The Texas Medical Center Library DigitalCommons@TMC
The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences
12-2019
Uncovering the ZEB1 Interactome to Identify Novel Regulators of Metastatic Non-small Cell Lung Cancer
Roxsan Manshouri
Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations
Part of the Biology Commons, Cancer Biology Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons
Recommended Citation Manshouri, Roxsan, "Uncovering the ZEB1 Interactome to Identify Novel Regulators of Metastatic Non- small Cell Lung Cancer" (2019). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 976. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/976
This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. Uncovering the ZEB1 Interactome to Identify Novel
Regulators of Metastatic Non-small Cell Lung Cancer
by
Roxsan Manshouri, M.S.
APPROVED:
______Don L. Gibbons, M.D./Ph.D. Advisory Professor
______Lauren A. Byers, M.D.
______Andrew Gladden, Ph.D.
______Michelle C. Barton, Ph.D.
______Pierre McCrea, Ph.D.
APPROVED:
______Dean, The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences
i
Uncovering the ZEB1 Interactome to Identify Novel
Regulators of Metastatic Non-small Cell Lung Cancer
A
DISSERTATION
Presented to the Faculty of
The University of Texas
MD Anderson Cancer Center UTHealth
Graduate School of Biomedical Sciences
in Partial Fulfillment
of the Requirements
for the Degree of
DOCTOR OF PHILOSOPHY
by
Roxsan Manshouri, M.S. Houston, Texas
August 23, 2019
ii
Acknowledgements
I would like to thank my thesis advisor, Dr. Don Gibbons, who has been a wonderful mentor throughout these past six years. He has continuously challenged, encouraged, and amused me. Thank you for taking the chance on me.
Thank you to all my committee members Drs. Michelle Barton, Andrew Gladden, Lauren
Byers, and Pierre McCrea for their constructive feedback and support. I would also like to acknowledge Dr. Amin, who has been instrumental to my education at MD Anderson. His mentorship throughout my formative years was extremely influential to my decision to pursue my studies at GSBS and I will always be grateful.
I’d like to thank the members of the Gibbons’ lab for their support. I would specifically like to thank Dr. Samrut Kundu who patiently trained me and has continued to help me develop this project and Drs. Christin Ungewiss and Jonathon Roybal for answering every foolish question — admittedly there were quite a few. Also, thank you to the entire Gibbon’s laboratory for guiding me scientifically and making every day at work too much fun.
And most importantly, I would like to acknowledge my family and Alex. Thank you to my parents and brother who encouraged me to pursue a PhD. Thank you to my father who has been an attentive study partner and sounding board whenever the situation required. Lastly, thank you Alex who has stabilized me throughout the stressful moments and has provided the laughter to revitalize me after draining work days. Thank you all for being there for me.
iii
Uncovering the ZEB1 Interactome to Identify Novel Regulators of Metastatic Non-small Cell Lung Cancer
Roxsan Manshouri, M.S.
Advisory Professor: Don L. Gibbons, M.D./Ph.D.
Non-small cell lung cancer (NSCLC) is the leading cause of cancer-related death in the United States, due in part to the robust affinity of lung cancer cells to metastasize. Understanding the processes that contribute to metastasis provides promise for the discovery of novel therapeutic targets. Epithelial-to- mesenchymal transition (EMT) is a proposed model for the initiation of metastasis. During EMT cell adhesion and polarity is reduced, allowing epithelial cancer cells to dissociate from the primary tumor and invade distant organs. The transcription factor zinc finger E-box-binding homeobox 1 (ZEB1) has been reported to uniquely correlate with NSCLC disease progression and to confer therapy resistance in multiple tumor types. Additionally, depletion of ZEB1 has been found to reverse therapy resistance, hence uncovering regulators of ZEB1 provides promise for innovative therapeutic strategies that may improve lung cancer patient outcome. Recent publications demonstrate that ZEB1 undergoes post-translational modification, suggesting a method for regulating ZEB1 function; however, the extent to which ZEB1 is modified as well as the purpose of ZEB1 modification has not been fully elucidated. Here, we apply two independent screens- BioID and an Epigenome shRNA dropout screen- to define ZEB1 interactors that regulate post-translational modification and are critical to metastatic NSCLC. These screens revealed an interaction amongst ZEB1 and the histone deacetylase (HDAC)-containing nucleosome and deacetylase remodeling complex (NuRD). Through treatment with class I HDAC inhibitors Trichostatin A, we identified that ZEB1 homodimerizes and determine that acetylation at lysine residue 811 regulates this association. Furthermore, we identify the NuRD complex as a novel ZEB1 co-repressor and the Rab22 GTPase activating protein TBC1D2b as a ZEB1/NuRD complex target. We find that TBC1D2b suppresses E-cadherin internalization, thus hindering cancer cell invasion and metastasis. Ultimately, this project provides a novel regulatory node for ZEB1 function and insight to the role of EMT in endocytosis.
iv
Table of Contents Approvals i Titles ii Acknowledgements iii Thesis Abstract iv Table of Contents v
Chapter 1: Introduction 1 Lung cancer 2 Post-transcriptional regulation of E-cadherin 4 Transcriptional regulation of E-cadherin 5 BioID screening method 7 Transcription factor dimerization 9
Chapter 2: Materials and Methods 11 Cell Culture 12 BioID 12 Epigenome Screen 13 Quantitative Real-Time PCR Analysis 17 Antibodies and Immunofluorescence 17 Proximity Ligation Assay 17 Gel Filtration 18 Immunoprecipitation 18
RNA Interference 18
Luciferase Reporter Assays 19 Chromatin Immunoprecipitation 19 Migration and Invasion Assay 20 Biotin Internalization Assay 21
v
In vivo tumor and metastasis experiments 21
Biotin Internalization Assay 21
3D Culture 22
Lambda Phosphatase incubation 22
Chapter 3: ZEB1/NuRD Complex Suppresses TBC1D2b to Stimulate 23 E-cadherin Internalization to Promote Invasion and Metastasis in Lung Cancer
BioID screen reveals ZEB1 interactome 24 Loss-of-function screen identifies vulnerabilities in NSCLC 27
ZEB1 interacts with the NuRD complex 33 The CHD4-containing NuRD complex is a ZEB1 co-repressor 37
Identifying targets of a ZEB1/NuRD complex 42 TBC1D2b/Rab22 axis mediate E-cadherin endocytosis 51 TBC1D2b hinders NSCLC metastasis 62 Chapter 4: ZEB1 acetylation precludes homodimerization 72 Class I HDAC inhibitors regulate ZEB1 dimerization 73 ZEB1 dimerization is regulated by acetylation 77
Chapter 5: Discussion 86
Chapter 6: Future directions 82
Bibliography 97
Vita 103
vi
CHAPTER 1:
Introduction
1
Lung cancer
Lung cancer is the leading cause of all cancer related death in the United States and worldwide1. The two major types of lung cancer are non-small cell lung cancer
(NSCLC) and small cell lung cancer (SCLC)2. NSCLC constitutes approximately 85% of lung cancers and is comprised of three subtypes: squamous cell carcinoma, large cell carcinoma and the most common histologic type, adenocarcinoma. Poor patient prognosis is primarily due to the affinity of tumors to metastasize leading to advanced disease at the time of diagnosis2. Nearly two-thirds of lung cancer patients are diagnosed with metastatic disease. Despite ongoing research the 5 year survival rate of lung cancer patients has changed little in the last decade due in part to the incomplete understanding of the metastatic process.
To study the biologic processes driving lung cancer progression, several genetically engineered mouse models have been generated3. The somatic activation of the KrasG12D allele (KrasLA1) was found to contribute to the development spontaneous lung adenocarcinoma; however these models lacked metastatic potential4. Introduction of a mutant p53 allele (p53R172H∆G)- commonly found in Li-Fraumeni syndrome patients- to the
KrasLA1 mouse model (denoted as KrasLA1p53R172HDG or KP mouse model) was found to recapitulate features of metastasis-prone lung adenocarcinoma cancer patients. To understand the molecular mechanisms driving metastatic disease our group derived a panel of cell lines from the primary and various metastatic tumor sites of the KP model 4.
These cell lines were subcutaneously injected into syngeneic mice to evaluate the propensity to metastasize. The cell line 393P (derived from primary lung tumor) was defined as a metastasis incompetent cell line, 344SQ (subcutaneous metastasis) was a metastasis prone cell line, and 393LN (lymph node metastasis) was capable of
2
intermediate metastasis- able to produce lung metastases when injected by tail vein or intra-cardiac injection, but not subcutaneously.
Comparison of the transcriptional profiles of these models revealed differential gene expression between metastatic and non-metastatic disease5. The genes associated with tight junction and cell differentiation were down-regulated in the 344SQ tumor compared to the 393P tumor. Based on these characteristics it was determined that the
344SQ mRNA profile was consistent with cells undergoing the biological process known as epithelial-to-mesenchymal transition (EMT). During EMT epithelial cells lose apical- basal polarity and specialized cell contacts to acquire migratory behavior6, 7. EMT is integral to implantation and embryonic gastrulation, but aberrant activation of EMT is the crucial mechanism for the initiation of cancer cell dissemination. EMT enables tumor cells to disassociate from the epithelial cell layer and invade remote locations. Dissecting the molecular mechanisms that regulate EMT has become critical for understanding tumor invasiveness and metastasis.
Epithelial cell-cell contacts are maintained by three structures: tight junctions, adherens junctions, and desmosomes 8. Adherens junctions initiate cell-cell contacts and mediate the maintenance of the contact. Adherens junctions are a complex consisting of the transmembrane protein E-cadherin and intracellular components, β-catenin and α- catenin. The extracellular domain of E-cadherin initiates the intercellular contact through pairing with the trans-domain of E-cadherin on the opposing cell. Meanwhile, the E- cadherin cytoplasmic domain binds to β-catenin, which in turn binds α-catenin, tethering the complex to the actin cytoskeleton. Seminal studies have demonstrated that loss of E- cadherin perturbs the formation of cell-cell contacts and promotes tumor progression toward metastasis 9. Historically, E-cadherin down-regulation in cancer has principally
3
been attributed to two mechanisms (1) dysregulation of adherens complexes maintenance and (2) epigenetic silencing or genomic loss of the E-cadherin locus.
Post-translational Regulation of E-cadherin
E-cadherin is dynamically endocytosed and relies on the recycling pathway for the maintenance of homeostasis; however, these endocytic pathways are often dysregulated in cancers and a shift in the balance can result in lysosomal mediated degradation and increased cell migration. Endocytosis is the process by which cells internalize macromolecules and surface proteins. The process is initiated when endocytic proteins are surrounded by an area of plasma membrane, which buds off inside the cell to form a vesicle containing the ingested cargo 10. Endocytosis occurs by several mechanisms that can be divided into clathrin-dependent and clathrin-independent. In clathrin-dependent endocytosis (CDE), the cytoplasmic domain of the plasma membrane is packaged into clathrin-coated vesicles that are brought into the cell 11. In contrast to CDE, clathrin- independent endocytosis (CIE) comes in many forms, such as macropinocytosis and phagocytosis 12. Cargo can be routed to late endosomes and lysosomes for degradation, slowly recycled to the trans-Golgi network (TGN), or recycled to endosomal carriers that rapidly bring the cargo back to the plasma membrane. Though the majority of studies report clathrin-dependent endocytosis (CDE) for E-cadherin internalization, clathrin- independent endocytosis (CIE) have been implicated 13. Post-transcriptional mechanisms have been shown to promote E-cadherin internalization and cell-cell dissociation 14. For example, upon v-Src expression E-cadherin can be ubiquitinated and shuttled to the lysosome, displacing the normal recycling route 15.
Irrespective of the method of entry, Rab GTPases facilitate the endocytosis of cargos and direct endosomes to a variety of intracellular pathways 16. The general function
4
of Rab GTPases depends on the dynamic GTP/GDP cycling for the assembly of multi- protein machinery. Belonging to the Ras superfamily of small GTPases, Rabs rely on guanine-nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs) to catalyze the exchange and hydrolysis of GTP. Rab proteins interact with specific effectors to both determine the cargo and the direction for vesicle movement. For example, Rab11 is responsible for the sorting of early endosomes for recycling through recruitment of the effector FIP2, which connects vesicles with myosin Vb and promotes endosome movement to the plasma membrane. While several Rabs have been intensively studied, the function and regulation of many are still poorly understood. Recent discoveries have implicated Rabs in several diseases such as the progression of multiple cancers 17, 18. In particular, specific Rabs can promote the membrane trafficking and degradation of cell adhesion molecules, such as E-cadherin, thus encouraging the metastatic transformation of tumor cells.
Transcriptional Regulation of E-cadherin
While germline mutations have been identified, methylation of the E-cadherin promoter is a key event during metastasis. Multiple EMT-associated transcription factors such as TWIST, SNAIL, SLUG, ZEB1 and ZEB2 19-21 mediate repression; however, in lung adenocarcinoma zinc finger E-box binding homeobox 1 (ZEB1, δEF1, zfhx1a) expression is an early and pivotal event in pathogenesis; conferring metastatic properties, treatment resistance, and correlating with poor prognosis22. ZEB1 is a transcriptional repressor characterized by a centrally located homeobox domain and two terminal flanking zinc finger domains, which allow for E-box binding in the promoters of target genes (Fig. 1)23.
