistance to the drug G418 (Sigma). Site-specific integration was confirmed by colony PCR. All double mutant strains were generated by crossing two temperature- sensitive mutants of opposite mating type, dissecting tetrads, and selecting for spores in which the temperature-sensitive phenotype exhibited 2:2 segregation. To generate temperature-sensitive strains with additional markers, random spore analysis was used to select for spores that exhibited the temperature-sensitive phenotype and auxotrophy for the marker. All strains containing nmtl-cdc 18+ were derived from crosses with an original nmtl-cdc 18+ integrant (CCL collection). This strain was generated by multiple integration of the pREP3-c Nishitani). The construction of new strains crossed either with this integrant or strains derived from the original integrant were selected for on the basis of prototrophy for 169 Chapter 6 Materials and methods observed due to random segregation of the multiple integrations of the nmtl-cdcl8+ gene. The cdc25-22 nmt41-cig2+ nmtl-cdcl8+ strain was generated by crossing the cdc25-22 nmt41-cig2+ leul-32 strain (CCL collection) with the nmtl-cdcl8 + integrant. The cdc25-22 nmt41-cig2+ leul-32 strain was originally constructed by replacing the endogenous cig2 promoter with nmt41 and selecting for the kanamycin cassette (constructed by P.Zarzov). The final cdc25-22 nmt41-cig2+ nmtl-cdcl8+ strain was selected for on the basis of resistance to G418 and leucine proto trophy. 6.1.5 Transformation and integration of plasmids Cells were transformed with plasmid DNA or PCR products by a modified lithium acetate method (Bahler et al., 1998). Approximately l-2p,g of DNA was transformed into 5x10* log phase cells with 20pg of carrier herring sperm DNA per transformation reaction. Plasmids were maintained by selection for the marker. 6.1.6 Induction of gene expression from the nmt promoter The nmt promoter is derived from the nmtl+ gene which is required for thiamine biosynthesis and is repressed in the presence of thiamine (Maundrell, 1990). Mutations in the TATA box of the promoter gave rise to modified versions which allow three different levels of gene expression (Basi et al., 1993; Forsburg, 1993). The strengths of the different versions of the promoter are described in section 6.1.3. The nmt promoter is repressed in cells grown in media containing thiamine (5p,g/ml), although a low level of leak-through expression is thought to occur. To induce full expression from the nmt promoter, cultures were grown in minimal media containing thiamine until log phase, filtered and washed three times with media lacking thiamine, resuspended and grown in the absence of thiamine. 170 Chapter 6 Materials and methods 6.1.7 Shift experiments with temperature-sensitive mutants Temperature-sensitive strains were cultured at the permissive temperature of 25°C or at the restrictive temperature of 37°C, except for the cold-sensitivenda3-km311 strain which was grown at the permissive temperature of 32°C or at the restrictive temperature of 18°C. Synchronous cultures using the cdc25-22 block and release method were prepared according to previous methods (Moreno et ah, 1989). 6.1.6 Physioiogicai experiments with hydroxyurea Hydroxyurea is a drug that inhibits the enzyme ribonucleotide reductase and results in the depletion of nucleotides. Addition of HU (llm M ) to exponentially growing cells arrests the entire population in early S phase. After treatment with HU for 3.5 hours at 32°C, cells can be released from the cell cycle arrest by filtering and washing three times with minimal media. The culture then proceeds relatively synchronously through the rest of the cell cycle. HU was used at higher concentrations (24mM) in several experiments presented herein in an attempt to overcome the effects of higher temperatures on the efficacy of the drug. 6.1.9 Flow cytometric analysis Between 2x10^ and 2x10^ cells were fixed in 70% ethanol and stored at 4°C. To process the samples for FACS, cells were washed twice in 2mls of 50mM NagCitrate, then resuspended in 0.5ml of 50mM Nag Citrate containing O.lmg RNaseA and incubated at 37°C for at least two hours. 0.5ml of Nag Citrate containing 2pg/ml of propidium iodide was then added and cells were sonicated for 15 to 30 seconds at setting 6 in a Soniprep 150 sonicator (MSB). Analysis was carried out using a Becton Dickinson FACScan as previously described (Sazer and Sherwood, 1990). 171 Chapter 6 Materials and methods 6.1.10 Cell number determination Cell number was determined using a Coulter counter. Cells were fixed by adding 1.6mls of formal saline (0.9% saline, 3.7% formaldehyde) to 0.4ml of cell culture and stored at 4°C. Before processing for cell number, 18mls of ISOTON solution was added and cells were sonicated for 30 seconds as described above, then counted. 6.1.11 Visualisation of nuclei by DAPI staining Cells were fixed in 70% ethanol and stored at 4°C. Cells were then re-hydrated in water, heat fixed to a slide and mounted in 1 |Ltg/ml of DAPI (4’,6-diamidino-2- phenylindole) in 50% glycerol. Photographs were taken using a Hamamatsu camera. 6.1.12 Visualisation of GFP Live cells were mounted on slides and visualised by a fluorescent microscope. Photographs were taken using a Hamamatsu camera. 6.2 Molecular Biology Techniques 6.2.1 General techniques The following techniques were performed essentially as described (Sambrook et al., 1989): preparation of competent bacteria, transformation of bacteria with DNA, restriction enzyme digests of DNA, and gel electrophoresis of DNA. Both small (miniprep) and large scale (maxiprep) preparation of DNA from bacteria was done using Qiagen columns (Qiagen). PCR reactions were carried out in a MiniCycler (MJ Research), under different conditions depending on the template and the oligos used in each reaction. PCR products were purified with a Wizard DNA Clean-Up System (Promega). 172 Chapter 6 Materials and methods 6.2.2 Preparation of genomic DNA for two-dimensional gel electrophoresis Approximately 8x10^ cells were harvested by filtration and washed once with 50mls of ice-cold nuclear isolation buffer (NIB; 50mM MOPS pH 7.2, 150mM KAc, 2mM MgCb) with 0.1% sodium azide, then washed again with 5Omis of NIB alone. Cell pellets were frozen at -70°C. Genomic DNA was purified from cells as described (Wu and Gilbert, 1995). Cell pellets were resuspended in 0.3ml of NIB containing 500|xM spermidine and 150)liM spermine and filled with acid-washed glass beads. Cell were broken in a vortex for 15 minutes at 4°C. The supernatant was separated from the beads, added to 2mls of NIB and centrifuged at 6500g for 10 minutes at 4°C. The pellet was then resuspended in 2mls of buffer G2 (SOOmM Guanidine-HCl, 30mM EDTA, 30mM Tris-HCl, 5% Tween 20, 0.5% Triton X-100; pH 8.0), containing 200|xg/ml RNase A, and incubated at 37°C for 30 minutes. Proteinase K (20mg/ml) was added to the lysates and incubated for another 60 minutes at 37°C. Lysates were then centrifuged at 6500g for 10 minutes at 4°C. The supernatant was added to an equal volume of Qiagen buffer QBT and added to a Qiagen genomic 20/G column, equilibrated with 1ml of QBT. Columns were washed three times with 1ml Qiagen buffer QC, then the DNA was eluted from the column in 1.8mls of Qiagen QF buffer pre-warmed to 50°C. DNA was precipitated with isopropanol, washed in ethanol and resuspended in TE. Approximately 15|Lig of genomic DNA was digested with 80 units of restriction enzymes in a 2 0 0 )li1 reaction for 2.5 hours at 37°C and ethanol precipitated. 