Structural and Functional Studies of the Human Telomeric Pot1-Tpp1 Complex and Its Role in Human Disease

University of Pennsylvania ScholarlyCommons

Publicly Accessible Penn Dissertations

2017

Structural And Functional Studies Of The Human Telomeric Pot1-Tpp1 Complex And Its Role In Human Disease

Cory Taylor Rice University of Pennsylvania, [email protected]

Follow this and additional works at: https://repository.upenn.edu/edissertations

Part of the Biochemistry Commons, and the Biophysics Commons

Recommended Citation Rice, Cory Taylor, "Structural And Functional Studies Of The Human Telomeric Pot1-Tpp1 Complex And Its Role In Human Disease" (2017). Publicly Accessible Penn Dissertations. 2550. https://repository.upenn.edu/edissertations/2550

This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2550 For more information, please contact [email protected]. Structural And Functional Studies Of The Human Telomeric Pot1-Tpp1 Complex And Its Role In Human Disease

Abstract Telomeres are essential regions of repetitive DNA at the ends of eukaryotic chromosomes that serve an indispensable role in the protection and replication of the genome.

Telomeres shorten over time due to nucleolytic degradation, oxidative damage, and through a process known as the ‘end replication problem,’ which shortens telomeres after every round of genome replication. Critically short telomeres are linked to cellular senescence, aging, and human disease. Therefore, it is imperative to understand the molecular mechanisms that regulate and protect telomere length.

Correct regulation of telomere length is key and is facilitated by two telomere capping complexes: shelterin and CST. The human shelterin complex is composed of TRF1, TRF2, Rap1, TIN2, POT1, and TPP1, binds single and double stranded telomeric DNA and protects telomeres from degradation and unwanted DNA repair. The human CST complex, composed of CTC1, Stn1, and Ten1, bind and caps the single-stranded overhang of telomeres. These two complexes also maintain telomere length by regulating access of telomerase to telomeres, the reverse transcriptase that extends the length of telomeres.

In humans, the shelterin subcomplex, POT1-TPP1, is thought to directly engage and enhance the processivity of telomerase. Conversely, CTC1 of the human CST complex interacts with TPP1 inhibiting the activity of telomerase at telomeres. Furthermore, the CST complex is involved in the recruitment of Pol to telomeres; the DNA polymerase involved in the replication of the telomeric C-strand. As a result, the interaction between the shelterin and CST complexes represents a potential key mechanism for telomere length regulation that is still not fully understood.

Naturally occurring mutations in patients with rare aging disorders and cancers have been recently linked to telomere capping complexes. Elucidating the structural and functional consequences of these naturally occurring mutations will allow us to better understand how dysfunctional telomere maintenance results in human disease. My dissertation focuses on the functional and structural data of the human POT1-TPP1 complex, which reveals that naturally occurring mutations in the C-terminal domain of POT1 result in partial disruption of the POT1-TPP1 complex and telomere phenotypes associated with unregulated telomere length.

Degree Type Dissertation

Degree Name Doctor of Philosophy (PhD)

Graduate Group Biochemistry & Molecular Biophysics

First Advisor Emmanuel Skordalakes

Keywords Cancer, Chromosomes, Structural Biology, Telomeres, X-ray Crystallography Subject Categories Biochemistry | Biophysics

This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/2550 STRUCTURAL AND FUNCTIONAL STUDIES OF THE HUMAN TELOMERIC POT1-TPP1

COMPLEX AND ITS ROLE IN HUMAN DISEASE

Cory Taylor Rice

A DISSERTATION

Biochemistry and Molecular Biophysics

Presented to the Faculties of the University of Pennsylvania

Partial Fulfillment of the Requirements for the

Degree of Doctor of Philosophy

2017

Supervisor of Dissertation

______

Emmanuel Skordalakes

Associate Professor of Gene Expression and Regulation

Graduate Group Chairperson

______

Kim A. Sharp, Associate Professor of Biochemistry and Biophysics

Dissertation Committee:

Ronen Marmorstein, Professor of Biochemistry and Biophysics

Paul M. Lieberman, Professor of Microbiology

Gregory D. Van Duyne, Professor of Biochemistry and Biophysics

Kim A. Sharp, Associate Professor of Biochemistry and Biophysics

STRUCTURAL AND FUNCTIONAL STUDIES OF THE HUMAN TELOMERIC POT1-TPP1

COMPLEX AND ITS ROLE IN HUMAN DISEASE

2017

Cory Taylor Rice

This work is licensed under the

Creative Commons Attribution-

NonCommercial-ShareAlike 3.0

License

To view a copy of this license, visit https://creativecommons.org/licenses/by-nc-sa/3.0/us/ ACKNOWLEDGMENT

First and foremost, I would like to express my gratitude and thankfulness for having

Emmanuel as a mentor. He has helped guide me through numerous challenges I have faced during my dissertation. His door was always open to discuss and troubleshoot experiments and would never hesitate to help me collect or analyze data. His guidance has shaped me into the scientist that I am today and instilled in me the desire to pursue research at the highest quality and integrity. For all of these things and many more, I am truly grateful.

I would also like to thank my thesis committee for their intellectual contributions to my project. Dr. Ronen Marmorstein (chair), Dr. Paul Lieberman, Dr. Gregory Van Duyne, Dr. Kathryn

Ferguson, and Dr. Kim Sharp all provided tremendous support throughout my dissertation and ensured that I was prepared for the next step in my career. In addition, I would like to thank Dr.

Lieberman’s lab and Dr. Susan Janicki’s lab for their time and resources as I have benefitted greatly from our collaborations. In addition, Dr. Zhong Deng and Zhuo Wang from the Lieberman lab and Prashanth Shastrula from the Janicki lab were always very helpful and supportive.

I would also like to thank the BMB department and the friends I have made throughout graduate school. Specifically, Atrish Bagchi, Christopher Bialas, John Welsh, Catherine

Debrosse, Jarret Remsberg, Joe Jordan, and Matthew Thompson were constantly supportive and

I would like to thank them for our numerous discussions and memories we have made over the years.

Lastly, but certainly not least, I would like to thank my family for their unconditional love and support. My mother and father were always there for me and taught me to always challenge myself in order to achieve great things. I thank my brother and his family for their constant love and support. Finally, I would like to thank my fiancée, Francesca Tuazon, her parents, and their cat Arusha, for the life we have built together and their constant love and support that helped me throughout graduate school.

iii

ABSTRACT

STRUCTURAL AND FUNCTIONAL STUDIES OF THE HUMAN TELOMERIC POT1-TPP1

COMPLEX AND ITS ROLE IN HUMAN DISEASE

Cory Taylor Rice

Emmanuel Skordalakes

Telomeres are essential regions of repetitive DNA at the ends of eukaryotic chromosomes that serve an indispensable role in the protection and replication of the genome.

Correct regulation of telomere length is key and is facilitated by two telomere capping complexes: shelterin and CST. The human shelterin complex is composed of TRF1, TRF2, Rap1,

TIN2, POT1, and TPP1, binds single and double stranded telomeric DNA and protects telomeres from degradation and unwanted DNA repair. The human CST complex, composed of CTC1,

Stn1, and Ten1, bind and caps the single-stranded overhang of telomeres. These two complexes also maintain telomere length by regulating access of telomerase to telomeres, the reverse transcriptase that extends the length of telomeres.

of the telomeric C-strand. As a result, the interaction between the shelterin and CST complexes represents a potential key mechanism for telomere length regulation that is still not fully understood.

TPP1 complex and telomere phenotypes associated with unregulated telomere length.

TABLE OF CONTENTS

ACKNOWLEDGMENT ...... III

ABSTRACT ...... IV

TABLE OF CONTENTS ...... VI

LIST OF TABLES ...... IX

LIST OF FIGURES ...... X

CHAPTER 1 TELOMERES AND CHROMOSOME END-PROTECTION ...... 1

1.1 Function and composition of telomeric DNA ...... 2

1.2 Telomerase and telomere replication ...... 3

1.3 Telomere length regulation ...... 4

1.4 Telomeres and human disease ...... 6

1.5 Project goals ...... 10

CHAPTER 2 STRUCTURE OF THE HUMAN POT1-TPP1 COMPLEX AND ITS ROLE

IN CANCER ...... 11

2.1 Introduction ...... 12

2.2 Results ...... 13

2.2.1 Structure of the human POT1-TPP1 complex ...... 13

2.2.2 Structural analysis of POT1C mutations ...... 18

2.2.3 Several POT1C mutations partially disrupt the POT1-TPP1 complex ...... 21

2.2.4 POT1C mutants do not alter telomerase processivity ...... 25

2.2.5 Partial disruption the POT1-TPP1 complex reduces POT1-DNA binding ...... 27

2.2.6 POT1C mutations do not affect the localization of POT1 to telomeres ...... 29

2.2.7 Partial disruption of the POT1-TPP1 complex results in telomere elongation ...... 31

2.2.8 POT1C mutations lead to fragile telomeres ...... 33

2.3 Discussion ...... 36

2.4 Materials and methods ...... 38

2.4.1 Protein expression and purification ...... 38

2.4.2 Protein crystallization and structure determination ...... 40

2.4.3 Isothermal Titration Calorimetry (ITC) ...... 41

2.4.4 Fluorescence Polarization (FP) Assays ...... 41

2.4.5 Human Cell Culture ...... 42

2.4.6 Western Blot ...... 43

2.4.7 Reverse Transcription PCR and quantitative PCR analyses ...... 44

2.4.8 Direct telomerase activity assays ...... 44

2.4.9 Cell Imaging ...... 45

2.4.10 Southern blot analysis ...... 46

2.4.11 Fluorescence in situ hybridization (FISH) ...... 46

CHAPTER 3: FUTURE DIRECTIONS FOR THE HUMAN POT1-TPP1 COMPLEX. .. 48

vii

BIBLIOGRAPHY ...... 51

viii

LIST OF TABLES

Table 1: Data collection and refinement statistics for POT1C-TPP1(PBD) ...... 17

Table 2: Reported cases of POT1C mutations in cancer...... 21

Table 3: ITC binding data for wild type and mutant POT1C proteins with TPP1(PBD) ...... 25

Table 4: FP assay binding data for POT1 and TPP1 proteins with telomeric 18mer...... 29

LIST OF FIGURES

Figure 1.1 The shelterin and CST complexes cooperate to maintain telomere length...... 6

Figure 1.2 Primary structures of the human POT1-TPP1 and CST complexes...... 9

Figure 2.1 Structure of the human POT1-TPP1 complex...... 16

Figure 2.2 Structural analysis of POT1C mutations...... 20

Figure 2.3 Expression and purification of POT1C mutants...... 23

Figure 2.4 ITC binding data for the POT1C and TPP1(PBD) proteins...... 24

Figure 2.5 Direct telomerase activity assays ...... 26

Figure 2.6 POT1-TPP1 telomeric DNA binding assays...... 28

Figure 2.7 Cell imaging for localization of wild type and mutant POT1 to telomeres...... 30

Figure 2.8 Southern blot analysis of wild type and mutant POT1...... 32

Figure 2.9 Fluorescence in situ Hybridization (FISH) data...... 35

CHAPTER 1

Telomeres and chromosome end-protection

1.1 Function and composition of telomeric DNA

Telomeres are nucleoprotein structures at the ends of eukaryotic chromosomes that are essential for the protection and replication of the genome (Blackburn and Gall, 1978; de Lange,

2009). Since eukaryotic chromosomes are linear, telomeres appear as double-strand breaks and activate the DNA damage response (Longhese, 2008; Maser and DePinho, 2004). This presents the cell with a unique challenge in maintaining genome integrity since unwanted DNA repair at telomeres leads to chromosome fusions and genomic instability. However, telomere specific proteins exist to bind and cap telomeres to prevent activation of unwanted DNA repair. Telomere specific proteins also maintain telomere length, which is essential for the full replication of the genome and prevents cellular senescence (Effros and Walford, 1984; Greider and Blackburn,

1996).

Telomeres are composed of tandem DNA repeats (TTAGGG in mammals) and consists of both duplex DNA and a single-stranded overhang (G’-overhang). The 5’ to 3’ strand is referred to as the G-strand because it contains the G-rich telomeric repeats, whereas the 3’ to 5’ strand is known as the C-strand. These characteristics result in telomeric DNA forming two well-defined tertiary structures, G-quadruplexes and T-loops (Doksani et al., 2013; Henderson et al., 1987;

Rhodes and Giraldo, 1995). The G-rich nature of telomeric DNA promotes G-quadruplexes (G4-

DNA), which are formed through Hoogsteen hydrogen bonds when four or more guanine bases come together to form a planar structure (Henderson et al., 1987; Tran et al., 2011). The presence of stable G4-DNA interferes with DNA replication and must be resolved for the proper replication of telomeres (Biffi et al., 2013; Oganesian et al., 2006; Schaffitzel et al., 2001; Zahler et al., 1991). Several telomere associated proteins have been reported to resolve G4-DNA, such as the S. cerevisiae Cdc13 protein and C. glabrata CST complex (Lin et al., 2001; Lue et al.,

2013), as well as human POT1 (Colgin et al., 2003; Wang et al., 2011; Zaug et al., 2005).

The other tertiary structure of telomeric DNA, T-loops, are generated when the single- stranded G’-overhang invades the duplex DNA to form a loop like structure (Doksani et al., 2013).