When ZEB1 was first identified as a repressor in the early 1990s, it was designated an
EMT-associated transcription factor due to the exclusive expression in mesodermal
5
tissues 24. Zeb1 null mice die perinatally, exhibiting severe T-cell deficiency of the thymus and various skeletal defects 25. These developmental defects were coupled with increased
Figure 1: Diagram depicts protein structure of human ZEB1. The centrally located homeobox domain (581-640) is flanked by two terminal zinc finger domains (240 to 277 and 918 to 971), which allow for E-box binding. Marked are the four post-translational modifications that have previously been described: S585-phosphorylation; K347- sumoylation; K774-sumoylation; K774 or K775-acetylation.
MET, as demonstrated by upregulation of E-cadherin -a central component in adherens junctions. These findings underscored the critical role of ZEB1 in developmental EMT. The function of ZEB1 in adult tissues is essentially still not well defined, though the ability of
ZEB1 to induce an EMT has implicated ZEB1 in the metastatic process.
ZEB1 orchestrates EMT through repression of epithelial genes such as E-cadherin and the microRNA-200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), which is considered a master regulator of the epithelial phenotype5, 26-28. ZEB1 represses transcription of target genes through the epigenetic regulation of promoter chromatin architecture. Densely arranged heterochromatin regions restrict the access of the transcription machinery thereby limiting the expression of the underlying gene. ZEB1 enhances heterochromatinization at target gene promoters by increasing H3K27 deacetylation and tri-methylation29. Class I and II HDAC inhibitors have been shown to have efficacy in restoring ZEB1 target gene expression, but the mechanism behind this association remains incomplete30. ZEB1 can interact with the C-terminal binding protein
(CtBP) corepressors, to aid in the recruitment of the CoREST complex in pancreatic
6
tumors31. However subsequent work has proposed that ZEB1 represses targets via CtBP- independent mechanisms in prostate cancer- suggesting that ZEB1 binding partners may be context specific32. Understanding how ZEB1 functions provides promise for innovative therapeutic strategies to improve lung cancer patient outcome.
Although ZEB1 has a predicted molecular weight of 125 kDa, multiple groups have reported discrepancies in the observed molecular weight (approximately 190-220 kDa) 33-
35. Some evidence attributes this molecular weight difference to post-translational modification. For instance, in human cholangiocarcinoma cell lines the histone acetyltransferases p300 and p/CAF were shown to acetylate ZEB1, resulting in inhibition of ZEB1 function 35 (depicted in Fig. 1). Additionally, in radio-resistant breast cancer it has been shown that ATM phosphorylates and stabilizes ZEB1 which in turn directly interacts with USP7 and enhances its ability to deubiquitylate and stabilize CHK1, thereby promoting homologous recombination-dependent DNA repair and resistance to radiation
36. Yet no group has been able to account for the total discrepancy between the predicted and observed molecular weight of ZEB1. Therefore, to identify ZEB1 interacting partners and thereby better understand its biology and potential post-translational modifications, we applied the biochemical BioID screening method.
BioID screening method
Identification of protein-protein interactions aids in deciphering the regulation and function of complex biological pathways, providing insight into potential targetable mechanisms for manipulation. Protein-protein interactions are classically identified through isolation of protein complexes that interact with a bait by affinity purification and identification by mass spectrometry (AP-MS). A recent publication described proximity- dependent biotin identification (BioID), which is a refinement of AP-MS methodology
7
utilizing the biotin ligase mutant, BirA-R118G (BirA*) 37. The prokaryotic biotin ligase BirA has stringent specificity for its substrate and can biotinylate molecular associations within
10 nm. The R118G mutation renders the enzyme promiscuous, therefore when fused to a bait protein, BirA-R118G will biotinylate proteins proximal to the protein of interest. In contrast to AP-MS, this methodology allows for the elucidation of transient or weak interactions that may be lost during stringent lysis and wash phases. Subsequent to lysis, biotinylated proteins were captured and purified using streptavidin conjugated beads and identified by mass spectrometry analysis. The computational tool ‘significance analysis of interactome’ (SAINT) was then applied to assign confidence scores to protein-protein interactions and derive the probability of a bona fide protein-protein interaction. Application of BioID revealed 77 ZEB1 interactors, of which 14 were previously published in ZEB1
AP-MS screens. Intriguingly, 13 identified members of the NuRD chromatin remodeling complex were identified in the top 20 ranked ZEB1 interactors.
The NuRD complex is one of four major chromatin remodeling complexes, which consists of at least six core subunits 38. The complex is unique from other chromatin remodeling complexes in that it contains two catalytic components: chromodomain helicase DNA-binding proteins (CHD4/Mi-2β and CHD3/Mi-2α), which have ATP- dependent chromatin remodeling activity and act as a scaffold for other members, and histone deacetylases (HDAC1 and HDAC2), which catalyze protein deacetylation. The other non-enzymatic subunits include GATAD2a (also known as p66α) and GATAD2b
(also known as p66β), retinoblastoma-binding proteins (RBBP4 and RBBP7), metastasis- associated gene proteins (MTA1, MTA2, and MTA3), and methyl-CpG binding domain proteins (MBD2 and MBD3). The current understanding of the biochemical and structural features of NuRD components suggests that combinatorial assembly of these factors
8
confers functional specificity of the NuRD complex. For instance, CHD3 and CHD4 are found in mutually exclusive NuRD complexes with non-overlapping functions 39.
Multiple biological functions are regulated through NuRD chromatin modification and post-translational modification of transcription factors. Alterations in NuRD activity have been implicated in a broad range of human diseases, including cancer 40. In particular, the role of the MTA family members in the context of NuRD recruitment and cancer development has emerged in recent years. Evidence has shown that the NuRD complex associates with oncogenic transcription factors via the MTA family to promote transcriptional repression 41. In addition to gene regulation, multiple groups have observed the role of NuRD in post-translational modification of transcription factors 42. For example, the NuRD complex can promote deacetylation of p53 to inhibit p53-dependent growth arrest and apoptosis 43. Here we uncover ZEB1 acetylation contributes to dimerization and propose a model in which the NuRD complex associates with ZEB1 to perform as a co- repressor and deacetylate ZEB1 thus inhibiting dimerization.
Transcription factor dimerization
The dimerization of transcription factors is a common regulatory node governing cell function 44. Heterodimerization affords functional diversity, whereas homodimerization provides unique functions distinct from monomers. Several studies have suggested that transcription factors originally functioned exclusively as monomers 45. Presumably evolutionary constraints resulted in the emergence of DNA-binding domains that bound with less affinity, obligating transcription factors to diversify and function as dimers.
The best studied families that form dimers are bHLH, bZIP, NR, MADS-box, HD-
ZIP and NF-kB families 46. Members of these transcription factor families contain highly conserved DNA-binding domains and less conserved dimerization domain. This is
9
frequently the case for zinc finger-containing transcription factors. Although most zinc fingers appear to contribute to protein-DNA interactions, zinc fingers have also been implicated in protein-protein interactions 47. Nonetheless, within several transcription factor families, monomers can sufficiently function. Often the purpose of dimerization for these transcription factors is to both increase specificity and affinity of binding.
The tumor suppressor transcription factor p53 was the first non-histone targets identified to be acetylated 48. p53 is acetylated at multiple lysine residues residing in the
C-terminal DNA binding regulatory domain, which serves to promote protein stability 49.
Since then there has been an explosion in the identification of acetylated non-histone targets, particularly transcription factors. The functional consequence of protein acetylation is variable, but aberrant modification can cause problems in cell signaling.
Accordingly, characterization of ZEB1 acetylation and dimerization may further reveal functional and pathological relevance to metastatic disease.
10
CHAPTER 2: Materials and Methods
11
Cell Culture
Human lung cancer cell lines H157, H1299 and H358 were obtained from the
National Cancer Institute (NCI-H series) or the Hamon Center for Therapeutic Oncology
Research, University of Texas Southwestern Medical Center (HCC series). Cell lines from the KP mice were derived and maintained as previously described 4. Cell line names depict the mouse number and site of derivation (e.g., 393P was derived from primary lung tumor).
HEK/293 Flp-In T-Rex cells were provided by the Raught laboratory (University of Toronto) and were cultured in DMEM with 0.4% Hygromycin B. All other cell lines were cultured and passaged in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and incubated in 5% CO2 at 37°C. In separate experiments, cells were cultured for 4 hours in the presence of hydroxychloroquine or MG-132.
BioID
Zeb1 was cloned from the pLenti-GIII-CMV-hZEB1-GFP-2A-Puro lentiviral vector
(Applied Biological Materials Inc., LV362466, Accession No. BC112392) using PCR amplification with primers containing AscI and Not1 (N-terminus tag) or Kpn1 and NotI (C- terminus tag) restriction enzyme sites and cloned in to the pcDNA5 FRT/TO Flag-BirAR118G
(pcDNA5 Flag-BirA*). BioID was conducted as previously reported 50.
Primer name Sequence 5' to 3'
Flag-BirA-ZEB1 Asc1 -F tataGGCGCGCCaATGgcggatggccccaggtg Flag-BirA-ZEB1 NotI-R ttaaGCGGCCGCaTCAggcttcatttgtctttt ZEB1-BirA-Flag KpnI -F tataGGTACCgccaccATGgcggatggccccaggtg ZEB1-BirA-Flag NotI-R ttaaGCGGCCGCggtggcttcatttgtctttt
The N-terminus or C-terminus Flag-BirA tag vector control and Zeb1 were transfected into HEK/293 Flp-In along with pOG44 Flp-Recombinase expression vector using Lipofectamine® LTX Reagent with PLUS™ Reagent as per the manufacturer's
12
instructions (Invitrogen, Cat. No. 15338100). Cell lines were cultured until colonies were
~3 mm in diameter at before divided into two pools. These were considered as a biological replicate and were processed independently.
Subsequently, all cell lines were cultured in four different conditions and harvested:
(1) DMEM (2) DMEM + 5 μM MG-132 (3) DMEM + 1 μg/ml Tetracyclin and 50 μM biotin (4) DMEM + 1 μg/ml Tetracyclin, 50 μM biotin, and 5 μM MG-132 Samples were snap-frozen and shipped on dry ice to the Raught laboratory for processing, mass spectrometry, and analysis.
Epigenome Screen
Murine lung cancer cell lines (393P and 344P) were infected at a multiplicity-of- infection (MOI) of 0.3 with a pooled shRNA lentiviral library targeting 235 epigenes (10 independent shRNAs/gene) 51. The GEMM-derived cells were transplanted at 106 cells per mouse ensuring an in vivo representation of 400 cells/barcode. Illumina base calls were processed using CASAVA (v.1.8.2), and resulting reads were processed using our in-house pipeline. Raw FASTQ files are filtered for a 4-bp spacer (CGAA) starting at 18th base allowing for one mismatch, such that only reads amplified using above mentioned
PCRs are used for further processing. We then extract 23–40 bp of the above reads for targeting libraries, and 1–18 bp for non-targeting library. These are further aligned using
Bowtie (2.0.2) to their respective libraries (2.4k mouse Epigenome and 12.5k non- targeting library) (Langmead et al., 2009). Then use SAMtools to count the number of reads aligned to each barcode. Read counts are normalized for the amount of sequencing reads retrieved for each sample, using library size normalization. Redundant shRNA
Activity (RSA) analysis method was employed to assign a p-value to a single gene relative
13
to the experimental effects 52. Fold change distribution was calculated by comparing the
RSA value of the 344SQ to 393P.
Quantitative Real-Time PCR Analysis
Total RNA was extracted using TRIzol® Reagent (Life Technologies) and was isolated according to the manufacturer's instructions. Analysis of mRNA levels was performed on a 7500 Fast Real-Time PCR System (Applied Biosystems) with SYBR®
Green Real-Time PCR, using primers designed using the NIH primer design tool. The ribosomal housekeeping gene L32 was used as an internal control and data was analyzed with the 7500 Software v2.0.5 (Applied Biosystems). Analysis of microRNA levels was performed using the TaqMan miR assays according to the manufacturer's instructions
(Applied Biosystems). All microRNA data are expressed relative to miR-16 performed simultaneously on the same sample. Student’s t-test was performed for statistical significance. For primer sequences see below.