173 Chapter 6 Materials and methods 6.2.3 2D gel conditions Gel conditions were as recommended (Friedman and Brewer, 1995). In the first dimension, DNA was run on a 0.4% agarose gel in the absence of ethidium bromide in THE, for 24 hours at IV/cm at room temperature. The gel was stained with ethidium bromide and the lane excised from the gel from 1cm below the fragment of interest to approximately 7cm above. The gel slab was rotated 90°C and re-cast in a 1.1% agarose gel containing 0.3|xg/ml ethidium bromide in TBE, equilibrated to 55°C. The second dimension was run at 4°C in TBE buffer containing 0.3pg/ml ethidium bromide circulating at 50-100mls/min, at 6V/cm until the arc of linears has migrated 8-10cm. 6.2.4 Southern blotting for 20 gels Second dimension gels were washed once in 5 volumes of 0.25N HCl for 30 minutes, then in 5 volumes of denaturing solution (0.5N NaOH, IM NaCl) for 30 minutes, and finally in 5 volumes of neutralising solution (0.5M Tris, pH 7.5, 3M NaCl) for 30 minutes. All wash steps were done at room temperature with gentle agitation. Gels were transferred to GeneScreen Plus membranes (NEN) using a Posiblot transfer apparatus (Stratagene). DNA was cross-linked to the membrane using a UV Stratalinker (Stratagene). Hybridisations were carried out at 68°C with approximately 2x10^ cpm of random primed probe per ml of QuickHyb hybridisation solution (Stratagene). Membranes were washed 3 times for 20 minutes with 0.1% SDS, O.IX SSC at 63°C. After washing, the membranes were exposed to BioMax film (Kodak), scanned and processed in Photoshop. 174 Chapter 6 Materials and methods 6.2.5 Probes for 2D gels To detect the replication origin ars3001 within the tandem rDNA repeats, genomic DNA was digested with Hindlll and Kpnl and probed with the same 3kb Hindlll- Kpnl fragment from the rDNA repeat. This fragment was isolated from a plasmid containing the rDNA repeat (YIP32-rDNA) and purified with a QIAquick Gel Extraction Kit (Qiagen). To detect non-origin DNA within the rDNA repeats, genomic DNA was digested with EcoRI and probed with the same 3.4kb EcoRJ fragment from the rDNA repeat, which was also isolated from the rDNA plasmid. Both probes were labeled with radioactive a(^^P)dATP (Amersham or ICN) using the Stratagene Prime It II labeling kit. Non-incorporated radioactive nucleotides were removed by a ProbeQuant G-50 Micro Column (Amersham) and the cpm/p.1 was determined using a scintillation counter. 6.2.6 Cell extract preparation Total boiled cell extracts were prepared from 2x10* cells as described (Nishitani and Nurse, 1995). Cells were washed once in STOP buffer (150 mM NaCl, 50 mM NaF, 10 mM EDTA, 1 mM NaN], pH 8.0), resuspended in 150pl of HB buffer (60mM p- glycerophosphate, 25mM MOPS, pH 7.2, 15mM MgCh, 15mM EGTA, ImM DTT, and 1% Triton X-100) boiled for 5 minutes. Cells were broken using glass beads and extracts recovered by centrifugation at 13,000 rpm for 15 minutes at 4°C in an Eppendorf microfuge and boiled in 5X SDS sample buffer (400 mM Tris-HCl, pH 6.8, 50% glycerol, 10% SDS, 500 mM DTT, and 0.02% Bromophenol Blue). cdclO- 129 extract in figure 4.5 was kindly given by S.Yamaguchi. Protein concentrations were determined with a BCAZCopper(II) Sulfate assay (Sigma). Approximately 50p,g of protein were run on gels for Western blotting. 175 Chapter 6 Materials and methods 6.2.7 Chromatin association assay Spheroplast preparation, lysis, and chromatin isolation was performed essentially as described previously (Lygerou and Nurse, 1999). Approximately 2x10* cells were killed with sodium azide (ImM) and collected by centrifugation. Cells were washed once with water, once with 0.65M KCl, and resuspended in 0.9ml of 0.65M KCl. Lysing enzyme (Sigma) was added at 2mg/ml and cells were incubated at 30°C until 80% of the cells became spheroplasts. The reaction was terminated with lOmM Tris- Cl, pH7.5, spheroplasts were spun through a sucrose gradient containing 15% sucrose, 1.2M sorbitol, and lOmM Tris-Cl, pH7.5, and washed several times in 1.2M sorbitol and lOmM Tris-Cl, pH7.5. Spheroplasts were lysed in BE 10 buffer (20mM Hepes, pH7.9, 1.5 mM magnesium acetate, 50 mM potassium acetate, 1% glycerol, 0.5 mM DTT, protease and phosphatase inhibitors) containing 1% Triton X-100 and 5mM ATP on ice for 10 minutes. Total cell extracts were recovered, and a sample was added to 2X SDS sample buffer and boiled for 5 minutes. The remaining fraction was centrifuged through a 10% sucrose cushion. The supernatant corresponded to the Triton extractable fraction and a sample was added to 2X sample buffer and boiled for 5 minutes. The pellet was purified further after resuspension in BE 10 buffer containing 5mM ATP and centrifugation through a 10% sucrose gradient. Chromatin associated proteins were released from this fraction by resuspending the pellet in BE 10 buffer containing 150mM NaCl and incubating with 277 U DNase I (Sigma) for 10 minutes at 25°C. The supernatant contained the chromatin-associated proteins and was added to 2X sample buffer and boiled for 5 minutes. 6.2.8 Western blotting Protein extracts were run on SDS-polyacrylamide gels (Laemmli, 1970). Proteins were transferred to Immobilon membranes (Millipore), blocked in PBS containing 176 Chapter 6 Materials and methods skim milk (10%) and Tween 20 (0.1%) for at least 20 minutes, then incubated with the primary antibody in the same solution (see Table 6.2 below for details of antibodies used in these experiments). Horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibodies were used as secondary antibodies and were detected using an ECL kit (Amersham). Orp2-Protein A (figure 4.l0) was detected using a peroxidase-anti-peroxidase antibody which can be detected directly with the ECL kit. Table 6.2 Antibodies used for Western blotting Antibody______Dilution anti-Cdcl8 polyclonal (H.Nishitani) 11000 anti-Cdc21 polyclonal (Z.Lygerou) 11000 anti-Cdtl polyclonal (H.Nishitani) 1 1000 anti-Rum 1 R4 polyclonal (J.Correa-Bordes) 1 500 anti-Cdc2 Y63 monoclonal (H.Yamano) 1 100 anti-Protein A peroxidase anti-peroxidase (Sigma) 1 1500 anti-a-Tubulin monoclonal (Sigma) 1 10,000 anti-rabbit HRP (Amersham) 1 2500 anti-mouse HRP (Amersham) 1 2500 177 Bibliography Bibliography Adachi, Y., Usukura, J. and Yanagida, M. (1997).A globular complex formation by Ndal and the other five members of the MCM protein family in fission yeast. Genes Cells 2, 467-479. Aladjem, M. I., Groudine, M., Brody, L. L., Dieken, E. S., Fournier, R. E., Wahl, G. M. and Epner, E. M. (1995). Participation of the human beta-globin locus control region in initiation of DNA replication. Science 270, 815-819. Aparicio, O. M., Weinstein, D. M. and Bell, S. P. (1997). Components and dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and Cdc45p during S phase.Cell 91, 59-69. Aparicio, O. M., Stout, A. M. and Bell, S. P. (1999). Differential assembly of Cdc45p and DNA polymerases at early and late origins of DNA replication. Proc Natl Acad Sci USA 96, 9130-9135. Bahler, J., Wu, J.-Q., Longtine, M. S., Shah, N. G., McKenzie III, A., Steever, A. B., Wach, A., Philippsen, P. and Pringle, J. R.(1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943-951. Bai, C., Sen, P., Hofmann, K., Ma, L., Goebl, M., Harper, J. W. and Elledge, S. J.(1996). SKPl connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86, 263-274. Basi, G., Schmid, E. and Maundrell, K. (1993). TATA box mutations in the Schizosaccharomyces pombe nmtl promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123, 131-136. Basi, G. and Draetta, D. (1995). pl3"^wc7 ofSchizosaccharomyces pombe regulates two distinct forms of the mitotic cdc2 kinase. Mol Cell Biol 15, 2028-2036. Baum, B., Nishitani, H., Yanow, S. and Nurse, P. (1998). Cdcl8 transcription and proteolysis couple S phase to passage through mitosis.E M B O J ll, 5689-5698. Baumeister, W., Walz, J., Zuhl, F. and Seemuller, E.(1998). The proteasome: paradigm of a self-compartmentalizing protease.Cell 92, 367-380. 178 Bibliography Beach, D., Durkaez, B. and Nurse, P. (1982).Functionally homologous cell cycle control genes in budding and fission yeast. Nature 300, 706-709. Bell, S. P. and Stillman, B. (1992). ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357,128-134. Bell, S. P., Kobayashi, R. and Stillman, B. (1993). Yeast origin recognition complex functions in transcription silencing and DNA replication.Science 262, 1830- 1831. Bell, S. P., Mitchell, J., Leber, J., Kobayashi, R. and Stillman, B. (1995).The multidomain structure of Ore Ip reveals similarity to regulators of DNA replication and transcriptional silencing. Cell 83, 563-568. Benito, J., Martin-Castellanos,C. and Moreno, S. (1998). Regulation of the G1 phase of the cell cycle by periodic stabilization and degradation of the CDK inhibitor. EMBOJ 17, 482-497. Berger, C., Strub, A., Staib, C., Lepke, M., Zisimopoulou, P., Hoehn, K., Nanda, I., Scmid, M. and Grummt, F. (1999). Identification and characterization of a mouse homolog to yeast Cdc6p. Cytogenet Cell Genet 86,307-316. Blow, J. J. and Laskey, R. A.