The formation and stabilization of T-loops is promoted by components of the shelterin telomere capping complex, such as TRF2 and Rap1 (Griffith et al., 1999; Grunstein, 1997; Stansel et al.,

2001). Although T-loops have not been directly identified in yeast, they are a conserved feature among vertebrates, ciliates, and protozoans (Griffith et al., 1999; Munoz-Jordan et al., 2001; Murti and Prescott, 1999). As a result, T-loops have been proposed as a general mechanism to protect telomeres since they sequester, and thus cap, the G’-overhang (de Lange, 2004; Griffith et al.,

1999).

1.2 Telomerase and telomere replication

Due to the linear nature of eukaryotic chromosomes, telomeres gradually shorten after every round of genome replication (Levy et al., 1992). Telomere shortening, known as the end- replication problem, is due in part to the requirement of RNA primers (Okazaki fragments) during lagging strand synthesis (Okazaki et al., 1967). In addition, significant telomere shortening comes from the generation of the 3’ overhang, which requires exonucleolytic activity to resect back the 5’ end of telomeres (Li et al., 2009; Machwe et al., 2004; Sfeir et al., 2005). Furthermore, since DNA damage repair is repressed at telomeres, telomeric DNA accumulates damage overtime which is also known to contribute to telomere shortening (Hewitt et al., 2012; Kawanishi and Oikawa,

2004; Rossiello et al., 2014). Consequently, it is approximated that 50-200 bases of telomeric

DNA is lost with every cell division (Zhao et al., 2011). Over time, telomeres may become critically short, which results in cellular senescence. Cellular senescence is a non-replicative state in which cells retain metabolic function but no longer divide and is linked to aging and human disease (Allsopp et al., 1992; Burton, 2009; Counter et al., 1992).

To combat telomere shortening, telomeres are extended by telomerase, an enzyme that specifically replicates telomeres. Telomerase is a stable ribonucleoprotein complex, consisting of a protein subunit (TERT) and an RNA component (TER). The RNA component serves as the template for TERT to add repeats of telomeric DNA to the ends of chromosomes. While telomerase is required to extend the telomeric overhang (G-strand), DNA polymerase alpha

(Polα) is required to synthesize the C-strand, therefore generating duplex telomeric DNA

(Hubscher et al., 2002). The switch from G to C-strand synthesis is tightly regulated, which leads to the generation of a homogenous length of double stranded telomeric DNA (Blackburn, 2000;

Diede and Gottschling, 1999; Fan and Price, 1997; Vermeesch and Price, 1994). Although the mechanism is still not fully understood, average telomere length is maintained and regulated by the shelterin and CST telomere capping complexes (Fan and Price, 1997; Wright et al., 1999;

Zhao et al., 2009; Zhao et al., 2011).

1.3 Telomere length regulation

Correct regulation of telomere length is facilitated by two telomere capping complexes: shelterin and CST. The human shelterin complex is composed of TRF1, TRF2, Rap1, and TIN2, which localize to double stranded telomeric DNA, and POT1 and TPP1, which localize to single- stranded telomeric DNA. Furthermore, POT1 and TPP1 form a stable complex that directly interacts with telomerase through the N-terminal oligosaccharide/oligonucleotide-binding (OB) fold of TPP1. This interaction enhances the processivity of telomerase by allowing it to remain on the overhang and synthesize additional telomeric repeats (Wang and Lei, 2011a; Wang et al.,

2007). However, POT1 has been reported to act as a negative regulator of telomere length, through binding and sequestering the telomeric overhang from telomerase (Kelleher et al., 2005).

Telomere length is also maintained by the trimeric CST complex, which specifically binds and caps the single-stranded telomeric overhang. The CST complex is composed of CTC1, Stn1,

and Ten1 in higher eukaryotes and Cdc13, Stn1, and Ten1 in yeast (Price et al., 2010; Wellinger,

2009). Yeast Cdc13 has been reported to be both a positive and negative regulator of telomerase activity (Chandra et al., 2001; Evans and Lundblad, 1999; Grandin et al., 2000; Lin and Zakian,

1996). However, the human homolog CTC1 is currently only known to be a negative regulator of telomerase. While the precise mechanism remains uncharacterized, CTC1 has been reported to terminate telomere elongation by binding TPP1 and preventing telomerase from accessing the overhang (Chen, 2012).

Our current understanding of telomere maintenance and replication suggests that shelterin and CST cooperate to properly maintain telomere length (Figure 1.1). Since telomere maintenance is critical to genome stability, it is not surprising that mutations in the shelterin and

CST complexes are known to cause human disease. It is well-documented that human telomere dysfunction causes symptoms of pre-mature aging, pulmonary fibrosis, and bone marrow failure, as well as an increased incidence of cancer (Anderson et al., 2012; Armanios and Blackburn,

2012; Chen et al., 2013; Gu and Chang, 2013; Keller et al., 2012; Vulliamy et al., 2002; Walne et al., 2013). Therefore, further insight into the molecular mechanisms of telomere maintenance will allow us to better understand the role of telomere dysfunction in human disease.

Figure 1.1 The shelterin and CST complexes cooperate to maintain telomere length.

TRF1/2, Rap1, and TIN2 of the shelterin complex bind and coat double-stranded telomeric DNA.

The shelterin components POT1 and TPP1 bind single-stranded telomeric DNA and recruit telomerase to telomeres. CTC1 is reported to bind TPP1 and terminate telomerase activity at the overhang. In addition, CTC1 and Stn1 are known cofactors of Pola, the DNA polymerase that is recruited to telomeres to synthesize the C-strand.

1.4 Telomeres and human disease

Telomeres were first implicated in human disease in the early 1990s when telomerase activity was linked to immortal cell lines and cancer (Kim et al., 1994). Since then the majority of cancers have been found to have an upregulated activity of telomerase, which suggests that telomerase and telomere length play a key role in extending the replicative potential of cancer cells. Not only does misregulation of telomere length increase the risk of cancer, but it also results in symptoms of pre-mature aging and affects tissues with both high and slow-turnover rates

(Armanios and Blackburn, 2012). Therefore, studying the causes and clinical manifestations of telomere dysfunction is tied to both cancer and age-related disease (Nordfjall et al., 2005).

The first disorder to be linked to telomere dysfunction was dyskeratosis congenita (Heiss et al., 1998). Although a rare disease, affecting roughly 1 in 1 million individuals, dyskeratosis congenita is defined by signs of premature aging such as skin hyperpigmentation, oral leukoplakia, and nail dystrophy (de la Fuente and Dokal, 2007; Savage, 1993; Walne and Dokal,

2008). The primary causes of mortality in dyskeratosis patients is bone marrow failure, pulmonary fibrosis, and cancer. Coats plus syndrome is a similar telomere related disease characterized by exudative retinopathy, intracranial calcifications, and abnormalities in bone marrow and growth

(Anderson et al., 2012; Armanios, 2012; Keller et al., 2012; Mangino et al., 2012; Polvi et al.,

2012; Romaniello et al., 2012).

To-date numerous mutations have been found in CTC1 and Stn1 in patients with dyskeratosis congenita and Coats plus syndrome (Figure 1.2B) (Anderson et al., 2012; Keller et al., 2012; Polvi et al., 2012; Simon et al., 2016; Walne et al., 2013). The mutations found in CTC1 are throughout the entire protein and have been shown to disrupt key functions of the protein such as DNA, Stn1, and Polα binding (Figure 1.2B) (Chen et al., 2013; Gu and Chang, 2013).

Two studies have reported short telomere length for patients with CTC1 mutations, however two additional reports did not observe the same phenotype (Anderson et al., 2012; Keller et al., 2012;

Polvi et al., 2012; Walne et al., 2013). Interestingly, CTC1 mutations when studied in cell culture lead to elongated telomeres due to the loss of telomerase repression (Chen et al., 2013; Gu and

Chang, 2013). Thus, CTC1 mutations are distinct from classical telomere dysfunction syndromes that usually lead to short telomeres and may not be directly associated with a loss of overall telomere length. Mutations in Stn1 are located in the N-terminal OB-fold that is responsible for binding Ten1 and single-stranded DNA and result in DNA replication defects at both telomeric and non-telomeric sites (Figure 1.2B) (Bryan et al., 2013; Simon et al., 2016).

Recently, mutations in POT1 and TPP1 have also been identified in patients with chronic lymphocytic leukemia (CLL), familial cases of glioma and melanoma, and Coats plus syndrome

(Figure 1.2A) (Bainbridge et al., 2015; Ramsay et al., 2013; Shi et al., 2014; Takai et al., 2016;

Trigueros-Motos, 2014). Mutations which occur in the N-terminal OB-folds of POT1 disrupt the binding of POT1 to single-stranded telomeric DNA and result in elongated and fragile telomeres

(Bainbridge et al., 2015; Ramsay et al., 2013; Shi et al., 2014; Takai et al., 2016; Trigueros-

Motos, 2014). The telomere length of peripheral blood mononuclear cells isolated from patients was examined and revealed elongated telomeres for N-terminal POT1 mutations in addition to the Q623H C-terminal POT1 mutation (Shi et al., 2014). Despite this one study, it is currently unknown how mutations in the C-terminal domain of POT1 impact the function of POT1 and its role in telomere length regulation. Although they are predicted to disrupt the assembly of the

POT1-TPP1 complex, there is a lack of structural and function data on the assembly of POT1 and

TPP1. Therefore, structural and functional studies the POT1-TPP1 complex will allow us to better understand the role of POT1 C-terminal mutations in telomere dysfunction and cancer.

Figure 1.2 Primary structures of the human POT1-TPP1 and CST complexes.

(A) POT1 and TPP1 naturally occurring mutations recently found in patients with chronic lymphocytic leukemia, familial glioma and melanoma, and Coats plus. POT1 N-terminal mutations are known to disrupt POT1-DNA binding. However, POT1 C-terminal mutations have only been predicted to disrupt POT1-TPP1 binding as there is currently a lack of structural and functional data on the POT1-TPP1 assembly. (B) CTC1 and Stn1 naturally occurring mutations recently found in patients with dyskeratosis congenita and Coats plus. CTC1 is shown with the predicted

OB-fold domains.

1.5 Project goals

To-date, the only structural information we have of human POT1 is of the two N-terminal

OB-folds which mediate POT1-DNA binding. From these high-resolution structures we find that naturally occurring mutations in the N-terminal OB-folds of POT1 disrupt POT1-DNA binding and results in telomere elongation and dysfunctional telomere maintenance. There is currently no structural information on the C-terminal domain of POT1 or how POT1 interacts with TPP1.

Structural and functional studies of the C-terminal domain of POT1 and the POT1-binding domain of TPP1 would allow us to determine the impact of C-terminal mutations on POT1 function as well as to gain further insight on how the POT1-TPP1 complex assembles. The goal of this research is to better understand the mechanism of POT1-TPP1 dependent telomere capping and how naturally occurring mutations within these proteins contribute to cancer. Through the use of X-ray crystallography, biochemical and cell-based assays, we wanted to specifically address the following items:

1. Identify how the C-terminal domain of human POT1 binds and interacts with the

POT1-binding domain of human TPP1.

2. Characterize the C-terminal mutations of POT1 and elucidate their impact on the

function of POT1 in telomere maintenance.

3. Determine how the disruption of the POT1-TPP1 complex contributes to telomere

dysfunction and human disease.

CHAPTER 2

Structure of the human POT1-TPP1 complex and its role in cancer

Summary

To understand the impact of C-terminal mutations on the assembly of function of the

POT1-TPP1 complex at telomeres, we determined the X-ray crystal structure of the C-terminal domain of human POT1 (POT1C) in complex with the POT1-binding domain (PBD) of TPP1. We found that the POT1C forms a bilobal structure consisting of an OB-fold and a holliday junction resolvase domain. The TPP1(PBD) consists of several loops and helices involved in extensive interactions with the bilobal POT1C domain. Biochemical data indicates that several of the naturally occurring mutations in POT1C partially disrupt the POT1-TPP1 complex which, in turn, disrupts the complex’s ability to bind telomeric DNA efficiently. We also show that the POT1C mutations result in telomere elongation and the formation of fragile telomeres, which is known to promote genomic instability that contributes to cancer and disease progression.

2.1 Introduction

The shelterin complex localizes to telomeres through binding both double and single- stranded telomeric DNA (Lei et al., 2004; Loayza et al., 2004). POT1 is unique from the rest of the shelterin complex as it is the only component that binds single-stranded telomeric DNA, and does so with high affinity and specificity (Barrientos et al., 2008; Lei et al., 2004; Loayza et al.,

2004). POT1 binding to telomeric DNA is mediated by its two N-terminal OB-folds and the remaining C-terminal portion is known to interact with TPP1 (Figure 1.2A) (Lei et al., 2003; Xin et al., 2007). Furthermore, TPP1 binding to POT1 enhances its telomeric DNA binding affinity by as much as 10-fold (Abagyan and Totrov, 1994; Nandakumar and Cech, 2012; Taylor et al., 2011;

Wang et al., 2007). Therefore, POT1 can localize to telomeres through binding to telomeric DNA,

TPP1, or a combination of both (Barrientos et al., 2008).