Gene qPCR Primer Sequence KCNK1-F (ms) TTCCAGGGGAAGGCTACAACCA KCNK1-R (ms) CTCGTGGAGTTCACAGAAGGTC TBC1D2-F (ms) CAGGAGAGGATGGAGCATCTGA TBC1D2-R (ms) ACTTGGTCAGCAGGGCTTTCTC MUC1-F (ms) AGTGCCTCTGACGTGAAGTCAC MUC1-R (ms) GGGAGGGAACTGCATCTCATTC PTPN6-F (ms) TTGGCAGGAGAACACTCGTGTC PTPN6-R (ms) TGCTCCCTACTGTTGGTCACAG MACC1-F (ms) TATTACAGCACGGCAAGGGC MACC1-R (ms) TTAGCTGCGTGATGTCCTCC ATG4D-F (ms) GTCTACATCGGCTAGTGGAGCT ATG4D-R (ms) GACTTCTGAGCAACTCTCCACAG IFNGR1-F (ms) CTTGAACCCTGTCGTATGCTGG IFNGR1-R (ms) TTGGTGCAGGAATCAGTCCAGG
14
EPS8L2-F (ms) AGCCAGACAGTGCTAAACCAGC EPS8L2-R (ms) GAGCACTCTCAATGTCTTCCTGC GADD45B-F (ms) GGAGACATTGGGCACAACCGAA GADD45B-R (ms) CTGCTCTCTTCACAGTAACTGGC DNM1-F (ms) GTGGACATGGTTATCTCGGAGC DNM1-R (ms) GGTGGTCACAATTCGCTCCATC FAM188A-F (ms) CTCGGTATCCATGAACAAGCAGC FAM188A-R (ms) GTGAGTTTCGCTGCCAACAATCC GTPBP2-F (ms) GGACTGTGGTTGGAGGAACACT GTPBP2-R (ms) ACCTGCTCGAAGAACACGACAC TERF2IP-F (ms) GAGAACTCCAGATTTGCCTGAAG TERF2IP-R (ms) AATCAGGAGGGCTCTCATCCAC SCAF8-F (ms) AGACCTTCAACAGCGAGTTGTAT SCAF8-R (ms) CTTAATAGCTTTGATGGCTGCCT PLLP-F (ms) GTTTGTCGCTGTCTTCCTCTGG PLLP-R (ms) AGAGAACCGTGGCAGCGACAAA MPC1-F (ms) CTCCAGAGATTATCAGTGGGCG MPC1-R (ms) GAGCTACTTCGTTTGTTACATGGC UBE2Q2-F (ms) CAGGAAGACTCAAAGGCAAGACC UBE2Q2-R (ms) CCTGCCTTGTAGCTCTGTGATC TBC1D2B-F (ms) TGGAACTCTCGGCTCTACGAAG TBC1D2B-R (ms) TTCAACCTGGCAGAGCTTGGCT FAM207A-F (ms) TAGTGCGTTGGTGCAGAGGCTG FAM207A-R (ms) TGTAACCATCGCTCACGGCGAA CHKA-F (ms) TTGGCGATGAGCCTCGGAAAGT CHKA-R (ms) GTGACCTCTCTGCAAGAATGGC TXNIP-F (ms) GTTGCGTAGACTACTGGGTGAAG TXNIP-R (ms) CTCCTTTTTGGCAGACACTGGTG FGFR1OP2-F (ms) TCTCGGCACATCCTTGAAGCAC FGFR1OP2-R (ms) TGCTGCCATCTCGGTGATTTGG KCTD5-F (ms) TGCCAGTGAAGCATGTGTACCG KCTD5-R (ms) GTAAGAGGAGCCAATGCTGACC IPMK-F (ms) CTTCACTCTGACAGCTACGAGAC IPMK-R (ms) GAATACTGGCGGCAATCGCATC 15
STXBP5-F (ms) GCTGGTCATTCAGTTGGTGTGG STXBP5-R (ms) CTGGAGGTAGTCAACCATTGCG MAN1A2-F (ms) CGGTGGGTTTTCTGGTGTCAAG MAN1A2-R (ms) GGTAGAAGGTCATCGCCAGAGA DIAPH3-F (ms) TCAGCATCTCCTGCTCATTCGC DIAPH3-R (ms) GTGAAGTCAGGGTCCGTTCCAT SH3GL1-F (ms) AGTCAGAGGGTCTGTTGGGAGA SH3GL1--R (ms) CGATGTCCAGTGAGTCCTTCAC CAB39L-F (ms) CAGCAAGCCAGAGAACCTGAAAC CAB39L-R (ms) CTCCACGATAGGCTGCGTTTTG CENPO-F (ms) AAGATAGCCGCAGCACACCTAC CENPO-R (ms) CGTGAGGACATCGCAGAAGTCA LEMD2-F (ms) CTCTTCGAGGTTTAAGGCTGCG LEMD2--R (ms) CCACTTTGTCCACTGTAGTCGC HAT1-F(ms) GATGGAGCTACGCTCTTTGCGA HAT1-R(ms) GCCCTGACCTTGAAATGGAGTC C1orf210-F(ms) TCCTCTCCATTCTCATCGCGCT C1orf210-R(ms) AGGCTGGATGTAATTGTCCTCGA msZeb1-F ATGCTCTGAACGCGCAGC msZeb1-R AATCGGCGATCTTTGAGAGCT msCDH1-F CCATCTCAAGCTCGCGGATA msCDH1-R TCCAACGTGGTCACCTGGT msCDH2-F GCCATTGATGCGGATGATC msCDH2-R CCTGTACCGCAGCATTCCAT msVimentin-F TCCAAGCCTGACCTCACTGC msVimentin-R TTCATACTGCTGGCGCACAT msRab22a-F CAGCATTGTCGTTGCCATCGCA msRab22a-R CGCTGGTCTCTACAAAGATGGC hsRab22a-F GCACCAATGTACTATCGAGGGTC hsRab22a-R CATGCTGTCGAAGCTCTTTCACC Immunoblot
Protein estimation was conducted by use of the Pierce™ BCA Protein Assay Kit
(Thermo Scientific, Cat. No. 23227). Samples were separated on SDS polyacrylamide 16
gels and transferred onto a nitrocellulose membrane. The membranes were blocked using
5% nonfat dry milk and incubated in primary antibody overnight at 4oC (see Table 2 for antibody list). Membranes were exposed using ECL (GE Healthcare) per the manufacturer’s instructions.
Antibodies and Immunofluorescence
Cells were fixed with 4% paraformaldehyde, then permeabilized with 0.1% Triton
X-100. The slides were incubated with the primary antibodies overnight at 4 °C. DAPI for the nuclear stain was contained in the mounting solution.
Protein Company Catalog No. ZEB1 Santa Cruz, Cell Signaling H-102, H-102X, 3396 normal mouse IgG Santa Cruz SC-2025 normal rabbit IgG Santa Cruz SC-2027 E-Cadherin B&D 160182 Flag Sigma F1804 MTA1 Cell Signaling 5647 MTA2 Santa Cruz Sc-9447 MTA3 Santa Cruz 81325 HDAC1 Cell Signaling 5356 HDAC2 Cell Signaling 5113 CHD3 Cell Signaling 4241 CHD4 Abcam ab72418 GFP Santa Cruz sc-9996 Rab22 Santa Cruz sc-390726 TBC1D2b Santa Cruz sc-398906 B-actin Sigma A1978
Proximity Ligation Assay
A total of 1 × 105 cells were seeded overnight onto glass coverslips. The next day, cells were fixed, permeabilized, blocked with BSA, and probed with primary antibodies
17
(listed above). Cells were then treated with Duolink In Situ Red Starter Mouse/Rabbit kit
(Sigma) as per manufacturer's instructions. Images were captured by confocal fluorescence microscope (Nikon). Area of PLA signal was quantified in Adobe Photoshop
CC 2017 and graphs represent relative area of PLA signal per nuclear area; standard deviation n=5.
Gel Filtration
Cells were washed twice with cold PBS, scraped, and collected by centrifugation at 1500 g for 5 min. Nuclear proteins were extracted and protein concentration was determined using BCA Pierce protein assay kit (Thermo Scientific). Protein was applied to a Superose 6 size exclusion column (Amersham Biosciences) that had been equilibrated with buffer and calibrated with protein standards. The column was eluted at a flow rate of 0.4 ml/min, collecting 0.5 ml fractions. Fractions were analyzed by immunoblot with various antibodies as indicated.
Immunoprecipitation
Pull-down assays were performed using 500 μg of crude lysate incubated overnight with the primary antibody at 4◦C and gentle agitation. Protein A/G PLUS-Agarose
Immunoprecipitation Reagent (SC-2003) was then introduced for 2 h. Antibody-antigen complexes were washed with phosphate-buffered saline (PBS) and Wash Buffer (50 mM
Tris (pH 7.4), 150 mM NaCl, 0.1% NP-40), eluted with 1 x RIPA buffer at 100 ͦC and separated by SDS-PAGE before Western blot analysis.
RNA Interference
The human CHD4 siRNA SMARTpool was purchased from Dharmacon (L-
009774-00-0005) and used at a final concentration of 25 nM. siRNA transfection was conducted using Lipofectamine RNAiMAX (Thermo Fisher Scientific). TRC Lentiviral 18
pLKO.1 plasmid expressing scrambled control shRNA or murine TBC1D2b shRNA were purchased from Dharmacon (TRCN0000106070, TRCN0000106071, TRCN0000106072,
TRCN0000106073, and TRCN0000106074). 344SQ and 531LN2 cells were virally infected as previously described and stably selected through culturing in RPMI 1640 with
10% FBS and puromycin.
Luciferase Reporter Assays
For 3′UTR reporter assays cells were co-transfected with 5 ng of pRL-TK Renilla plasmid (Promega) and 500 ng miR-200b∼200a∼429 promoter firefly luciferase reporter plasmids using Lipofectamine 2000 (Invitrogen) 27. 24 hours after transfection, cells were doxycycline induced for 24 to express GFP-ZEB1 or GFP vector only. For select experiments cells were first pre-transfected for 24 hours with siRNA followed prior to co- transfection of reporter constructs, then assayed for luciferase activity after an additional
24 hours of doxycycline induction. All reporter assays were performed using the Dual-
Luciferase reporter assay system (Promega, Madison, WI)
Chromatin Immunoprecipitation
Cells (1 × 107) were fixed in 1.1% formaldehyde for 10 min at room temperature followed by quenching with 0.125 M glycine. Nuclei lysed were isolated as previously described, and DNA was sheared by sonication to fragments of ∼300 bp 53. Chromatin was precipitated using the anti-ZEB1 (Santa Cruz) or anti-CHD4 antibody (Abcam). After reversal of cross-links, precipitated DNA was subjected to qPCR analysis using gene- specific primer pairs (see below).
Gene ChIP Primer Sequence miR‐200c,141- F AGGGCTCACCAGGAAGTGT miR‐200c,142- R AGATCCCTGGCTCCCATC TBC1D2-F(hs) #1 GAGACTGCGGAGGGACGAG 19
TBC1D2-R(hs) #1 CCCAGGTGTCTCCCTTTGGG TBC1D2-F(hs) #2 GGCAGCTTCCCAAAGGGAGA TBC1D2-R(hs) #2 CGCCGTAACCTGGGTTTGC TBC1D2-F(hs) #3 GAGACTGCGGAGGGACGAG TBC1D2-R(hs) #3 CCCAGGTGTCTCCCTTTGGG KCNK1-F(hs) #1 ACCTGCTGGTTCCCGTAACA KCNK1-R(hs) #1 GTGAGGCCAAGAGAGGTGCT KCNK1-F(hs) #2 TCCTGGTGCTGGGCTACTTG KCNK1-R(hs) #2 GCACTCGTGCTCCTCCAAGA KCNK1-F(hs) #3 GAGCACGAGTGCCTGTCTGA KCNK1-R(hs) #3 GTTGCTGAGCACCGACACG EPS8L2-F(hs) #1 GACGGAGGCTCCCAAGAAGG EPS8L2-R(hs) #1 ACTCACGGCAGCACATGGA EPS8L2-F(hs) #2 TAAGGGAAGTGACTCTGCCC EPS8L2-R(hs) #2 AGGCCTCGAGCTCTTCCTT EPS8L2-F(hs) #3 GGGGCTGCCACAAAGAAAA EPS8L2-R(hs) #3 ACATACCTGCCCCAGGTGA SEMA3F-pr ChIP- hs F GGCGTATGGATGTGTGGATGA SEMA3F-pr ChIP- hs R TATGAGAGCACCCACCCAGAAC SEMA3F-neg ChIP- hs F CCCTACAGTTCCAGCAGCCC SEMA3F-neg ChIP- hs R CCACCAACCCAGACCCTGAT DNM1-F(hs) ChIP AGACCCAACCCATTGACAAA DNM1-R(hs) ChIP GGCATCATGGGTGTCGTAGT PTPN6-F(hs) ChIP TCCATTTACCTCCGCTGAAC PTPN6-R(hs) ChIP GATTCTCACCCTTTGCTTGC TXNIP-F(hs) ChIP CAGCCCCAAACCTGAAAGTA TXNIP-R(hs) ChIP AGAGCCTGTCGTTATTCCTG PTPN6-F(hs) ChIP #2 GCTTGGGGTATGAAGGTTTG PTPN6-R(hs) ChIP #2 CAGCGGAGGTAAATGGAAAA TBC1D2b-F(hs) ChIP #1 GGGTCAGTTGCCTTCGTG TBC1D2b-R(hs) ChIP #1 GAAATAGACCATTGCTTCATCC TBC1D2b-F(hs) ChIP #2 GCCCTGGTAGCTGAAGCA TBC1D2b-R(hs) ChIP #2 CGCCGCTGCTACCTTTACT
20
Migration and Invasion Assay
Cells were resuspended in serum-free media and seeded in a 24-well Transwell or Matrigel plate (BD Biosciences) at a concentration of 5 x 104 per well. RPMI supplemented with 10% FBS was added to the lower chamber and cells were allowed to migrate for 16 h in 5% CO2 at 37°C. Migrating cells were stained with 0.1% crystal violet.
Non-migrating cells were removed using a cotton swab. Migrated cells were quantified based on five microscopic fields at a 4X magnification and results were represented as mean ± standard deviation and student’s t-test was performed for statistical significance.
Each assay was performed in triplicate.
Biotin Internalization Assay
Following doxycycline induction for 4 hours, cells were washed with PBS containing 10mM CaCl2 and 1mM MgCl2 and incubated with 0.5 mg/ml EZ-Link NHS-SS
Biotin (Pierce) for 30 min on ice, followed by washing with quenching reagent (15mM glycine in PBS-Ca2+-Mg2+). Old media was added and cells were incubated at 37°C for various time points to allow endocytosis. Biotinylated proteins at the plasma membrane were then stripped at 0°C by glutathione treatment twice for 15min (60mM glutathione,
75mM NaCl, 10mM EDTA, 75mM NaOH and 1% BSA). Cells were lysed (1% Triton X-
100, 150mM NaCl, 50mM Hepes pH 7.6 with protease inhibitors as above) and an aliquot was separated to measure total amount of E-cadherin. Biotinylated proteins (internalized) were recovered from lysates by immunoprecipitation with streptavidin beads. The amount of internalized and total E-cadherin was quantified by Western blots.