(1988). A role for the nuclear envelope in controlling DNA replication within the cell cycle. Nature 332, 546-548. Bonatti, S., Simili, M. and Abbondandolo, A. (1972). Isolation of temperature- sensitive mutants of Schizosaccharomyces pombe. J Bacterial 109, 484-491. Boober, R. and Beach, D. (1988). Involvement of cdcl3+ in mitotic control in Schizosaccharomyces pombe: possible interaction of the gene product with microtubules. EMBOJ 1, 2321-2327. Boober, R. N., Alfa, C. E., Hyams, J.S. and Beach, D. H. (1989). The fission yeast cdc2/cdcl3/sucl protein kinase: regulation of catalytic activity and nuclear localization. Cell 58,485-497. Bousset, K. and Diffley, J. F.(1998). The Cdc7 protein kinase is required for origin firing during S phase. Genes Dev 12, 480-490. 179 ______Bibliography Breeding, C. S., Hudson, J., Balasubramanian, M. K., Hemmingsen, C. S., Young, P. G. and Gould, K. L. (1998). The cdr2^ gene encodes a regulator of G2/M progression and cytokinesis in Schizosaccharomyces pombe. Mol Biol Cell 9, 3399-3415. Brewer, B. J. and Fangman, W. L. (1987).The localization of replication origins on ARS plasmids in S. cerevisiae. Cell 51, 463-471. Broek, D., Bartlett, R., Crawford, K. and Nurse, P. (1991). Involvement of p34cdc2 in establishing the dependency of S phase on mitosis.Nature 349, 388-393. Brown, G. W., Jallepalli, P. V., Huneycutt, B. J. and Kelly, T. V. (1997). Interaction of the S phase regulator cdcl8 with cyclin-dependent kinase in fission yeast. Proc Natl Acad Sci USA 94, 6142-6147. Brown, G. W. and Kelly, T. J. (1998).Purification of Hskl, a minichromosome maintenance protein kinase from fission yeast. J Biol Chem 273, 22083-22090. Brown, G. W. and Kelly, T. J. (1999).Cell cycle regulation of Dfpl, an activator of the Hskl protein kinase. Proc Natl Acad Sci USA 96, 8443-8448. Buck, V., Russell, P. and Millar, J. B.A. (1995). Identification of a cdk-activating kinase in fission yeast. EMBOJ. 14, 6173-6183. Bueno, A., Richardson, H., Reed, S. I. and Russell, P. (1991). A fission yeast B- type cyclin functioning early in the cell cycle. Cell 66, 149-159. Bueno, A. and Russell, P. (1993). Two fission yeast B-type cyclins, Cig2 and Cdcl3, have different functions in mitosis. Mol Cell Biol 13, 2286-2297. Calvi, B. R., Lilly, M.A. and Spradling,A. C. (1998).Cell cycle control of chorion gene amplification. Genes Dev 12, 734-744. Carpenter, P. B., P. R. Mueller, and W.G. Dunphy. (1996).Role for a Xenopus Orc2-related protein in controlling DNA replication.Nature 379, 357-360. Carpenter, P. B. and Dunphy, W. G.(1998). Identification of a novel 81-kDa component of the Xenopus origin recognition complex.J Biol Chem 273, 24891- 24897. 180 Bibliography Charles, J. F., Jaspersen, S. L., Tinker-Kulberg, R. L., Hwang, L., Szidon, A. and Morgan, D. O. (1998). The Polo-related kinase Cdc5 activates and is destroyed by the mitotic cyclin destruction machinery in S. cerevisiae. Curr Biol 8, 497-507. Chong, J., Mahbubani, H., Khoo, C. and Blow, J. (1995).Purification of an MCM- containing complex as a component of the DNA replication licensing system.Nature 375,418-421. Chuang, R. Y. and Kelly, T. J.(1999). The fission yeast homologue of Orc4p binds to replication origin DNA via multiple AT-hooks. Proc Natl Acad Sci USA96, 2656-2661. Clyne, R. K. and Kelly, T. J.(1995). Genetic analysis of an ARS element from the fission yeast Schizosaccharomyces pombe. EMBO J 12, 6348-6357. Cocker, J. H., Piatti, S., Santocanale, C., Nasmyth, K. and Diffley, J. (1996).F. An essential role for the Cdc6 protein in forming the pre-replicative complexes of budding yeast. Nature 379, 180-182. Coleman, T. R., Carpenter, P. B. and Dunphy, W. G. (1996). The Xenopus Cdc6 protein is essential for the initiation of a single round of DNA replication in cell-free extracts. Cell SI, 53-63. Connolly, T. and Beach, D. (1994). Interaction between the Cigl and Cig2 B-type cyclins in the fission yeast cell cycle. Mol Cell Biol 14, 768-776. Correa-Bordes, J. and Nurse, P. (1995). p25^^^^ orders S phase and mitosis by acting as an inhibitor of the p34‘^^^‘^ mitotic kinase. Cell 83, 1001-1009. Correa-Bordes, J. and Nurse, P. (1997). p25ruml promotes proteolysis of the mitotic B-cyclin p56cdcl3 during 01 of the fission yeast cell cycle. EMBO J 16, 4657-4664. Coué, M., Kearsey, S. and Mechali, M. (1996). Cell-cycle dependent phosphorylation and localization of an S. pombe cdc21 homolog in Xenopus Lae vis. E M B O J 15, 1085-1097. Coux, O., Tanaka, K. and Goldberg, A. L.(1996). Structure and functions of the 20S and 26S proteasomes. Annu Rev Biochem 65,801-847. 181 Bibliography Coverley, D., Pelizon, C., Trewick, S. and Laskey, R. A.(2000). Chromatin-bound Cdc6 persists in S and G2 phases in human cells, while soluble Cdc6 is destroyed in a cyclin A-cdk2 dependent process. J Cell Sci 113, 1929-1938. Coxon, A., Maundrell, K. and Kearsey, S. E.(1992). Fission yeast cdc21+ belongs to a family of proteins involved in an early step of chromosome-replication.Nucleic Acids Res 20,5571-5577. Dahmann, C., Diffley, J. F. and Nasmyth, K. A.(1995). S-phase-promoting cyclin- dependent kinases prevent re-replication by inhibiting the transition of replication origins to a pre-replicative state.Curr Biol 5, 1257-1269. Delidakis, C. and Kafatos, F. C. (1989). Amplification enhancers and replication origins in the autosomal chorion gene cluster of Drosophila. EMBO J ^ , 891-901. Detweiler, C. and Li, J.(1997). Cdc6p establishes and maintains a state of replication competence during G1 phase. J Ce//Sci 110, 753-763. Diffley, J. F. and Cocker, J. H. (1992).Protein-DNA interactions at a yeast replication origin. Nature 357, 169-172. Diffley, J. F., Cocker, J. H., Dowell, S. J. and Rowley, (1994).A. Two steps in the assembly of complexes at yeast replication origins in vivo. Cell 78,303-316. Diffley, J. F.(1995). The initiation of DNA replication in the budding yeast cell division cycle. Y e a s t 1651-1670. Diffley, J. F.(1996). Once and only once upon a time: specifying and regulating origins of DNA replication in eukaryotic cells. Genes Dev 10, 2819-2830. Donaldson, A. D., Fangman, W. L. and Brewer, B. J. (1998).Cdc7 is required throughout the yeast S phase to activate replication origins. Genes Dev 12, 491-501. Donovan, S., Harwood, J., Drury, L. S. and Diffley, J. (1997).F. Cdc6p-dependent loading of Mem proteins onto pre-replicative chromatin in budding yeast.Proc Natl Acad Sci USA 94, 5611-5616. 182 Bibliography Dowell, S. J., Romanowski, P. and Diffley, J. F.(1994). Interaction of Dbf4, the Cdc7 protein kinase regulatory subunit, with yeast replication origins in vivo. Science 265,1243-1246. Draetta, G., Luca, F., Westendorf, J., Brizuela, L., Ruderman, J. and Beach, D. (1989). cdc2 protein kinase is complexed with both cyclin A and B: evidence for proteolytic inactivation of MPF. Cell 56, 829-838. Drury, L. S., Perkins, G. and Diffley, J. F.(2000). The cyclin-dependent kinase Cdc28p regulates distinct modes of Cdc6p proteolysis during the budding yeast cell cycle. Curr Biol 10, 231-240. Dubey, D. D., Zhu, J., Carlson, D. L., Sharma, K. and Huberman, J. (1994).A. Three ARS elements contribute to the ura4 replication orgin region in the fission yeast, Schizosaccharomyces pombe. EMBO J 13, 3638-3647. Dubey, D. D., Kim, S., Todorov, I. T. and Huberman, J. A. (1996).Large, complex modular structure of a fission yeast DNA replication origin. Curr Biol 6, 467-473. Dunphy, W. G., Brizuela, L., Beach, D. and Newport, J.(1988). The Xenopus homolog of cdc2 is a component of MPF, a cytoplasmic regulator of mitosis. Cell 54, 423-431. Elsasser, S., Lou, F., Wang, B., Campbell, J. L. and Jong, A.(1996). Interaction between yeast Cdc6 protein and B-type cyclin/Cdc28 kinases. Mol Biol Cell 7, 1723- 1735. Elsasser, S., Chi, Y., Yang, P. and Campbell, J. L.