POT1 binding to telomeres caps and sequesters the G’-overhang, thereby preventing

ATR dependent DNA damage response (DDR) and access of telomerase for telomere elongation

(Denchi and de Lange, 2007; He et al., 2014; Hockemeyer et al., 2005; Tong et al., 2015).

However, during S-phase, the POT1-TPP1 complex assembles at telomeres and actually recruits telomerase to the telomeric overhang (Wang et al., 2007; Xin et al., 2007; Zhang et al., 2013).

Human TPP1 is known to make direct contact with telomerase via the N-terminal OB-fold of TPP1

(Figure 1.2A) (Nandakumar et al., 2012). POT1 also mediates the proper loading of telomerase to telomeric DNA by resolving G-quadruplexes; tertiary structures that can impede telomerase activity (Zaug et al., 2005). As a result, the POT-TPP1 complex can enhance the processivity of telomerase, while POT1 alone can function as both a positive and negative regulator of telomerase activity (Colgin et al., 2003; Kelleher et al., 2005; Latrick and Cech, 2010; Lei et al.,

2005; Loayza and De Lange, 2003; Wang and Lei, 2011b; Wang et al., 2007; Zaug et al., 2005).

Though TPP1 binding to POT1 is required for POT1 to function properly at telomeres, the molecular basis of POT1-TPP1 assembly remains relatively uncharacterized. Therefore, we sought to crystalize the human POT1-TPP1 complex. In this chapter, I discuss the high-resolution crystal structure of the human POT1-TPP1 complex and the functional characterization of naturally occurring mutations of the POT1 C-terminal domain. This research allows for a better understanding of how some of these mutations disrupt the function of POT1 and contribute to cancer.

2.2 Results

2.2.1 Structure of the human POT1-TPP1 complex

To study the interacting domains of POT1 and TPP1, we used limited proteolysis and mass spectrometry to identify a stable complex consisting of the C-terminal domain of POT1

(POT1C) and the POT1-binding domain of TPP1 (TPP1(PBD)). POT1C consists of residues 330-

634 and TPP1(PBD) of 255-337. After crystal screening and optimization, we solved the structure of POT1C-TPP1(PBD) by the method of single wavelength anomalous dispersion (SAD) and a

Hg derivative (Table 1). In the structure there was clear electron density for POT1C residues 332-

633 and TPP1(PBD) residues 266-326 (Figure 2.1A).

From the structure we found that POT1C consists of an OB-fold and a holliday junction resolvase domain (HJR) (Figure 2.1A). The canonical binding pocket of the POT1C(OB) is formed through the organization of six b-strands, a common feature of OB-folds, which forms a deep and well defined indentation on the surface of the protein and is occupied by the a3 and a4 helices of the TPP1(PBD) (Figure 2.1). The POT1C(OB) is most similar to the third OB-fold of the

Oxytricha Nova Telomere End-Binding Protein alpha subunit (OnTEBPa, PDB ID: 1OTC), with an

RMSD of 2.2 Å (Figure 2.1B). However, an overlay of the TEBP alpha and beta dimer with that of the POT1-TPP1 structure shows no similarities in the organization of the two heterodimers (PDB

ID: 1OTC (Horvath et al., 1998)).

The POT1C holliday junction resolvase domain (POT1C(HJR)) is an insertion of the OB- fold and consists of seven antiparallel b-sheets surrounded by five alpha helices (a3-7) (Figure

2.1A). The structure of the POT1C(HJR) is most similar to the Archaeoglobus fulgidus holliday junction resolvase domain (AfHJR, PDB:ID 2WIW), with an RMSD 2.7Å (Figure 2.1B), but there are two distinct differences between the POT1 and Af HJRs. One key difference lies within the organization of the helices present in both HJR domains with four out of the five helices not overlapping (Figure 2.1B). Another striking difference lies within the DNA binding pocket of the

AfHJR. We find that the DNA binding pocket in the POT1C(HJR) does not align with the pocket in the AfHJR and is instead occupied by the a3 helix of POT1C (Figure 2.1B).

Interestingly, POT1C contains a Zn2+ ion coordination site mediated by a tetra-cysteine cluster located at the interface of the two domains (Figure 2.1A). The precise function of this site 14

remains to be determined, but it likely contributes in the stability and organization of the POT1C domains. The organization of the POT1C domains generates a long cylindrical structure with an extensive surface area for the TPP1(PBD) to bind (Figure 2.1A). We find that the TPP1(PBD) consists of an extended coil composed of four alpha helices and is organized in an opposite orientation (N- to C-terminal) to that of POT1C. As a result, we find that the N-terminal helix (a1) of TPP1(PBD) interacts with the POT1C(HJR) (Figure 2.1A). Whereas the C-terminal portion of

TPP1(PBD), consisting of helices a3 and a4, interacts with the canonical binding pocket of the

POT1C(OB) (Figure. 2.1A). Consequently, all of the helices and loops throughout the TPP1(PBD) form numerous interactions with POT1C, with many side chains of TPP1 found buried in large hydrophobic pockets of POT1C (Figures 2.1 and 2.2).

Figure 2.1 Structure of the human POT1-TPP1 complex.

(A) Cartoon representation of crystal structure of the POT1C-TPP1(PBD) complex; POT1C is shown in light blue color with the OB-fold and HJR of POT1C labeled above each motif; the

TPP1(PBD) is shown in green color (PDB ID: 5UN7). The Zn2+ ion (yellow) is coordinated by 4 cysteines (C382, C385, C503 and C506 - stick). (B) Overlay of POT1C and the Oxytricha nova

TEBPa OB-fold (OnTEBPa - cyan color, PDB ID: 1OTC (Horvath et al., 1998)) and the

Archaeoglobus fulgidus HJR (AfHJR - magenta color; PDB ID: 2WIW).

Table 1: Data collection and refinement statistics for POT1C-TPP1(PBD)

2.2.2 Structural analysis of POT1C mutations

Recently, POT1 has been shown to be frequently mutated in cases of chronic lymphocytic leukemia (CLL) and familial cases of melanoma and glioma (Bainbridge et al., 2015;

Ferrandon et al., 2013; Lin et al., 2010; Ramsay et al., 2013; Robles-Espinoza et al., 2014; Shi et al., 2014). Mutations in the N-terminal OB-folds of POT1 disrupt DNA binding and result in aberrant telomere elongation and phenotypes associated with telomere uncapping, such as chromosome fusions and fragile and missing telomeres (Bainbridge et al., 2015; Ramsay et al.,

2013; Robles-Espinoza et al., 2014; Shi et al., 2014). Although the POT1 C-terminal mutation,

Q623H, has been shown to result in elongated telomere is patients (Shi et al., 2014), the structural ramifications of this mutation and other mutations in POT1C remain uncharacterized.

The majority of mutations found in the POT1C domain are somatic mutations and are so far only found in cases of CLL (L343F, P446Q, P475L, R477T and C591W) (Table 2) (Ramsay et al., 2013). However, the A532P and Q623H mutations are germline and have only been reported in cases of familial glioma and melanoma (Table 2) (Shi et al., 2014). In the structure we find that

P446 is critical for TPP1 binding, as it lies within a key region of a loop that joins the HJR strands b6 and b7 and coordinates L271 of the N-terminal helix a1 of TPP1 (Figure 2.2A). Mutating this proline to glutamine would destabilize this loop and therefore disrupt the pocket in which the N- terminal helix a1 of TPP1 interacts with the HJR of POT1. On the other hand, P475 is located in the core of the HJR, in b8, and helps contribute to the fold of the HJR (Figure 2.2B). Therefore, the proline to leucine mutations would most likely lead to a subtle perturbation of structural elements of the HJR resulting in the re-organization of the a5 helix, which makes extensive interactions with the a1 helix of TPP1 (Figure 2.2B).

As for C591, we find this residue is located at the C-terminal a8 helix, which spans the entire side of the OB-fold and is involved in the organization of this domain in POT1C (Figure

2.2C). Furthermore, the N-terminal portion of the POT1C a8 helix also makes extensive interactions with the a2 helix of TPP1 as well as forming a pocket for the W293 side chain of

TPP1 to bind. Therefore, a displacement of the a8 helix of POT1C, from the cysteine to tryptophan mutation, would likely lead to a reorganization in this region of the OB-fold and disrupt

TPP1 binding. From the structure we also find that Q623 is located in the center of the canonical binding pocket of the POT1C OB-fold, which directly interacts with the backbone of the a3 helix of

TPP1 that is coordinated by the solvent accessible side chains (Figure 2.2D and E). We predict that the introduction of a larger hydrophobic side chain, such as histidine, would likely lead to the loss of hydrogen binding that is created by the NE2 of Q623 in POT1 with the carboxyl of L313 in

TPP1 (Figure 2.2D and E). As a result, the Q623H mutation would likely disrupt POT1-TPP1 binding. Lastly, we find that I535 is located in the POT1C(HJR) in a7 with the hydrophobic side chain being buried into the core of this region in POT1C. The introduction of the larger phenylaline side chain at I535, such as phenylalanine, would likely lead to the destabilization in the core of the HJR domain (Figure 2.2F).

Unlike P446Q, P475L, I535F, C591W, and Q623H, it is unclear how the L343F, R477T, and A532P POT1C mutants contribute to human disease (Figure 2.2E and F). From the structure we find that L343 comprises part of a loop that connects b1 to a1 in the POT1C (OB) (Figure

2.2E). Although L343 is important for the structural organization of this loop, it does not make direct contacts with TPP1 and that mutating this leucine to phenylalanine would not likely disrupt

POT1-TPP1 binding (Figure 2.2E). Similarly, we find that R477 is part of b8 and is located at the opposite face where the a1 helix of TPP1 binds the POT1C(HJR) (Figure 2.2F). R477, unlike

L343, is solvent exposed and does not interact with TPP1, with the nearest point of contact with

TPP1 being approximately 18 Å away. We also find that like R477, A532 is located on the opposite side of the HJR domain of POT1C.

Figure 2.2 Interactions between POT1C and TPP1l; POT1C mutations are highlighted.

(A) The POT1C(HJR) (blue) forms extensive interaction with the leucine rich a1 of TPP1(PBD)

(green). The P446Q mutation site is shown in magenta. (B) P475L mutation site (magenta) is located in the core of the POT1C(HJR) domain. (C) The C591W mutation (magenta) site in the a8 helix of the POT1C(OB). The a8 helix makes extensive interactions with the a2 helix of TPP1 and forms a pocket for the W293 side chain of TPP1 to bind (D) The Q623H mutation (magenta) is located in the core of the POT1C(OB) binding pocket and makes direct contacts with L313 of

TPP1. (E) The POT1C(OB) binding pocket forms extensive interaction with the a3 and a4 helices of TPP1(PBD). The L343F and Q623H mutations are shown in magenta. (F) The R477T, A532P, and I535F (magenta) are located in the POT1C(HJR).

Table 2: Reported cases of POT1C mutations in cancer.

2.2.3 Several POT1C mutations partially disrupt the POT1-TPP1 complex

To determine the impact of POT1C mutations on the assembly of the POT1-TPP1 complex, we measured the binding affinity of each mutant to the TPP1(PBD) using Isothermal

Titration Calorimetry (ITC). For these binding experiments, we overexpressed the POT1C and

TPP1(PBD) constructs we used in crystallographic studies and purified them separately using three successive steps of purification as described in the methods section of this chapter (Figure

2.3A and B). Of note, all of the mutant POT1C proteins were expressed in sufficient quantities for the ITC assay, except for the I535F mutant, which did not express stably (Figure 2.3B).

From the ITC assay, we found that the wildtype POT1C and TPP1(PBD) bound with nanomolar affinity (Kd = 120 ± 16 nM – Figure 2.4A and Table 3). Out of all the POT1C mutants we tested, only the P446Q, C591W, and Q623H mutants displayed a significant loss of affinity to

TPP1 (2.4, 7.9, and 3.9-fold change, respectively – Figure 2.4C, G, H, I and Table 3). P475L did display a marginal decrease in TPP1 binding (1.4-fold change, Figure 2.4D and Table 3) but was

not statistically significant (P = 0.22, Figure 2.4I). The remaining POT1C mutants, L343F, R477T, and A532P displayed wildtype TPP1(PBD) affinity (1-fold change – Figure 2.4B, E, F and I and

Table 3).

An analysis of the overall enthalpic and entropic components of wild type POT1C and

TPP1(PBD) binding reveal that is comprised of favorable enthalpic-driven interactions, as indicated by the negative binding enthalpy (DH = -68.12 kcal/mol), that is typically mediated by hydrogen-bonding and van der Waals interactions (Table 3) (Velazquez-Campoy et al., 2015).

The increase in entropy is an unfavorable contribution to binding that is usually associated with conformational restrictions (-TDS = 58.74 kcal/mol) (Table 3). The overall contribution of enthalpic and entropic components is represented by the change in free energy (DG), where wild type

POT1C-TPP1(PBD) binding displays a negative and favorable free energy change of approximately -9.38 kcal/mol (Table 3). In contrast, the P446Q, C591W, and Q623H mutants display a decrease in binding energy (DG = -8.9, -8.16, and -8.64 kcal/mol, respectively) compared to wild type binding due to an increase in unfavorable conformational changes (-TDS)

(Table 3).

Figure 2.3 Expression and purification of POT1C mutants.

