DOCSLIB.ORG

Essential Requirement for Nicastrin in Marginal Zone and B-1 B Cell Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Essential Requirement for Nicastrin in Marginal Zone and B-1 B Cell Development Essential requirement for nicastrin in marginal zone and B-1 B cell development Jin Huk Choia,b,1,2, Jonghee Hanc,1, Panayotis C. Theodoropoulosa,d, Xue Zhonga, Jianhui Wanga, Dawson Medlera, Sara Ludwiga, Xiaoming Zhana, Xiaohong Lia, Miao Tanga, Thomas Gallaghera, Gang Yuc, and Bruce Beutlera,2 aCenter for the Genetics of Host Defense, University of Texas Southwestern Medical Center, Dallas, TX 75390; bDepartment of Immunology, University of Texas Southwestern Medical Center, Dallas, TX 75390; cDepartment of Neuroscience, Peter O’Donnell Jr. Brain Institute, University of Texas Southwestern Medical Center, Dallas, TX 75390; and dDepartment of Internal Medicine, Physician Scientist Training Program, Washington University in St. Louis, Barnes Jewish Hospital, St. Louis, MO 63110 Contributed by Bruce Beutler, January 7, 2020 (sent for review September 24, 2019; reviewed by Douglas J. Hilton and Ellen V. Rothenberg) γ-secretase is an intramembrane protease complex that catalyzes peritoneal cavity, and are maintained by self-renewal throughout the proteolytic cleavage of amyloid precursor protein and Notch. the life of the organism (10). It is well established that the spleen is Impaired γ-secretase function is associated with the development also required for B-1 (especially B-1a) cell development (11); of Alzheimer’s disease and familial acne inversa in humans. In a however, the underlying mechanism(s) that mediate B-1 cell dif- forward genetic screen of mice with N-ethyl-N-nitrosourea-induced ferentiation remain largely unknown. mutations for defects in adaptive immunity, we identified animals The γ-secretase protease complex cleaves multiple type I mem- within a single pedigree exhibiting both hypopigmentation of brane proteins, including amyloid precursor protein (APP) and the fur and diminished T cell-independent (TI) antibody responses. Notch. APP undergoes proteolytic processing by either α-or The causative mutation was in Ncstn, an essential gene encoding β-secretase to release soluble APP ectodomains into the extra- the protein nicastrin (NCSTN), a member of the γ-secretase complex cellular space. Then γ-secretase cleaves the remaining membrane- that functions to recruit substrates for proteolysis. The missense anchored APP C-terminal fragments (APP-CTFs) and generates mutation severely limits the glycosylation of NCSTN to its mature p3 (the byproduct of α-andγ-secretase cleavages) or amyloid β form and impairs the integrity of the γ-secretase complex as well as peptides (the byproduct of β- and/or γ-secretase cleavage) together its catalytic activity toward its substrate Notch, a critical regulator of with the APP intracellular domain (12). Notch plays essential roles B cell and T cell development. Strikingly, however, this missense in thymic T cell lineage commitment (13), as well as in specifica- mutation affects B cell development but not thymocyte or T cell tion of MZ B cell versus B-2 cell fate (14), and it undergoes a development. The Ncstn allele uncovered in these studies reveals series of proteolytic cleavages by ADAM family metalloproteases an essential requirement for NCSTN during the type 2 transitional- and γ-secretase to generate the Notch intracellular domain (NICD) marginal zone precursor stage and peritoneal B-1 B cell develop- (15). The γ-secretase complex consists of four core subunits: ment, the TI antibody response, fur pigmentation, and intestinal presenilin (PS), PS enhancer 2 (PEN-2), anterior pharynx-defective homeostasis in mice. 1 (APH-1), and nicastrin (16). Nicastrin is a type I membrane protein with a large extracellular domain (17) that functions as nicastrin | marginal zone B cells | B-1 B cells | T cell-independent antibody response Significance cell responses to antigens are classified as T cell-dependent Follicular B cells generally require T cell help to contribute to B(TD) or T cell-independent (TI) based on their need for adaptive