(1999). Phosphorylation controls timing of Cdc6p destruction: a biochemical analysis. Mol Biol Cell 10, 3263- 3277. Epstein, C. B. and Cross, F. R. (1992). CLB5: a novel B cyclin from budding yeast with a role in S phase. Genes Dev 6, 1695-1706. Evans, T., Rosenthal, E. T., Youngblom, J., Distel, D. and Hunt, T. (1983). Cyclin: a protein specified by maternal mRNA in sea urchin eggs that is destroyed at each cleavage division. Cell 33, 389-396. 183 Bibliography Fantes, P. (1979). Epistatic gene interactions in the control of division in fission yeast Nature 279,428-430. Featherstone, C. and Russell, P. (1991). Fission yeast p i07^^^^ mitotic inhibitor is a tyrosine/serine kinase. Nature 349,808-811. Feng, L., Hu, Y., Wang, B., Wu, L. and Jong, A. (2000).Loss control of Mcm5 interaction with chromatin in cdc6-l mutated in CDC-NTP motif. DNA Cell Biol 19, 447-457. Findeisen, M., El-Denary, M., Kapitza, T., Graf, R. and Strausfeld, U.(1999). Cyclin A-dependent kinase activity affects chromatin binding of ORC, Cdc6, and MCM in egg extracts of Xenopus laevis. Eur J Biochem 264,415-426. Fisher, D. L. and Nurse, P. (1996). A single fission yeast mitotic cyclin B-p3 4 ^^^^ kinase promotes both S-phase and mitosis in the absence of G1 cyclins. EMBO J 15, 850-860. Fitch, I., Dahmann, C., Surana, U., Amon, A., Nasmyth, K., Goetsch, L., Byers, B. and Futcher, B. (1992). Characterization of four B-type cyclin genes of the budding yeast Saccharomyces cerevisiae. Mol Biol Cell 3, 805-818. Forsburg, S. L. and Nurse, P. (1991a). Cell cycle regulation in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Annu Rev Cell Biol 7, 227-256. Forsburg, S. L. and Nurse, P. (1991b). Identification of a G1-type cyclin pucl+ in the fission yeast Schizosaccharomyces pombe. Nature 351, 245-248. Forsburg, S. L. (1993). Comparison ofSchizosaccharomyces pombe expression systems. Nucleic Acids Res 21, 2955-2956. Forsburg, S. and Nurse, P. (1994). Analysis of the Schizosaccharomyces pombe cyclin pud : evidence for a role in cell cycle exit. J Ce// Sci 107, 601-613. Foss, M., McNally, F. J., Laurenson, P. and Rine, J.(1993). Origin recognition complex (ORC) in transcriptional silencing and DNA replication in S. cerevisiae. Science 262, 1838-1844. 184 Bibliography Fox, C. A., Loo, S., Dillin, A. and Rine, J. (1995).The origin recognition complex has essential functions in transcriptional silencing and chromosomal replication. Genes Dev 9, 911-924. Friedman, K. L. and Brewer, B. J. (1995).Analysis of replication intermediates by two-dimensional agarose gel electrophoresis. Methods Enzymol 262, 613-627. Friedman, K. L., Brewer, B. J. and Fangman, W. L.(1997). Replication profile of Saccharomyces cerevisiae chromosome VI. Genes Cells 2, 667-678. Fujita, M., Yamada, C., Goto, H., Yokoyama, N., Kuzushima, K., Inagaki, M. and Tsurumi, T. (1999). Cell cycle regulation of human CDC6 protein. Intracellular localization, interaction with the human mcm complex, and CDC2 kinase- mediated hyperphosphorylation.J Biol Chem 274,25927-25932. Ganoth, D., Bornstein, G., Ko, T. K., Larsen, B., Tyers, M., Pagano, M. and Hershko, A. (2001). The cell-cycle regulatory protein Cksl is required for SCF(Skp2)- mediated ubiquitinylation of p27. Nat Cell Biol 3, 321-324. Gautier, J., Norbury, C., Lohka, M., Nurse, P. and Mailer, J.(1988). Purified maturation-promoting factor contains the product of a Xenopus homolog of the fission yeast cell cycle control gene cdc2+. Cell 54,433-439. Gautier, J., Solomon, M. J., Boober, R. N., Bazan, J. F. and Kirschner, M. W. (1991). Cdc25 is a specific tyrosine phosphatase that directly activates p34‘^^^‘^.Cell 67, 197-211. Gavin, K., Hidaka, M. and Stillman, B.(1995). Conserved initiator proteins in eukaryotes. Science 270, 1667-1677. Glotzer, M., Murray, A. W. and Kirschner, M. W. (1991). Cyclin is degraded by the ubiquitin pathway. Nature 349, 132-138. Gossen, M., Pak, D. T., Hansen, S. K., Acharya, J. K. and Botchan, M.(1995). A Drosophila homolog of the yeast origin recognition complex.Science 270, 1674- 1677. Gould, K. L. and Nurse, P. (1989). Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis. Nature 342, 39-45. 185 ______Bibliography Gould, K. L., Moreno, S., Tonks, N. K. and Nurse, P. (1990). Complementation of the mitotic activator, p80cdc25, by a human protein-tyrosine phosphatase.Science 250, 1573-1576. Gould, K. L., Moreno, S., Owen, D. J., Sazer, S. and Nurse, P. (1991). Phosphorylation at Thr 167 is required for Schizosaccharomyces pombe p34cdc2 function. E M B O J Id. 3297-3309. Grallert, B. and Nurse, P. (1996). The ORCl homolog orpl in fission yeast plays a key role in regulating onset of S phase. Genes Dev 10, 2644-2654. Greenwood, E., Nishitani, H. and Nurse, P. (1998). Cdcl8p can block mitosis by two independent mechanisms. J Cell Sci 111, 3101-3108. Hagan, I., Hayles, J. and Nurse, P. (1988).Cloning and sequencing of the cyclin- related cdcl3+ gene and a cytological study of its role in fission yeast mitosis. J Cell 5'd 91, 587-595. Hardy, C. F. (1996). Characterization of an essential Orc2p-associated factor that plays a role in DNA replication.Mol Cell Biol 16, 1832-1841. Harland, R. M. and Laskey, R. A. (1980).Regulated replication of DNA microinjected into eggs o ïXenopus laevis. Cell 21, 761-771. Hartwell, L., Culotti, J., Pringle, J. and Reid, B. (1974).J. Genetic control of the cell division cycle in yeast. Science 183, 46-51. Hartwell, L. H. (1976). sequential function of gene products relative to DNA synthesis in the yeast cell cycle. J Mol Biol 104, 803-817. Hateboer, G., Wobst, A., Otzen Petersen, B., Le Cam, L., Vigo, E., Sardet, C. and Helin, K. (1998). Cell cycle-regulated expression of mammalian CDC6 is dependent on E2F. Mol Cell Biol 18, 6679-6697. Hayles, J., Fisher, D., Woollard, A. and Nurse, P.(1994). Temporal order of S- phase and mitosis in fission yeast is determined by the state of the p34^(^("^/mitotic B cyclin complex. Cell 78,813-822. 186 ______Bibliography Heck, M. M. and Spradling, A. C. (1990).Multiple replication origins are used during Drosophila chorion gene amplification. / Ce//Biol 110, 903-914. Hendrickson, M., M. Madine, S. Dalton, and J. Gautier.(1996). phosphorylation of MCM4 by cdc2 protein kinase inhibits the activity of the minichromosome maintenance complex. Proc Natl Acad Sci USA 93, 12223-12229. Hennessy, K. M., Clark, C. D. and Botstein, D. (1990).Subcellular localization of yeast CDC46 varies with the cell cycle. Genes Dev 4, 2252-2263. Herbig, U., Griffith, J. W. and Fanning, E. (2000).Mutation of cyclin/cdk phosphorylation sites in HsCdc6 disrupts a late step in initiation of DNA replication in human cells. Mol Biol Cell 11, 4117-4130. Hershko, A., Ganoth, D., Sudakin, V., Dahan, A., Cohen, L. H., Luca, F. C., Ruderman, J. V. and Eytan, E. (1994).Components of a system that ligates cyclin to ubiquitin and their regulation by the protein kinase cdc2. J Biol Chem 269, 4940- 4946. Hofmann, J. F. and Beach, D.(1994). cdtl is an essential target of the CdclO/Sctl transcription factor: requirement for DNA replication and inhibition of mitosis. E M B O J 13, 425-434. Hopwood, B. and Dalton, S. (1996). Cdc45p assembles into a complex with Cdc46p/Mcm5p, is required for minichromosome maintenance, and is essential for chromosomal DNA replication. Proc Natl Acad Sci USA 93, 12309-12314. Hori, Y., Shirahige, K., Obuse, C., Tsurimoto, T. and Yoshikawa, H. (1996). Characterization of a novel GDC gene (ORCl) partly homologous to CDC6 of Saccharomyces cerevisiae. Mol Biol Cell 7, 409-418. Hua, X. H., Yan, H. and Newport, J.(1997). A role for Cdk2 kinase in negatively regulating DNA replication during S phase of the cell cycle. J Ce//Biol 137, 183-192. Hua, X. H. and Newport, J.(1998). Identification of a preinitiation step in DNA replication that is independent of Origin Recognition Complex and cdc6, but dependent on cdk2. J Cell Biol 140, 271-281. 187 Bibliography Huberman, J. A., Spotila, L. D., Nawotka, K. A., el-Assouli, S. M. and Davis, L. R. (1987). The in vivo replication origin of the yeast 2 microns plasmid.Cell 51, 473- 481. Irniger, S., Piatti, S., Michaelis, C. and Nasmyth, K.