In vivo tumor and metastasis experiments
All animal experiments were reviewed and approved by the Institutional Animal
Care and Use Committee at The University of Texas M.D. Anderson Cancer Center. Cells
21
were subcutaneously injected in the flanks of syngeneic 129/Sv mice of 8–10 weeks age and observed for tumor growth for a period of 5 weeks. Upon euthanasia, metastatic nodules on the surface of lung lobes were counted manually. Lung tissue was fixed in
10% formalin and then processed for sectioning followed by haematoxylin and eosin staining.
3D Culture
Cells were grown in 8-well chamber slides coated with Matrigel (BD 356231) or
Matrigel/Collagen (BD 354249, 1.75 mg/ml type I Collagen concentration), as previously described 5. The media (RPMI with 10 % FBS and 2 % Matrigel) was replaced daily and supplemented with doxycycline. The morphology of the structures was monitored every 2 days by light microscope.
Lambda Phosphatase incubation
Cells were lysed with 1 x NEBuffer for PMP supplemented with 1 mM MnCl2 or with 1 X RIPA Buffer (Cell Signaling 9806). Lysates harvested in the PMP buffer (30 μg) was treated with 400 units of lambda-phosphatase/20 μL for 30 min. at 37 ͦ C. Samples were immediately separated on an SDS polyacrylamide gel and transferred onto a nitrocellulose membrane.
22
CHAPTER 3:
ZEB1/NuRD Complex Suppresses
TBC1D2b to Stimulate E-cadherin
Internalization to Promote Invasion and
Metastasis in Lung Cancer
23
BioID screen reveals ZEB1 interactome
Previous studies have applied affinity purification-mass spectrometry (AP-MS) analysis to identify proteins in stable association with ZEB1 33, 54; however, a high- confidence ZEB1 protein interactome has yet to be established. To elucidate ZEB1 transcriptional co-regulators we applied the BioID screening method to identify ZEB1 interacting partners 37, 55. This technique harnesses an abortive E. coli biotin ligase (BirA-
R118, denoted BirA*) fused to a protein of interest. BirA* can generate biotinoyl-AMP, but has lost the ability to interact with this intermediate. Highly reactive biotinoyl-AMP is thus released into the vicinity of the bait protein, and reacts with amine groups on nearby polypeptides. Biotinylated proteins can then be isolated with streptavidin and identified using mass spectrometry. In contrast to traditional AP-MS, this methodology allows for the elucidation of interactions that may be lost during stringent lysis and washing (Fig. 2A).
A FlagBirA* tag was fused in-frame to either the N- or C-terminus of human ZEB1 and stably integrated into HEK293 Flp-In cells, under the control of a tetracycline-inducible promoter. Two isogenic pools were generated for each bait protein, representing biological replicates. We performed RT-qPCR and immunoblot to validate ZEB1 upregulation and to determine the effect on the expression of the known ZEB1 target gene, E-cadherin. Upon tetracycline induction, exogenous expression of ZEB1 consistently produced E-cadherin repression by both mRNA and protein expression (Fig. 2B and 1C). To additionally assess the functionality of the FlagBirA*-tagged human ZEB1 proteins, we expressed the constructs in the murine 393P cell line (Fig. 3A). Both tagged ZEB1 constructs significantly upregulated the migratory and invasive potential of the 393P cell line, confirming that the
FlagBirA* tag did not hinder the biologic function of ZEB1 (Fig. 3B). The expression of
FlagBirA* protein alone (denoted as “-“) had no effect on E-cadherin expression levels or
24
Figure 2: (A) Human Zeb1 was cloned into the pcDNA5-FlagBirA*-FRT/TO vector. Fusion of an E coli abortive biotin ligase mutant (BirA*) to ZEB1 allows for biotinylation of ZEB1 proximal proteins. Biotinylated proteins are captured by streptavidin conjugated sepharose beads and identified by mass spectrometry to define the ZEB1 interactome. Constructs retained biological activity as assessed by repression of the established ZEB1 target, E-cadherin (cdh1) by (B) transcription and (C) protein expression.
A. Streptavidin ATP Biotin
BirA* Flag
Stable interactor
Transient interactor B.
C. FlagBirA*-ZEB1 ZEB1- FlagBirA* ZEB1: - - + + - - + + - - + + - - + + Pool: A B A B A B A B A B A B A B A B Tet.: - - - - + + + + - - - - + + + + ZEB1
E-cad
Flag
β-actin 25
Figure 3: (A) 393P cells were pre-transfected with siRNA control or siRNA targeting murine ZEB1 (denoted mZEB1), prior to transfection with FlagBirA*, FlagBirA*-hZEB1 (human ZEB1) or hZEB1-FlagBirA*. Relative mRNA confirms mZEB1 knockdown and hZEB1 overexpression. (B) Transwell assays was conducted to determine whether fusion constructs can functionally replace endogenous ZEB1.
A. hZEB1
* 1000 * 800 600 2.0 1.5 1.0 0.5 0.0
Relative mRNA expressionRelative mRNA scramble siZEB1 E-cadherin
1.5 * *
1.0
0.5
0.0 scramble siZEB1
B. 8 * FlagBirA* * 6 FlagBirA*-ZEB1 ZEB1-FlagBirA* 4
2 Percent Invasion Percent Percent Migration 0 siCTL siZEB1
26
invasive potential in these assays.
Following validation of the biological activity of the N- and C-terminal tagged ZEB1 proteins, cell pools were incubated with tetracycline, biotin and the proteasome inhibitor
MG-132. Biotinylated proteins were isolated with streptavidin-sepharose beads, washed, and subjected to trypsin proteolysis. The released peptides were identified using nanoflow liquid chromatography–electrospray ionization–tandem mass spectrometry (nLC–ESI–
MS/MS). Using cells expressing the FlagBirA* tag alone for comparison, the computational tool Significance Analysis of INTeractome56 was used to assign confidence scores to individual protein-protein interactions with ZEB1. Proteins confidently identified with a Max
SAINT score > 0.8, identified with > 2 unique spectra in both analyses, and with at least
2.5-fold greater peptide counts in the FlagBirA*-ZEB1 samples than in FlagBirA* samples, yielded a high-confidence list of 68 ZEB1 interacting proteins (Table 1). Notably, BioID identified a novel association between ZEB1 and several HDAC1 and HDAC2 containing co-repressor complexes: Sin3, CoREST, and the NuRD complex. In fact, all core members of the NuRD complex were identified as the top-ranking hits in the BioID screen.
Several members of the NuRD complex were previously identified as ZEB1 interactors
(Fig. 4).
Loss-of-function screen identifies vulnerabilities in NSCLC
To ascertain the significance of these ZEB1 interactors as therapeutic targets in metastatic NSCLC we utilized a previously published in vivo shRNA drop out screen methodology specifically concentrated on epigenetic regulators51. ZEB1-mediated epigenetic dysregulation is documented in metastatic NSCLC and a variety of cancer types, implying a causal role in disease pathogenesis. To differentiate epigenetic vulnerabilities between metastatic and non-metastatic NSCLC, we enlisted two murine cell
27
Table 1: High confidence FlagBirA*-ZEB1 interactors. MS data were analyzed as described in the text. Proteins identified with a max SAINT score > 0.8, proteins identified with > 2 unique peptides and with spectral counts at least 2.5-fold higher in FlagBirA*-ZEB1 samples are shown. NuRD complex members are highlighted in blue.
28
Figure 4: Venn diagram depicts comparison of BioID interactors to other AP/MS studies, Zhang et al. 2013 and Gubelman et al. Overlap of the high-confidence BioID ZEB1 interactors identified all known members of the nucleosome remodeling and deacetylase (NuRD; also known as Mi-2) complex as bona fide ZEB1 interacting partners.
C15orf44 CTBP1 INTS10
AP-MS (Zhang 2013) BioID
3 37 50 CTBP2 3 ZNF516 1 7 SSRP1
CHD4 77 MTA2 HDAC1/2 LRRC59 AP-MS GATAD2A/B (Gubelmann 2014) RBBP4
29
line models derived from the genetically engineered KrasLA1/+;p53R172H∆G/+ (KP) mice4, 5.
We have previously described the KP model to faithfully recapitulate features of metastatic lung cancer patients. Aimed at understanding the drivers of metastatic disease our group derived a panel of lung adenocarcinoma cell lines from the KP model. Subcutaneous injection of the KP cell lines into syngeneic mice established the cell line 393P to be an epithelial and non-metastatic phenotype, while the cell line 344P is mesenchymal and has metastatic ability 4.
A barcoded shRNA library, previously published by Carugo et. al., targeting 235 unique epigenetic regulators was infected into 393P and 344P cells 51. Target regulators included subunits of various complexes that remodel nucleosomes, catalyze post- translational modifications, deposit histone variants and methylate DNA. To enhance the robustness of the screen and facilitate hit prioritization, the library was designed with ten unique shRNAs targeting each gene. To ensure adequate representation of the complexity of the deep-coverage shRNA library in mouse samples, mice were implanted with 400 cells/shRNA. Tumors were harvested at 150-200 mm3 and barcode abundance was quantified by sequencing (In Vivo). The cell lines grown in vitro (In Vitro) were also sequenced to potentially delineate genes that contribute to in vivo survival (Fig. 5). To detect the top “hits” (or top scoring genes) emerging from the screens, we assigned p- values from RSA (Redundant shRNA Activity) scores. Comparison of the RSA values of
344P (mesenchymal) and 393P (epithelial) allowed for the identification of genes which are essential for growth of the mesenchymal metastatic model vs the epithelial and non- metastatic model. The top 15% of most differentially regulated genes were compared to the BioID screen and yielded five genes: CHD3, CHD4, CHD5, CHD8, and MTA3. One of the most robust hits to emerge by both in vitro and in vivo screening was CHD4, which
30
Figure 5: Depiction of the Epigenome short hairpin RNA (shRNA) dropout screen. Briefly, (1) an shRNA library consisting of 235 unique mouse or human epigenetic regulators was infected in to the murine Kras/p53 lung cancer cell lines, 393P and 344P. (2) Syngeneic 129/Sv mice were implanted with 400 cells/shRNA and monitored for four weeks; (3) Tumors (denoted “In Vivo”) and cell lines (denoted “In Vitro”) were sequenced to determine the barcoded shRNAs abundance.
31
Figure 6: Differential analysis of 344P and 393P RSA score reveals hits with the most significant rank change. Graphs represents top fifteenth percentile in in vitro and in vivo analysis. Cross analysis with BioID indicates that knockdown of the NuRD complex members CHD4 and CHD3 significantly impaired in vitro and tumor growth in 344P but had little effect on 393P.
32
was also the most significant interactor in the BioID screen, suggesting the NuRD complex is central to the biology of mesenchymal NSCLC (Fig. 6).
ZEB1 interacts with the NuRD complex
To validate the ZEB1-NuRD interaction we employed co-immunoprecipitation (co-
IP) in the HEK293 Flp-In cells originally utilized to conduct the BioID screen. Upon
FlagBirA*-ZEB1 immunoprecipitation we were able to co-IP HDAC1 and through immunoprecipitation of MTA1 we observed co-IP of ZEB1 (Fig. 7A-7C). Furthermore, using exogenously expressed GFP-conjugated ZEB1 in the 344SQ murine cell line, we were also able to detect an interaction between ZEB1 and the NuRD complex members
HDAC1 and MTA1 by co-IP (Fig. 7B). We next explored the endogenous interaction of
ZEB1 with each member of the NuRD complex through the application of the proximity ligation assay (PLA). The PLA technique employs oligonucleotide labeled species-specific secondary antibodies, which when within close proximity (30-40 nm) allow the oligonucleotides to be ligated for amplification of the resulting circular DNA. The amplified signal may then be visualized by the use of fluorescently-labeled oligonucleotides and fluorescence microscopy. Addition of the ZEB1 or HDAC1 specific antibodies alone yielded only background levels of fluorescence in H157 cells. However, focal nuclear fluorescence signals were detected when cells were probed with both the ZEB1 and
HDAC1 antibodies (Fig. 8). Similar results were observed for HDAC2, CHD4, MTA1,
MTA2, and MTA3 in the human and murine NSCLC cell lines H157 (Fig. 9A), H1299 (Fig.
9B), 344SQ (Fig. 9C), and 531LN2 (Fig. 9D), providing additional evidence that ZEB1 interacts with the NuRD complex. Considering that the MTA family of proteins form mutually exclusive NuRD complexes, frequently with non-overlapping function 41, we found it interesting that PLA detected an interaction with all MTA members. Given that the
CHD 33
34
35
36
proteins also form exclusive complexes, we noted that ZEB1 preferentially forms a complex with CHD4/NuRD in NSCLC cell lines.
To further substantiate the observation that ZEB1 interacts with the NuRD complex, human H157 and murine 344SQ lung cancer cell lines were utilized to conduct gel chromatography. We determined the apparent molecular weight of ZEB1 by applying nuclear lysates to a Superose column. The eluate was collected in 60 sequential fractions of equal volume and analyzed by SDS-PAGE, followed by immunoblotting for ZEB1.
Native ZEB1 from both H157 (Fig. 10A) and 344SQ (Fig. 10B) cells eluted with an apparent molecular mass much greater than that of the predicted mass (125 kDa). ZEB1 immunoreactivity was detected in chromatographic fractions from the Superose column in one distinct peak greater than 669 kDa. Significantly, the elution pattern of ZEB1 overlapped with that of the NuRD complex proteins HDAC1 and CHD4, further supporting the finding that ZEB1 interacts with the NuRD complex.