immunity, producing several isotypes of immuno- T cell help in antibody production. Antigens eliciting a TD an- globulins that carry out distinct effector functions. Two spe- tibody response are proteins that are processed and presented to cialized B cell subsets, marginal zone (MZ) and B-1 B cells, arise helper T cells in the context of MHC II molecules. The TD from different developmental steps and have different func- antibody responses are mediated by follicular B cells (also known tions. They become activated to produce antibodies without as B-2 cells, the major B cell subset in the body) and are long- T cell help and are the major sources of plasma IgM. We identi- lasting to deploy high-affinity antibodies of multiple isotypes. In fied a viable missense allele of Ncstn in a forward genetic contrast, TI antigens, such as bacterial capsular polysaccharides screen. We discovered that the development of MZ and B-1 and viral capsids, stimulate antibody responses that do not require B cells, TI antibody response, fur pigmentation, and intestinal MHC II-restricted T cell help (1). The TI antibody response is homeostasis critically depend on the glycosylation status of mediated by the marginal zone (MZ) and B-1 B cell populations, NCSTN and the catalytic activity of γ-secretase toward its sub- which expand on immunization in extrafollicular sites (2–4) and strate Notch, a critical receptor in numerous developmental confer protective immunity by producing antigen-specific IgM decisions. without somatic hypermutation (4–7). Thus, TI responses give rise to less specific but more immediate protection compared with Author contributions: J.H.C., J.H., P.C.T., G.Y., and B.B. designed research; J.H.C., J.H., TD antibody responses. P.C.T., X. Zhong, and J.W. performed research; D.M., S.L., X. Zhan, X.L., and M.T. contrib- uted new reagents/analytic tools; J.H.C., J.H., P.C.T., G.Y., and B.B. analyzed data; B-2 cells are continuously replenished from precursors in bone and J.H.C., J.H., T.G., G.Y., and B.B. wrote the paper. marrow, where they undergo both positive and negative selection. Reviewers: D.J.H., Institute of Medical Research; and E.V.R., California Institute of Immature B cells in bone marrow migrate to the spleen, where Technology. they differentiate through two transitional stages and become The authors declare no competing interest. mature naïve B-2 cells (8) or, alternatively, MZ B cells. Their fate Published under the PNAS license. is determined during the transitional stages and depends on signals 1J.H.C. and J.H. contributed equally to this work. κ from the B cell receptor, B cell activating factor, nuclear factor 2To whom correspondence may be addressed. Email: [email protected] or light chain enhancer of activated B cells, and Notch2, as well as [email protected]. signals involved in anatomical retention of MZ B cells in the This article contains supporting information online at https://www.pnas.org/lookup/suppl/ spleen (9). In contrast, B-1 cells are generated mainly from fetal doi:10.1073/pnas.1916645117/-/DCSupplemental. liver progenitors rather than bone marrow precursors, reside in the First published February 18, 2020. 4894–4901 | PNAS | March 3, 2020 | vol. 117 | no. 9 www.pnas.org/cgi/doi/10.1073/pnas.1916645117 Downloaded by guest on September 27, 2021 a γ-secretase substrate receptor (18). Activation of the γ-secretase screens, we identified several mice from a single pedigree complex requires extensive N-linked glycosylation of nicastrin, exhibiting hypopigmentation of the fur (Fig. 1A) and diminished which helps stabilize the protein (19). Mutations in γ-secretase TI antibody responses to (4-hydroxy-3-nitrophenyl) acetyl-Ficoll complex proteins and impaired catalytic activity of the complex (NP-Ficoll) compared with wild-type C57BL/6J mice (Fig. 1B). have been implicated in Alzheimer’s disease (AD) (20), fa- The mice exhibited comparable TD antibody responses to alumi- milial type acne inversa (21), hypopigmentation (22, 23), and num hydroxide-precipitated ovalbumin (OVA/alum; Fig. 1C). The thymic hypoplasia (24); however, little is known about the role phenotype, named