(A) SDS-PAGE of purified TPP1(PBD) and wild type (WT) and mutant POT1C proteins (Q623H,

L343F, P446Q, and R477T) for use in the ITC binding experiments. (B) SDS-PAGE of purified

WT and mutant POT1C proteins (P475L, A532P, I535F, and C591W) for use in the ITC binding experiments. Of note, the P475L, A532P, and C591W had slight decrease in expression levels and the I535F mutant had significantly lower levels of expression compared to WT POT1C.

Figure 2.4 ITC binding data for the POT1C and TPP1(PBD) proteins.

(A – G), ITC binding data of wild type (WT) and mutant (L343F, P446Q, P475L, R477T, A532P,

C591W and Q623H) POT1C with TPP1(PBD). (I) Bar graph of binding constants (Kd, µM) for WT and mutant POT1C proteins derived from the fitted ITC data. Two-tailed Student’s t-test with respect to WT: *P < 0.05, **P < 0.01. The data clearly shows that the POT1C, P446Q, C591W and Q623H mutations reduce TPP1 binding. 24

Table 3: ITC binding data for wild type and mutant POT1C proteins with TPP1(PBD)

2.2.4 POT1C mutants do not alter telomerase processivity

To determine if the POT1C mutants disrupted telomerase processivity, we performed direct telomerase activity assays using super telomerase extracts. Super telomerase extracts were prepared by lysing HEK293T cells over-expressing human TERT and TER (hTERT and hTER plasmids were a gift from the Lingner lab) (Cristofari and Lingner, 2006). Super telomerase extracts were then supplemented with saturating amounts of POT1 (wild type or mutant) and

TPP1. We purified full-length POT1 and a stably expressed N-terminal truncation of TPP1 consisting of residues 87-544 (TPP1(87)) from E. coli to supplement extracts (Figure 2.5A). We also performed direct assays using cell extracts co-expressing full-length POT1 and TPP1 with human telomerase in HEK293T cells (Figure 2.5B). A detailed summary of how we carried out the direct assay reactions is explained in the methods sections of this chapter.

The use of both E. coli purified and co-transfected POT1 and TPP1 proteins with super telomerase extracts produced increased telomerase processivity only when POT1 and TPP1 were both present (Figure 2.5C and D). Surprisingly, all of the POT1C mutants showed wild type telomerase processivity, with no statistically significant differences (Figure 2.5C-F). Even the

POT1C mutants, P446Q, C591W, and Q623H, which displayed a significant loss of affinity for

TPP1(PBD) in the ITC assays (Table 3), also had wildtype telomerase processivity within the margin of error (Figure 2.5E and F). 25

Figure 2.5 Direct telomerase activity assays

(A) SDS-PAGE gel for the 2 µg of super-telomerase extract (STE) and 150 nM of E. coli purified full-length POT1 (flPOT1) and TPP1(87) proteins used in the direct assay of panel c. The red arrow indicates where TERT is expected to run (~130 kDa). (B) Western blot of HEK293T lysates used in the direct assay of panel d. (C) Telomerase direct activity assay using 2 µg of STE supplemented with150 nM of purified wild type (WT) or mutant flPOT1 and WT TPP1(87) (D)

Telomerase direct activity assay using 5 µg of STE co-transfected with WT or mutant flPOT1 and

WT full-length TPP1 (flTPP1). The number of telomeric repeats added to the primer are indicated on the right of the gels C and D. (E and F), Quantification of telomerase processivity of panels C and D respectively; The values are the average of two independent experiments; error bars indicate standard deviation.

2.2.5 Partial disruption the POT1-TPP1 complex reduces POT1-DNA binding

TPP1 binding to POT1 is known to enhance the affinity of POT1 for telomeric DNA

(Nandakumar and Cech, 2012; Taylor et al., 2011). Therefore, we wanted to determine if any of the POT1C mutations would disrupt the DNA binding affinity of POT1 in the presence of TPP1.

To test this, we performed Fluorescence Polarization (FP) assays using a labeled DNA probe consisting of three telomeric repeats ((TTAGGG)3, 18mer) and the POT1C and TPP1(PBD) proteins used for structural and ITC experiments (Figure 2.3A). We also tested wild type and mutant (P446Q, C591W, and Q623H) full-length POT1 alone in addition to the wild type and mutant full-length POT1-TPP1 complexes used in the direct telomerase assays (Figure 2.5A).

The FP binding assays show that POT1C, TPP1(87) and the POT1C-TPP1(PBD) complex do not bind single-stranded telomeric DNA (Figure 2.6A and C). We also found that the wild type and mutant (P446Q, C591W, and Q623H) full-length POT1 proteins bind single- stranded telomeric DNA with similar affinity (approximate Kd = 20 nM, Figure 2.6B, D and Table

4). Consistent with previously published reports, the FP assays show that the DNA affinity of wildtype POT1 is enhanced in the presence of TPP1, where the wild type POT1-TPP1 complex binds single-stranded telomeric DNA with low nanomolar affinity (Kd = 5.8 ± 0.5 nM, Figure 2.6C

– D and Table 4) (Lei et al., 2004; Wang et al., 2007). Interestingly, the POT1C mutants that have wildtype TPP1 binding affinity according to the ITC assays (L343F, R477T, and A532P, Table 3) all display a similar affinity for telomeric DNA as the wildtype POT1-TPP1 complex (Figure 2.6C,

D and Table 4). In contrast, the P446Q, P475L, C591W, and Q623H POT1C mutants, which disrupt POT1C-TPP1(PBD) binding, all display a decrease in DNA binding affinity for the POT1-

TPP1 complex (1.8, 1.8, 2.7, 1.5-fold change, respectively – Figure 2.6C, D and Table 4).

Figure 2.6 POT1-TPP1 telomeric DNA binding assays.

(A) FP assays of POT1C and POT1C-TPP1(PBD) complex with single-stranded DNA probe consisting of 3 telomeric repeats (18mer). (B) FP assays of the wild type (WT) and mutant (those that partially disrupt the POT1-TPP1 complex P446Q, C591W and Q623H) flPOT1 with the

18mer DNA probe. (C) FP assays of the WT and mutant flPOT1 + TPP1(87) complex with the

18mer. (D) Bar graph showing the differences in Kd (nM) between the WT and mutant flPOT1 and flPOT1-TPP1(87) complex. Two-tailed Student’s t-test with respect to WT POT1-TPP1(PBD) complex: *P < 0.05, **P < 0.01.

Table 4: FP assay binding data for POT1 and TPP1 proteins with telomeric 18mer.

2.2.6 POT1C mutations do not affect the localization of POT1 to telomeres

Since POT1 is known to localize to telomeres through its interaction with TPP1 and DNA, we wanted to determine if the POT1C mutants were able to localize to telomeres. In collaboration with Dr. Susan Janicki’s lab, we first co-expressed YFP-tagged wild type and mutant POT1 with mCherry-tagged TRF2 in HEK293T cells. We then used confocal microscopy on fixed cells co- expressing the fluorescently labeled POT1 and TRF2 proteins to determine if the POT1C mutants would co-localize to telomeres with TRF2. We also performed western blot analysis of transfected

HEK293T cells to validate the expression of the wildtype and mutant YFP-tagged POT1 proteins

(Figure 2.7A). Surprisingly, all of the POT1C mutants co-localized with TRF2 (Figure 2.7B). In conclusion, none of the POT1C mutants we tested disrupt the ability of POT1 to localize to telomeres. This is consistent with studies of N-terminal POT1 mutants that also disrupt POT1-

DNA binding, but still localize to telomeres (Ramsay et al., 2013).

Figure 2.7 Cell imaging for localization of wild type and mutant POT1 to telomeres.

(A) Western blot showing the levels of YFP tagged, wild type (WT) and mutant (L343F, P466Q,

P475L, R477T, A532P, I535F, C591W and Q623H) full length POT1. We used GFP (aGFP) or

POT1 (aPOT1) to detect the levels the YFP-POT1 in each cell line. GAPDH was used as a loading control. (B) Maximum projection images of co-localization of YFP-POT1 (green) and

Cherry-TRF2 (red) proteins are shown. Merged images include DAPI. Scale bar = 5µm. The data clearly shows co-localization of WT and mutant flPOT1 proteins to telomeres.

2.2.7 Partial disruption of the POT1-TPP1 complex results in telomere elongation

To determine the impact of POT1C mutations on telomere length regulation in cells, we performed Southern blot analysis on genomic DNA purified from HEK293T cells stably infected and expressing wild type and mutant full-length POT1 proteins. Endogenous levels of POT1 were reduced using a shRNA targeting the 3’UTR of POT1 (shPOT1, TRCN0000009837 - Sigma

Mission shRNA library) (Figure 2.8A). HEK293T cells were infected with lentivirus prepared with shPOT1 (pLKO.1 vector, puromycin resistance) and wildtype or mutant POT1 vectors (pLU vector, blasticidin resistance) and stably selected using puromycin and blasticidin. For controls, we utilized cells transfected with empty vectors (pLKO.1 and pLU vectors), wild type POT1 with the shPOT1, and shPOT1 treated cells with empty pLU vector (Figure 2.8A and B).

We determined by western blot analysis that wild type and mutant full-length POT1 were expressed at similar levels in the presence of shPOT1 (Figure 2.8B). The Southern blot data shows significant telomere elongation in the shPOT1 treated cells compared to marginal increases observed in wild type POT1 cells (Figures 2.8C-F). For the C591W and Q623H POT1C mutants we observed elongated compared to the wild type POT1 cells after 120 population doublings (Figures 2.8C-E). In addition, the L343F mutant also displayed a subtle elongation in telomere length. In contrast we observed wildtype changes in telomere length for the R477T,

A532P, P475L, and I535F (Figures 2.8C, D, and F).

Figure 2.8 Southern blot analysis of wild type and mutant POT1.

(Caption continues on next page)

Figure 2.8 Southern blot analysis of wild type and mutant POT1 (continued).

(A) Quantitative RT-PCR showing knock down of endogenous POT1 mRNA, normalized to

GAPDH transcript levels, after lentiviral infection of HEK293T cells with shPOT1 and wild type

(WT) Flag-POT1; selection was carried out with puromycin and blasticidin; ± s.d. (n = 3). (B)

Western blot showing WT and mutant POT1 protein expression levels in HEK293T cells expressing shPOT1 and Flag-POT1. Cells infected with the empty pLU and pLKO.1 lentiviral vectors are used as controls. (C - E) Southern blots of HEK293T cells expressing shPOT1 and

WT or mutant flPOT1. DNA from 5, 50 and 120 populations doublings (PD) is shown. HEK293T cells treated with only shPOT1 range from 5, 30, and 70 population doublings. DNA length standards are indicated along the left of each gel. The white dashed line indicates the baseline telomere length for the vector control. Green (vector control), yellow (WT and shPOT1 treated cells), and red (POT1 mutants) dots show mean telomere length at each PD. (F) Quantification of the mean telomere length (kb) from panel C-E across population doublings (PD) was performed with TeloTool (Gohring et al., 2014). Green (control), yellow (WT and shPOT1 treated cells), and red (POT1 mutants) dots show mean telomere length at each PD. Black bars indicate the range of telomere restriction fragments (TRF) at each PD.

2.2.8 POT1C mutations lead to fragile telomeres

N-terminal mutations of POT1, which disrupt POT1-DNA binding are reported to cause telomere elongation and chromosome fusions, fragile telomeres, and missing telomere signal at the ends of chromosomes (Ramsay et al., 2013; Robles-Espinoza et al., 2014; Shi et al., 2014).

To examine the integrity of telomeres in cells expressing the POT1C mutants, we preformed

Fluorescence in situ Hybridization (FISH) by preparing metaphase spreads from the same stable

cell lines as those used in the Southern blot analysis (Figure 2.8B). Metaphase spreads after 50 population doublings were prepared by fixing chromosomes to microscope slides and hybridizing the telomeres with a 5′ TelC-Tamra peptide nucleic acid (PNA) probe ((CCCTAA)3-Tamra,

Panagene). Chromosomal DNA was then stained with DAPI and images were taken with Nikon

E600 upright fluorescent microscope.

The frequency of chromosome fusions, fragile telomeres, and telomere free ends were then recorded as a percentage of all the metaphase chromosomes counted, with an average of

500 chromosomes counted for each sample. The HEK293T cells carrying the empty vectors displayed an average of 2-3% of chromosomes with fusion, fragile, and missing telomeres, comparable to the amount observed in the wild type POT1 cell line (Figure 2.9). Elevated levels of chromosome fusions were only observed in cell lines expressing the L343F (7%) and I535F

(5%) mutants (Figure 2.9). Interestingly, all mutants showed an increased level of fragile telomeres (L343F, 9%; P446Q, R477T and Q623H, 9%; P475L and C591W, 10%) compared to the low frequency observed for the empty vector and wild type POT1 controls (approximately 3%)

(Figure. 2.9B and D). We also observed an increase in the occurrence of missing telomeres in the

L343F (7%), R477T (7%), and I535F (12%) mutant cell lines (Figure 2.9B and E).

Figure 2.9 Fluorescence in situ Hybridization (FISH) data.

(A) Telomeric FISH metaphase spreads of cells expressing wild type (WT) and mutant (L343F,

P466Q, P475L, R477T, A532P, I535F, C591W and Q623H) flPOT1 proteins after 50 population doublings (Red, TelC-Tamra; blue, DAPI). Endogenous POT1 levels were reduced with shPOT1.

