G C A T T A C G G C A T genes

Article PRPH2-Related Retinal Diseases: Broadening the Clinical Spectrum and Describing a New Mutation

Rosa M. Coco-Martin 1,2,*, Hortensia T. Sanchez-Tocino 3 , Carmen Desco 4 , Ricardo Usategui-Martín 1 and Juan J. Tellería 1

1 Instituto Universitario de Oftalmobiologia Aplicada, Universidad de Valladolid, 47011 Valladolid, Spain; [email protected] (R.U.-M.); [email protected] (J.J.T.) 2 Red Temática de Investigación Cooperativa en Salud de Oftalmologia (Oftared), Instituto de Salud Carlos III, 28029 Madrid, Spain 3 Department of Ophthalmology, Hospital Universitario Rio Hortega, 47012 Valladolid, Spain; [email protected] 4 Fisabio Oftalmologia Medica, 46035 Valencia, Spain; [email protected] * Correspondence: [email protected]; Tel.: +34-983-423-559 (ext. 4738)



Received: 8 June 2020; Accepted: 7 July 2020; Published: 9 July 2020


Abstract: Over 175 pathogenic mutations in the Peripherin-2 (PRPH2) gene are linked to various retinal diseases. We report the phenotype and genotype of eight families (24 patients) with retinal diseases associated with seven distinct PRPH2 gene mutations. We identified a new mutation, c.824_828+3delinsCATTTGGGCTCCTCATTTGG, in a patient with adult-onset vitelliform macular dystrophy (AVMD). One family with the p.Arg46Ter mutation presented with the already described AVMD phenotype, but another family presented with the same mutation and two heterozygous pathogenic mutations (p.Leu2027Phe and p.Gly1977Ser) in the ATP Binding Cassette Subfamily A Member 4 (ABCA4) gene that cause extensive chorioretinal atrophy (ECA), which could be a blended phenotype. The p.Lys154del PRPH2 gene mutation associated with the p.Arg2030Glu mutation in the ABCA4 gene was found in a patient with multifocal pattern dystrophy simulating fundus flavimaculatus (PDsFF), for whom we considered ABCA4 as a possible modifying gene. The mutation p.Gly167Ser was already known to cause pattern dystrophy, but we also found ECA, PDsFF, and autosomal-dominant retinitis pigmentosa (ADRP) as possible phenotypes. Finally, we identified the mutation p.Arg195Leu in a large family with common ancestry, which previously was described to cause central areolar choroidal dystrophy (CACD), but we also found ADRP and observed that it caused ECA more frequently than CACD in this family.

Keywords: PRPH2; ABCA4; AVMD; pattern dystrophy simulating FF; extensive chorioretinal atrophy; CACD; blended phenotypes; inherited retinal diseases

1. Introduction Mutations in the Peripherin-2 (PRPH2) gene (OMIM: 179605) are among the most frequently found in inherited retinal diseases (IRD) [1], with an even higher percentage among diseases primarily involving the central retina [2]. The mutations may differentially affect the gene’s protein product role as a structural component or as a functional protein that is key for organizing membrane domains for cellular signaling. These roles may be different in the rods and cones, thus contributing to the phenotypic heterogeneity that characterizes this group of diseases [3]. Over 175 pathogenic mutations in the PRPH2 gene are linked to numerous human retinal diseases (summarized at http://www.retina-international.org/files/sci-news//rdsmut.htm)[4], which generally have an autosomal-dominant inheritance pattern. Their linked phenotypes show significant variability

Genes 2020, 11, 773; doi:10.3390/genes11070773 www.mdpi.com/journal/genes Genes 2020, 11, 773 2 of 24 in age at onset, severity, and a range of clinical features including those limited to the macula, such as adult-onset vitelliform macular dystrophy (AVMD, MIM 608161), butterfly patterned dystrophy (PD, MIM 169150), or central areolar choroidal dystrophy (CACD, MIM 613105), and those with more widespread disorders, such as retinitis pigmentosa 7 (RP, MIM 608133) or retinitis punctata albescens (MIM 136880) or digenic RP caused by heterozygous mutations in Retinal Outer Segment Membrane Protein 1 (ROM1) and PRPH2 genes in conjunction. Homozygous PRPH2 mutations cause Leber’s congenital amaurosis 18 (MIM 608133). Finally, clinical features also may look similar to the flecked retina associated with mutations of the ATP Binding Cassette Subfamily A Member 4 gene (ABCA4), which in this case is called multifocal patterned dystrophy simulating fundus flavimaculatus (PDsFF) [5]. Moreover, great variability has been reported even in single-point mutations among members of the same family who may present with very distinct phenotypes [6,7]. Mutations in the PRPH2 gene are associated with marked phenotypic heterogeneity and show relatively limited genotype–phenotype correlation [8]. This is because there is transition from one clinical classification to another as patients grow older and is also due to the inter- and intra-familial phenotypic variability, even among all patients carrying the same mutant allele. Currently, no known treatment has been developed for these diseases and the presence of other genetic modifiers (ROM1, ABCA4, etc.) makes gene therapy design challenging. Therefore, studying these conditions is important to identify new ways to improve vision in these patients. Knowing the mutations that patients carry also is important for genetic counseling. In this study, we present a detailed clinical characterization of 24 patients to broaden the spectrum of molecularly confirmed macular dystrophy due to PRPH2 mutations by disclosing new clinical presentations of known mutations, one new mutation, and one possible blended phenotype.