The CHD4-containing NuRD complex is a ZEB1 co-repressor
Previously, ZEB1 was found to recruit class I and II HDACs in pituitary organogenesis through the formation of a complex containing CtBP and the CoREST corepressors 57. However, our discovery implicated the NuRD complex in ZEB1-mediated repression. In order to explore the significance of the physical association between ZEB1 and the NuRD complex, we analyzed established transcriptional targets of ZEB1 by chromatin IP (ChIP). Since the chromodomain helicase DNA binding proteins CHD3 and
CHD4 participate in distinct forms of the NuRD complex and given our observation that
ZEB1 interacts predominantly with CHD4 in NSCLC, we designated CHD4 as a surrogate for the NuRD complex. In these experiments, ChIP was performed in H1299 cells with antibodies against ZEB1, CHD4, and H3K27ac. This modification was selected following
37
previous studies, which suggested the CHD4/NuRD complex specifically demethylates
H3K27 to recruit the Polycomb Repressive Complex 2 (PRC2) 58. We additionally depleted
CHD4 to understand the significance of the NuRD complex to the regulation of the promoter activity of established ZEB1 genes. We selected miR-200c and SEMA3F as established ZEB1 target genes and included the CHD4/NuRD regulated gene, N-Myc, and
SEMA3F intron 13 to be a negative control for ZEB1 binding 29, 30, 59. Upon depletion of
CHD4 we observed reduced CHD4 binding at all of the loci queried (Fig. 11A-11B). We detected ZEB1 and CHD4 at the promoter of miR-200c and SEMA3F, but ZEB1 did not localize to the N-Myc promoter or SEMA3F intron 13 (Fig. 11C). We observed that ZEB1 binding to both the miR-200c and SEMA3F promoters was increased upon knockdown of
CHD4. Yet, despite this increase in ZEB1 binding we observed an increase of H3K27ac at each of the CHD4 co-localized regions, suggesting that ZEB1 was not capable of repressing these genes in the absence of CHD4/NuRD recruitment (Fig. 11D).
To determine whether ZEB1 can orchestrate CHD4/NuRD recruitment we expressed a doxycycline inducible GFP-ZEB1 in the human NSCLC cell line H358 (H358-
GFP-ZEB1). Upon ZEB1 expression we observed a phenotypic EMT, which was confirmed by down-regulation of E-cadherin (Fig. 12A). We subsequently performed ChIP for CHD4 and ZEB1. Consistent with the BioID and phenotypic data, we detected co- binding of ZEB1 and CHD4 at the miR-200c-141 and SEMA3F promoters only in the ZEB1 overexpressing cells, suggesting that ZEB1 enhances CHD4-NuRD binding at these sites
(Fig. 12B and 12C). By contrast we found CHD4 binding at the N-Myc promoter was not influenced by ZEB1 overexpression and we did not find ZEB1 binding to the SEMA3F intronic region under either circumstance.
We also utilized the H358-GFP-ZEB1 cell line to ascertain the significance of
CHD4 in the ZEB1-dependent repression of the miR-200a-b-429 cluster. We performed a 38
39
40
41
luciferase reporter assay, using the luciferase coding region cloned downstream of the miR-200a-b-429 promoter 60 and transfected into the H358_GFP or H358_GFP-ZEB1 cells prior to doxycycline induction for 24h (Fig. 13A). As expected, induction of ZEB1 expression decreased the luciferase reporter activity as compared to the GFP control
(Fig. 13B). To determine whether ZEB1 was capable of repressing the miR-200a-b-429 promoter expression in the absence of CHD4, we transiently knocked down CHD4 prior to expression of ZEB1. In the ZEB1 expressing cells we observed a rescue of the luciferase activity upon CHD4 knockdown, suggesting that ZEB1 regulates miR-200 expression through a CHD4/NuRD complex. Consistent with these results, the endogenous gene expression of miR-200b and miR141 was similarly restored upon
CHD4 depletion (Fig. 13C).
Identifying targets of a ZEB1/NuRD complex
We postulated that defining ZEB1/NuRD target genes may uncover regulatory pathways contributing to NSCLC invasion and metastasis. To delineate direct transcriptional effectors of this complex we utilized the ZEB1 and CHD4 ChIP-seq data provided by the ENCODE project (Encyclopedia of DNA Elements)61 (Fig. 14).
Overlapping DNA sequences/gene promoters were considered potential targets of a
ZEB1/CHD4/NuRD complex, and identified a total of 7231 different genomic locations. We further filtered this list by analysis of several mRNA datasets to identify targets that are inversely correlated with ZEB1 expression. Datasets included comparison of ZEB1 overexpression in the 393P murine cells, miR-200 overexpression in murine 344SQ cells,
ZEB1 knockdown in human MDA-MB-231 breast cancer cells, and ZEB1 overexpression in 3T3-L1 pre-adipocytes 5, 54, 62. 93 candidates were repressed by at least 50% upon ZEB1 overexpression in the 393P cell line and were significantly changed in any other one dataset. Our last criterion was the location of the binding site in relation to the distance 42
43
44
45
from the transcription start site, as ZEB1 has been reported to preferentially bind gene proximal regions (-/+ 250 bp from the TSS) 63. This yielded 37 genes, which we sought to further validate (Table 2). We determined the capacity of ZEB1 to repress candidate targets by comparing the mRNA expression of each gene upon constitutive ZEB1 overexpression in the 393P cell line (pcDNA_ZEB1; Fig. 15A and 15B) or inducible expression of miR-200a-b-429 in the 344SQ cell line, which should rescue the target gene expression (Fig. 16A and 16B). The potential target genes were stratified by fold change.
Genes that were repressed by 50% or more upon ZEB1 overexpression or increased by
2-fold upon ZEB1 suppression were considered candidate ZEB1/CHD4/NuRD target genes. This yielded five genes: KCNK1, TBC1D2a, EPS8L2, DNM1, and TBC1D2b.
Additional analysis of the upstream promoter sequence of the candidate target genes also revealed at least one E-box, in particular ‘CACCTG’, a previously described ZEB1 binding motif 64.
We verified whether ZEB1 and CHD4 bind to the candidate target gene promoters by employing ChIP in H1299 cells (Fig. 17). Compared to the non-specific control (IgG),
ZEB1 and CHD4 co-occupied the promoters of KCNK1, EPS8L2, TBC1D2a and
TBC1D2b, four of the five genes queried. To validate ZEB1 and CHD4 binding to the target promoters, CHD4 was depleted by siRNA prior to ChIP with antibodies against ZEB1,
CHD4, and H3K27ac. CHD4/NuRD depletion resulted in marked reduction of the recruitment of CHD4 to the promoter of EPS8L2, TBC1D2a, and TBC1D2b, but not
KCNK1, suggesting non-specific binding to the KCNK1 promoter (Fig. 18A). No observable trend in ZEB1 binding was perceived upon CHD4 knockdown (Fig. 18B), however H3K27 acetylation increased at the TBC1D2a, TBC1D2b, and EPS8L2 promoters, signifying these were indeed targets of a CHD4/NuRD complex (Fig. 18C). To
46
47
48
49
50
delineate whether ZEB1 could enhance CHD4 binding to these two target promoters we again utilized the H358-GFP-ZEB1 cell line. Inducible ZEB1 expression produced a significant recruitment of CHD4 to the TBC1D2a, TBC1D2b and EPS8L2 promoters compared to vector control cells (Fig. 19A and 19B).
TBC1D2b/Rab22 axis mediate E-cadherin endocytosis
Preliminary experiments transiently overexpressing each of the three hits yielded from the analysis of the ENCODE ChIP-seq data (Fig. 20A and 20B) suggested that all three genes significantly affect in vitro migration and invasive potential of murine NSCLC
(Fig. 20C); however, TBC1D2b posed an intriguing candidate. Previous work has revealed
TBC1D2b as a GTPase activating protein (GAP) for Rab22 family members (Rab22 and
Rab31) 65. Both Rabs are described in sorting recycling endosomes; however, Rab22 was recently identified in the membrane trafficking of clathrin-independent endosomes.
Additionally, Rab22 has previously shown to be required for lung cancer cell migration and invasion 66. To study the role of TBC1D2b in lung cancer metastasis we inducibly expressed TBC1D2b or GFP in the murine and human cell lines 344SQ, 531LN2 and
H1299. These cell lines exhibited a robust upregulation of TBC1D2b mRNA (Fig. 21A) and protein expression (Fig. 21B) upon doxycycline induction. This observation was further confirmed by immunofluorescent staining, which revealed TBC1D2b localization to the cytoplasm (Fig. 21C). We also observed a physical association between TBC1D2b and Rab22 by co-IP, but could not detect an interaction with Rab31 (Fig. 22). We next investigated the functional role of TBC1D2b in tumor cell migration and invasion.
Overexpression significantly reduced Transwell migration and invasion, as well as migration in a wound closure assay (Fig. 23A and Fig. 23B). Conversely, stable TBC1D2b knockdown increased both Transwell migration and invasion (Fig. 24A and 24B). To determine whether this phenotype was due to the TBC1D2b/Rab22 association we 51
52
53
54
55
56
57
58
expressed a GFP-conjugated human Rab22 in 393P, H358 and H1299. Again, upon doxycycline induction we witnessed upregulation of Rab22 mRNA and protein expression
(Fig. 25A and Fig. 25B). Rab22 overexpression significantly upregulated Transwell migration and invasion (Fig. 25C), a phenotype previously observed by other groups 63.
To determine if TBC1D2b could avert this invasive phenotype we performed a rescue experiment in which TBC1D2b was transiently overexpressed in GFP-Rab22-expressing cells. After 24h of TBC1D2b expression doxycycline was utilized to induce expression of
Rab22 for 12 h. Subsequently, cells were harvested to confirm expression (Fig. 26A) and to perform Transwell migration and invasion assays. The cell line 393P has limited ability to migrate and thus we observed no significant difference upon TBC1D2b overexpression in the GFP control cells in either assay. However, in the Rab22 overexpressing cell line,
TBC1D2b expression suppressed the migratory and invasive phenotype despite an increase in Rab22 transcriptional levels, suggesting that TBC1D2b hinders invasion through the regulation of Rab22 protein activity (Fig. 26B).
Interested in the significance of TBC1D2b expression in the context of EMT and metastasis, we also examined E-cadherin levels. Although there was no significant effect on E-cadherin transcription upon TBC1D2b manipulation until 24h of induction (Fig. 27A and 27B), an increase in E-cadherin protein levels was observed within 4h of TBC1D2b expression (Fig. 27C). Additionally, a faster migrating form of E-cadherin (97 kDa compared to the commonly observed 120 kDa) was detected by immunoblot upon
TBC1D2b expression. E-cadherin dephosphorylation is a precursor to internalization 14, and the accumulation of a lower molecular weight E-cadherin suggested that E-cadherin was no longer endocytosed. Treatment of 344SQ-TBC1D2b lysate with lambda phosphatase produced a molecular weight shift comparable to 97 kDa (Fig. 27D), advocating that TBC1D2b promotes the dephosphorylated E-cadherin. Upon induction of 59
60
61
Rab22 overexpression in 393P we also observed degradation productions of E-cadherin at approximately 35 kDa, suggesting that Rab22 promoted E-cadherin degradation (Fig.
28A). We found that treatment with the lysosomal inhibitor hydroxychloroquine (HCQ) was able to prevent E-cadherin degradation, while a proteosomal inhibitor (MG-132) did not, signifying that Rab22 promotes E-cadherin lysosomal degradation (Fig. 28B). To determine if TBC1D2b plays a significant role in the regulation of E-cadherin degradation we co-expressed GFP-E-cadherin67 and RFP-LAMP1 in the 344SQ_TBC1D2b knockdown cell lines to determine the fate of E-cadherin by live cell imaging. We observed the GFP-E-cadherin localized to the cell periphery in wildtype control cells, while in the
TBC1D2b knockdown cells we observed co-localization of the GFP and RFP signals, suggesting that the absence of TBC1D2b directs E-cadherin to the lysosomal compartment for degradation (Fig. 28C). To determine whether TBC1D2b was regulating surface E-cadherin uptake we performed a biotin internalization assay (Fig. 29A and 29B).
TBC1D2b was expressed for 6 hours prior to labeling surface proteins with cleavable biotin. Cells were then incubated at 37°C for up to 1h to allow protein internalization and surface biotin was cleaved to determine the relative amount of E-cadherin that was endocytosed. Compared with control cells, a reduced amount of biotinylated E-cadherin localized to the cytoplasm of TBC1D2b overexpressing 344SQ and 531LN2 murine lung cancer cells, suggesting that TBC1D2b regulates E-cadherin endocytic processing. Of note, the total amount of E-cadherin remained unchanged in both TBC1D2b and GFP control cell lines. Conversely, Rab22 overexpression significantly contributed to the uptake of E-cadherin in the cell line 393P over 24h (Fig. 30).
TBC1D2b hinders NSCLC metastasis
To determine the potency of TBC1D2b in metastasis in vivo, we implanted syngeneic mice subcutaneously with the TBC1D2b overexpressing or control 344SQ cells. 62
63
64
65
66
Despite no difference in primary tumor growth, we observed a ~6-fold decrease in the number of distant lung metastatic nodules after 5 weeks (Fig. 31A and 31B). This was confirmed by haematoxylin and eosin staining of lung sections (Fig. 31C). Further analysis of TBC1D2b overexpressing tumors also confirmed an increase in TBC1D2b expression, which corresponded with an increase in E-cadherin mRNA and protein (Fig. 32A and 32B).