Telomere fusions (fused chromosome ends), fragile telomeres (multiple telomere signals) and missing telomeres (no telomere signal) are indicated by red, pink and green arrows respectively.

Scale bar is 5 µm. (B-D), Quantification and examples of telomere fusions, fragile, and missing telomeres from the metaphase spreads of panel A. Bars indicate the percent of metaphase events. Error bars are indicating standard deviation. An average of 500 chromosomes was counted in each experiment. 35

2.3 Discussion

Naturally occurring mutations in POT1 have been linked to human cancer and are located throughout the entire protein (Figure 1.2B and Table 2) (Bainbridge et al., 2015; Lin et al.,

2010; Ramsay et al., 2013; Robles-Espinoza et al., 2014; Shi et al., 2014). The N-terminal OB- folds of POT1 mediate DNA binding and mutations in this region of POT1 disrupt POT1-DNA binding and result in dysfunctional telomere maintenance (Bainbridge et al., 2015; Ramsay et al.,

2013; Robles-Espinoza et al., 2014; Shi et al., 2014). The C-terminal domain of POT1 binds

TPP1 and POT1-TPP1 binding is known to enhance the DNA affinity of POT1 (Abagyan and

Totrov, 1994; Barrientos et al., 2008; Nandakumar and Cech, 2012; Taylor et al., 2011; Wang et al., 2007). We speculate that mutations which disrupt POT1-TPP1 assembly will indirectly affect

POT1-DNA binding. Furthermore, since the POT1-TPP1 complex also enhances the processivity of telomerase, we hypothesize that mutations disrupting POT1-TPP1 assembly will decrease telomerase processivity (Lei et al., 2004; Loayza et al., 2004; Wang et al., 2007).

The structure of the POT1C-TPP1(PBD) complex presented here allows us for the first time to understand how POT1 and TPP1 interact. We also find that several of the POT1C mutations are directly or indirectly involved in critical interactions between the POT1C and

TPP1(PBD). ITC and FP binding assays reveal that some of these mutants (P446Q, P475L,

C591W and Q623H) partially disrupt the POT1-TPP1 complex and reduce the affinity of the complex for telomeric DNA (Table 3 and 4). Furthermore, Southern blot analysis shows longer telomeres in mutants (C591W and Q623H) which significantly disrupt the POT1-TPP1 assembly

(Figure 2.8). We postulate that partial disruption of the POT1-TPP1 complex prevents the proper assembly of the complex at telomeres and leads to a misregulation of telomerase access, thus resulting in longer, fragile telomeres. This is in agreement with a previous report which demonstrated that reduced affinity of the POT1-TPP1 complex for telomeric DNA leads to telomere elongation due to persistent access of telomerase to the telomeric overhang (Loayza and De Lange, 2003). Finally, the POT1C mutants that disrupt the POT1-TPP1 complex also 36

show elevated levels of missing and fragile telomeres (Figure 2.9), which is consistent with reports that unregulated telomere length leads to chromosomal abnormalities (Bailey and

Murnane, 2006; Sfeir et al., 2009; Webb CJ, 2013).

Interestingly, none of the POT1C mutations appear to affect telomerase processivity, even those which significantly reduce the assembly of POT1 and TPP1 (P446Q, C591W, and

Q623H) (Figure 2.5C-F). Cell imaging experiments also show that all of the POT1C mutants still localize to telomeres (Figure 2.7). Although surprising, a complete deletion of the first N-terminal

OB-fold or the entire C-terminal domain of POT1 still results in localization of POT1 to telomeres

(Barrientos et al., 2008; Liu et al., 2004; Loayza and De Lange, 2003). However, POT1 localization to telomeres is hindered when TPP1 is depleted or when the POT1-TPP1 interaction is completely disrupted (Liu et al., 2004). In addition, several of the POT1C mutations we examined (L343F, A532P, and R477T) do not disrupt the assembly of the POT1-TPP1 complex.

The precise role of these mutations is currently unclear and further studies are required to better understand their impact on the function of the POT1-TPP1 complex and telomere maintenance.

Nevertheless, we observed phenotypes of telomere dysfunction in all of the POT1C mutants. Specifically, we observed fragile telomeres in all mutants, while in some mutants we also observed defects in telomere length and missing or fused telomeres. Taken together, the data clearly shows that there is a confluence of factors that contribute to the disruption of the

POT1-TPP1 complex by mutations found in the C-terminal domain of POT1. It is also worth noting that, so far, many POT1 mutations are heterozygous and therefore cells still contain one wild type copy of the POT1 allele (Table 2). Furthermore, POT1 mutations typically occur in combination with an array of other defective genes known to predispose patients to malignant disease, such as: CDKN2a, CDK4, BAP1, Notch1, SF3B1, TP53, and ATM (Bainbridge et al.,

2015; Ramsay et al., 2013; Shi et al., 2014; Trigueros-Motos, 2014). Therefore, it is apparent that

developing mutations in POT1 contributes to the driving nature and prognosis of malignant disease among other factors.

Telomere length regulation is a vital for maintaining proper telomere length and preserving telomere stability (Rivera et al., 2017). Like N-terminal POT1 mutants, we observed elongated telomere length for the two most severe POT1C mutants (C591W and Q623H) and in all of the mutants we do observe phenotypes of telomere dysfunction. Although the defects we observe in POT1C mutants are not severe, dysfunctional telomere maintenance can result in genome instability overtime, which can contribute to the clonal evolution and development of cancer (Feldser et al., 2003). Reports have linked elongated telomeres to an increased risk of adult glioma, melanoma, CLL, and other carcinomas (Anic et al., 2013; Ojha et al., 2016; Walsh et al., 2015). On the other hand, short telomeres promote genome instability and are also reported to drive tumor progression and be linked to a poor disease prognosis in CLL patients

(Lin et al., 2010; Lin et al., 2014). There is clearly a link between the misregulation of telomere length and the dysfunction of telomeres, however the direct mechanism of how this contributes to the human disease is still not fully understood. Therefore, understanding how POT1 regulates telomere length will enable us to better understand how telomere length contributes to genome instability, aging, and the development of cancer.

2.4 Materials and methods

2.4.1 Protein expression and purification

Human POT1C, comprising residues 330-634, was identified via limited proteolysis and cloned into a pET28b vector containing a N-terminal hexahistidine - pMocr fusion tag, cleavable by TEV protease. The TPP1(PBD) construct was designed to contain residues 255-337 and was cloned into a pET28b vector containing a N-terminal hexahistidine tag cleavable by TEV

protease. Both POT1C and TPP1(PBD) were overexpressed in Escherichia coli ScarabXpress T7 lac competent cells (Scarab Genomics) at 18ºC and 30ºC for 4 hours, respectively, using 1 mM

IPTG (isopropyl-β-D-thiogalactopyranoside; Gold Biotechnology). The cells were harvested by centrifugation and lysed in a buffer containing 25 mM Tris-HCl, pH 7.5, 1.0 M KCl, 1.0 M Urea,

5% glycerol, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1 mM benzamidine (Ni Buffer A) via sonication. The proteins were purified over a Ni-nitrilotriacetic acid (Ni-NTA) column, buffer exchanged while on the Ni-NTA column with 25 mM Tris-HCl, pH 7.5, 0.2 M KCl, and 5% glycerol

(Ni Buffer C). The complex was eluted with 300 mM imidazole onto a tandem HS(poros) –

HQ(poros) columns (Applied Biosystems) equilibrated with Ni Buffer C. The HS-HQ columns were then detached and the POT1C-TPP1(PBD) complex was eluted from the HQ column with a salt gradient of 0.2 M KCl to 1.0 M KCl. The fusion tags were cleaved by TEV overnight at 4°C and removed from the sample by an additional step of Poros-HS and HQ. The clean complex was passed over a Superdex S200 (GE Healthcare) to remove any aggregates.

Full-length wild type and mutant POT1 were cloned into the same vector as POT1C.

TPP1(87-544) was cloned into a pET28b vector containing an N-terminal hexahistidine-MBP

(maltose binding protein) cleavable by TEV protease. POT1 and TPP1 were overexpressed separately in ScarabXpress cells at 18º C overnight using 1 mM IPTG. The cells were harvested by centrifugation and lysed in Ni buffer A via sonication. The proteins were first purified over a Ni-

NTA column and then eluted onto an amylose column (New England Biotech) to further purify the

POT1 – TPP1 complex and remove excess POT1 before eluting with a buffer containing 25 mM

Tris-HCl, pH 7.5, 0.5 M KCl, 5% glycerol, 1 mM DTT and 30 mM maltose. The fusion tags were cleaved with TEV protease overnight at 4oC. The POT1-TPP1 complex was then buffer exchanged to remove the maltose and passed over an orthogonal Ni-NTA and amylose column to remove any residue fusion tags and TEV protease from the samples. The purified full-length

POT1-TPP1 complex was then concentrated and ran on an SDS-PAGE gel with known

concentrations of BSA standard and quantified using ImageQuant TL (GE Healthcare) to determine the concentration of the complex.

2.4.2 Protein crystallization and structure determination

POT1C-TPP1(PBD), crystal screening produced a crystal hit under sitting-drop vapor diffusion at room temperature in a crystallization buffer containing 2.4 M KCl, 50 mM K/Na

Tartrate, 20 mM BaCl2, and 0.1 M Sodium Citrate, pH 5.5. A longer construct of POT1C consisting of residues 325-634 produced a different crystal form that belonged to the P1 space group and diffracted to 3 Å at best. The new crystal form belongs to the P4122 (sg91, 1 copy in asymmetric unit) and diffracted to 2.1 Å. The native dataset (containing Zn) was collected from 2 crystals at 1.03317 Å wavelength at BL12-2 SSRL to 2.1 Å resolution. The radiation damage was slowed with a careful absorbed dose estimate, allowing high multiplicity and accumulating a significant anomalous signal from the present Zn and Sulfurs in the protein. Both the native and derivative data were processed with XDS (autoxds script at SSRL) with a zero dose correction.

We solved the structure using a single methyl mercury (meHg) derivative using the SAD approach as implemented in SHELXCDE using the graphical interface of the HKL2MAP software.

SHELXD identified 5 well defined Hg sites and SHELXE extended and optimized the initial phases to 2.1 Å and generated a preliminary structure of 330 residues with excellent contrast

(0.943) and connectivity (0.843) resulting in FOM of 0.605. Subsequently the model was traced using 10 cycles of BUCCANEER. The resulting model was almost complete - 358 sequenced residues. The remaining model was improved in COOT and refined with BUSTER (version

2.10.2). The refinement converged to R/Rfree = 17.3/19.3 % to 2.1 Angstrom resolution. The model has excellent stereochemistry as examined by MOLPROBITY server

(http://molprobity.biochem.duke.edu/).

2.4.3 Isothermal Titration Calorimetry (ITC)

We carried out ITC experiments on a MicroCal iTC200 (Malvern) using separately purified TPP1(PDB) and wild type and mutant POT1C proteins. The purified proteins were buffer exchanged into a buffer containing 25 mM Hepes, pH 7.5, 0.1 M KCl, 5% glycerol, and 1 mM

TCEP. Protein concentration was measured using a Bradford Assay (Bradford, 1976).

TPP1(PBD) at a concentration of 100 µM was injected into a cell containing 10 µM Pot1-C. For the ITC experiment, the cell of the calorimeter was kept at 25° C (298.15 K), and the volume of each injection was 2.47 µL with a total of 16 injections. Analysis of the ITC data used the Origin analysis software (GE Healthcare) to obtain binding constants and ratios. Binding constants (Ka), reaction stoichiometry (n), binding enthalpy (DH), and entropy change (DS) were obtained from the Origin analysis software used to fit the ITC data using a one-site binding model. The binding free energy change (DG) was determined with the following equation:

DG = -RT ln Ka = DH - TDS

2.4.4 Fluorescence Polarization (FP) Assays

We performed FP DNA binding assays using an Envision Xcite Multilabel Plate

Reader (Perkin Elmer). 20 µl binding reactions were carried out in a buffer containing 20 mM

Hepes, pH 7.5, 100 mM KCl, 2 mM MgCl2, 1 mM EDTA, 2 mM DTT, 1 mg/mL BSA, 5% v/v glycerol, and 75 nM polyT50 competitor (IDT). The 18mer DNA probe

(TTAGGGTTAGGGTTAGGG) was purchased with a 5′ 6-FAM label from IDT. The final probe concentration used was 2.5 nM, while the POT1-TPP1 protein concentration ranged from 0 to

100 nM or POT1C-TPP1(PBD) concentrations ranged from 0 to 5 µM. The reactions were incubated at room temperature for 30 minutes and pipetted in triplicate into a black 384 well optiplate (PerkinElmer). The reactions were excited with 480 nm light and the emissions were

measured at 535 nm light. The milipolarization (mP) values were calculated by the Envision operating software (PerkinElmer). The data was fit and the binding constants were determined with a one-site binding, nonlinear regression model using PRISM 5.0 (GraphPad Software, San

Diego California USA, www.graphpad.com).