truffle, was transmitted as a recessive trait. By and function of the γ-secretase complex in B cell-mediated automated meiotic mapping (25), the truffle phenotype was cor- immunity.Herewedescribetheeffect of a severely hypomor- related with a missense mutation in Ncstn (Fig. 1D), resulting in a phic but viable missense mutation of Ncstn on MZ B cell and valine (V)-to-glycine (G) substitution at position 439 (V439G) in B-1 B cell development. the DYIGS and peptidase homologous (DAP) domain of the NCSTN protein (Fig. 1E) (18), which was predicted to be dam- Results aging by PolyPhen-2 (score = 1.000) (26). Identification of a Viable Ncstn Missense Mutation. To identify genes To verify causation, CRISPR/Cas9-mediated gene targeting was required for the development and function of adaptive immu- used to generate a single nucleotide replacement allele (A→Cat nity, we carried out a forward genetic screen in third-generation chr1_172,070,009), causing the same amino acid change as that (G3) C57BL/6J mice bred to carry homozygous and heterozy- caused by the ENU-induced mutation (V439G). Consistent with gous mutations induced by N-ethyl-N-nitrosourea (ENU) in their truffle mice, NcstnV439G/V439G mice showed hypopigmentation of the great-grandsires (G0). During the course of adaptive immunity fur (Fig. 1F) and diminished TI and normal TD antibody responses, A B CD 4 4 10 m) m) Ncstn Wild-type truffle n -10 0 8 p=5.35 ×10 3 3 ) 45 10 6 @ -log 2 D 2 4 truffle truffle G (O IMMUNOLOGY AND INFLAMMATION 1 1 -value ( 2 P 0 NP IgM (OD0 @ 450 n 0 OVA Ig 123 45679 8 10 11131817 19 X WT G3 WT G3 Genomic location E SP DAP domain TM 132 134 273 498 669 691708 V439G (truffle) FGH I J V439G/ 4 4 110 ** 8 ** +/+ V439G m) *** n 0 cm) 100 ( 7 3 45 3 @ 2 D 2 90 6 al body weight i G (O M(OD@450nm) 1 1 80 5 Colon length %init NP Ig 0 0 70 4 V439G/ OVA Ig +/+ V439G/ +/+ V439G/ +/+ V439G/ +/+ V439G V439G V439G V439G +/+ males (n=18) KL+/+ females (n=22) 50 V439G/V439G males (n=29) V439G/V439G females (n=40) 40 + / + 30 l prolapse 20 10 %Recta V439G V439G/ 0 02479121416 Age (months) Fig.
Load more

Recommended publications
  • Oxidative Lipid Modification of Nicastrin Enhances Amyloidogenic ?-Secretase Activity in Alzheimer's Disease
    University of Central Florida STARS Faculty Bibliography 2010s Faculty Bibliography 1-1-2012 Oxidative lipid modification of nicastrin enhances amyloidogenic ?-secretase activity in Alzheimer's disease A-Ryeong Gwon Jong-Sung Park Thiruma V. Arumugam Yong-Kook Kwon Sic L. Chan University of Central Florida SeeFind next similar page works for additional at: https:/ authors/stars.libr ary.ucf.edu/facultybib2010 University of Central Florida Libraries http://library.ucf.edu This Article is brought to you for free and open access by the Faculty Bibliography at STARS. It has been accepted for inclusion in Faculty Bibliography 2010s by an authorized administrator of STARS. For more information, please contact [email protected]. Recommended Citation Gwon, A-Ryeong; Park, Jong-Sung; Arumugam, Thiruma V.; Kwon, Yong-Kook; Chan, Sic L.; Kim, Seol-Hee; Baik, Sang-Ha; Yang, Sunghee; Yun, Young-Kwang; Choi, Yuri; Kim, Saerom; Tang, Sung-Chun; Hyun, Dong- Hoon; Cheng, Aiwu; Dann, Charles E. III; Bernier, Michel; Lee, Jaewon; Markesbery, William R.; Mattson, Mark P.; and Jo, Dong-Gyu, "Oxidative lipid modification of nicastrin enhances amyloidogenic ?-secretase activity in Alzheimer's disease" (2012). Faculty Bibliography 2010s. 2695. https://stars.library.ucf.edu/facultybib2010/2695 Authors A-Ryeong Gwon, Jong-Sung Park, Thiruma V. Arumugam, Yong-Kook Kwon, Sic L. Chan, Seol-Hee Kim, Sang-Ha Baik, Sunghee Yang, Young-Kwang Yun, Yuri Choi, Saerom Kim, Sung-Chun Tang, Dong-Hoon Hyun, Aiwu Cheng, Charles E. Dann III, Michel Bernier, Jaewon Lee, William R. Markesbery, Mark P. Mattson, and Dong-Gyu Jo This article is available at STARS: https://stars.library.ucf.edu/facultybib2010/2695 Aging Cell (2012) 11, pp559–568 Doi: 10.1111/j.1474-9726.2012.00817.x Oxidative lipid modification of nicastrin enhances amyloidogenic c-secretase activity in Alzheimer’s disease A-Ryeong Gwon,1* Jong-Sung Park,1* Thiruma V.