(1995). Genes Involved in Sister Chromatid Separation Are Needed for B-Type Cyclin Proteolysis in Budding Yeast. Cell 81, 269-277. Ishiai, M., Dean, F. B., Okumura, K., Abe, M., Moon, K. V., Amin, A. A., Kagotani, K., Taguchi, H., Murakami, ¥., Hanaoka, F. et al.(1997). Isolation of human and fission yeast homologues of the budding yeast origin recognition complex subunit 0RC5: human homologue (0RC5L) maps to 7q22. Genomics 46,294-298. Ishimi, Y. (1997). A DNA helicase activity is associated with an MCM4, -6 and -7 protein complex.J Biol Chem 272,24508-24513. Jacob, F., Brenner,S. and Cuzin, F. (1963). On the regulation of DNA replication in bacteria. Cold Spring Harbor Symp Quant Biol 28, 329-348. Jallepalli, P. V. and Kelly, T. J.(1996). Ruml and Cdcl8 link inhibition of cyclin- dependent kinase to the initiation of DNA replication in Schizosaccharomyces pombe. Genes DevlO, 541-552. Jallepalli, P. V., Brown, G. W., Muzi-Falconi, M., Tien, D. and Kelly, T. J. (1997). Regulation of the replication initiator protein by CDK phosphorylation.Genes Dev 11, 2767-2779. Jallepalli, P. V., Tien, D. and Kelly, T. J.(1998). sudl'^ targets cyclin-dependent kinase-phosphorylated Cdcl8 and Ruml proteins for degradation and stops unwanted diploidization in fission yeast. Proc Natl Acad Sci USA 95, 8159-8164. Jares, P. and Blow, J. J.(2000). Xenopus Cdc7 function is dependent on licensing but not on XORC, XCdc6, or CDK activity and is required for XCdc45 loading. Genes Dev 14, 1528-1540. Jaspersen,S. L., Charles, J. F., Tinker-Kulberg, R. L. and Morgan, D. O.(1998). A late mitotic regulatory network controlling cyclin destruction in Saccharomyces cerevisiae. Mol Biol Cell 9, 2803-2817. 188 Bibliography Jiang, W. and Hunter, T.(1997). Identification and characterization of a human protein kinase related to budding yeast Cdc7p. Proc Natl Acad Sci US A94, 14320- 14325. Jiang, W., McDonald, D., Hope, T. J. and Hunter, T.(1999). Mammalian Cdc7- Dbf4 protein kinase complex is essential for initiation of DNA replication. EMBO J 18, 5703-5713. Johnston, L. H. and Barker, D. G. (1987).Characterisation of an autonomously replicating sequence from the fission yeast Schizosaccharomyces pombe. Mol Gen Genet 207, 161-164. Kanoh, J. and Russell, P.(1998). The protein kinase Cdr2, related to niml/cdrl mitotic inducer, regulates the onset of mitosis in fission yeast. Mol Biol Cell 9, 3321- 3334. Kearsey, S. E., Montgomery, S., Labib, K. and Lindner, K.(2000). Chromatin binding of the fission yeast replication factor mcm4 occurs during anaphase and requires ORC and cdcl8. EMBO J 19, 1681-1690. Kelly, T. J., Martin, G. S., Forsburg, S. L., Stephen, R. J., Russo, A. and Nurse, P. (1993). The fission yeast cdclS gene product couples S-phase to start and mitosis. C elllA. 371-382. Kelman, Z., Lee, J. K. and Hurwitz, J. (1999).The single minichromosome maintenance protein of Methanobacterium thermoautotrophicum DeltaH contains DNA helicase activity. Proc Natl Acad Sci U SA 96, 14783-14788. Kim, S.-M. and Huberman, J. A.(1998). Multiple orientation-dependent, synergistically interacting, similar domains in the ribosomal DNA replication origin of the fission yeast, Schizosaccharomyces pombe. Mol Cell Biol 18, 7294-7303. Kimura, H., N. Nozaki, and K. Sugimoto. (1994). DNA polymerase a associated protein PI, a murine homolg of yeast MCM3, changes its intranuclear distribution during the DNA synthesis period. EMBO J 13, 4311-4320. Kimura, H., Ohtomo, T., Yamaguchi, M., Ishii, A. and Sugimoto, K. (1996). Mouse MCM proteins: complex formation and transportation to the nucleus.Genes Cells 1, 977-993. 189 ______Bibliography King, R. W., Peters, J., Tugendreich, S., Rolfe, M., Hieter, P. and Krischner, M. (1995). A 20S Complex Containing CDC27 and CDC16 Catalyzes the Mitosis- Specific Conjugation of Ubiquitin to Cyclin B. Cell 81, 279-288. Kirschner, M., Newport, J. and Gerhart, J.(1985). The timing of early developmental events m Xenopus. Trends in Genetics , (February), 41-47. Kishimoto, T., Kuriyama, R., Kendo, H. and Hanatani, H. (1982). Generality of the action of various maturation-promoting factors. Exp Cell Res 137, 121-126. Kitsberg, D., Selig, S., Keshet, I. and Cedar, H.(1993). Replication structure of the human beta-globin gene domain. Nature 366, 588-590. Kominami, K. and Toda, T. (1997). Fission yeast WD-repeat protein Popl regulates genome ploidy through ubuiquitin-proteosome-mediated degredation of the CDK inhibitor Ruml and the S-phase initiator Cdcl8. Genes Dev 11, 1548-1560. Krude, T., Musahl, C., Laskey, R. A. and Knippers, R.(1996). Human replication proteins hCdc21, hCdc46 and PlMcmS bind chromatin uniformly before S-phase and are displaced locally during DNA replication.J Cell Sci 109, 309-318. Kubota, Y., Mimura, S., Nishimoto, S., Takisawa, H. and Nojima, H. (1995). Identification of the Yeast MCM3-Related Protein as a Component of Xenopus DNA Replication Licensing Factor. Cell 81, 601-609. Kubota, Y., Mimura, S., Nishimoto, S., Masuda, T., Nojima, H. and Takisawa, H. (1997). Licensing of DNA replication by a multi-protein complex of MCM/Pl proteins m Xenopus eggs. EMBO J 16, 3320-3331. Kukimoto, I., Igaki, H. and Kanda, T. (1999). Human CDC45 protein binds to minichromosome maintenance 7 protein and the p70 subunit of DNA polymerase a. Eur J Biochem 265, 936-943. Kumagai, A. and Dunphy, W. G.(1991). The cdc25 protein controls tyrosine dephosphorylation of the cdc2 protein in a cell-free system.Cell 64, 903-914. Labbe, J. C., Lee, M. G., Nurse, P., Picard, A. and Doree, M.(1988). Activation at M-phase of a protein kinase encoded by a starfish homologue of the cell cycle control gene cdc2+. Nature 335, 251-254. 190 Bibliography Labbe, J., Capony, J., Caput, D., Cavadore, J., Desancourt, M., Kaghad, M., Lelias, J. M., Picard, A. and Doree, M.(1989). MPF from starfish oocytes at first meiotic metaphase is an heterodimer containing one molecule of cdc2 and one molecule of cyclin B. EMBO J S , 3053-3058. Labib, K., Moreno, S. and Nurse, P. (1995). Interaction of cdc2 and ruml regulates Start and S-phase in fission yeast. J Cell Sci 108, 3285-3294. Labib, K., Diffley, J. F. X. and Kearsey, S. E.(1999). G1-phase and B-type cyclins exclude the DNA-replication factor Mcm4 from the nucleus. Nat Cell Biol 1, 415- 422. Labib, K., Tereco, J. A. and Diffley, J. F. X.(2000). Uninterrupted MCM2-7 function required for DNA replication fork progression. Science 288, 1643-1647. Laemmli, U. K. (1970).Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Landis, G., Kelley, R., Spradling, A. C. and Tower, J.(1997). The k43 gene, required for chorion gene amplification and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin recognition complex subunit 2. Proc Natl Acad Sci U SA 94, 3888-3892. Langan, T. A., Gautier, J., Lohka, M., Hollingsworth, R., Moreno, S., Nurse, P., Mailer, J. and Selafani, R. A.(1989). Mammalian growth-associated HI histone kinase: a homolog of cdc2+/CDC28 protein kinases controlling mitotic entry in yeast and frog cells. Mol Cell Biol 9, 3860-3868. Leatherwood, J., A. Lopez Girona, and P. Russell. (1996). Interaction of Cdc2 and Cdcl8 with a fission yeast 0RC2-like protein. Nature 379, 360-363. Lee, J. K. and Hurwitz, J.(2001). Processive DNA helicase activity of the minichromosome maintenance proteins 4, 6, and 7 complex requires forked DNA structures. Proc Natl Acad Sci U S A9^, 54-59. Lee, M. G. and Nurse, P. (1987). Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature 327, 31-35. 191 ______Bibliography Lee, M. S., Ogg, S., Xu, M., Parker, L. L., Donoghue, D. J., Mailer, J. L. and Piwnica-Worms, H. (1992). cdc25+ encodes a protein phosphatase that dephosphorylates p34cdc2.Mol Biol Cell 3, 73-84. Lee, M. S., Enoch, T. and Piwinica-Worms, H. (1994). mikl+ encodes a tyrosine kinase that phosphorylates p34cd2 on tyrosine 15. J Biol Chem 269,30530-30537. Lei, M., Kawasaki, Y. and Tye, B. K. (1996).Physical interactions among Mcm proteins and effects of Mcm dosage on DNA replication in Saccharomyces cerevisiae. Mol Cell Biol 16, 5081-5090. Lei, M., Kawasaki, ¥., Young, M. R., Kihara, M., Sugino, A. and Tye, B. K. (1997). Mcm2 is a target of regulation by Cdc7-Dbf4 during the initiation of DNA synthesis. Genes Dev 11, 3365-3374. Li, J. J. and Herskowitz, I.