2. Materials and Methods

2.1. Ethics Statement This observational cross-sectional study was conducted in accordance with the 1964 Declaration of Helsinki and its subsequent amendments. All subjects signed an informed consent form, including consent to publish photographs, under protocol code number IOBA-2020-D, approved by the Instituto Universitario de Oftalmobiologia Aplicada (IOBA) Research Commission. The study was performed at the IOBA Retina Unit, University of Valladolid, Spain.

2.2. Clinical Characterization of the Study Subjects The current study included only Spanish Caucasian patients with a demonstrated mutation in the PRPH2 gene from a database of 579 patients. Patients underwent a routine ocular examination at IOBA. Patient demographic data, age at symptom onset, best-corrected visual acuity (BCVA), fundus appearance, and the results of autofluorescence (AF), spectral-domain optical coherence tomography (SD-OCT), and sometimes fluorescein angiography (FA) were recorded. A detailed family history was obtained from the probands and/or their relatives; first-degree relatives were examined when possible. Automated static perimetry to examine the visual fields (VF) was performed using the Humphrey Field Analyzer (Carl Zeiss Meditec, Dublin, CA, USA). Full-field electroretinogram (ffERG) recordings were assessed using the computerized Optoelectronic Stimulator Vision Monitor MonPack 120 (Metrovision, Pérenchies, France) according to the International Society for Clinical Electrophysiology of Vision protocols [9]. Clinical diagnoses were based on structural and functional eye examinations. AVMD was diagnosed based on the presence of elevated yellow or pigmented deposits between the neurosensory retina and retinal pigment epithelium (RPE) at the foveal or parafoveal region in at least one eye and normal electrophysiology testing. PDsFF was diagnosed in the presence of multiple yellowish, irregular flecks scattered around the posterior pole and mid-periphery, simulating what is observed in FF disease, with a normal ffERG that remains asymptomatic until adulthood. CACD was diagnosed Genes 2020, 11, 773 3 of 24 based on the presence of atrophic changes restricted to the macular area that started in middle age. Patients with extensive chorioretinal atrophy (ECA) presented with large atrophic retinal areas involving the macula and fundus mid-periphery, a large central scotoma in the VF, and both subnormal photopic and scotopic ffERGs. Finally, patients presenting with these later features, but associated with night blindness, concentric VF restriction, and an abolished scotopic ffERG with a subnormal, but still present, response in the photopic ffERG were diagnosed with ADRP.

2.3. Genetic Analysis Peripheral blood samples were collected from the affected patients and available unaffected relatives for DNA extraction. For families 1, 2, 5, 6, and 7, the PRPH2 gene was analyzed by direct sequencing. Forward and reverse direct sequencing was done using Big Dye v3.1 chemistry (Applied Biosystems, Foster City, CA, USA). Capillary electrophoresis was performed on the ABI PRISM 3130xl Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA). The resulting data were analyzed using Sequencing Analysis v5.2 and SeqScape v2.5 software (Applied Biosystems, Foster City, CA, USA). Regarding families 3, 4, and 8, DNA was sequenced with an Illumina HiSeq next generation sequencing (NGS) platform (Illumina, San Diego, CA, USA) using a specific IRD enrichment panel based on exon capture technology. Exome enrichment was carried out with the Nextera Exome Kit, previously known as the TruSeq Rapid Exome Library Prep Kit. The IRD panel captured 346 hereditary eye disease genes, including 346 genes and 66 non-coding genomic regions of interest related to more than 50 IRDs including the ones diagnosed in the probands. Several bioinformatic filtering steps were carried out to rule out neutral variants and prioritize possible pathogenic variants. This prioritization was based on genetic and population criteria and complemented by exhaustive bibliographic studies and databases. The mean coverage in the presented cases was 577.2x, and in all three cases, 99.8% of the regions of interest had a read depth of 15x or greater. Stratified disease-associated variants were confirmed by Sanger sequencing. In this study, only those variants that were identified as pathogenic (frameshift, premature stop codon, splice site variants affecting canonical sites, and reported variants known to cause retinal diseases in ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/) or the Human Gene Mutation Database (https://go.qiagen.com/HGMD) or whose frequency in the control population was less than 0.5% and complied with the pathogenicity predictions following established bioinformatic algorithms such as PolyPhen-2 [10], SIFT [11], and MutationTaster [12] were reported. All the variants reported in this publication had been previously described as pathogenic or likely pathogenic mutations with only one exception. Cases in which two mutated alleles on the same gene were identified would have needed a segregation analysis to identify if they had been inherited separately from the parents, but in most cases of this series, parents were not available for the study.