2.4.5 Human Cell Culture

The wild type and mutant full-length human POT1 genes were cloned in the pLU-EF1A- iBlast (pLU) vector with an N-terminal 1xFlag tag and 4 µg of vector was used to transfect HEK

293T cells using lipofectomine 2000® (Invitrogen) to test expression. HEK293T cells were cultured in growth medium containing Dulbecco’s modified Eagle medium (Cellgro) supplemented with 10% fetal bovine serum (Sigma) and 100 units ml−1 penicillin and 100 µg ml−1 streptomycin

(Sigma). All human cells were cultured at 37° C with 5% CO2 and harvested 48 hours after transfection.

Stable HEK293T cell lines over-expressing 1xFlag-POT1 were carried out using lentiviral infection to deliver wild type and mutant human POT1 genes in the pLU vector with blasticidin resistance. A pLKO.1 vector with puromycin resistance carrying the shRNA (TRCN0000009837) targeting the 3’UTR of endogenous POT1 (shPOT1) was obtained from the Sigma Mission shRNA library and was delivered with lentiviral infection. Lentiviral particles were prepared by lipofectomine 2000® (Invitrogen) transfection of HEK293T cells with the pLU or pLKO.1 and lentiviral production vectors. Growth media was spiked with 5 µg/mL blasticidin S, and 2 µg/mL puromycin.

2.4.6 Western Blot

For the western blot analysis of HEK293T cells co-transfected with hTERT, hTER, POT1 and TPP1, standard immunoblot protocols were used with the following antibody dilutions: anti- human TERT (Abbexa, 1:1000), anti-human POT1 antibody (Abcam, 1:1000 dilution), anti-human

ACD (Sigma, 1:1000 dilution), anti-Actin antibody conjugated to HRP (Abcam, 1:1000 dilution), and secondary HRP-conjugated anti-sheep IgG (Santa Cruz, 1:1000) and anti-rabbit IgG (GE

Healthcare, 1:1000 dilution) were used to detect the human TERT and human POT1 and TPP1 antibody, respectively.

For western blot analysis of HEK293T cells stably expressing shPOT1 and wild type and mutant POT1 proteins, standard immunoblot protocols were used with the following antibody dilutions: anti-human POT1 antibody (Sigma, 1:1000 dilution), anti-GAPDH antibody conjugated to HRP (2118S; 1:5000; Cell Signaling Technology, Danvers, MA), and secondary HRP- conjugated anti-rabbit IgG antibody (GE Healthcare, 1:1000 dilution) was used to detect the human POT1 antibody

For the western blot analysis of YFP tagged wild type and mutant POT1, standard immunoblot protocols were used with the following antibody dilutions: anti-GFP antibody

(11814460001 ROCHE, 1:2000; Sigma Aldrich), anti-human POT1 antibody (ab21382, 1:1000;

Abcam, Cambridge, MA), anti-GAPDH antibody conjugated to HRP (2118S; 1:5000; Cell

Signaling Technology, Danvers, MA), and secondary HRP-conjugated anti-rabbit IgG antibody

(GE Healthcare, 1:1000 dilution) was used to detect the human POT1 antibody.

Detection of antibody signal was done with chemiluminescence activated using 2 mL of

Luminata Forte Western HRP Substrate (Millipore). The signal was detected and developed with a Fuji LAS-3000 scanner. Western blot signals were quantified using ImageQuant TL (GE

Healthcare) and normalized using the b-Actin or GAPDH signal as a loading control.

2.4.7 Reverse Transcription PCR and quantitative PCR analyses

To test the effectiveness of the shRNA targeting the 3’UTR of endogenous POT1, we collected RNA from cells treated with shRNA by lysing pelleted cells in TRizol (Life Technologies) and purified RNA using the Direct-zol RNA mini prep kit (Zymo Research, Irvine CA). Reverse transcription PCR was performed using random hexamer primers followed by quantitative PCR using primers in 3’-UTR of POT1. The following primer pairs were used to measure human POT1 and GAPDH mRNA levels after knockdown:

POT1 (5’CTCACCTTCCCTGTTTGAGCTT3’ and 5’TCCCATACCCATGCTAACATCA3’);

GAPDH (5’ATGGAAATCCCATCACCATCTT3’ and 5’CGCCCCACTTGATTTTGG3’)

2.4.8 Direct telomerase activity assays

Telomerase preparations were carried out as described previously (Cristofari et al.,

2007). Briefly, super telomerase extracts were prepared by lysing HEK293T cells overexpressing human TERT and TER (pcDNA6-hTERT and pBS-U1-hTER plasmids were a gift from J. Lingner) in CHAPS lysis buffer consisting of 150 mM KCl, 50 mM Hepes, pH 7.5, 1 mM MgCl2, 1 mM

EDTA, 10% glycerol, 0.5% CHAPS, 5mM b-mercaptoethanol and 0.01 µL/mL of protease inhibitor cocktail (Sigma P8340). Direct assays were carried out with 150 nM of purified full-length

POT1 or TPP1 incubated with 20 nM of A5 primer (TTAGGGTTAGCGTTAGGG) before the addition of 2 µg of super telomerase extract. In addition, direct assays were also performed with 5

µg of lysates from HEK293T + shPOT1 cells transiently transfected with 1 µg of pcDNA6-hTERT and 3 µg of pBS-U1-hTER plasmids. For transfections involving POT1 or TPP1, 1 µg of pLU-

1xFlag-POT1 or pLU-1xHA-hTPP1 plasmid was used. In control transfections where POT1 or

TPP1 were omitted, 1 µg of pLU-EF1A-iBlast (empty vector) was included.

Telomerase extension reactions were carried out in 20 µL at 30oC for 60 minutes, 50 mM

Tris - HCl, pH 8.0, 50 mM KCl, 1 mM spermidine, 1 mM MgCl2, 5 mm β-mercaptoethanol, 500 µM dATP, 500 µM dTTP, µM dGTP, 20 µCi of [α-32P] - dGTP (3,000 Ci mmol−1). Reactions were stopped with the addition of 100 µL of 3.6 M ammonia acetate, 20 µg of glycogen, 0.5 nM of 5’

32P-labeled 18mer loading control, and were precipitated overnight with 500 µL of ethanol at -80o

C. The samples were pelleted by centrifugation at 14,000 RPM at 4o C for 20 minutes, washed with 500 µL of 70% ethanol, centrifuged again for 10 minutes. The ethanol was removed from each sample and then air dried for 30 minutes. The pellets were then resuspended in a loading buffer containing 98% formamide, 1 mM EDTA, and 0.05% xylene cyanol, heated to 95o C for 5 minutes, and then loaded onto a 10% acrylamide, 7 M urea, 1x TBE sequencing gel. The gel was run for 3.5 hours at 1800 V, fixed with 30% Methanol 10% acetic acid solution and dried for 1 hour with a gel dryer (Bio-Rad). The dried gel was then exposed to a phosphorous storage plate overnight and imaged the next day with a Typhoon 9410 Imager (GE Healthcare). Quantification of telomerase products was measured using ImageQuant TL software (GE Healthcare).

Calculation of telomerase processivity was performed as described previously(Latrick and Cech,

2010; Wang et al., 2007).

2.4.9 Cell Imaging

Human full-length TRF2 and wild type and mutant POT1 genes were cloned into modified pEGFP-C3 vectors (BD Biosciences Clontech) carrying the YFP or mCherry N-terminal fusion tags. HEK 293 cells were transiently transfected with Cherry-TRF2 and YFP-POT1 plasmids using Fugene 6 (Promega, Madison WI) transfection for 24 hours. Cells were fixed with freshly prepared paraformaldehyde (4% at room temperature) and stained with DAPI.

Confocal images were taken with a Leica SP8X white light laser scanning confocal microscope (Leica Microsystems, Buffalo Grove, IL) using a 63X oil objective lens (numerical 45

aperture 1.4) with 6X zoom. For each cell, stacks of ~15 images with 0.5 µm step sizes were acquired and processed using Huygens deconvolution software (Scientific Volume Imaging, The

Netherlands). The files were then presented as maximum projection images using Leica LASX software.

2.4.10 Southern blot analysis

For telomere length analysis we carried out Southern blots on HEK293T cells stably expressing wild type and mutant 1xFlag-POT1 and an shRNA targeting the 3’UTR of the endogenous POT1. Genomic DNA from cells at various passages was purified using a QIAamp

DNA mini kit (Qiagen) and 10 µg of genomic DNA was then digested with AluI + MboI restriction endonucleases. 5’ 32P-labeled GeneRuler 1 kb Plus DNA ladder (Thermo) and 2 µg of digested

DNA was then fractionated in a 0.7% agarose gel, denatured and transferred onto a GeneScreen

Plus hybridization membrane (Perkin Elmer) overnight. The membrane was cross-linked,

o 32 hybridized at 42 C with 5’-end-labaled P-(TTAGGG)4 probe in Church buffer (0.5 N Na2HPO4, pH 7.2, 7% SDS, 1% BSA, 1mM EDTA) overnight and then washed three times for 20 minutes each with wash buffer (0.2 M Na2HPO4, pH 7.2, 1mM EDA, and 2% SDS) at 37oC. The membrane was exposed to a phosphorous storage plate overnight and visualized by Typhoon

9410 Imager (GE Healthcare). Telomere length was calculated using the software TeloTool

(MATLAB) (Gohring et al., 2014).

2.4.11 Fluorescence in situ hybridization (FISH)

HEK293T cells stably expressing wild type and mutant 1xFlag-POT1 and an shRNA targeting the 3’UTR of the endogenous POT1 were passaged 10 times (approximately 50 population doublings) and grown to 40% confluence on a 10 cm plate and treated with 100 µg/mL 46

of colcemid for 4 hours. Cells were detached from the plate with trypsin digest, pelleted, then treated with 75 mM KCl for 30 minutes at 37o C. Cells were then fixed in 10 mL of 3:1 methanol:acetic acid solution and stored at 4oC. Cells were dropped on frosted microscope slides

(Thermo Scientific), washed with 3:1 methanol:acetic acid solution, heated for 5 min at 70oC, and dried overnight. Slides were then rehydrated in coplin jars with PBS, fixed with 4% formaldehyde

(Sigma), washed 3 times with PBS and dehydrated in 70%, 95%, and 100% ethanol successively. Slides were then air dried and hybridized with 20 µL of 200 nM TelC-Tamra peptide nucleic acid (PNA) probe ((CCCTAA)3-Tamra, Panagene) in 70% formamide, 10 mM Tris pH 7.5,

0.5% Odyessy blocking buffer (LiCor) and then stained with DAPI. Slides were then imaged using a Nikon 80i upright microscope using a 100x oil objective.

CHAPTER 3: Future directions for the human POT1-TPP1 complex.

The structure of the POT1C-TPP1(PBD) complex provides us with a molecular understanding of how POT1 directly interacts with TPP1. However, we still do not fully understand how the full-length POT1-TPP1 complex assembles and binds telomeric DNA.

Though it is well-characterized that the N-terminal OB-folds of POT1 mediate DNA binding, it is unclear how TPP1 binding at the C-terminal of POT1 enhances POT1-DNA binding. Therefore, structural and mechanistic studies using full-length proteins will allow us to determine how TPP1 enhances the DNA binding affinity of POT1. Furthermore, though it has only been shown to be the case in fission yeast (S. pombe), POT1 is reported to dimerize when bound to single-stranded telomeric DNA (Lei et al., 2003; Nandakumar and Cech, 2012). Therefore, an analysis of the oligomeric state of full-length human POT1 in the presence of both TPP1 and telomeric DNA will allow us to better understand how the human POT1-TPP1 complex caps telomeres and is involved in telomerase processivity.

From the structure of the POT1C-TPP1(PBD) complex we also discovered a tetra – cysteine cluster that coordinates a Zn2+ ion (Figure 2.1A). We predict that this zinc coordination site contributes to the stabilization of the bilobal structure of the C-terminal domain of POT1.

However, the role of this coordination site is unknown since no naturally occurring mutations have been reported to disrupt this site. Therefore, site-directed mutagenesis and functional studies will be necessary to determine the significance of the tetra – cysteine cluster and role of zinc coordination in the overall function of POT1.

The localization of POT1 to telomeres is facilitated by POT1 binding to telomeric DNA and TPP1. However, POT1 has also been implicated in binding another shelterin component,

TRF2, through Co-IP assays (Barrientos et al., 2008). This interaction between POT1 and TRF2 can be disrupted by substituting the NAAIRS amino acid sequence at residues 545 and 599 of

POT1 (Barrientos et al., 2008). From the structure of the POT1C-TPP1(PBD) complex, we find that this particular region of amino acids is located on the surface of the POT1C OB-fold, suggesting these solvent accessible residues mediate POT1-TRF2 binding. POT1 mutants defective for TRF2 binding are still able to suppress the DNA damage response at telomeres, but have reduced telomere localization (Barrientos et al., 2008). In contrast, POT1 mutants defective for TPP1 binding result in accumulated DNA damage response at telomeres, but still localize to telomeres (Barrientos et al., 2008). Therefore, further studies are needed in order to understand the molecular basis of the POT1-TRF2 interaction in the function of POT1 at telomeres and the overall assembly of the shelterin complex.