Conversely, we observed no significant difference in primary tumor size when comparing the growth of 344SQ tumors with constitutive TBC1D2b knockdown to the non-targeting control group (Fig. 33A and Fig. 33B), but an increased number of metastatic lesions were detected, again support the hypothesis that TBC1D2b is a potent metastasis suppressor.
Haematoxylin and eosin staining of lung sections confirmed the increased metastasis observed from gross examination (Fig. 33C). TBC1D2b knockdown contributed to downregulation of E-cadherin expression (Fig. 34A and 34B)
Based on our overall findings we propose a model in which ZEB1 and CHD4/NuRD work in concert to repress TBC1D2b as well as other targets such as the miR-200 family
(Fig. 35). TBC1D2b down-regulation results in an increase in Rab22 activation and in turn promotes E-cadherin internalization and degradation, enhancing in vivo metastasis.
67
68
69
70
71
CHAPTER 4:
ZEB1 acetylation precludes
homodimerization
72
Class I HDAC inhibitors regulate ZEB1 dimerization
To determine whether the enzymatic activity of the NuRD complex members
HDAC1 and HDAC2 contribute to ZEB1 mediated repression we utilized the class I HDAC inhibitors Mocetinostat and Trichostatin A (TSA). Previous reports have found that use of these inhibitors can induce mesenchymal-epithelial transition (MET) by repressing ZEB1 expression, subsequently restoring the transcription of targets such as the miR-200 family
30. Treatment with TSA for 24h did not significantly affect ZEB1 transcription (Fig. 36A).
Although we did find that 48h of treatment did down regulate ZEB1 expression (data not shown). We concurrently found that utilization of these inhibitors caused the molecular weight of ZEB1 to shift from ~250 kDa to 125 kDa (Fig. 36B and 36C). The predicted molecular weight of ZEB1 is 125 kDa, but a growing body of evidence indicates that ZEB1 appears as two species-125 kDa and 190-250 kDa.
Given that the observed molecular weight difference is twice that of ZEB1 predicted molecular weight we questioned whether ZEB1 was forming a homodimer. To assess this hypothesis we co-transfected a GFP-ZEB1 and a flag-ZEB1 in the 344SQ cell line (Fig. 37A). Cells were treated with doxycycline to induce the expression of GFP,
GFP/Flag-ZEB1, GFP-ZEB1, or GFP-ZEB1/Flag-ZEB1 for 24 h and co- immunoprecipitation was conducted with an anti-GFP antibody (Fig. 37B). Immunoblot for flag antibody indicated that GFP-ZEB1 co-immunoprecipitated with flag-ZEB1, demonstrating that ZEB1 forms a homodimer that is not disrupted by SDS-PAGE reducing conditions. Additionally, this suggested that class I HDACs are responsible for the maintenance of ZEB1 dimerization.
We noted that after 24h of TSA treatment in the human cell line H1299 we could induce a significant proportion of the total protein to appear as a monomer. We therefore
73
74
75
76
performed chIP for ZEB1 to determine the capacity of ZEB1 to bind to the miR-200c and
SEMA3F promoter (Fig. 38A). Unlike knockdown of CHD4 which caused an increase in
ZEB1 binding, treatment with TSA caused ZEB1 binding to decrease at all of the queried binding sites. An increase in H3K27ac was also observed, consistent with previous reports
(Fig. 38B).
ZEB1 dimerization is regulated by acetylation
We next questioned how class I HDACs dictated ZEB1 dimerization. Our data indicated that ZEB1 acetylation may modulate homodimerization, therefore we decided to perform tandem-mass spectrometry to identify post-translational modifications (PTMs).
Through utilization of a GFP conjugated murine ZEB1 in the 344SQ cell line we initially confirmed that both observed bands (125 kDa and 250 kDa) are indeed ZEB1 (data not shown). We then conducted mass spectrometry on peptides generated from both trypsin or chymotrypsin digest to identify differences in phosphorylation, ubiquitination, and acetylation. We were able to detect four phosphorylation sites (T131, Y577/Y578, S624, and S657) and one acetylation site (K811) (Fig. 39A). None of these sites have previously been identified and we noted that the Y577/Y578 site was located within the homeobox domain (Fig. 39B).
To determine whether phosphorylation contributes to ZEB1 dimerization we utilized lambda phosphatase, which has dual activity to sites of serine/threonine and tyrosine phosphorylation. Both murine (393P and 344SQ; Fig. 40A) and human (H441,
H358, H1299, and H157; Fig. 40B) NSCLC cell lines were harvested in Protein
MetalloPhosphatases (PMP) buffer or in buffer containing phosphatase inhibitors as a control. Lysates were incubated with lambda phosphatase for 30 min prior to immunoblot
77
78
79
for ZEB1 and the total phospho-Ser/Thr antibody to determine the effectiveness of treatment. A modest decrease in ZEB1 molecular weight was observed in the phosphatase treated samples (~10 kDa in the murine cell lines and ~20 kDa in the human cell lines), confirming that the protein is phosphorylated, but suggesting that phosphorylation does not contribute to dimerization. Further experiments must be performed to determine the functional significance of ZEB1 phosphorylation.
We then generated mutations of the single acetylation site identified by mass spectrometry (mus musculus K811 or homo sapien K833). To mimic acetylation, we exchanged lysine 811 with glutamine (K811Q) to model both the charge and chemical structure of acetylated lysine. To abolish acetylation at this residue while conserving the positive charge we mutated lysine to arginine (K811R). Overexpression of each ZEB1 mutant as a fusion protein with GFP in the 393P cell line demonstrated localization to the nucleus, consistent with overexpression of wild-type ZEB1 (Fig. 41A). We observed overexpression after 24h doxycycline induction both by qPCR and noted both mutants repressed the expression of E-cadherin (Fig. 41B). Counterintuitively, immunoblot indicated that the acetyl-mimetic mutant, ZEB1_K811Q, did not disrupt ZEB1 dimerization
(Fig. 42A). However, acetyl-deficient mutant ZEB1_K811R appeared exclusively at 125 kDa suggesting that disruption of acetylation hindered dimerization (Fig. 42B). To determine whether the K811R mutant precludes dimerization, we co-expressed the GFP-
ZEB1_K811R and flag-ZEB1_WT (Fig. 43A) in the cell line 344SQ. Immunoprecipitation of the GFP-tagged mutant was unable to co-immunoprecipitate the wild type flag-ZEB1, validating that acetylation is necessary for ZEB1 dimerization.
To assess the functional effect of ZEB1 deacetylation on tumor cell invasion we performed Transwell migration and invasion assays. Both mutants were capable of
80
81
82
83
promoting migration (Fig. 44A) and invasion (Fig. 44B) in Boyden chamber assays, comparable to wild type ZEB1 overexpression. We next investigated tumor cell invasion in 3D cultures. To model the extracellular matrix composition found in tumors, cells were grown on a Matrigel/ collagen type I (1.75 mg/ml) mixture to reveal the differential 3D organization. Control 344SQ cells grew as non-invasive colonies, but upon ZEB1 (wild type) expression colonies displayed an invasive response, forming elongated protrusions
(Fig. 44C). 3D culture of the ZEB1 dimerization mutant ZEB1_K811R produced poorly cohesive structures with protrusions appearing more rounded. Additional studies are necessary to determine how monomer ZEB1 modulates cell invasion distinct of dimer
ZEB1.
84
85
CHAPTER 5: Discussion
86
The dysregulation of ZEB1 expression is associated with poor clinical prognosis in numerous epithelial cancers and notably drives EMT in lung cancer pathogenesis 22.
Previous work has shown that ZEB1 cofactors are critical to its function in tumorigenesis, metastasis, and therapy resistance 23. Therefore we studied the molecular mechanisms governing ZEB1 function in metastatic NSCLC by applying two independent screens, the biochemical BioID screen 55 and an in vivo shRNA-mediated loss-of-function screen51.
This allowed us to study ZEB1 interactors that can be exploited therapeutically in metastatic NSCLC. Here we report that ZEB1 interacts with the NuRD complex and that chromodomain helicase family members are essential to the survival of metastatic
NSCLC. Multiple studies have demonstrated that the NuRD complex associates with other transcriptional repressors, including FOG-1 68, and ZEB2 (Zfhx1b) 42, 69, 70. Previous ZEB1 affinity purification studies have detected an interaction between ZEB1 and some NuRD complex members, although none followed up in studying the NuRD complex as a ZEB1 co-repressor 33, 71. To define the functional consequence of this interaction we considered established targets of ZEB1 and determined that not only does ZEB1 recruit CHD4/NuRD to target promoters, but in the case of miR-200, CHD4 is necessary to facilitate ZEB1- mediated repression. Aberrant DNA methylation of the miR-200c/141 promoter is closely linked to inappropriate silencing in cancer cells 72.
Interested in the identification of other ZEB1/CHD4/NuRD targets, we interrogated the ENCODE ChIP-seq data and through application of stringent criteria defined the paralogues TBC1D2a (Armus) and TBC1D2b as target genes. Rather than examining
Armus, which was previously described as a Rac1 effector and a bona fide GAP for Rab7
73, 74, we selected to characterize TBC1D2b (mKIAA1055) due to its association with lung cancer oncogenesis 75. Earlier work established TBC1D2b as a Rab22 binding protein-
Rab22 (Rab22a) and Rab31 (Rab22b) 65. TBC1D2b consists of two coiled‐coil (CC) 87
domains, which are flanked by an N‐terminal pleckstrin homology (PH) domain and a C‐ terminal Tre‐2/Bub2/Cdc16 (TBC) domain. Truncation mutants of each domain unexpectedly demonstrated that TBC1D2b has nominal GAP activity towards Rab22, more likely serving as a hub for the recruitment of other Rab22 GAPs 65. Studies now place Rab22 at the level of recycling of clathrin-mediated endocytosis (CME) and clathrin- independent endocytosis cargo proteins 66, 76, 77. There have been other reports of Rab22 acting at endocytic entry points, markedly in the endocytosis of the TrkA receptor 77 and in the early uptake of the bacterium Borrelia 78.
Initial overexpression of TBC1D2b led us to observe an upregulation and altered electrophoretic mobility of E-cadherin. It is well established that the cytoplasmic tail of E- cadherin is phosphorylated in the β-catenin binding region, increasing its affinity for β- catenin14. Additionally, phospho-deficient E-cadherin mutants exhibit enhanced endocytosis and degradation through a lysosomal compartment. Together with the observed mobility shift we became intrigued by the role of TBC1D2b/Rab22 in the regulation of E-cadherin uptake. E-cadherin degradation is efficiently blocked by the expression of TBC1D2b, providing another important regulatory node for E-cadherin turnover and stability of cell-cell contacts. A wealth of reports have demonstrated that
EMT-associated transcription factors bind to the E-box within the E-cadherin promoter to suppress gene expression79; however, we provide evidence that ZEB1 can dually facilitate the down-regulation of surface E-cadherin by promoting excessive internalization and degradation. Our data also suggests that ZEB1 promotes hyper-activation of Rab22 and may regulate other junctional proteins, thereby disrupting tissue polarity and instigating a motile phenotype. Future studies will be required to determine whether ZEB1 influences the activity of Rab7 through regulation of TBC1D2a during normal development and tumor metastasis. 88
Concurrently, we determined that TBC1D2b is an inhibitor of invasion in vitro and metastasis in vivo. Given the physiological role of E-cadherin in cell-cell contacts, we propose that TBC1D2b likely stabilizes the cell junctions found in epithelial cells.
Additionally, we find that TBC1D2b rescues Rab22-mediated cell migration and invasion.
Distinguishing the role of ZEB1-mediated Rab22 activation in the regulation of the endocytic pathway is an important area for future investigation. Furthermore, endocytosis entails selective packaging of cell surface proteins such as receptors that are frequently skewed in cancer cells 80. Unveiling Rab22 cargo may yield invaluable tools for decoding therapeutic resistance in multiple epithelial tumors.
In addition to our findings relating ZEB1 to increased endocytic uptake of cargo such as E-cadherin, we are also the first group to identify ZEB1 homodimerization.
Previous work has suggested that class I HDAC inhibitors are a potent inducer of MET through regulation of ZEB1 transcription thus restoring target genes such as the miR-200 family. However, our data suggested that these inhibitors could impede the NuRD complex activity consequently stunting ZEB1 function. We therefore treated multiple NSCLC cell lines with class I HDAC inhibitors and unexpectedly found that we could induce a dramatic change in the molecular weight of ZEB1. Through co-immunoprecipitation studies we demonstrated that ZEB1 forms a homodimer that depends on class I HDAC activity.
We performed mass spectrometry to identify PTMs which can regulate ZEB1 dimerization. Mass spectrometry of the dimer identified four novel phosphorylation sites and one acetylation site, but did not identify any modifications on the monomer. Further analysis must be conducted to increase the coverage and potentially identify other modifications. To determine whether these phosphorylation modifications contribute to
ZEB1 dimerization we applied lambda phosphatase and found that we could not achieve the disassociation of the dimer compared to application of TSA. Previous research has 89
suggested that ZEB1 phosphorylation contributes to protein stability 33, however, further research is necessary to determine the significance of the other PTMs unearthed in this study.