3. Results Twenty-four patients from eight families were included with seven distinct PRPH2 genetic mutations. The phenotype characterization of patients is summarized in Tables1 and2. Genotype data, type of mutation, location in the protein domains, and clinical diagnoses are presented in Table3. The location of the identified mutations in a scheme of the PRPH2 protein is shown in Figure1, together with the frequency and location of all the mutations described to date in the PRPH2 gene. Genes 2020, 11, 773 4 of 24

Table 1. Functional characteristics of patients’ clinical features.

Patient Gender Age at Onset Symptoms at Onset BCVA at First Visit (Age) BCVA at Last Visit (Age) Visual Field ffERG (Gene Variant) Metamorphopsia F1-II-2 Small central M 56 followed by central 20/32 RE; 20/25 LE (56) N/A Normal p.Arg46Ter scotoma vision loss F1-II-3 Fe 51 Metamorphopsia 20/25 BE (51) N/A Normal Normal p.Arg46Ter F1-II-4 M 46 Metamorphopsia 20/25 BE (46) N/A Normal Normal p.Arg46Ter F2-III-6 Scotopic and photopic subnormal PRPH2: p.Arg46Ter Loss of peripheral Large central 0 dB b-wave amplitude = 152 µV M 52 20/50 RE; 20/40 LE (61) 20/63 RE/20/200 LE (76) ABCA4: visual field scotoma RE/182 µV LE; photopic = 22 µV p.Leu2027Phe/p.Gly1977Ser RE/28 µV LE F3-V-2 Scotopic subnormal and photopic PRPH2: p.Lys154del Small paracentral preserved M 37 Metamorphopsia 20/16 RE; 20/20 LE (37) N/A ABCA4: scotomas 0 dB b-wave amplitude = 222 µV p.Arg2030Gln RE/219 µV LE Scotopic abolished and photopic F4-III-1 Casual finding after Large central subnormal Fe 68 20/25 BE (68) 20/100 RE; 20/32 LE (78) p.Gly167Ser cataract surgery scotoma Photopic b-wave amplitude = 22 µV RE/28 µV LE Scotopic and photopic subnormal Asymptomatic, casual F4-IV-1 Paracentral 0 dB b-wave amplitude = 231 µV Fe 53 finding after Dx of her 20/20 BE (53) N/A p.Gly167Ser scotoma RE/218 µV LE; photopic = 57 µV mother RE/61 µV LE Asymptomatic, casual F4-IV-2 Fe 51 finding after Dx of her 20/20 BE (51) N/A Normal Normal p.Gly167Ser mother F5a-III-2 M 53 Loss of central vision 20/32 RE; 20/100 LE (59) N/AN/A Normal p.Arg195Leu Asymptomatic, casual F5a-III-7 M 58 finding after Dx of 20/20 RE; 20/32 LE (58) N/AN/A Normal p.Arg195Leu his brother Asymptomatic, casual F5a-III-8 M 59 finding after Dx of 20/125 RE; 20/100 LE (59) N/AN/A Normal p.Arg195Leu his brother Genes 2020, 11, 773 5 of 24

Table 1. Cont.

Patient Gender Age at Onset Symptoms at Onset BCVA at First Visit (Age) BCVA at Last Visit (Age) Visual Field ffERG (Gene Variant) F5a-III-10 M 42 Loss of central vision 20/63 RE; 20/25 LE (55) 20/400 RE; 20/50 LE (61) Central scotoma Normal p.Arg195Leu Scotopic subnormal and photopic F5b-III-4 Large central abolished Fe 26 Loss of central vision 20/400 BE (89) N/A p.Arg195Leu scotoma 0 dB b-wave amplitude = 87 µV RE/113 µV LE Scotopic and photopic subnormal F5b-IV-1 0 dB b-wave amplitude = 228 µV M 39 Loss of central vision 20/25 RE; 20/32 LE (42) N/A Central scotoma p.Arg195Leu RE/169 µV LE; photopic = 27 µV RE/28 µV LE Scotopic and photopic subnormal Asymptomatic, casual F5b-IV-2 Small central 0 dB b-wave amplitude = 256 µV Fe 31 finding after Dx of 20/20 BE (31) N/A p.Arg195Leu scotoma RE/253 µV LE; photopic = 25 µV his cousin RE/27 µV LE Scotopic subnormal and photopic F5b-IV-4 Large central abolished M 37 Loss of central vision 20/40 RE; 20/25 LE (37) 20/63 RE/20/25 LE (50) p.Arg195Leu scotoma 0 dB b-wave amplitude = 174 µV RE/216 µV LE Scotopic subnormal and photopic F5c-IV-4 abolished Fe 25 Loss of central vision 20/800 RE/CF LE (77) N/A Central scotoma p.Arg195Leu 0 dB b-wave amplitude = 231 µV RE/218 µV LE Scotopic subnormal and photopic F5c-V-2 abolished Fe 35 Loss of central vision 20/200 RE; 20/125 LE (41) N/A Central scotoma p.Arg195Leu 0 dB b-wave amplitude = 251 µV RE/259 µV LE Scotopic subnormal and photopic F5c-VI-2 abolished Fe 18 Loss of central vision 20/50 RE; 20/32 LE (18) N/A central scotoma p.Arg195Leu 0 dB b-wave amplitude = 258 µV RE/299 µV LE; Scotopic abolished and photopic F5d-VI-1 Loss of central vision Large central subnormal M 20 20/32 BE (25) 20/100 BE (45) p.Arg195Leu and night blindness scotoma Photopic b-wave amplitude = 35 µV RE/38 µV LE Genes 2020, 11, 773 6 of 24

Table 1. Cont.