Finally, we were unable to determine a molecular basis for several POT1C mutants

(L343F, R477T, and A532P) as they maintained wild type POT1C-TPP1(PBD) binding affinity and

POT1-TPP1 DNA binding affinity. Despite these findings we still observed increase amounts of fragile telomeres in HEK293T cells expressing these mutants. The L343F, R477T, and A532P are therefore somehow perturbing the role of POT1 in telomere replication, but not through the assembly of the POT1-TPP1 complex. In order to investigate these mutants further, a deeper understanding of the role POT1 plays in telomere replication will allow us to determine if POT1 C- terminal mutations, that do not disrupt POT1-TPP1 binding, are involved in mediating other interactions with telomere replication factors. For example, the WRN helicase has been shown to interact with POT1 and WRN has been suggested to be required for G-strand synthesis (Arnoult et al., 2009). In addition, the BLM helicase has also been associated with TRF1 and is involved in facilitating lagging strand synthesis at telomeres (Zimmermann et al., 2014). Therefore, telomerase independent mechanisms need to be investigated to determine if POT1 is involved in the loading or regulation of nucleases or other telomere replication factors. One way to study this would be to examine the role of POT1 mutations in a cell line that is not telomerase positive to determine if there are telomeric defects in the absence of telomerase.

While future studies are needed to fully understand the role of POT1 in telomere maintenance, the combination of functional and structural studies are revealing how telomere capping complexes assemble and protect telomeres on a molecular level. We were able to utilize the structure of the POT1C-TPP1(PBD) complex to elucidate the molecular basis of naturally occurring mutations in the C-terminal domain of POT1 and how they contribute to cancer. By understanding the molecular and structural ramifications of naturally occurring mutations, we can begin to fully understand how mutations are linked to the cause and progression of human disease.

BIBLIOGRAPHY

Abagyan, R., and Totrov, M. (1994). Biased probability Monte Carlo conformational searches and electrostatic calculations for peptides and proteins. J Mol Biol 235, 983-1002.

Allsopp, R.C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E.V., Futcher, A.B., Greider, C.W., and Harley, C.B. (1992). Telomere length predicts replicative capacity of human fibroblasts. Proceedings of the National Academy of Sciences of the United States of America 89, 10114- 10118.

Anderson, B.H., Kasher, P.R., Mayer, J., Szynkiewicz, M., Jenkinson, E.M., Bhaskar, S.S., Urquhart, J.E., Daly, S.B., Dickerson, J.E., O'Sullivan, J., et al. (2012). Mutations in CTC1, encoding conserved telomere maintenance component 1, cause Coats plus. Nature genetics 44, 338-342.

Anic, G.M., Sondak, V.K., Messina, J.L., Fenske, N.A., Zager, J.S., Cherpelis, B.S., Lee, J.H., Fulp, W.J., Epling-Burnette, P.K., Park, J.Y., et al. (2013). Telomere length and risk of melanoma, squamous cell carcinoma, and basal cell carcinoma. Cancer Epidemiol 37, 434-439.

Armanios, M. (2012). An emerging role for the conserved telomere component 1 (CTC1) in human genetic disease. Pediatric blood & cancer 59, 209-210.

Armanios, M., and Blackburn, E.H. (2012). The telomere syndromes. Nature reviews. Genetics 13, 693-704.

Arnoult, N., Saintome, C., Ourliac-Garnier, I., Riou, J.F., and Londono-Vallejo, A. (2009). Human POT1 is required for efficient telomere C-rich strand replication in the absence of WRN. Genes & development 23, 2915-2924.

Bailey, S.M., and Murnane, J.P. (2006). Telomeres, chromosome instability and cancer. Nucleic acids research 34, 2408-2417.

Bainbridge, M.N., Armstrong, G.N., Gramatges, M.M., Bertuch, A.A., Jhangiani, S.N., Doddapaneni, H., Lewis, L., Tombrello, J., Tsavachidis, S., Liu, Y., et al. (2015). Germline mutations in shelterin complex genes are associated with familial glioma. Journal of the National Cancer Institute 107, 384.

Barrientos, K.S., Kendellen, M.F., Freibaum, B.D., Armbruster, B.N., Etheridge, K.T., and Counter, C.M. (2008). Distinct functions of POT1 at telomeres. Molecular and cellular biology 28, 5251-5264.

Biffi, G., Tannahill, D., McCafferty, J., and Balasubramanian, S. (2013). Quantitative visualization of DNA G-quadruplex structures in human cells. Nature chemistry 5, 182-186.

Blackburn, E.H. (2000). Telomeres and telomerase. The Keio journal of medicine 49, 59-65.

Blackburn, E.H., and Gall, J.G. (1978). A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena. J Mol Biol 120, 33-53.

Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-254.

Bryan, C., Rice, C., Harkisheimer, M., Schultz, D.C., and Skordalakes, E. (2013). Structure of the human telomeric Stn1-Ten1 capping complex. PloS one 8, e66756.

Burton, D.G. (2009). Cellular senescence, ageing and disease. Age (Dordr) 31, 1-9.

Chandra, A., Hughes, T.R., Nugent, C.I., and Lundblad, V. (2001). Cdc13 both positively and negatively regulates telomere replication. Genes & development 15, 404-414.

Chen, L.Y., Majerska, J., and Lingner, J. (2013). Molecular basis of telomere syndrome caused by CTC1 mutations. Genes & development 27, 2099-2108.

Chen, L.Y., Redon, S. & Lingner, J. (2012). The human CST complex is a terminator of telomerase activity. Nature.

Colgin, L.M., Baran, K., Baumann, P., Cech, T.R., and Reddel, R.R. (2003). Human POT1 facilitates telomere elongation by telomerase. Curr Biol 13, 942-946.

Counter, C.M., Avilion, A.A., LeFeuvre, C.E., Stewart, N.G., Greider, C.W., Harley, C.B., and Bacchetti, S. (1992). Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. The EMBO journal 11, 1921-1929.

Cristofari, G., and Lingner, J. (2006). Telomere length homeostasis requires that telomerase levels are limiting. The EMBO journal 25, 565-574.

Cristofari, G., Reichenbach, P., Regamey, P.O., Banfi, D., Chambon, M., Turcatti, G., and Lingner, J. (2007). Low- to high-throughput analysis of telomerase modulators with Telospot. Nature methods 4, 851-853. de la Fuente, J., and Dokal, I. (2007). Dyskeratosis congenita: advances in the understanding of the telomerase defect and the role of stem cell transplantation. Pediatric transplantation 11, 584- 594. de Lange, T. (2004). T-loops and the origin of telomeres. Nature reviews. Molecular cell biology 5, 323-329. de Lange, T. (2009). How telomeres solve the end-protection problem. Science 326, 948-952.

Denchi, E.L., and de Lange, T. (2007). Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature 448, 1068-1071.

Diede, S.J., and Gottschling, D.E. (1999). Telomerase-mediated telomere addition in vivo requires DNA primase and DNA polymerases alpha and delta. Cell 99, 723-733.

Doksani, Y., Wu, J.Y., de Lange, T., and Zhuang, X. (2013). Super-resolution fluorescence imaging of telomeres reveals TRF2-dependent T-loop formation. Cell 155, 345-356.

Effros, R.B., and Walford, R.L. (1984). T cell cultures and the Hayflick limit. Human immunology 9, 49-65. 52

Evans, S.K., and Lundblad, V. (1999). Est1 and Cdc13 as Comediators of Telomerase Access. Science 286, 117-120.

Fan, X., and Price, C.M. (1997). Coordinate regulation of G- and C strand length during new telomere synthesis. Mol Biol Cell 8, 2145-2155.

Feldser, D.M., Hackett, J.A., and Greider, C.W. (2003). Telomere dysfunction and the initiation of genome instability. Nature reviews. Cancer 3, 623-627.

Ferrandon, S., Saultier, P., Carras, J., Battiston-Montagne, P., Alphonse, G., Beuve, M., Malleval, C., Honnorat, J., Slatter, T., Hung, N., et al. (2013). Telomere profiling: toward glioblastoma personalized medicine. Mol Neurobiol 47, 64-76.

Gohring, J., Fulcher, N., Jacak, J., and Riha, K. (2014). TeloTool: a new tool for telomere length measurement from terminal restriction fragment analysis with improved probe intensity correction. Nucleic acids research 42, e21.

Grandin, N., Damon, C., and Charbonneau, M. (2000). Cdc13 Cooperates with the Yeast Ku Proteins and Stn1 To Regulate Telomerase Recruitment. Molecular cell 20, 8397-8408.

Greider, C.W., and Blackburn, E.H. (1996). Telomeres, telomerase and cancer. Scientific American 274, 92-97.

Griffith, J.D., Comeau, L., Rosenfield, S., Stansel, R.M., Bianchi, A., Moss, H., and de Lange, T. (1999). Mammalian telomeres end in a large duplex loop. Cell 97, 503-514.

Grunstein, M. (1997). Molecular model for telomeric heterochromatin in yeast. Curr Opin Cell Biol 9, 383-387.

Gu, P., and Chang, S. (2013). Functional characterization of human CTC1 mutations reveals novel mechanisms responsible for the pathogenesis of the telomere disease Coats plus. Aging cell 12, 1100-1109.

He, Q., Zeng, P., Tan, J.H., Ou, T.M., Gu, L.Q., Huang, Z.S., and Li, D. (2014). G-quadruplex- mediated regulation of telomere binding protein POT1 gene expression. Biochim Biophys Acta 1840, 2222-2233.

Heiss, N.S., Knight, S.W., Vulliamy, T.J., Klauck, S.M., Wiemann, S., Mason, P.J., Poustka, A., and Dokal, I. (1998). X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nature genetics 19, 32-38.

Henderson, E., Hardin, C.C., Walk, S.K., Tinoco, I., Jr., and Blackburn, E.H. (1987). Telomeric DNA oligonucleotides form novel intramolecular structures containing guanine-guanine base pairs. Cell 51, 899-908.

Hewitt, G., Jurk, D., Marques, F.D., Correia-Melo, C., Hardy, T., Gackowska, A., Anderson, R., Taschuk, M., Mann, J., and Passos, J.F. (2012). Telomeres are favoured targets of a persistent DNA damage response in ageing and stress-induced senescence. Nature communications 3, 708.

Hockemeyer, D., Sfeir, A.J., Shay, J.W., Wright, W.E., and de Lange, T. (2005). POT1 protects telomeres from a transient DNA damage response and determines how human chromosomes end. The EMBO journal 24, 2667-2678.

Horvath, M.P., Schweiker, V.L., Bevilacqua, J.M., Ruggles, J.A., and Schultz, S.C. (1998). Crystal structure of the Oxytricha nova telomere end binding protein complexed with single strand DNA. Cell 95, 963-974.

Hubscher, U., Maga, G., and Spadari, S. (2002). Eukaryotic DNA polymerases. Annual review of biochemistry 71, 133-163.

Kawanishi, S., and Oikawa, S. (2004). Mechanism of telomere shortening by oxidative stress. Ann N Y Acad Sci 1019, 278-284.

Kelleher, C., Kurth, I., and Lingner, J. (2005). Human protection of telomeres 1 (POT1) is a negative regulator of telomerase activity in vitro. Molecular and cellular biology 25, 808-818.

Keller, R.B., Gagne, K.E., Usmani, G.N., Asdourian, G.K., Williams, D.A., Hofmann, I., and Agarwal, S. (2012). CTC1 Mutations in a patient with dyskeratosis congenita. Pediatric blood & cancer 59, 311-314.

Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L., Coviello, G.M., Wright, W.E., Weinrich, S.L., and Shay, J.W. (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-2015.

Latrick, C.M., and Cech, T.R. (2010). POT1-TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation. The EMBO journal 29, 924-933.

Lei, M., Podell, E.R., Baumann, P., and Cech, T.R. (2003). DNA self-recognition in the structure of Pot1 bound to telomeric single-stranded DNA. Nature 426, 198-203.

Lei, M., Podell, E.R., and Cech, T.R. (2004). Structure of human POT1 bound to telomeric single- stranded DNA provides a model for chromosome end-protection. Nat Struct Mol Biol 11, 1223- 1229.

Lei, M., Zaug, A.J., Podell, E.R., and Cech, T.R. (2005). Switching human telomerase on and off with hPOT1 protein in vitro. J Biol Chem 280, 20449-20456.

Levy, M.Z., Allsopp, R.C., Futcher, A.B., Greider, C.W., and Harley, C.B. (1992). Telomere end- replication problem and cell aging. Journal of molecular biology 225, 951-960.

Li, B., Reddy, S., and Comai, L. (2009). Sequence-specific processing of telomeric 3' overhangs by the Werner syndrome protein exonuclease activity. Aging (Albany NY) 1, 289-302.

Lin, J.J., and Zakian, V.A. (1996). The Saccharomyces CDC13 protein is a single-strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere behavior in vivo. Proceedings of the National Academy of Sciences of the United States of America 93, 13760-13765.

Lin, T.T., Letsolo, B.T., Jones, R.E., Rowson, J., Pratt, G., Hewamana, S., Fegan, C., Pepper, C., and Baird, D.M. (2010). Telomere dysfunction and fusion during the progression of chronic lymphocytic leukemia: evidence for a telomere crisis. Blood 116, 1899-1907.

Lin, T.T., Norris, K., Heppel, N.H., Pratt, G., Allan, J.M., Allsup, D.J., Bailey, J., Cawkwell, L., Hills, R., Grimstead, J.W., et al. (2014). Telomere dysfunction accurately predicts clinical outcome in chronic lymphocytic leukaemia, even in patients with early stage disease. British journal of haematology 167, 214-223.