    [Show full text]
  • Nicastrin Is Required for -Secretase Cleavage of the Drosophila Notch
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Cell, Vol. 2, 69–78, January, 2002, Copyright 2002 by Cell Press Nicastrin Is Required for ␥-Secretase Cleavage of the Drosophila Notch Receptor Yue Hu, Yihong Ye,2 and Mark E. Fortini1 putative transmembrane domains and a large cyto- Department of Genetics plasmic loop, and they are localized predominantly in University of Pennsylvania School of Medicine the ER/Golgi compartment. Mutations in the two known Philadelphia, Pennsylvania 19104 human Presenilin genes PS1 and PS2 account for most cases of early onset, autosomal dominant Alzheimer’s disease (reviewed in Selkoe, 1999; Steiner and Haass, Summary 2000). The PS mutations promote the generation of neu- rotoxic A␤ peptide derivatives of amyloid precursor pro- Nicastrin is genetically linked to Notch/lin-12 signaling tein (APP) by altering the manner in which APP is cleaved in C. elegans and is part of a large multiprotein com- at a site, termed the ␥-secretase site, within its trans- plex along with Presenilin. Here we describe the isola- membrane domain. These observations led to the hy- tion and characterization of Drosophila Nicastrin (Nic) pothesis that Presenilin might itself be the long sought mutants. Nic mutants and tissue clones display char- “␥-secretase” enzyme responsible for this cleavage acteristic Notch-like phenotypes. Genetic and inhi- (Wolfe et al., 1999). Several findings have now provided bitor studies indicate a function for Nicastrin in the strong support for this idea. Elimination of PS1 activity ␥-secretase step of Notch processing, similar to Pre- in knockout mice leads to reduced ␥ cleavage of APP senilin.
    [Show full text]
  • Nicastrin (NCSTN) (NM 015331) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC100655 Nicastrin (NCSTN) (NM_015331) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Nicastrin (NCSTN) (NM_015331) Human Untagged Clone Tag: Tag Free Symbol: NCSTN Synonyms: ATAG1874 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Nicastrin (NCSTN) (NM_015331) Human Untagged Clone – SC100655 Fully Sequenced ORF: >OriGene ORF within SC100655 sequence for NM_015331 edited (data generated by NextGen Sequencing) ATGGCTACGGCAGGGGGTGGCTCTGGGGCTGACCCGGGAAGTCGGGGTCTCCTTCGCCTT CTGTCTTTCTGCGTCCTACTAGCAGGTTTGTGCAGGGGAAACTCAGTGGAGAGGAAGATA TATATCCCCTTAAATAAAACAGCTCCCTGTGTTCGCCTGCTCAACGCCACTCATCAGATT GGCTGCCAGTCTTCAATTAGTGGAGACACAGGGGTTATCCACGTAGTAGAGAAAGAGGAG GACCTACAGTGGGTATTGACTGATGGCCCCAACCCCCCTTACATGGTTCTGCTGGAGAGC AAGCATTTTACCAGGGATTTAATGGAGAAGCTGAAAGGGAGAACCAGCCGAATTGCTGGT CTTGCAGTGTCCTTGACCAAGCCCAGTCCTGCCTCAGGCTTCTCTCCTAGTGTACAGTGC CCAAATGATGGGTTTGGTGTTTACTCCAATTCCTATGGGCCAGAGTTTGCTCACTGCAGA GAAATACAGTGGAATTCGCTGGGCAATGGTTTGGCTTATGAAGACTTTAGTTTCCCCATC TTTCTTCTTGAAGATGAAAATGAAACCAAAGTCATCAAGCAGTGCTATCAAGATCACAAC CTGAGTCAGAATGGCTCAGCACCAACCTTCCCACTATGTGCCATGCAGCTCTTTTCACAC
    [Show full text]
  • Bottom-Up Structural Proteomics: Cryoem of Protein Complexes Enriched from the Cellular Milieu