Patient Gender Age at Onset Symptoms at Onset BCVA at First Visit (Age) BCVA at Last Visit (Age) Visual Field ffERG (Gene Variant) Metamorphopsia F6-I-5 First normal, then M 56 followed by 20/32 RE; 20/25 LE (62) 20/400 BE (76) Normal p.Val209Ile central scotoma centralvision loss 6-II-2 Asymptomatic, Fe 51 20/20 BE (50) 20/20 BE (54) Normal Normal p.Val209Ile casual finding Concentric F7-III-1 Tunnel vision and Scotopic and photopic Fe 18 20/20 RE; 20/32 LE (48) 20/25 RE; 20/200 LE (67) retraction of p.Pro216Ser night blindness abolished visual field F8-II-2 c.824_828+3delins M 34 Metamorphopsia 20/25 RE; 20/40 LE (34) N/A Normal Normal CATTTGGGCTCCTCATTTGG BCVA, best-corrected visual acuity; ffERG, full-field electroretinogram; F, family; C, case; Fe, female; M, male; RE, right eye; LE, left eye; BE, both eyes; ABCA4, ATP binding Cassette Subfamily A member 4 gene; PRPH2, Peripherin-2 gene; N/A, not available; Dx, diagnosis.

Table 2. Image pictures, description of structural changes, and clinical diagnosis.

Patient Fundus Rat Peripheral Fundus at Central Retina Autofluorescence OCT Clinical Diagnosis (Gene Variant) Retina F1-II-2 Hyper-reflective deposit above RPE Subfoveal yellowish deposit Normal Hyper-AF of the subfoveal deposit AVMD p.Arg46Ter in the foveal/perifoveal regions F1-II-3 Hyper-reflective deposit above the Subfoveal yellowish deposit Normal Hyper-AF of the subfoveal deposit AVMD p.Arg46Ter RPE in the foveal/perifoveal regions F1-II-4 Hyper-reflective deposit above the Subfoveal yellowish deposit Normal Hyper-AF of the subfoveal deposit AVMD p.Arg46Ter RPE in the foveal/perifoveal regions Outer retinal atrophy of the macular F2-III-6 Large confluent areas of CR region and choroidal PRPH2: p.Arg46Ter Hypo-AF due to plaques atrophy in atrophy, with preserved Plaques of CR atrophy hyper-reflectivity by window defect Extensive CR atrophy ABCA4: macula and periphery of the retina foveal area at the posterior pole in BE. p.Leu2027Phe/p.Gly1977Ser CRT = 128 µm RE/141 µm LE F3-V-2 Irregular aspect or disruption of the PRPH2: p.Lys154del Yellow triradiate flecks in the Yellow and gray triradiate Some flecks were hyper-AF and Multifocal PD simulating EZ and IZ limited to the foveal region. ABCA4: posterior pole flecks in mid-periphery others were hypo-AF Fundus Flavimaculatus CRT = 286 µm RE/287 µm LE p.Arg2030Gln Genes 2020, 11, 773 7 of 24

Table 2. Cont.