(1993). Isolation of 0RC6, a component of the yeast origin recognition complex by a one-hybrid system. Science 262, 1870-1874. Liang, C., Weinreich, M. and Stillman, B. (1995).ORC and Cdc6p interact and determine the frequency of initiation of DNA replication in the genome. Cell 81, 667- 676. Liang, C. and Stillman, B.(1997). Persistent initiation of DNA replication and chromatin-bound MCM proteins during the cell cycle in cdc6 mutants. Genes Dev 11, 3375-3386. Lin, S. and Kowalski, D. (1997). Functional equivalency and diversity of cis-acting elements among yeast replication origins. Mol Cell Biol 17, 5473-5484. Loebel, D., Huikeshoven, H. and Cotterill, S. (2000). Localisation of the DmCdc45 DNA replication factor in the mitotic cycle and during chorion gene amplification. Nucleic Acids Res 28, 3897-3903. Lohka, M. J., Hayes, M. K. and Mailer, J. (1988).L. Purification of maturation- promoting factor, an intracellular regulator of early mitotic events. Proc Natl Acad 85, 3009-3013. Loo, S., Fox, C. A., Rine, J., Kobayashi, R., Stillman, B. and Bell, S.(1995). The origin recognition complex in silencing, cell cycle progression, and DNA replication. Mol Biol Cell 6, 741-756. 192 Bibliography Lopez-Girona, A., Mondesert, O., Leatherwood, J. and Russell, P. (1998). Negative regulation of cdclS DNA replication protein by cdc2. Mol Biol Cell 9, 63- 73. Lu, L., Zhang, H. and Tower, J.(2001). Functionally distinct, sequence-specific replicator and origin elements are required for Drosophila chorion gene amplification. Genes Dev 15, 134-146. Lundgren, K., Walworth, N., Booher, R., Dembski, M., Kirschner, M. and Beach, D. (1991). mikl and weel cooperate in the inhibitory tyrosine phosphorylation ofcdc2. Cell 64, 1111-1122. Lygerou, Z. and Nurse, P.(1999). The fission yeast origin recognition complex is constitutively associated with chromatin and is differentially modified through the cell cyc\Q. J Cell Sci 112, 3703-3712. MacNeill, S. A. and Fantes, P. (1993).Methods for analysis of the fission yeast cell cycle,. In in "The Cell Cycle", Practical Approach Series, IRL Press at Oxford University Press, (ed. 93-125). Madine, M., Khoo, C., Mills, A. D. and Laskey, R. A. (1995).MCM3 complex required for cell cycle regulation of DNA replication in vertebrate cells. Nature 375, 421-424. Mahbubani, H. M., Chong, J. P., Chevalier, S., Thommes, P. and Blow, J. J. (1997). Cell cycle regulation of the replication licensing system: involvement of a Cdk-dependent inhibitor. J Ce// Biol 136, 125-135. Maine, G. T., Sinha, P. and Tye, B.(1984). Mutants of S. cerevisiae defective in the maintenance of minichromosomes. Genetics 106, 365-385. Maiorano, D., Van Assendelft, G. B. and Kearsey, S. E. (1996). Fission yeast cdc21, a member of the MCM protein family, is required for onset of S phase and is located in the nucleus throughout the cell cycle. EMBO J 15, 861-872. Maiorano, D., Moreau, J. and Mechali, M. (2000). XCDTl is required for the assembly of pre-replicative complexes in Xenopus laevis.Nature 404,622-625. 193 ______Bibliography Marahrens, Y. and Stillman, B. (1992). A yeast chromosomal origin of replication defined by multiple functional elements. Science 255, 817-823. Martin-Castellanos, C., Labib, K. and Moreno, S. (1996). B-type cyclins regulate G1 progression in fission yeast in opposition to the p25ruml cdk inhibitor. EMBO J 15, 839-849. Martin-Castellanos, C., Blanco, M. A., de Prada, J. M. and Moreno, S. (2000). The pud cyclin regulates the G1 phase of the fission yeast cell cycle in response to cell size. Mol Biol Cell 11, 543-554. Masai, H., Miyake, T. and Arai, K. (1995).hskl+, a Schizosaccharomyces pombe gene related to Saccharomyces cerevisiae CDC7, is required for chromosomal replication. EMBO J 14, 3094-3104. Masui, Y. and Markert, C. (1971). Cytoplasmic control of nuclear behaviour during meiotic maturation of frog oocytes. J Exp Zool 177, 129-146. Maundrell, K., Hutchison, A. and Shall, S. (1988). Sequence analysis of ARS elements in fission yeast. EMBOJl, 2203-2209. Maundrell, K. (1990). nmtl of fission yeast: a highly transcribed gene completely repressed by thiamine. J Biol Chem 265. McGarry, T. J. and Kirschner, M. W. (1998).Geminin, an inhibitor of DNA replication, is degraded during mitosis. Cell 93, 1043-1053. Mendenhall, M. D. (1993). An inhibitor of p34(cdc28) protein-kinase activity from saccharomyces-cerevisiae. Science 259, 216-219. Micklem, G., Rowley, A., Harwood, J., Nasmyth, K. and Diffley, J. F. (1993). Yeast origin recognition complex is involved in DNA replication and transcriptional silencing. Nature 366, 87-89. Mimura, S. and Takisawa, H. (1998). Xenopus Cdc45-dependent loading of DNA polymerase a onto chromatin under the control of S-phase cdk. EMBO J 17, 5699- 5707. 194 Bibliography Mimura, S., Masuda, T., Matsui, T. and Takisawa, H.(2000). Central role for cdc45 in establishing an initiation complex of DNA replication in Xenopus egg extracts. Genes Cells 5, 439-452. Mitchison, J. M. and Creanor, J.(1971). Further measurements of DNA synthesis and enzyme potential during cell cycle of fission yeast Schizosaccharomyces pombe. Exp Cell Res 69,244-247. Mitchinson, J. (1974). Sequences pathways and timers in the cell cycle. In Cell Cycle Controls. G. M. Padilla, I. L. Cameron and A. Zimmerman, eds (New York Academic Press). Miyake, S. and Yamashita, S.(1998). Identification ofsna41 gene, which is the suppressor ofnda4 mutation and is involved in DNA replication in Schizosaccharomyces pombe. Genes Cells 3, 157-166. Mizushima, T., Takahashi, N. and Stillman, B. (2000).Cdc6p modulates the structure and DNA binding activity of the origin recognition complex in vitro. Genes Dev 14, 1631-1641. Mondesert, O., McGowan, C. H. and Russell, P. (1996). Cig2, a B-type cyclin, promotes the onset of S in Schizosaccharomyces pombe. Mol Cell Biol 16, 1527- 1533. Moon, K., Kong, D., Lee, J., Raychaudhuri, S. and Hurwitz, J. (1999). Identification and reconstitution of the origin recognition complex from Schizosaccharomyces pombe. Proc Natl Acad Sci USA 96, 12367-12372. Moreno, S., Hayles, J. and Nurse, P.(1989). Regulation of p34^^^^ protein kinase during mitosis. Cell 58, 361-372. Moreno, S., Nurse, P. and Russell, P. (1990). Regulation of mitosis by cyclic accumulation of p80cdc25 mitotic inducer in fission yeast. Nature 344,549-552. Moreno, S., Klar, A. and Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol 194, 795-823. Moreno, S., Labib, K., Correa, J. and Nurse, P. (1994). Regulation of the cell cycle timing of Start in fission yeast by the ruml+ gene. J Cell Sci 18, 63-68. 195 Bibliography Moreno, S. and Nurse, P. (1994). Regulation of progression through the G1 phase of the cell cycle by the ru m l^ gene. Nature 367, 236-242. Morgan, D. O. (1999). Regulation of the APC and the exit from mitosis. Nat Cell Rzo/l,E47-53. Murray, A. W., Solomon, M. J. and Kirschner, M. W. (1989).The role of cyclin synthesis and degradation in the control of maturation promoting factor activity. Nature 339, 280-286. Musahl, C., Schulte, R., Burkhart, R. and Knippers, R. (1995). A human homologue of the yeast replication protein cdc21 : interactions with other Mcm proteins. Eur J Biochem 230, 1096-1101. Muzi-Falconi, M. and Kelly, T. J. (1995).Orpl, a member of the Cdcl8/Cdc6 family of S-phase regulators, is homologous to a component of the origin recognition complex. Proc Natl Acad Sci U SA 92, 12475-12479. Muzi-Falconi, M., Brown, G. W. and Kelly, T. J. (1996).cd clS ^ regulates initiation of DNA replication in Schizosaccharomyces pombe. Proc Natl Acad Sci U S A 93, 1566-1570. Nasmyth, K. and Nurse, P.(1981). Cell division cycle mutants altered in DNA replication and mitosis in the fission yeast Schizosaccharomyces pombe. Molec Gen Genet 182, 119-124. Natale, D. A., Li, C. J., Sun, W. H. and DePamphilis, M. L. (2000).Selective instability of Orel protein accounts for the absence of functional origin recognition complexes during the M-G(l) transition in mammals. EMBO J 19, 2728-2738. Nguyen, V. Q., Co, C., Irie, K. and Li, J. J.