    ARTICLES https://doi.org/10.1038/s41592-019-0637-y Bottom-up structural proteomics: cryoEM of protein complexes enriched from the cellular milieu Chi-Min Ho 1,2,3,10, Xiaorun Li3,4,10, Mason Lai2,3, Thomas C. Terwilliger 5, Josh R. Beck 6,7, James Wohlschlegel 8, Daniel E. Goldberg6, Anthony W. P. Fitzpatrick9 and Z. Hong Zhou 1,2,3* X-ray crystallography often requires non-native constructs involving mutations or truncations, and is challenged by membrane proteins and large multicomponent complexes. We present here a bottom-up endogenous structural proteomics approach whereby near-atomic-resolution cryo electron microscopy (cryoEM) maps are reconstructed ab initio from unidentified pro- tein complexes enriched directly from the endogenous cellular milieu, followed by identification and atomic modeling of the proteins. The proteins in each complex are identified using cryoID, a program we developed to identify proteins in ab initio cryoEM maps. As a proof of principle, we applied this approach to the malaria-causing parasite Plasmodium falciparum, an organism that has resisted conventional structural-biology approaches, to obtain atomic models of multiple protein complexes implicated in intraerythrocytic survival of the parasite. Our approach is broadly applicable for determining structures of undis- covered protein complexes enriched directly from endogenous sources. he recent ‘resolution revolution’ in cryoEM1–9 has opened the of routinely achievable cryoEM maps. A systematic approach for iden- door for determination of high-resolution structure of a vast tifying a complex from typical near-atomic (3.0–4.0 Å) cryoEM maps Tnumber of previously intractable biological systems. There would be transformative for cryoEM and systems biology, opening the is no need for crystallization because samples for cryoEM are pre- door for structure determination of novel, unidentified molecules and served in a frozen-hydrated state and are randomly oriented within complexes enriched directly from endogenous sources.
    [Show full text]
  • V9a26-Li Pgmkr
    Molecular Vision 2003; 9:179-83 <http://www.molvis.org/molvis/v9/a26> © 2003 Molecular Vision Received 22 January 2003 | Accepted 30 April 2003 | Published 1 May 2003 β-Amyloid secretases and β-amyloid degrading enzyme expression in lens Guanghui Li, Luigi Percontino, Qian Sun, A. Sami Qazi, Peter H. Frederikse Department of Pharmacology & Physiology and the Integrative Neuroscience Program, UMDNJ-New Jersey Medical School, NJ Purpose: β- and γ-Secretases are proteases involved in the processing of the Alzheimer precursor protein (AβPP) that releases the transmembrane β-amyloid fragment (Aβ), associated with age-dependent disease in lens and brain. γ-Secretase is a protein complex containing Presenilin and Nicastrin proteins, which also processes Notch and other receptors in- volved in the eye and lens development. Neprilysin (NEP), a major protease involved in degrading Aβ, acts with β- and γ- secretases to regulate steady-state levels of Aβ. Previously, we demonstrated AβPP and Presenilin expression and process- ing in the lens and demonstrated cell degeneration in classic Alzheimer disease (AD) transgenic and systemic oxidative stress animal models, suggesting that additional AβPP processing proteins are also present in the lens. Here we investigate lens expression of β-secretases, nicastrin and NEP proteins, and compare their protein distribution to Notch and Presenilin in lens. Methods: RT-PCR was used to analyze mRNA transcripts. Immunoblots and immunohistochemistry were used to exam- ine the protein expression and distribution of secretase and Aβ degrading proteins, as well as Presenilin and Notch pro- teins in mouse lenses. Results: β-Acting cleaving enzymes, BACE (BACE1) and BACE2, Nicastrin, Presenilins, Notch and NEP are expressed in the lens.