Patient Fundus Rat Peripheral Fundus at Central Retina Autofluorescence OCT Clinical Diagnosis (Gene Variant) Retina Areas of outer retinal atrophy, EZ Confluent hypo-AF areas involving and IZ disrupted at the posterior pole Large confluent areas of CR the optic disc and extending beyond F4-III-1 Whitish dots in in BE. Hyporeflective cysts at the atrophy, with preserved the vascular arcades with speckled ADRP p.Gly167Ser mid-periphery inner nuclear layers and epiretinal foveal area points of hypo-AF in the posterior membrane in the LE. CRT = 253 µm pole and mid-periphery RE/252 µm LE Whitish dots in Small plaque area of hypo-AF at the EZ and IZ disrupted at the perifoveal F4-IV-1 Whitish stippling all over the mid-periphery and small fovea with scarce speckled points of level in BE. CRT = 270 µm Extensive CR atrophy p.Gly167Ser posterior pole areas of atrophy in hypo-AF and hyper-AF in the RE/272 µm LE far-periphery posterior pole and mid-periphery Macular hypo-AF with speckled Irregular aspect or disruption of the F4-IV-2 Yellow triradiate flecks in the Yellow triradiate flecks in Multifocal PD simulating hyper-AF and hypo-AF at the EZ and IZ limited to the foveal p.Gly167Ser posterior pole mid-periphery Fundus Flavimaculatus posterior pole and mid-periphery region. CRT = 264 µm RE/266 µm LE Hypo-AF at the atrophic macular Outer retinal atrophy of the macular F5a-III-2 Atrophy of both maculae with Normal area and speckled hypo-AF within region and choroidal CACD p.Arg195Leu preserved fovea the vascular arcades hyper-reflectivity by window defect F5a-III-7 Whitish stippling only in the Hypo-AF at the atrophic Irregular aspect or disruption of the Normal CACD p.Arg195Leu macular area macular area EZ and IZ at the macular region Outer retinal atrophy of the macular F5a-III-8 Hypo-AF at the atrophic Atrophy of both maculae Normal region and choroidal CACD p.Arg195Leu macular area hyper-reflectivity by window defect Large areas of CR atrophy Hypo-AF at the atrophic macular Outer retinal atrophy of the macular F5a-III-10 and whitish stippling within Normal area and speckled hypo-AF within region and choroidal CACD p.Arg195Leu the vascular arcades the vascular arcades hyper-reflectivity by window defect Confluent hypo-AF areas involving Outer retinal atrophy of the macular Large confluent areas of CR the optic disc and extending beyond F5b-III-4 Extensive CR atrophy of region and choroidal atrophy in the posterior pole the vascular arcades with speckled Extensive CR atrophy p.Arg195Leu mid-periphery hyper-reflectivity by window defect and mid-periphery points of hypo-AF in the posterior at the posterior pole in BE pole and mid-periphery Outer retinal atrophy of the macular region and choroidal Whitish stippling all over the Small plaque areas of hypo-AF with F5b-IV-1 Whitish dots in hyper-reflectivity by window defect, posterior pole of BE with scarce speckled points of hypo-AF in Extensive CR atrophy p.Arg195Leu mid-periphery EZ and IZ disrupted at the posterior macular atrophy (>LE) the posterior pole and mid-periphery pole in BE. CRT = 174 µm RE/184 µm LE Genes 2020, 11, 773 8 of 24

Table 2. Cont.

Patient Fundus Rat Peripheral Fundus at Central Retina Autofluorescence OCT Clinical Diagnosis (Gene Variant) Retina Retinal thinning of the F5b-IV-2 Atrophy of both maculae with Speckled points of hypo-AF in the Normal macular region. CACD p.Arg195Leu preserved fovea posterior pole CRT = 205 µm RE/213 µm LE Outer retinal atrophy of the macular Confluent hypo-AF areas involving region and choroidal Large confluent areas of CR the optic disc and extending beyond F5b-IV-4 Plaques of CR atrophy in hyper-reflectivity by window defect, atrophy, with preserved the vascular arcades with speckled Extensive CR atrophy p.Arg195Leu mid-periphery EZ and IZ disrupted at the posterior foveal area at the beginning points of hypo-AF in the posterior pole in BE. CRT = 220 µm pole and mid-periphery RE/214 µm LE Outer retinal atrophy of the macular Small plaque areas of hypo-AF in the F5c-IV-4 Small areas of CR atrophy region and choroidal Atrophy of both maculae posterior pole BE and in the CACD p.Arg195Leu in the RE hyper-reflectivity by window defect. mid-periphery RE CRT = 179 µm RE/191 µm LE Outer retinal atrophy of the macular Very small, shining, region and choroidal F5c-V-2 Very small, whitish dots all Speckled points of hypo-AF in the whitish dots in hyper-reflectivity by window defect, Extensive CR atrophy p.Arg195Leu over the posterior pole posterior pole and mid-periphery mid-periphery EZ and IZ disrupted at the posterior pole in BE Very small, shining, F5c-VI-2 Very small, whitish dots all Speckled points of hypo-AF in the Retinal thinning of the whitish dots in Extensive CR atrophy p.Arg195Leu over the posterior pole posterior pole and mid-periphery macular region mid-periphery Outer retinal atrophy of the macular Large confluent areas of CR Large plaque areas of hypo-AF in the F5d-VI-1 Small areas of CR atrophy region and choroidal atrophy, with preserved posterior pole and small plaque areas ADRP p.Arg195Leu in BE hyper-reflectivity by window defect foveal area at the beginning in mid-periphery at the posterior pole in BE Hyper-reflective deposit above the Subfoveal yellowish deposit RPE in the foveal region followed by F6-I-5 Hyper-AF first, followed by macular that evolved to macular Normal outer retinal atrophy of the AVMD p.Val209Ile hypo-AF atrophy macular region. CRT = 179 µm RE/164 µm LE Small scarce hyper-reflective deposit F6-II-2 Drusen-like deposits nasal to above the RPE in the Normal Juxtafoveal hypo-AF spots AVMD p.Val209Ile fovea in the LE perifoveal region. CRT = 226 µm RE/226 µm LE Genes 2020, 11, 773 9 of 24

Table 2. Cont.