(2000). Clb/Cdc28 kinases promote nuclear export of the replication initiator proteins Mcm2-7.Curr Biol 10, 195-205. Nishitani, H. and Nurse, P. (1995). p65^^^^*^ plays a major role controlling the initiation of DNA replication in fission yeast. Cell 83, 397-405. Nishitani, H., Lygerou, Z., Nishimoto, T. and Nurse, P. (2000). The Cdtl protein is required to license DNA for replication in fission yeast. Nature 404, 625-628. 196 Bibliography Noton, E. and Diffley, J. F.(2000). CDK inactivation is the only essential function of the APC/C and the mitotic exit network proteins for origin resetting during mitosis. Mol Cell 85-95. Nougarède, R., Della Seta, F., Zarzov, P. and Schwob, F. (2000). Hierarchy of S- phase promoting factors: Yeast Dbf4-Cdc7 kinase requires prior cyclin-dependent kinase activation. Mol Cell Biol 20, 3795-3806. Nurse, P. (1975). Genetic control of cell size at cell division in yeast. Nature 256, 547-5551. Nurse, P., Thuriaux,P. and Nasmyth,K. (1976). Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Molec Gen Genet 146, 167-178. Nurse, P. and Thuriaux,P. (1980). Regulatory genes controlling mitosis in the fission yeast Schizosaccharomyces pombe. Genetics 96, 627-637. Nurse, P. and Bissett, Y. (1981). Gene required in G1 for commitment to cell cycle and in G2 for control of mitosis in fission yeast. Nature 292, 558-560. Obara-lshihara, T. and Okayama, H. (1994).A B-type cyclin negatively regulates conjugation via interacting with cell cycle 'start' genes in fission yeast. EMBO J. 13, 1863-1872. Ogawa, V., Takahashi, T. and Masukata, H. (1999).Association of fission yeast Orpl and Mcm6 proteins with chromosomal replication origins.Mol Cell Biol 19, 7228-7236. Okuno, V., Okazaki, T. and Masukata, H. (1997). Identification of a predominant replication origin in fission yeast. NAR 25, 530-536. Okuno, V., Satoh, H., Sekiguchi, M. and Masukata, H. (1999). Clustered adenine/thymine stretches are essential for function of a fission yeast replication origin. Mol Cell Biol 19, 6699-6709. Orr-Weaver, T. L. (1991).Drosophila chorion genes: cracking the eggshell's secrets. Bioessays 13, 97-105. 197 Bibliography Osheim, Y. N., Miller, O. L., Jr. and Beyer, A. L. (1988).Visualization of Drosophila melanogaster chorion genes undergoing amplification.Mol Cell Biol 8, 2811-2821. Owens, J. C., Detweiler, C. S. and Li, J. J.(1997). CDC45 is required in conjunction with CDC7/DBF4 to trigger the initiation of DNA replication. Proc Natl Acad Sci USA 94, 12521-12526. Pardee, A. (1974). A restriction point for control of normal animal cell proliferation. Proc Natl Acad Sci USA 71, 1286-1290. Parker, L. L., Atherton-Fessler, S. and Piwnica-Worms, H. (1992). p i07^^^^ is a dual-specificity kinase that phosphorylates p34^^^“^ on tyrosine 15. Proc Natl Acad Sci USA 89, 2917-2921. Parker, L. L., Walter, S. A., Young, P. G. and Piwnica-Worms, H. (1993). Phosphorylation and inactivation of the mitotic inhibitor Weel by the nim l/cdrl kinase. Nature 363, 736-738. Pasero, P., Duncker, B. P., Schwob, E. and Casser, S. M. (1999). A role for the Cdc7 kinase regulatory subunit Dbf4p in the formation of initiation-competent origins of replication. Genes Dev 13, 2159-2176. Pasion, S. G. and Forsburg, S. L. (1999). Nuclear localization of Schizosaccharomyces pombe Mcm2p/Cdcl9p requires MCM complex assembly.Mol Biol Cell 10, 4043-4057. Petersen, B. O., Lukas, J., Sorensen, C. S., Bartek, J. and Helin, K.(1999). Phosphorylation of mammalian CDC6 by cyclin A/CDK2 regulates its subcellular localization. EMBOJll, 396-410. Piatti, S., Lengauer, C. and Nasmyth, K.(1995). Cdc6 is an unstable protein whose de novo synthesis in G1 is important for the onset of S phase and for preventing a 'reductionaf anaphase in the budding yeast Saccharomyces cerevisiae. EMBO J 14, 3788-3799. Piatti, S., Bohm, T., Cocker, J. H., Diffley, J. F. and Nasmyth, K. (1996). Activation of S-phase-promoting CDKs in late G1 defines a "point of no return" after 198 Bibliography which Cdc6 synthesis cannot promote DNA replication in yeast. Genes Dev 10, 1516- 1531. Planas-Silva, M. D. and Weinberg, R. A.(1997). The restriction point and control of cell proliferation. Curr Opin Cell Biol 9, 768-772. Raghuraman, M. K., Brewer, B. J. and Fangman, W. L. (1997).Cell cycle- dependent establishment of a late replication program.Science 276, 806-809. Rao, H. and Stillman, B. (1995). The origin recognition complex interacts with a bipartite DNA binding site within yeast replicators. Proc Natl Acad SciUSA92, 2224-2228. Rao, P. and Johnson, R. (1970). Mammalian cell fusion studies on the regulation of DNA synthesis and mitosis. Nature 225, 159-164. Reed, S. I., Hadwiger, J. A. and Lorincz, A. T.(1985). Protein kinase activity associated with the product of the yeast cell division cycle gene CDC28. Proc Natl Acad Sci USA 82, 4055-4059. Richardson, H., Lew, D. J., Henze, M., Sugimoto, K. and Reed, S. I. (1992). Cyclin-B homologs in Saccharomyces cerevisiae function in S phase and in G2. Genes Dev 6, 2021-2034. Richardson, H. E., Wittenberg, C., Cross, F. and Reed, S. I. (1989). An essential G1 function for cyclin-like proteins in yeast. Cell 59, 1127-1133. Rivin, C. J. and Fangman, W. L.(1980). Replication fork rate and origin activation during the S phase of Saccharomyces cerevisiae. J Cell Biol 85, 108-115. Romanowski, P., Madine, M. A., Rowles, A., Blow, J. J. and Laskey, R. A. (1996). The Xenopus origin recognition complex is essential for DNA replication and MCM binding to chromatin. Curr Biol 6, 1416-1425. Ross, K. E., Kaldis, P. and Solomon, M. J. (2000). Activating phosphorylation of the Saccharomyces cerevisiae cyclin-dependent kinase, Cdc28p, precedes cyclin binding. Mol Biol Cell 11, 1597-1609. 199 Bibliography Rowles, A., Chong, J. P., Brown, L., Howell, M., Evan, G. I. and Blow, J. J. (1996). Interaction between the origin recognition complex and the replication licensing system in Xenopus. Cell 87, 287-296. Rowley, A., Cocker, J. H., Harwood, J. and Diffley, J. (1995).F. Initiation complex assembly at budding yeast replication origins begins with the recognition of a bipartite sequence by limiting amounts of the initiator, ORC. EMBO J 14, 2631- 2641. Royzman, I., Austin, R. J., Bosco, G., Bell, S. P. and Orr-Weaver, T. L. (1999). ORC localization in Drosophila follicle cells and the effects of mutations in dE2F and dDP. Genes Dev 13, 827-840. Russell, P. and Nurse, P. (1986). cdc25+ functions as an inducer in the mitotic control of fission yeast. Cell 45, 145-153. Russell, P. and Nurse, P. (1987). Negative regulation of mitosis by weel+, a gene encoding a protein kinase homolog. Cell 49, 559-567. Saha, P., Chen, J., Thome, K. C., Lawlis, S. J., Hou, Z., Hendricks, M., Parvin, J. D. and Dutta, A. (1998). Human CDC6/Cdcl8 associates with Orel and Cyclin/cdk and is selectively eliminated from the nucleus at the onset of S phase. Mol Cell Biol 18, 2758-2767. Sambrook, J., Fritsch, E. and Maniatis, T.(1989). Molecular cloning: a laboratory manual. Second edition. Cold Spring Harbor Laboratory Press. Sanchez, J. A., Kim, S. and Huberman, J. A.(1998). Ribosomal DNA Replication in the Fission Yeast Schizosaccharomycespombe. Exp Cell Res 238, 220-230. Sanchez, M., Calzada, A. and Bueno, A. (1999). Functionally homologous DNA replication genes in fission and budding yeast. J Cell Sci 112, 2381-2390. Sanchez-Diaz, A., Gonzalez, I., Arellano, M. and Moreno, S. (1998). The Cdk inhibitors p25^^^1 and p40^^^^ are functional homologues that play similar roles in the regulation of the cell cycle in fission and budding yeast. J Cell Sci 111, 843-851. Santocanale, C. and Diffley, J. F.(1996). ORC- and Cdc6-dependent complexes at active and inactive chromosomal replication origins in Saccharomyces cerevisiae. EMBO J IS, 6671-6679. 