Lin, Y.C., Shih, J.W., Hsu, C.L., and Lin, J.J. (2001). Binding and partial denaturing of G-quartet DNA by Cdc13p of Saccharomyces cerevisiae. The Journal of biological chemistry 276, 47671- 47674.

Liu, D., Safari, A., O'Connor, M.S., Chan, D.W., Laegeler, A., Qin, J., and Songyang, Z. (2004). PTOP interacts with POT1 and regulates its localization to telomeres. Nat Cell Biol 6, 673-680.

Loayza, D., and De Lange, T. (2003). POT1 as a terminal transducer of TRF1 telomere length control. Nature 423, 1013-1018.

Loayza, D., Parsons, H., Donigian, J., Hoke, K., and de Lange, T. (2004). DNA binding features of human POT1: a nonamer 5'-TAGGGTTAG-3' minimal binding site, sequence specificity, and internal binding to multimeric sites. J Biol Chem 279, 13241-13248.

Longhese, M.P. (2008). DNA damage response at functional and dysfunctional telomeres. Genes & development 22, 125-140.

Lue, N.F., Zhou, R., Chico, L., Mao, N., Steinberg-Neifach, O., and Ha, T. (2013). The telomere capping complex CST has an unusual stoichiometry, makes multipartite interaction with G-Tails, and unfolds higher-order G-tail structures. PLoS genetics 9, e1003145.

Machwe, A., Xiao, L., and Orren, D.K. (2004). TRF2 recruits the Werner syndrome (WRN) exonuclease for processing of telomeric DNA. Oncogene 23, 149-156.

Mangino, M., Hwang, S.J., Spector, T.D., Hunt, S.C., Kimura, M., Fitzpatrick, A.L., Christiansen, L., Petersen, I., Elbers, C.C., Harris, T., et al. (2012). Genome Wide Meta-analysis points to CTC1 and ZNF676 as genes regulating telomere homeostasis in humans. Human molecular genetics.

Maser, R.S., and DePinho, R.A. (2004). Telomeres and the DNA damage response: why the fox is guarding the henhouse. DNA repair 3, 979-988.

Munoz-Jordan, J.L., Cross, G.A., de Lange, T., and Griffith, J.D. (2001). t-loops at trypanosome telomeres. The EMBO journal 20, 579-588.

Murti, K.G., and Prescott, D.M. (1999). Telomeres of polytene chromosomes in a ciliated protozoan terminate in duplex DNA loops. Proceedings of the National Academy of Sciences of the United States of America 96, 14436-14439.

Nandakumar, J., Bell, C.F., Weidenfeld, I., Zaug, A.J., Leinwand, L.A., and Cech, T.R. (2012). The TEL patch of telomere protein TPP1 mediates telomerase recruitment and processivity. Nature 492, 285-289.

Nandakumar, J., and Cech, T.R. (2012). DNA-induced dimerization of the single-stranded DNA binding telomeric protein Pot1 from Schizosaccharomyces pombe. Nucleic acids research 40, 235-244.

Nordfjall, K., Larefalk, A., Lindgren, P., Holmberg, D., and Roos, G. (2005). Telomere length and heredity: Indications of paternal inheritance. Proceedings of the National Academy of Sciences of the United States of America 102, 16374-16378.

Oganesian, L., Moon, I.K., Bryan, T.M., and Jarstfer, M.B. (2006). Extension of G-quadruplex DNA by ciliate telomerase. The EMBO journal 25, 1148-1159.

Ojha, J., Codd, V., Nelson, C.P., Samani, N.J., Smirnov, I.V., Madsen, N.R., Hansen, H.M., de Smith, A.J., Bracci, P.M., Wiencke, J.K., et al. (2016). Genetic Variation Associated with Longer Telomere Length Increases Risk of Chronic Lymphocytic Leukemia. Cancer Epidem Biomar 25, 1043-1049.

Okazaki, R., Okazaki, T., Sakabe, K., and Sugimoto, K. (1967). Mechanism of DNA replication possible discontinuity of DNA chain growth. Jpn J Med Sci Biol 20, 255-260.

Polvi, A., Linnankivi, T., Kivela, T., Herva, R., Keating, J.P., Makitie, O., Pareyson, D., Vainionpaa, L., Lahtinen, J., Hovatta, I., et al. (2012). Mutations in CTC1, encoding the CTS telomere maintenance complex component 1, cause cerebroretinal microangiopathy with calcifications and cysts. Am J Hum Genet 90, 540-549.

Price, C.M., Boltz, K.A., Chaiken, M.F., Stewart, J.A., Beilstein, M.A., and Shippen, D.E. (2010). Evolution of CST function in telomere maintenance. Cell Cycle 9, 3157-3165.

Ramsay, A.J., Quesada, V., Foronda, M., Conde, L., Martinez-Trillos, A., Villamor, N., Rodriguez, D., Kwarciak, A., Garabaya, C., Gallardo, M., et al. (2013). POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia. Nature genetics 45, 526-530.

Rhodes, D., and Giraldo, R. (1995). Telomere structure and function. Curr Opin Struct Biol 5, 311-322.

Rivera, T., Haggblom, C., Cosconati, S., and Karlseder, J. (2017). A balance between elongation and trimming regulates telomere stability in stem cells. Nature structural & molecular biology 24, 30-39.

Robles-Espinoza, C.D., Harland, M., Ramsay, A.J., Aoude, L.G., Quesada, V., Ding, Z., Pooley, K.A., Pritchard, A.L., Tiffen, J.C., Petljak, M., et al. (2014). POT1 loss-of-function variants predispose to familial melanoma. Nature genetics 46, 478-481.

Romaniello, R., Arrigoni, F., Citterio, A., Tonelli, A., Sforzini, C., Rizzari, C., Pessina, M., Triulzi, F., Bassi, M.T., and Borgatti, R. (2012). Cerebroretinal Microangiopathy With Calcifications and Cysts Associated With CTC1 and NDP Mutations. Journal of child neurology.

Rossiello, F., Herbig, U., Longhese, M.P., Fumagalli, M., and d'Adda di Fagagna, F. (2014). Irreparable telomeric DNA damage and persistent DDR signalling as a shared causative mechanism of cellular senescence and ageing. Current opinion in genetics & development 26, 89-95.

Savage, S.A. (1993). Dyskeratosis Congenita. In GeneReviews, R.A. Pagon, T.D. Bird, C.R. Dolan, K. Stephens, and M.P. Adam, eds. (Seattle (WA)).

Schaffitzel, C., Berger, I., Postberg, J., Hanes, J., Lipps, H.J., and Pluckthun, A. (2001). In vitro generated antibodies specific for telomeric guanine-quadruplex DNA react with Stylonychia lemnae macronuclei. Proceedings of the National Academy of Sciences of the United States of America 98, 8572-8577.

Sfeir, A., Kosiyatrakul, S.T., Hockemeyer, D., MacRae, S.L., Karlseder, J., Schildkraut, C.L., and de Lange, T. (2009). Mammalian telomeres resemble fragile sites and require TRF1 for efficient replication. Cell 138, 90-103.

Sfeir, A.J., Chai, W., Shay, J.W., and Wright, W.E. (2005). Telomere-end processing the terminal nucleotides of human chromosomes. Molecular cell 18, 131-138.

Shi, J., Yang, X.R., Ballew, B., Rotunno, M., Calista, D., Fargnoli, M.C., Ghiorzo, P., Bressac-de Paillerets, B., Nagore, E., Avril, M.F., et al. (2014). Rare missense variants in POT1 predispose to familial cutaneous malignant melanoma. Nature genetics 46, 482-486.

Simon, A.J., Lev, A., Zhang, Y., Weiss, B., Rylova, A., Eyal, E., Kol, N., Barel, O., Cesarkas, K., Soudack, M., et al. (2016). Mutations in STN1 cause Coats plus syndrome and are associated with genomic and telomere defects. J Exp Med 213, 1429-1440.

Stansel, R.M., de Lange, T., and Griffith, J.D. (2001). T-loop assembly in vitro involves binding of TRF2 near the 3' telomeric overhang. The EMBO journal 20, 5532-5540.

Takai, H., Jenkinson, E., Kabir, S., Babul-Hirji, R., Najm-Tehrani, N., Chitayat, D.A., Crow, Y.J., and de Lange, T. (2016). A POT1 mutation implicates defective telomere end fill-in and telomere truncations in Coats plus. Genes & development 30, 812-826.

Taylor, D.J., Podell, E.R., Taatjes, D.J., and Cech, T.R. (2011). Multiple POT1-TPP1 proteins coat and compact long telomeric single-stranded DNA. J Mol Biol 410, 10-17.

Tong, A.S., Stern, J.L., Sfeir, A., Kartawinata, M., de Lange, T., Zhu, X.D., and Bryan, T.M. (2015). ATM and ATR Signaling Regulate the Recruitment of Human Telomerase to Telomeres. Cell Rep 13, 1633-1646.

Tran, P.L., Mergny, J.L., and Alberti, P. (2011). Stability of telomeric G-quadruplexes. Nucleic acids research 39, 3282-3294.

Trigueros-Motos, L. (2014). Mutations in POT1 predispose to familial cutaneous malignant melanoma. Clinical genetics 86, 217-218.

Velazquez-Campoy, A., Leavitt, S.A., and Freire, E. (2015). Characterization of protein-protein interactions by isothermal titration calorimetry. Methods in molecular biology 1278, 183-204.

Vermeesch, J.R., and Price, C.M. (1994). Telomeric DNA sequence and structure following de novo telomere synthesis in Euplotes crassus. Molecular and cellular biology 14, 554-566.

Vulliamy, T., Marrone, A., Dokal, I., and Mason, P.J. (2002). Association between aplastic anaemia and mutations in telomerase RNA. Lancet 359, 2168-2170.

Walne, A.J., Bhagat, T., Kirwan, M., Gitiaux, C., Desguerre, I., Leonard, N., Nogales, E., Vulliamy, T., and Dokal, I.S. (2013). Mutations in the telomere capping complex in bone marrow failure and related syndromes. Haematologica 98, 334-338.

Walne, A.J., and Dokal, I. (2008). Dyskeratosis Congenita: a historical perspective. Mechanisms of ageing and development 129, 48-59.

Walsh, K.M., Codd, V., Rice, T., Nelson, C.P., Smirnov, I.V., McCoy, L.S., Hansen, H.M., Elhauge, E., Ojha, J., Francis, S.S., et al. (2015). Longer genotypically-estimated leukocyte telomere length is associated with increased adult glioma risk. Oncotarget 6, 42468-42477.

Wang, F., and Lei, M. (2011a). Human telomere POT1-TPP1 complex and its role in telomerase activity regulation. Methods in molecular biology 735, 173-187.

Wang, F., and Lei, M. (2011b). Human telomere POT1-TPP1 complex and its role in telomerase activity regulation. Methods in molecular biology 735, 173-187.

Wang, F., Podell, E.R., Zaug, A.J., Yang, Y., Baciu, P., Cech, T.R., and Lei, M. (2007). The POT1-TPP1 telomere complex is a telomerase processivity factor. Nature 445, 506-510.

Wang, H., Nora, G.J., Ghodke, H., and Opresko, P.L. (2011). Single molecule studies of physiologically relevant telomeric tails reveal POT1 mechanism for promoting G-quadruplex unfolding. The Journal of biological chemistry 286, 7479-7489.

Webb CJ, W.Y., Zakian VA. (2013). DNA repair at telomeres: keeping the ends intact. Cold Spring Harb Perspect Biol. 5.

Wellinger, R.J. (2009). The CST complex and telomere maintenance: the exception becomes the rule. Molecular cell 36, 168-169.

Wright, W.E., Tesmer, V.M., Liao, M.L., and Shay, J.W. (1999). Normal human telomeres are not late replicating. Exp Cell Res 251, 492-499.

Xin, H., Liu, D., Wan, M., Safari, A., Kim, H., Sun, W., O'Connor, M.S., and Songyang, Z. (2007). TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature 445, 559-562.

Zahler, A.M., Williamson, J.R., Cech, T.R., and Prescott, D.M. (1991). Inhibition of telomerase by G-quartet DNA structures. Nature 350, 718-720.

Zaug, A.J., Podell, E.R., and Cech, T.R. (2005). Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro. Proceedings of the National Academy of Sciences of the United States of America 102, 10864-10869.

Zhang, Y., Chen, L.Y., Han, X., Xie, W., Kim, H., Yang, D., Liu, D., and Songyang, Z. (2013). Phosphorylation of TPP1 regulates cell cycle-dependent telomerase recruitment. Proceedings of the National Academy of Sciences of the United States of America 110, 5457-5462.

Zhao, Y., Sfeir, A.J., Zou, Y., Buseman, C.M., Chow, T.T., Shay, J.W., and Wright, W.E. (2009). Telomere extension occurs at most chromosome ends and is uncoupled from fill-in in human cancer cells. Cell 138, 463-475.

Zhao, Y., Shay, J.W., and Wright, W.E. (2011). Telomere terminal G/C strand synthesis: measuring telomerase action and C-rich fill-in. Methods Mol Biol 735, 63-75.

Zimmermann, M., Kibe, T., Kabir, S., and de Lange, T. (2014). TRF1 negotiates TTAGGG repeat- associated replication problems by recruiting the BLM helicase and the TPP1/POT1 repressor of ATR signaling. Genes & development 28, 2477-2491.