Patient Fundus Rat Peripheral Fundus at Central Retina Autofluorescence OCT Clinical Diagnosis (Gene Variant) Retina Outer retinal atrophy of the macular region and choroidal hyper-reflectivity by window defect F7-III-1 CR atrophy and Hypo-AF in macula and periphery of at the posterior pole in BE. CR atrophy (>LE) ADRP p.Pro216Ser pigmentation in spicules the retina Hyporeflective cysts at the inner nuclear layer and lamellar macular hole in the LE. CRT = 188 µm RE/258 µm LE F8-II-2 Hyper-AF deposit in RE and Hyper-reflective deposit above the c.824_828+3delins Subfoveal yellowish deposit Normal AVMD hypo-AF in LE RPE in the foveal/perifoveal regions CATTTGGGCTCCTCATTTGG OCT, optical coherence tomography; F, family; C, case; CR, chorioretinal; LE, left eye; RE, right eye; BE, both eyes; AF, autofluorescence; EZ, ellipsoid zone; IZ, interdigitation zone; CRT, central retinal thickness; RPE, retinal pigment epithelium; ADRP, autosomal-dominant retinitis pigmentosa; AVMD, adult-onset vitelliform macular dystrophy; CACD, central areolar choroidal dystrophy; PD, pattern dystrophy.

Table 3. Genotype and phenotype data.

Location of Mutation PRPH2 Gene Global Allele Accession Phenotypes of All Phenotypes Family PRPH2 Gene Mutations in the Prph2 Mutation Type Frequency Number our Patients Described Protein Domain AVMD: F1-II-2, 1 (3 patients) c.136C>T, p.Arg46Ter Nonsense ID1 1.59115 10 5 rs61755771 AVMD [13] × − F1-II-3, and F1-II-4 c.136C>T, p.Arg46Ter +ABCA4: rs61751408 ECA [current study] 2 (1 patient) Nonsense ID1 1.59115 10 5 ECA: F2-III-6 c.6079C>T, p.Leu2027Phe and × − rs61750639 (blended phenotype) c.5929G>A, p.Gly1977Ser c.461_463del, p.Lys154del rs61755786 ADRP [14] 3 (1 patient) +ABCA4: Amino acid deletion ID2 Unknown PDsFF: F3-V-2 rs61750641 PDsFF [current study] c.6089G>A, p.Arg2030Gln PD [15] ADRP: F4-III-1 PDsFF [current study] 4 (3 patients) c.499G>A, p.Gly167Ser Missense ID2 1.59280 10 5 rs527236098 ECA: F4-IV-1 − ECA [current study] × PDsFF: F4-IV-2 ADRP [current study] Genes 2020, 11, 773 10 of 24

Table 3. Cont.

Location of Mutation PRPH2 Gene Global Allele Accession Phenotypes of All Phenotypes Family PRPH2 Gene Mutations in the Prph2 Mutation Type Frequency Number our Patients Described Protein Domain CACD: F5a-III-2, F5a-III-7, F5a-III-8, F5aIII-10, F5b-IV-2, CACD [16] and F5c-IV-4 5 (12 patients) c.584G>T, p.Arg195Leu Missense ID2 3.98349 10 6 rs121918567 ECA [13] − ECA: F5b-III-4, × ADRP [current study] F5b_IV-1, F5b-IV-4, F5c-V-2, and F5c-VI-2 ADRP: F5d-VI-1 AVMD: F6-I-5 and 6 (2 patients) c.625G>A, p.Val209Ile Missense ID2 1.98877 10 5 rs753657349 AVMD [13] × − F6-II-2 7 (1 patient) c.646C>T, p.Pro216Ser del ID2 Unknown rs61755805 ADRP: F7-III-1 ADRP [17] c.824_828+3delins Not previously AVMD [current 8 (1 patient) del/ins TM4 AVMD: F8-II-2 CATTTGGGCTCCTCATTTGG described study] ID2, intradiscal domain 2; ID1, intradiscal domain 1; TM4, transmembrane domain 4; AVMD, adult-onset vitelliform macular dystrophy; ECA, extensive chorioretinal atrophy; ADRP, autosomal-dominant retinitis pigmentosa; PD, pattern dystrophy; PDsFF: pattern dystrophy simulating fundus flavimaculatus; CACD, central areolar choroidal dystrophy. Genes 2020, 11, x FOR PEER REVIEW 9 of 24