200 Bibliography Santocanale, C. and Diffley, J. F. X. (1998).A M ed- and Rad5 3-dependent checkpoint controls late-firing origins of DNA replication. Nature 395, 615-617. Sato, N., Aral, K. and Masai, H. (1997). Human and Xenopus cDNAs encoding budding yeast Cdc7-related kinases: in vitro phosphorylation of MCM subunits by a putative human homologue of Cdc7. EMBO J 16, 4340-4351. Sazer, S. and Sherwood, S. W. (1990). Mitochondrial growth and DNA synthesis occur in the absence of nuclear DNA replication in fission yeast. J Cell Sci 97, 509- 516. Schwob, E. and Nasmyth, K. (1993). CLB5and CLB6, a new pair ofB cyclins involved in DNA replication in Saccharomyces cerevisiae. Genes Dev 7, 1160-1175. Schwob, E., Bohm, T., Mendenhall, M. D. and Nasmyth, K. (1994). The B-type cyclin kinase inhibitor p40SICl controls the G1 to S transition in S. cerevisiae. Cell 79, 233-244. Sherman, D. A. and Forsburg, S. L. (1998). Schizosaccharomyces pombe Mcm3p, an essential nuclear protein, associates tightly with Nda4p (Mcm5p).NAR 26, 3955- 3960. Sherr, C. J.(1996). Cancer Cell Cycles. Science 274,1672-1677. Simanis, V. and Nurse, P. (1986). The cell cycle control gene cdc2+ of fission yeast encodes a protein kinase potentially regulated by phosphorylation. Cell 45,261-268. Smith, L. D. and Ecker, R. E. (1971).The interaction of steroids with R. pipiens oocytes in the induction of maturation. Dev Biol 25, 233-247. Stinchcomb, D. T., Struhl, K. and Davis, R. W. (1979). Isolation and characterisation of a yeast chromosomal replicator. Nature 282, 39-43. Strausfeld, U., Labbe, J.-C., Fesquet, D., Cavadore, J. C., Picard, A., Sadhu, K., Russell, P. and Dorée, M. (1991). Dephophorylation and activation of a p34cdc2/cyclin B complex in vitro by human CDC25 protein. Nature 351, 242-245. 201 ______Bibliography Sudakin, V., Ganoth, D., Dahan, A., Heller, H., Horshko, J., luca, F. C., Ruderman, J. V. and Hershko, A.(1995). The cyclosome, a large complex containng cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell 6, 185-197. Sunkara, P., Wright, D. and Rao, P. (1979). Mitotic factors from mammalian cells induces germinal vesicle breakdown and chromosome condensation in amphibian oocytes. Proc Natl Acad Sci. USA 76,2799-2802. Tada, S., Li, A., Maiorano, D., Mechali, M. and Blow, J. J.(2001). Repression of origin assembly in metaphase depends on inhibition of RTF- B/Cdtl by geminin. Nat C ellB io n , 107-113. Takeda, T., Ogino, K., Matsui, E., Cho, M. K., Kumagai, H., Miyake, T., Arai, K. and Masai, H. (1999). A fission yeast gene, himl^/dfpl^, encoding a regulatory subunit for Hskl kinase, plays essential roles in S-phase initiation as well as in S- phase checkpoint control and recovery from DNA damage. Mol Cell Biol 19, 5535- 5547. Tanaka, T., Knapp, D. and Nasmyth, K.(1997). Loading of an Mem protein onto DNA replication origins is regulated by Cdc6p and CDKs. Cell 90, 649-660. Tanaka, T. and Nasmyth, K.(1998). Association of RPA with chromosomal replication origins requires an Mem protein, and is regulated by Rad53, and cyclin- and Dbf4-dependent kinases. EMBO 717, 5182-5191. Tercero, J. A., Labih, K. and Diffley, J. (2000).F. DNA synthesis at individual replication forks requires the essential initiation factor Cdc45p. EMBO J 19, 2082- 2093. Thommes, P., Kubota, Y., Takisawa, H. and Blow, J. J. (1997).The RLF-M component of the replication licensing system forms complexes containing all six MCM/Pl polypeptides.EMBO J 16, 3312-3319. Todorov, I. T., Pepperkok, R., Philipova, R. N., Kearsey, S. E., Ansorge, W. and Werner, D. (1994). A human nuclear protein with sequence homology to a family of early S phase proteins is required for entry into S phase and for cell division.J Cell Sci 107, 253-265. Tugal, T., Zou-Yang, X. H., Gavin, K., Pappin, D., Canas, B., Kobayashi, R., Hunt, T. and Stillman, B. (1998). The orc4p and orc5p subunits of the xenopus and 202 Bibliography human origin recognition complex are related to ore Ip and cdc6p.J Biol Chem 273, 32421-32429. Tyers, M., Tokiwa, G. and Futcher, B. (1993). Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Clnl, Cln2 and other cyclins. EMBO J 12, 1955-1968. Verma, R., Annan, R. S., Huddleton, M. J., Carr, S. A., Reynard, G. and Deshaies, R. J.(1997). Phosphorylation of Siclp by G1 Cdk required for its degradation and entry into S phase. Science 278,455-459. Weinreich, M., Liang, C. and Stillman, B.(1999). The Cdc6p nucleotide-binding motif is required for loading mcm proteins onto chromatin. Proc Natl Acad Sci USA 96, 441-446. Weinreich, M. and Stillman, B. (1999). Cdc7p-Dbf4p kinase binds to chromatin during S phase and is regulated by both AFC and the RAD53 checkpoint pathway. EMBO J IS, 5334-5346. Whittaker, A. J., Royzman, I. and Orr-Weaver, T. L.(2000). Drosophila Double parked: a conserved, essential replication protein that colocalizes with the origin recognition complex and links DNA replication with mitosis and the down-regulation of S phase transcripts.Genes Dev 14, 1765-1776. Williams, R. S., Shohet, R. V. and Stillman, B. (1997). A human protein related to yeast Cdc6p. Proc Natl Acad Sci USA 94, 142-147. Wohlgemuth, J. G., Bulboaca, G. H., Moghadam, M., Caddie, M. S. and Calos, M. P. (1994). Physical mapping of origins of replication in the fission yeast Schizosaccharomyces pombe. MBC 5, 839-849. Wohlschlegel, J. A., Dwyer, B. T., Dhar, S. K., Cvetic, C., Walter, J. C. and Dutta, A. (2000). Inhibition of eukaryotic DNA replication by geminin binding to Cdtl. Science 290, 2309-2312. Wu, J. and Gilbert, D. M.(1995). Rapid DNA preparation for 2D gel analysis of replication intermediates. NAR 23, 3997-3998. Wu, L. and Russell, P. (1997). Nifl, a novel mitotic inhibitor in Schizosaccharomyces pombe. EMBO 16, J. 1342-1350. 203 Bibliography Wuarin, J. and Nurse, P.(1996). Regulating S phase: CDKs, Licensing and proteolysis. Cell 85, 785-787. Yamano, H., Gannon, J. and Hunt, T. (1996).The role of proteolysis in cell-cycle progression in Schizosaccharomyces pombe. EMBO 15, J. 5268-5279. Yamano, H., Tsurumi, C., Gannon, J. and Hunt, T.(1998). The role of the destruction box and its neighbouring lysine residues in cyclin B for anaphase ubiquitin-dependent proteolysis in fission yeast: defining the D-box receptor. EMBO J17,5670-5678. Yamano, H., Kitamura, K., Kominami, K., Lehmann, A., Katayama, S., Hunt, T. and Toda, T. (2000). The spike of S phase cyclin Cig2 expression at the Gl-S border in fission yeast requires both APC and SCF ubiquitin ligases. Mol Cell 6, 1377-1387. Yamashita, M., Hori, Y., Shinomiya, T., Obuse, C., Tsurimoto, T., Yoshikawa, H. and Shirahige, K.(1997). The efficiency and timing of initiation of replication of multiple replicons of Saccharomyces cerevisiae chromosome VI.Genes Cells 2, 655- 665. Yan, H., Merchant, A. M. and Tye, B. K.(1993). Cell cycle-regulated nuclear localization of MCM2 and MCM3, which are required for the initiation of DNA synthesis at chromosomal replication origins in yeast. Genes Dev 7, 2149-2160. You, Z., Komamura, Y. and Ishimi, Y. (1999). Biochemical analysis of the intrinsic Mcm4-Mcm6-Mcm7 DNA helicase activity. Molecular and Cellular Biology 19, 8003-8015. Young, M. R. and Tye, B. K. (1997).Mcm2 and Mcm3 are constitutive nuclear proteins that exhibit distinct isoforms and bind chromatin during specific cell cycle stages of Saccharomyces cerevisiae. Mol Biol Cell 8, 1587-1601. Zachariae, W. and Nasmyth, K.(1999). Whose end is destruction: cell division and the anaphase-promoting complex.Genes Dev 13, 2039-2058. Zeng, Y. and Piwnica-Worms, H. (1999). DNA Damage and Replication checkpoints in fission yeast require nuclear exclusion of the cdc25 phosphatase via 14-3-3 binding. Mol Cell Biol 19, 7410-7419. 204 Bibliography Zhu, J., Carlson, D. L., Dubey, D. D., Sharma, K. and Huberman, J. A. (1994). Comparison of the two major ARS elements of the ura4 replication origin region with other ARS elements in the fission yeast, Schizosaccharomyces pombe. Chromosoma 103, 414-422. Zou, L. and Stillman, B. (1998). Formation of a Preinitiation Complex by S-phase Cyclin CDK-Dependent Loading of Cdc45p onto Chromatin. Science 280, 593-596. Zou, L. and Stillman, B. (2000). Assembly of a complex containing Cdc45p, Replication Protein A, and Mcm2p at replication origins controlled by S-phase Cyclin-Dependent Kinases and Cdc7p-Dbf4p Kinase.Mol Cell Biol 20, 3086-3096. 205