    [Show full text]
  • APH-1 Is a Multipass Membrane Protein Essential for the Notch Signaling Pathway in Caenorhabditis Elegans Embryos
    APH-1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos Caroline Goutte*†, Makoto Tsunozaki*, Valerie A. Hale*, and James R. Priess‡§¶ *Department of Biology, Amherst College, Amherst, MA 01002; ‡Division of Basic Sciences and Molecular and Cellular Biology Program, Fred Hutchinson Cancer Research Center, Seattle, WA 98109; and §Department of Zoology and ¶Howard Hughes Medical Institute, University of Washington, Seattle, WA 98195 Edited by Judith Kimble, University of Wisconsin, Madison, WI, and approved November 16, 2001 (received for review October 2, 2001) Early embryonic cells in Caenorhabditis elegans embryos interact We have identified aph-1 as a gene that is involved in Notch through a signaling pathway closely related to the Notch signaling signaling in the early C. elegans embryo, and show that closely pathway in Drosophila and vertebrates.Components of this path- related genes exist in Drosophila, mice, and humans. Mutations way include a ligand, receptor, the presenilin proteins, and a novel in aph-1 cause the embryonic Aph phenotype, indicative of protein, APH-2, that is related to the Nicastrin protein in humans. defective Notch signaling at the 4- and 12-cell stages of embry- Here we identify the aph-1 gene as a new component of the Notch ogenesis. At these stages, the aph-1 mutant embryos show a pathway in Caenorhabditis elegans. aph-1 is predicted to encode a marked defect in the ability to localize the Notch pathway novel, highly conserved multipass membrane protein. We show component APH-2͞Nicastrin. We show that inactivation of the that aph-1 and the presenilin genes share a similar function in that presenilin genes causes a very similar mislocalization of APH- they are both required for proper cell-surface localization of 2͞Nicastrin.
    [Show full text]
  • Structural Modeling of Γ-Secretase Aβn Complex Formation And
    bioRxiv preprint doi: https://doi.org/10.1101/500488; this version posted December 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Structural Modeling of γ-Secretase Aβn Complex Formation and Substrate Processing M. Hitzenberger and M. Zacharias Physics Department T38 Technical University of Munich James-Frank-Str. 1 85748 Garching, Germany bioRxiv preprint doi: https://doi.org/10.1101/500488; this version posted December 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The intra-membrane aspartyl protease γ-secretase (GSEC) cleaves single-span trans- membrane helices including the C-terminal fragment of the amyloid precursor protein (APP). This substrate is initially cleaved at the -site followed by successive processing (trimming) events mostly in steps of three amino acids. GSEC is responsible for the for- mation of N-terminal APP amyloid-β (Aβ) peptides of different length (e.g. Aβ42) that can form aggregates involved in Alzheimer's disease pathogenesis. The molecular mecha- nism of GSEC-APP substrate recognition is key for understanding how different peptide products are formed and could help in designing APP-selective modulators. Based on the known structure of apo GSEC and the APP-C99 fragment we have generated putative structural models of the initial binding in three different possible modes using extensive Molecular Dynamics (MD) simulations. The binding mode with the substrate helix lo- cated in a cleft between the transmembrane helices 2 and 3 of the presenilin subunit was identified as a most likely binding mode.
    [Show full text]
  • 82505318.Pdf
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Am. J. Hum. Genet. 70:1568–1574, 2002 Report The Gene Encoding Nicastrin, a Major g-Secretase Component, Modifies Risk for Familial Early-Onset Alzheimer Disease in a Dutch Population-Based Sample Bart Dermaut,1 Jessie Theuns,1 Kristel Sleegers,2 Hiroshi Hasegawa,3 Marleen Van den Broeck,1 Krist’l Vennekens,1 Ellen Corsmit,1 Peter St. George-Hyslop,3 Marc Cruts,1 Cornelia M. van Duijn,1,2 and Christine Van Broeckhoven1 1Department of Molecular Genetics, Flanders Interuniversity Institute of Biotechnology, University of Antwerp (Universitaire Instelling Antwerpen), Antwerp; 2Department of Epidemiology and Biostatistics, Erasmus Medical Center, Rotterdam; and 3Centre for Research in Neurodegenerative Diseases and Department of Medicine, University of Toronto, Department of Medicine (Neurology), Toronto Western Hospital, University of Toronto, Toronto Nicastrin regulates g-secretase cleavage of the amyloid precursor protein by forming complexes with presenilins, in which most mutations causing familial early-onset Alzheimer disease (EOAD) have been found. The gene encoding nicastrin (NCSTN) maps to 1q23, a region that has been linked and associated with late-onset Alzheimer disease (LOAD) in various genome screens. In 78 familial EOAD cases, we found 14 NCSTN single-nucleotide polymor- phisms (SNPs): 10 intronic SNPs, 3 silent mutations, and 1 missense mutation (N417Y). N417Y is unlikely to be pathogenic, since it did not alter amyloid b secretion in an in vitro assay and its frequency was similar in case and control subjects. However, SNP haplotype estimation in two population-based series of Dutch patients with EOAD (n p 116 ) and LOAD (n p 240 ) indicated that the frequency of one SNP haplotype (HapB) was higher in the group with familial EOAD (7%), compared with the LOAD group (3%) and control group (3%).