Genes 2020, 11, x FOR PEER GenesREVIEW2020 , 11, 773 11 of 24 9 of 24

Figure 1. Location of identified mutations on the Peripherin-2 (PRPH2) protein and the frequency and location of all reported PRPH2 gene mutations. The PRPH2 protein scheme shows the location of the identified mutations. (A) The PRPH2 peptide chain shows extradiscal (C1, C2, and C3), transmembrane (TM1, TM2, TM3, and TM4), and intradiscal space locations (ID1 and ID2). The numberingFigureFigure indicates 1. Location the of identified identifiedamino acid mutations positions on the Peripherinat Peripherin-2 the boundaries-2 ( (PRPH2)PRPH2) proteinof the and domains. the frequency The and mutations identifiedlocationlocation in the ofof allallpatients reportedreported PRPH2PRPH2are indicated genegene mutations.mutations. by circles The PRPH2 (i.e., protein red scheme, p.Arg shows46Ter the; locationblack, ofp. theLys 154del, identifiedidentified mutations.mutations. (A )(A The) The PRPH2 PRPH2 peptide peptide chain shows chain extradiscal shows extradiscal (C1, C2, and (C1, C3), transmembraneC2, and C3), p.Gly167Ser, p.Arg195Leu, p.Val209Ile, and p.Pro216Ser; and purple for the novel mutation (TM1,transmembrane TM2, TM3, (TM1, and TM4), TM2, andTM3 intradiscal, and TM4), space and locations intradiscal (ID1 space and ID2). locations The numbering(ID1 and ID2). indicates The c.824_828+3delinsCATTTGGGCTCCTCATTTGGthenumbering amino acid indicates positions the at amino the boundaries acid positions of the domains.)at. (theB) boundariesRepresentation The mutations of the identified domains.of the in location theThe patients mutations (C are) and the frequencyindicatedidentified and number byin circles the ofpatients (i.e., all red, reported are p.Arg46Ter; indicated PRPH2 black, by mutations p.Lys154del,circles (i.e., are p.Gly167Ser,red based, p.Arg on46 p.Arg195Leu,Ter the; black Human, p. p.Val209Ile,Lys Gene154del, Mutation Databaseandp.G (HGMDly p.Pro216Ser;167Ser 2020.1)., p.Arg and195L purpleeu, forp.V theal209I novelle, mutationand p.Pro c.824_828216Ser; +and3delinsCATTTGGGCTCCTCATTTGG). purple for the novel mutation (c.824_828+3delinsCATTTGGGCTCCTCATTTGGB) Representation of the location (C) and the frequency). (B) andRepresentation number of allof reportedthe locationPRPH2 (Cmutations) and the Three affectedarefrequency based on membersand the number Human fromof Gene all reported Mutationfamily PRPH2 Database1 were mutations (HGMDsiblings are 2020.1). basedwith onAVMD the Human, aged Gene 56, Mutation 51, and 46 years Database (HGMD 2020.1). (Figure 2). AllThree three aff ectedhad subretinal members from foveal family and/or 1 were parafoveal siblings with yellowish AVMD, aged deposits 56, 51, either and 46 in years the fundus or on AF(Figure andThree SD2).- AllOCT affected three ima hadmembersges subretinal (Figure from foveal 3Afamily–C). and 1 The /wereor parafoveal changes siblings yellowishwerewith AVMD bilateral deposits, aged and either 56, symmetric. 51, in theand fundus 46 years All or patients reportedon(Figure mild AF andmetamorphopsia 2). All SD-OCT three imageshad subretinal (Figureand the 3fovealA–C). ffERGs and/or The were changes parafoveal normal. were yellowish bilateral anddeposits symmetric. either in All the patients fundus reportedor on AF mildand SD metamorphopsia-OCT images (Figure and the 3Aff–ERGsC). The were changes normal. were bilateral and symmetric. All patients reported mild metamorphopsia and the ffERGs were normal.

Figure 2.2. Family 1 pedigree. Figure 2. Family 1 pedigree.

Genes 2020, 11, x; doi: FOR PEER REVIEW www.mdpi.com/journal/genes

Genes 2020, 11, x; doi: FOR PEER REVIEW www.mdpi.com/journal/genes Genes 2020, 11, x FOR PEER REVIEWGenes 2020, 11, x FOR PEER Genes10 ofREVIEW 242020 , 11 , 773 12 of 24 10 of 24

Figure 3. The clinical features of AVMD from families 1 (p.Arg46Ter) and 6 (p.Val209Ile). (A) The fundus FigureFigure 3. 3.The The clinical clinical features features of of AVMD AVMD fromfrom ffamiliesamilies 1 (p.ArgArg4646TerTer) )and and 6 6(p.V (p.Valal209I209Ile).le ).(A ()A The) The appearance with the typical small yellow foveal deposits, (B) fluorescein angiography (FA) shows fundusfundus appearance appearance with with the the typical typical small small yellowyellow fovealfoveal depositsdeposits, , ((BB) )fluorescein fluorescein angiography angiography (FA (FA) ) the hyperfluorescence produced by a window defect, and (C) spectral-domain optical coherence showsshows the the hyperfluorescence hyperfluorescence producedproduced byby aa windowwindow defectdefect,, andand (C(C) ) spectralspectral-domain-domain optical optical tomography (SD-OCT) shows the subfoveal hyper-reflective deposit (white arrow) from patient coherencecoherence tomography tomography (SD (SD-OCT)-OCT) shows shows thethe subfovealsubfoveal hyper--reflectivereflective deposit deposit (white (white arrow) arrow) from from F1-II-2. (D) The ocular fundus appearance from a patient aged 56 years (F6-I-5) with a pigmented patientpatient F1 F1-II-II2.- 2.(D (D) )The The ocular ocular fundus fundus appearanceappearance from aa patientpatient agedaged 56 56 years years (F6 (F6-I--5)I- 5)with with a a fovealpigmented dot surrounded foveal dot bysurrounded a yellow halo.by a yellow (E,F) The halo. fundus (E,F) The and fundus autofluorescence and autofluorescence after 14 years after show 14 pigmented foveal dot surrounded by a yellow halo. (E,F) The fundus and autofluorescence after 14 macularyears show atrophy. macular atrophy. years show macular atrophy. FamilyFamily 2 2 included included aa 52-year-old52-year-old man man with with a positive a positive family family history history (Figure (Figure 4). He4). presented He presented with Family 2 included a 52-year-old man with a positive family history (Figure 4). He presented with withECA ECA that that produced produced a large a large central central scotoma scotoma (Figure (Figure 5),5 ),but but a awell well-preserved-preserved foveal foveal area area on on AF AF ECA that produced a large central scotoma (Figure 5), but a well-preserved foveal area on AF throughoutthroughout life, life, which which explained explained the the good good BCVA BCVA (Figure (Figure6A,B). 6A,B). Both Bo theth scotopic the scotopic and photopic and photopicffERGs throughout life, which explained the good BCVA (Figure 6A,B). Both the scotopic and photopic wereffERGs subnormal were subnormal (Figure7). (Figure He also 7). had He mutationsalso had mutations in the ABCA4 in the ABCA4gene (Table gene3 (Table). 3). ffERGs were subnormal (Figure 7). He also had mutations in the ABCA4 gene (Table 3).