We generated the acetylation mimetic and deficient ZEB1_K811 mutants and as hypothesized, affecting this site hindered the ability of ZEB1 to homodimerize as assessed by the inability to co-immunoprecipitate the wild type flag-ZEB1 with the mutant
ZEB1_K811R. Interestingly, this mutant was still capable of inducing an EMT, although we provide evidence that the monomer is not capable of binding to the promoter of miR-
200c/141 or SEMA3F. We also noted that both the dimer and monomer eluted in fractions larger than 669 kDa by column chromatography, suggesting that the monomer also interacts with multi-molecular complexes. Furthermore, in 3D invasion assays the 344SQ-
ZEB1_K811R formed invasive spheres which appeared rounded as compared to the elongated ZEB1 wild type overexpressing spheres. Tumor cells exhibit two distinct modes of migration when invading the 3D microenvironment: mesenchymal or amoeboid 81. This work suggests that ZEB1 monomer may modulate genes which contribute to an amoeboid pattern of invasion. Further characterization is necessary to confirm if the ZEB1 monomer and dimer differentially regulate gene expression.
ZEB1 ablation is associated with increased therapy sensitivity and underscores the importance of ZEB1 as a crucial driver of tumor progression. Transcription factor dimerization can facilitate enhancement of DNA-binding specificity and can become an additional point of regulation. Recently, the disruption of transcription factor dimerization has emerged as a novel and promising strategy for developing a new generation of drugs
44. So far generation of dominant-negative peptides lacking the DNA-binding domain can disrupt endogenous dimerization 82. Together, our results suggest that this strategy of
90
treatment with a cell penetrating dominant-negative form of ZEB1 may hold promise for cancer therapy, either alone or in a multi-targeting approach.
In conclusion, our results unveil the oncogenic function of the NuRD complex in
NSCLC metastasis through physical association with and recruitment by ZEB1. The
ZEB1/CHD4/NuRD complex is responsible for mediating repression of miR-200c/141 and
TBC1D2b, a regulator of Rab22 and a potent suppressor of NSCLC invasion and metastasis. These findings are the first to demonstrate how EMT associated transcription factors regulate the degradation of E-cadherin protein and suggests that
ZEB1/CHD4/NuRD can harness endocytosis to promote oncogenic signals. We also uncover ZEB1 homodimerization and identify the site K811 as a pivotal regulator of dimerization. Therefore, this data validates the targeting of the ZEB1 axis for the treatment of metastatic lung cancer.
91
CHAPTER 6: Future directions
92
Over the last decade, early diagnosis and targeted therapy has done little to improve the survival rates of NSCLC patients. Moreover, despite the recent progress with immunotherapy and approval of tyrosine kinase inhibitors as first-line therapy, EMT remains a prominent mechanism of resistance- underscoring the need for further research of this process. Since the identification of ZEB1 in the early 1990s if has been defined as a transcriptional mediator of EMT and compared to other EMT-associated transcription factors, ZEB1 is uniquely correlated with disease progression in NSCLC2. While considerable research has focused on understanding the processes ZEB1 regulates, the goal of this project was to uncover how ZEB1 functions. Through two unbiased screens, we identify the NuRD complex as a ZEB1 interactor, necessary for the survival of mesenchymal NSCLC. We propose a model in which the NuRD complex is dually a ZEB1 co-repressor and a regulator of ZEB1 dimerization.
In Chapter 4 we identify three ZEB1/NuRD target genes: EPS8L2, TBC1D2a and
TBC1D2b. Though we selected to study TBC1D2b, the other two pose as interesting targets and the significance of these genes in metastasis has yet to be defined. EPS8L2 is a member of the SOS1/ABI1 multi-molecular complex which is required for Rac1 activation and actin cytoskeletal remodeling83. Intriguingly, TBC1D2a is also a Rac1 effector- coordinating between Rac1 and Rab7 during starvation74. Rab7 designates the maturation of endosomes and autophagosomes, directing the trafficking of cargos along microtubules, and finally, participating in the fusion step with lysosomes. Rac1 is part of the Rho family of small GTPases, which are activated in a sequential manner to mediate cell motility. In this model Cdc42 induces filopodia, Rac1 induces lamellipodia and subsequently activation of Rho induces stress fiber formation, with Rho and Rac acting antagonistically84, 85. Several reports show an association between autophagy and the function of the Rho family. In particular, RhoA and Rac1 have a regulatory function on
93
starvation-mediated autophagy, but with opposing roles86. RhoA activates autophagy, while Rac1 inhibits autophagy. This implies that ZEB1 represses Rac1 activity to promote autophagy progression. Autophagy and EMT are linked in a multifaceted relationship.
Given the numerous challenges that metastatic tumor cells overcome to successfully establish distant colonies, cells that undergo EMT require autophagy activation to survive during metastatic spreading. Accordingly, our data suggesting ZEB1 stimulates autophagy substantiates these reports, but whether ZEB1 would inhibit Rac1 activation to achieve this goal should be addressed in future work.
In this chapter we also propose that ZEB1 harnesses the endocytic circuitry by repressing TBC1D2a and TBC1D2b. In addition to junction stability, key cellular processes are regulated through dynamic endocytosis. To ascertain precisely which cargo are influenced by ZEB1, mass spectrometry based vacuolar proteomics and lipidomics must be performed. However, several cell surface proteins pose as interesting targets for future work. Frequently receptor tyrosine kinases (RTKs) are aberrantly trafficked in lung cancer and are often increased activity of endocytic molecules can prolong propagation of RTK signals or mislocalize RTKs87. Similarly, whether ZEB1 regulates the recycling of MHCs should be explored. Tumor cells evade immune recognition directly by downregulating features that make them vulnerable such as tumor antigens or MHC class I. Tumors in patients treated with anti-PD-1 who initially responded and then relapse showed loss in
MHC class I surface expression to avoid cytotoxic T cell recognition88. Previous work has demonstrated that Rab22 plays a central role in the MHC class I endocytic trafficking and silencing of Rab22 expression can drastically reduce the intracellular pool and recycling of MHC class I molecules89. Future work should determine whether ZEB1 regulation of the
TBC1D2b/Rab22 axis could contribute to downregulation of MHC class I presentation and immunotherapy resistance. 94
Later in an effort to determine if HDAC inhibitors can restore ZEB1 target gene expression we uncover that ZEB1 dimerizes. We additionally identify that dimerization is prohibited through mutation of lysine 811 to arginine (ZEB1_K811R), which prevents acetylation at this site. Much work remains to comprehend the phenotype produced by expression of the monomer ZEB1, but we have noted a unique phenotype in 3D assays.
ZEB1_K811R formed invasive spheres, which appear rounded as compared to the elongated ZEB1 wild type overexpressing spheres. There remain two explanations for this observation. Previous work by our group has demonstrated that ZEB1 monomer has a lower half-life compared to dimer ZEB1 (data not shown). Thus the reduced invasive phenotype may be due to decreased protein expression. Future work studying the half-life of the ZEB1_K811 acetylation mutants may provide more insights in to the contribution of the NuRD complex to protein stability. Alternatively, our data may indicate that ZEB1 monomer modulates pathways which contribute to an amoeboid-type invasion. Previous work has shown that ZEB1 is crucial for amoeboid-type invasion in breast cancer and has demonstrated that RhoA activation is preferentially required for amoeboid invasion, opposing Rac1 activation which drives cancer mesenchymal-type invasion90. Combined with our data from Chapter 4, this again suggests that ZEB1 promotes Rac1 deactivation.
Additionally, this also indicates that the monomer regulates genes independent of the dimer and may still associate with the NuRD complex. ChIP-seq and RNA-seq comparing the monomer (ZEB1_K811R) to wild-type and dimer (ZEB1_K811Q) are necessary to determine whether ZEB1 dimerization attributes to differences in signaling pathways.
Finally, we propose that ZEB1/NuRD association dually facilitates heterochromatinization of target gene promoters subsequent to deacetylation of ZEB1 to disrupt dimerization. Mutation of lysine 811 to arginine prohibited ZEB1 from dimerizing signifying that acetylation is necessary dimerization. We also establish that upon TSA
95
treatment of NSCLC lines ZEB1 binding is significantly decreased, while knockdown of
CHD4 enhances ZEB1 binding. Interestingly, knockdown of CHD4 did not achieve ablation of ZEB1 dimerization but does contribute to upregulation of expression (data not shown).
Coupled, this data suggests that the monomer is unable to bind DNA as efficiently as the dimer and that the NuRD complex hampers ZEB1 expression. Future work ought to explore how the NuRD complex directly regulates ZEB1 and how HDAC activity affects
ZEB1 dimerization separate from the NuRD complex. Additionally, this may provide insights to the molecular mechanisms underlying the response to HDAC inhibitors, which are currently used in combination with other chemotherapeutic agents in multiple clinical trials.
To date, we remain far from understanding the complex intracellular and extracellular networks regulating the expression and function of ZEB1; however, answering these questions may elucidate several of these mechanisms. In addition to these questions, future work should also address how ZEB1 is involved in other disease models such as Fuch’s endothelial dystrophy, where ZEB1 mutations frequently contribute to disease progression; and how ZEB1 functions are altered in cancer in the context of accumulating genetic alterations and the changing tumor environment. To this end, investing in advance and intelligent experimental designs, particularly ChIP-seq analysis, to reveal DNA binding and co-factor binding patterns for our ZEB1 dimer mutants may provide impactful knowledge and extend our therapeutic strategies for NSCLC patients.
96
CHAPTER 6: Bibliography
97
1. Siegel, R.L., Miller, K.D. & Jemal, A. Cancer statistics, 2019. CA: a cancer journal for clinicians 69, 7‐34 (2019). 2. Larsen, J.E. & Minna, J.D. Molecular biology of lung cancer: clinical implications. Clinics in chest medicine 32, 703‐740 (2011). 3. Gibbons, D.L., Byers, L.A. & Kurie, J.M. Smoking, p53 Mutation, and Lung Cancer. Molecular Cancer Research 12, 3 (2014). 4. Gibbons, D.L. et al. Expression signatures of metastatic capacity in a genetic mouse model of lung adenocarcinoma. PloS one 4, e5401 (2009). 5. Gibbons, D.L. et al. Contextual extracellular cues promote tumor cell EMT and metastasis by regulating miR‐200 family expression. Genes Dev 23, 2140‐2151 (2009). 6. Thiery, J.P., Acloque, H., Huang, R.Y. & Nieto, M.A. Epithelial‐mesenchymal transitions in development and disease. Cell 139, 871‐890 (2009). 7. Kalluri, R. & Weinberg, R.A. The basics of epithelial‐mesenchymal transition. The Journal of clinical investigation 119, 1420‐1428 (2009). 8. van Roy, F. & Berx, G. The cell‐cell adhesion molecule E‐cadherin. Cellular and Molecular Life Sciences 65, 3756‐3788 (2008). 9. Jeanes, A., Gottardi, C.J. & Yap, A.S. Cadherins and cancer: how does cadherin dysfunction promote tumor progression? Oncogene 27, 6920‐6929 (2008). 10. Marsh, M. & McMahon, H.T. The Structural Era of Endocytosis. Science 285, 215 (1999). 11. Mettlen, M., Chen, P.‐H., Srinivasan, S., Danuser, G. & Schmid, S.L. Regulation of Clathrin‐ Mediated Endocytosis. Annual Review of Biochemistry 87, 871‐896 (2018). 12. Mayor, S., Parton, R.G. & Donaldson, J.G. Clathrin‐Independent Pathways of Endocytosis. Cold Spring Harbor Perspectives in Biology 6 (2014). 13. Delva, E. & Kowalczyk, A.P. Regulation of cadherin trafficking. Traffic (Copenhagen, Denmark) 10, 259‐267 (2009). 14. McEwen, A.E., Maher, M.T., Mo, R. & Gottardi, C.J. E‐cadherin phosphorylation occurs during its biosynthesis to promote its cell surface stability and adhesion. Molecular biology of the cell 25, 2365‐2374 (2014). 15. Palacios, F., Tushir, J.S., Fujita, Y. & D'Souza‐Schorey, C. Lysosomal targeting of E‐cadherin: a unique mechanism for the down‐regulation of cell‐cell adhesion during epithelial to mesenchymal transitions. Molecular and cellular biology 25, 389‐402 (2005). 16. Agola, J.O., Jim, P.A., Ward, H.H., Basuray, S. & Wandinger‐Ness, A. Rab GTPases as regulators of endocytosis, targets of disease and therapeutic opportunities. Clin Genet 80, 305‐318 (2011). 17. Otto, E.A. et al. Mutation analysis of 18 nephronophthisis associated ciliopathy disease genes using a DNA pooling and next generation sequencing strategy. Journal of Medical Genetics 48, 105 (2011). 18. Syx, D. et al. The RIN2 syndrome: a new autosomal recessive connective tissue disorder caused by deficiency of Ras and Rab interactor 2 (RIN2). Human Genetics 128, 79‐88 (2010). 19. Scheel, C. et al. Paracrine and autocrine signals induce and maintain mesenchymal and stem cell states in the breast. Cell 145, 926‐940 (2011). 20. Moustakas, A. & Heldin, C.‐H. Signaling networks guiding epithelial–mesenchymal transitions during embryogenesis and cancer progression. Cancer science 98, 1512‐1520 (2007). 21. Zheng, H. & Kang, Y. Multilayer control of the EMT master regulators. Oncogene 33, 1755‐ 1763 (2014). 98
22. Larsen, J.E. et al. ZEB1 drives epithelial‐to‐mesenchymal transition in lung cancer. The Journal of clinical investigation 126, 3219‐3235 (2016). 23. Zhang, P., Sun, Y. & Ma, L. ZEB1: At the crossroads of epithelial‐mesenchymal transition, metastasis and therapy resistance. Cell cycle 14, 481‐487 (2015). 24. Funahashi, J., Kamachi, Y., Goto, K. & Kondoh, H. Identification of nuclear factor delta EF1 and its binding site essential for lens‐specific activity of the delta 1‐crystallin enhancer. Nucleic acids research 19, 3543‐3547 (1991). 25. Postigo, A.A. & Dean, D.C. Independent Repressor Domains in ZEB Regulate Muscle and T‐Cell Differentiation. Molecular and cellular biology 19, 7961‐7971 (1999). 26. Burk, U. et al. A reciprocal repression between ZEB1 and members of the miR‐200 family promotes EMT and invasion in cancer cells. EMBO Reports 9, 582‐589 (2008). 27. Gregory, P.A. et al. The miR‐200 family and miR‐205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nature cell biology 10, 593‐601 (2008). 28. Park, S.‐M., Gaur, A.B., Lengyel, E. & Peter, M.E. The miR‐200 family determines the epithelial phenotype of cancer cells by targeting the E‐cadherin repressors ZEB1 and ZEB2. Genes & development 22, 894‐907 (2008). 29. Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1‐Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers 5, 334‐356 (2013). 30. Meidhof, S. et al. ZEB1‐associated drug resistance in cancer cells is reversed by the class I HDAC inhibitor mocetinostat. EMBO molecular medicine 7, 831‐847 (2015). 31. Aghdassi, A. et al. Recruitment of histone deacetylases HDAC1 and HDAC2 by the transcriptional repressor ZEB1 downregulates E‐cadherin expression in pancreatic cancer. Gut 61, 439‐448 (2012). 32. Sanchez‐Tillo, E. et al. ZEB1 represses E‐cadherin and induces an EMT by recruiting the SWI/SNF chromatin‐remodeling protein BRG1. Oncogene 29, 3490‐3500 (2010). 33. Zhang, P. et al. ATM‐mediated stabilization of ZEB1 promotes DNA damage response and radioresistance through CHK1. Nature cell biology 16, 864‐875 (2014). 34. Long, J., Zuo, D. & Park, M. Pc2‐mediated sumoylation of Smad‐interacting protein 1 attenuates transcriptional repression of E‐cadherin. The Journal of biological chemistry 280, 35477‐35489 (2005). 35. Mizuguchi, Y. et al. Cooperation of p300 and PCAF in the control of microRNA 200c/141 transcription and epithelial characteristics. PloS one 7, e32449 (2012). 36. Zhang, P. et al. ATM‐mediated stabilization of ZEB1 promotes DNA damage response and radioresistance through CHK1. Nature cell biology 16, 864‐875 (2014). 37. Roux, K.J., Kim, D.I., Raida, M. & Burke, B. A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. The Journal of cell biology 196, 801‐810 (2012). 38. Torchy, M.P., Hamiche, A. & Klaholz, B.P. Structure and function insights into the NuRD chromatin remodeling complex. Cellular and Molecular Life Sciences 72, 2491‐2507 (2015). 39. Hoffmeister, H. et al. CHD3 and CHD4 form distinct NuRD complexes with different yet overlapping functionality. Nucleic acids research 45, 10534‐10554 (2017). 40. Lai, A.Y. & Wade, P.A. Cancer biology and NuRD: a multifaceted chromatin remodelling complex. Nat Rev Cancer 11, 588‐596 (2011). 41. Kumar, R. & Wang, R.‐A. Structure, expression and functions of MTA genes. Gene 582, 112‐121 (2016).