    [Show full text]
  • P53-Dependent Control of Transactivation of the Pen2 Promoter by Presenilins
    Research Article 4003 p53-dependent control of transactivation of the Pen2 promoter by presenilins Julie Dunys1, Jean Sevalle1, Emilie Giaime1, Raphaëlle Pardossi-Piquard1, Michael P. Vitek2, Paul Renbaum3, Ephrat Levy-Lahad3, Yun-wu Zhang4,5, Huaxi Xu4,5, Frédéric Checler1,* and Cristine Alves da Costa1,* 1Institut de Pharmacologie Moléculaire et Cellulaire of Centre National de la Recherche Scientifique and Institut de NeuroMédecine Moléculaire, Equipe labellisée Fondation pour la Recherche Médicale, Valbonne, France 2Cogniscience, Research Triangle Park, NC 27709, USA 3Medical Genetics Unit, Shaare Zedek Medical Center, Hebrew University Medical School, Jerusalem 91031, Israel 4Neurodegeneration Program, Burnham Institute for Medical Research, La Jolla, CA 92037, USA 5Institute for Biomedical Research and Fujian Provincial Key Laboratory of Neurodegenerative Disease and Aging Research, Xiamen 361005, China *Authors for correspondence ([email protected]; [email protected]) Accepted 18 August 2009 Journal of Cell Science 122, 4003-4008 Published by The Company of Biologists 2009 doi:10.1242/jcs.051169 Summary The senile plaques found in the brains of patients with Interestingly, overexpression of presenilin-2 greatly increases Alzheimer’s disease are mainly due to the accumulation of Pen2 promoter transactivation. The opposite effect triggered amyloid -peptides (A) that are liberated by -secretase, a high by both presenilins was reminiscent of our previous study, which molecular weight complex including presenilins, PEN-2, APH- showed that these two proteins elicit antagonistic effects on p53. 1 and nicastrin. The depletion of each of these proteins disrupts Therefore, we examined the contribution of p53 on Pen2 the complex assembly into a functional protease. Here, we transcription.
    [Show full text]
  • Crystal Structure of the Γ-Secretase Component Nicastrin
    Crystal structure of the γ-secretase component nicastrin Tian Xiea,b,1, Chuangye Yanb,c,1, Rui Zhoua,b, Yanyu Zhaoa,b, Linfeng Suna,b, Guanghui Yangb,c, Peilong Lua,b, Dan Maa,b, and Yigong Shia,b,2 aMinistry of Education Key Laboratory of Protein Science, cState Key Laboratory of Bio-Membrane and Membrane Biotechnology, and bTsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences and School of Medicine, Tsinghua University, Beijing 100084, China Contributed by Yigong Shi, August 6, 2014 (sent for review July 12, 2014) γ-Secretase is an intramembrane protease responsible for the gen- secondary structural elements, including 19 TMs (26). In this eration of amyloid-β (Aβ) peptides. Aberrant accumulation of study, we present the high-resolution crystal structure of the Aβ leads to the formation of amyloid plaques in the brain of nicastrin ECD from the eukaryote Dictyostelium purpureum and patients with Alzheimer’s disease. Nicastrin is the putative sub- discuss its functional implications. strate-recruiting component of the γ-secretase complex. No atomic- resolution structure had been identified on γ-secretase or any Results of its four components, hindering mechanistic understanding of Overall Structure of the Nicastrin ECD. The ECD of human nicastrin γ-secretase function. Here we report the crystal structure of nicas- (HsNCT), containing residues 1–669, accounts for 94% of trin from Dictyostelium purpureum at 1.95-Å resolution. The ex- the full-length sequence. Similar to other higher organisms, tracellular domain of nicastrin contains a large lobe and a small D. purpureum contains all four components of the γ-secretase, lobe.