99
42. Si, W. et al. Dysfunction of the Reciprocal Feedback Loop between GATA3‐ and ZEB2‐ Nucleated Repression Programs Contributes to Breast Cancer Metastasis. Cancer Cell 27, 822‐836 (2015). 43. Luo, J., Su, F., Chen, D., Shiloh, A. & Gu, W. Deacetylation of p53 modulates its effect on cell growth and apoptosis. Nature 408, 377‐381 (2000). 44. Amoutzias, G.D., Robertson, D.L., Van de Peer, Y. & Oliver, S.G. Choose your partners: dimerization in eukaryotic transcription factors. Trends in Biochemical Sciences 33, 220‐ 229 (2008). 45. Moraitis, A.N. & Giguère, V. Transition from Monomeric to Homodimeric DNA Binding by Nuclear Receptors: Identification of RevErbAα Determinants Required for RORα Homodimer Complex Formation. Molecular endocrinology 13, 431‐439 (1999). 46. Lee, K.A. Dimeric transcription factor families: it takes two to tango but who decides on partners and the venue? Journal of Cell Science 103, 9 (1992). 47. Mackay, J.P. & Crossley, M. Zinc fingers are sticking together. Trends in Biochemical Sciences 23, 1‐4 (1998). 48. Gu, W. & Roeder, R.G. Activation of p53 sequence‐specific DNA binding by acetylation of the p53 C‐terminal domain. Cell 90, 595‐606 (1997). 49. Ito, A. et al. MDM2–HDAC1‐mediated deacetylation of p53 is required for its degradation. The EMBO journal 21, 6236‐6245 (2002). 50. Coyaud, E. et al. BioID‐based Identification of Skp Cullin F‐box (SCF)β‐TrCP1/2 E3 Ligase Substrates. Mol Cell Proteomics 14, 1781‐1795 (2015). 51. Carugo, A. et al. In Vivo Functional Platform Targeting Patient‐Derived Xenografts Identifies WDR5‐Myc Association as a Critical Determinant of Pancreatic Cancer. Cell Reports 16, 133‐147 (2016). 52. Birmingham, A. et al. Statistical methods for analysis of high‐throughput RNA interference screens. Nature Methods 6, 569 (2009). 53. Li, J. et al. TRIM28 interacts with EZH2 and SWI/SNF to activate genes that promote mammosphere formation. Oncogene 36, 2991‐3001 (2017). 54. Gubelmann, C. et al. Identification of the transcription factor ZEB1 as a central component of the adipogenic gene regulatory network. eLife 3, e03346 (2014). 55. Roux, K.J., Kim, D.I. & Burke, B. BioID: a screen for protein‐protein interactions. Current protocols in protein science / editorial board, John E. Coligan ... [et al.] 74, Unit 19 23 (2013). 56. Choi, H. et al. SAINT: probabilistic scoring of affinity purification‐mass spectrometry data. Nat Meth 8, 70‐73 (2011). 57. Wang, J. et al. Opposing LSD1 complexes function in developmental gene activation and repression programmes. Nature 446, 882‐887 (2007). 58. Reynolds, N. et al. NuRD‐mediated deacetylation of H3K27 facilitates recruitment of Polycomb Repressive Complex 2 to direct gene repression. The EMBO journal 31, 593‐605 (2012). 59. Böhm, M. et al. Helicase CHD4 is an epigenetic coregulator of PAX3‐FOXO1 in alveolar rhabdomyosarcoma. The Journal of clinical investigation 126, 4237‐4249 (2016). 60. Kundu, S.T. et al. The miR‐200 family and the miR‐183~96~182 cluster target Foxf2 to inhibit invasion and metastasis in lung cancers. Oncogene 35, 173‐186 (2016). 61. The ENCODE (ENCyclopedia Of DNA Elements) Project. Science 306, 636‐640 (2004). 62. Lehmann, W. et al. ZEB1 turns into a transcriptional activator by interacting with YAP1 in aggressive cancer types. Nature communications 7, 10498 (2016). 100
63. Abdul‐Jalil, K.I. et al. The frequencies and clinical implications of mutations in 33 kinase‐ related genes in locally advanced rectal cancer: a pilot study. Annals of surgical oncology 21, 2642‐2649 (2014). 64. Remacle, J.E. et al. New mode of DNA binding of multi‐zinc finger transcription factors: deltaEF1 family members bind with two hands to two target sites. The EMBO journal 18, 5073‐5084 (1999). 65. Kanno, E. et al. Comprehensive Screening for Novel Rab‐Binding Proteins by GST Pull‐ Down Assay Using 60 Different Mammalian Rabs‡. Traffic 11, 491‐507 (2010). 66. Zhou, Y. et al. Rab22a enhances CD147 recycling and is required for lung cancer cell migration and invasion. Experimental Cell Research 357, 9‐16 (2017). 67. Wu, S.K. et al. Cortical F‐actin stabilization generates apical–lateral patterns of junctional contractility that integrate cells into epithelia. Nature cell biology 16, 167 (2014). 68. Fieo, R. et al. Differential item functioning due to cognitive status does not impact depressive symptom measures in four heterogeneous samples of older adults. International journal of geriatric psychiatry (2014). 69. Korpal, M., Lee, E.S., Hu, G. & Kang, Y. The miR‐200 family inhibits epithelial‐mesenchymal transition and cancer cell migration by direct targeting of E‐cadherin transcriptional repressors ZEB1 and ZEB2. The Journal of biological chemistry 283, 14910‐14914 (2008). 70. Wu, L.M.N. et al. Zeb2 recruits HDAC‐NuRD to inhibit Notch and controls Schwann cell differentiation and remyelination. Nature neuroscience 19, 1060‐1072 (2016). 71. Grzeskowiak, C.L. et al. In vivo screening identifies GATAD2B as a metastasis driver in KRAS‐driven lung cancer. Nature communications 9, 2732 (2018). 72. Lim, Y.‐Y. et al. Epigenetic modulation of the miR‐200 family is associated with transition to a breast cancer stem‐cell‐like state. Journal of Cell Science 126, 2256‐2266 (2013). 73. Carroll, B. et al. The TBC/RabGAP Armus Coordinates Rac1 and Rab7 Functions during Autophagy. Dev Cell 25, 15‐28 (2013). 74. Frasa, M.A.M. et al. Armus Is a Rac1 Effector that Inactivates Rab7 and Regulates E‐ Cadherin Degradation. Current Biology 20, 198‐208 (2010). 75. O'Brien, T.D., Jia, P., Caporaso, N.E., Landi, M.T. & Zhao, Z. Weak sharing of genetic association signals in three lung cancer subtypes: evidence at the SNP, gene, regulation, and pathway levels. Genome medicine 10, 16‐16 (2018). 76. Magadán, J.G., Barbieri, M.A., Mesa, R., Stahl, P.D. & Mayorga, L.S. Rab22a Regulates the Sorting of Transferrin to Recycling Endosomes. Molecular and cellular biology 26, 2595 (2006). 77. Marlin, M.C. & Li, G. Differential effects of overexpression of Rab5 and Rab22 on autophagy in PC12 cells with or without NGF. Methods in molecular biology (Clifton, N.J.) 1298, 295‐304 (2015). 78. Naj, X. & Linder, S. ER‐Coordinated Activities of Rab22a and Rab5a Drive Phagosomal Compaction and Intracellular Processing of Borrelia burgdorferi by Macrophages. Cell Reports 12, 1816‐1830 (2015). 79. Pećina‐Šlaus, N. Tumor suppressor gene E‐cadherin and its role in normal and malignant cells. Cancer Cell International 3, 17‐17 (2003). 80. Mellman, I. & Yarden, Y. Endocytosis and Cancer. Cold Spring Harbor Perspectives in Biology 5 (2013). 81. Krakhmal, N.V., Zavyalova, M.V., Denisov, E.V., Vtorushin, S.V. & Perelmuter, V.M. Cancer Invasion: Patterns and Mechanisms. Acta naturae 7, 17‐28 (2015).
101
82. Zhang, J.‐W., Tang, Q.‐Q., Vinson, C. & Lane, M.D. Dominant‐negative C/EBP disrupts mitotic clonal expansion and differentiation of 3T3‐L1 preadipocytes. Proceedings of the National Academy of Sciences 101, 43 (2004). 83. Offenhäuser, N. et al. The eps8 Family of Proteins Links Growth Factor Stimulation to Actin Reorganization Generating Functional Redundancy in the Ras/Rac Pathway. Mol Biol Cell 15, 91‐98 (2004). 84. Chauhan, B.K., Lou, M., Zheng, Y. & Lang, R.A. Balanced Rac1 and RhoA activities regulate cell shape and drive invagination morphogenesis in epithelia. Proceedings of the National Academy of Sciences 108, 18289‐18294 (2011). 85. Moorman, J.P., Luu, D., Wickham, J., Bobak, D.A. & Hahn, C.S. A balance of signaling by Rho family small GTPases RhoA, Rac1 and Cdc42 coordinates cytoskeletal morphology but not cell survival. Oncogene 18, 47 (1999). 86. Aguilera, M.O., Berón, W. & Colombo, M.I. The actin cytoskeleton participates in the early events of autophagosome formation upon starvation induced autophagy. Autophagy 8, 1590‐1603 (2012). 87. Wang, Q. et al. Prognostic significance of RIN1 gene expression in human non‐small cell lung cancer. Acta Histochemica 114, 463‐468 (2012). 88. Perea, F. et al. HLA class I loss and PD‐L1 expression in lung cancer: impact on T‐cell infiltration and immune escape. Oncotarget 9, 4120‐4133 (2017). 89. Weigert, R., Yeung, A.C., Li, J. & Donaldson, J.G. Rab22a Regulates the Recycling of Membrane Proteins Internalized Independently of Clathrin. Molecular Biology of the Cell 15, 3758‐3770 (2004). 90. Handa, H., Hashimoto, A., Hashimoto, S. & Sabe, H. Arf6 and its ZEB1‐EPB41L5 mesenchymal axis are required for both mesenchymal‐ and amoeboid‐type invasion of cancer cells. Small GTPases 9, 420‐426 (2018).
102
Vita
Roxsan Manshouri was born in Houston, Texas on September 7, 1990, the
daughter of Taghi Manshouri and Mary Jane Manshouri. She received the degree
of Bachelor of Science with a major in Biology in May 2013 and the degree of
Masters of Science with a major in Biomedical Research in May 2015. She entered
The University of Texas MD Anderson Cancer Center UTHealth Graduate School
of Biomedical Sciences and joined Don L. Gibbons’ lab in August of 2013.
103