    [Show full text]
  • The Notch Inhibitor Cowanin Accelerates Nicastrin Degradation Midori A
    www.nature.com/scientificreports OPEN The Notch inhibitor cowanin accelerates nicastrin degradation Midori A. Arai 1, Ryuta Akamine1, Anna Tsuchiya1, Tatsuro Yoneyama1, Takashi Koyano2, Thaworn Kowithayakorn3 & Masami Ishibashi1 Received: 13 November 2017 Aberrant activation of Notch signaling contributes to the pathogenesis of several diferent types of Accepted: 19 March 2018 cancer, and Notch pathway inhibitors may have signifcant therapeutic potential. Using a unique cell- Published: xx xx xxxx based assay system, we isolated twelve compounds, including one new natural product from Garcinia speciosa, that inhibit the Notch signaling pathway. HES1 and HES5 are target genes of the Notch cascade, and compound 2, referred to as cowanin, decreased the protein levels of HES1 and HES5 in assay cells. Furthermore, cowanin (2) showed potent cytotoxicity against human leukemic HPB-ALL cells. The Notch signaling inhibitory activity of cowanin (2) is linked to the increased degradation of nicastrin, which is one of the components of the γ-secretase complex. To the best of our knowledge, this is the frst example of a compound with Notch pathway inhibitory activity mediated by nicastrin degradation. Notch signaling plays a pivotal role in the regulation of many fundamental cellular processes, including prolifera- tion and stem cell maintenance. It also infuences cell diferentiation decisions at various stages during embryonic and adult development1,2. It is apparent that an important direct output of Notch activity is the upregulation of basic helix-loop-helix (bHLH) transcriptional repressors such as the hairy and enhancer of split 1 (HES1), HES5 and HES related (HESR/HEY) family genes. Notch signaling has an important role in the regulation of neural stem cell diferentiation3,4, and the diferentiation of neural stem cells into neurons can be inhibited by Notch signaling.
    [Show full text]
  • The Role of APP and BACE1 Trafficking in APP Processing and Amyloid-Β Generation Xiaojie Zhang and Weihong Song*
    Zhang and Song Alzheimer's Research & Therapy 2013, 5:46 http://alzres.com/content/5/5/46 REVIEW The role of APP and BACE1 trafficking in APP processing and amyloid-β generation Xiaojie Zhang and Weihong Song* Abstract Neuritic plaques in the brain are a major neuropathological hallmark of Alzheimer’s disease. They are formed by the deposition and aggregation of extracellular amyloid-β protein (Aβ). Aβ is derived from the sequential cleavage of amyloid-β precursor protein (APP) by β-secretase and γ-secretase. β-Site APP cleaving enzyme 1 (BACE1) functions as the primary, if not sole, β-secretase in vivo and is essential for Aβ production. Regulation of APP processing is a major focus of research into AD pathogenesis. The trafficking systems of APP and its cleavage enzymes are complex. Transporting APP and secretases into the same subcellular organelles facilitates their interaction and favors APP processing. The role of APP and BACE1 trafficking in the amyloidgenic pathway and the underlying mechanisms for Aβ production are discussed in this review. In addition, the distinct mechanisms of amino- and carboxy-terminal Aβ generation are reviewed. Introduction APP and BACE1 trafficked through subcellular organelles? Alzheimer’s disease (AD) is the most common type of How do the cleavage enzymes become mature and active? dementia. The most common initial symptom is gradual Do these enzymes exhibit preferential activities in certain memory loss followed by impairment of other intellec- subcellular locations? And how do substrates encounter tual abilities. According to the report of the Alzheimer’s these enzymes? Association in 2013, every 68 seconds one American will Here, we review current studies that advance our develop AD.
    [Show full text]