Figure 4. The family 2 pedigree indicates apparent incomplete penetrance. Figure 4. The family 2 pedigree indicates apparent incomplete penetrance. Figure 4. The family 2 pedigree indicates apparent incomplete penetrance.

Genes 2020, 11, x FOR PEER GenesREVIEW2020, 11, 773 13 of 24 11 of 24 Genes 2020, 11, x FOR PEER REVIEW 11 of 24

Figure 5. ExamplesFigure 5. Examples of visual of visual fields fields (VFs). (VFs ().A (A)) Small Small paracentral paracentral scotoma scotoma from F3 from-V-2 F3-V-2with PDsFF with. (B) PDsFF. (B) Figure 5. Examples of visual fields (VFs). (A) Small paracentral scotoma from F3-V-2 with PDsFF. (B) Central scotomaCentral scotoma from F5a-III-2 from F5a- withIII-2 with CACD. CACD (.C (C)) AA large central central scotoma scotoma from fromF2-III-6 F2-III-6 with ECA with. (D) ECA. (D) Central scotoma from F5a-III-2 with CACD. (C) A large central scotoma from F2-III-6 with ECA. (D) ConcentricC VFoncentric restriction VF restriction from from F7-III-1 F7-III with-1 with ADRP. ADRP. Concentric VF restriction from F7-III-1 with ADRP.

Figure 6. Clinical images from patients with mutations in the PRPH2 and ABCA4 genes. (A) Fundus Figure 6. Clinical images from patients with mutations in the PRPH2 and ABCA4 genes. (A) Fundus and (B) autofluorescence of a case from F2-III-6 (PRPH2: p.Arg46Ter and ABCA4: p.Leu2027Phe and and (B) autofluorescence of a case from F2-III-6 (PRPH2: p.Arg46Ter and ABCA4: p.Leu2027Phe and p.Gly1977Ser)p.Gly with1977S theer) with typical the typical appearance appearance of ECA of ECA and and foveal foveal preservation preservation t thathat explains explains the the good good visual acuity. (C)visual The a ocularcuity. (C fundus) The ocular and fundus (D) AF and of (D an) AF F3-V-2 of an F3 member-V-2 member (PRPH2 (PRPH2: p.Lys154del: p.Lys154del and and ABCA4: p.Arg2030Gln),ABCA4 which: p.Arg2030 resemblesGln), which FF. resembles FF.

FamilyFigure 3 6. included Clinical images a 37-year-old from patients man with who mutations presented in tothe ourPRPH2 clinic and for ABCA4 a second genes. opinion (A) Fundus to confirm a diagnosisand (B of) autofluorescence FF. His paternal of greata case grandmotherfrom F2-III-6 (PRPH2 was blind: p.Arg and46Ter had and tubular ABCA4: vision,p.Leu2027 andPhe his and paternal p.Gly1977Ser) with the typical appearance of ECA and foveal preservation that explains the good great aunt and her two daughters had poor vision. Thus, the pedigree shows apparent non-penetrant visual acuity. (C) The ocular fundus and (D) AF of an F3-V-2 member (PRPH2: p.Lys154del and inheritance (Figure8). The patient’s BCVA was 20 /16 in the RE and 20/20 in his LE. The VF showed only ABCA4 : p.Arg2030Gln), which resembles FF. a mild decrease in sensitivity in the RE. Yellow flecks were seen in the posterior pole and mid-periphery bilaterally. SD-OCT showed an irregularity or mild disruption of the outer nuclear layer and the ellipsoid zone was limited to the foveal region. FA showed a dark choroid and a combination of hypo- and hyper-fluorescent flecks with some areas of extrafoveal incipient retinal atrophy (Figure6C,D). The scotopic ffERG showed a mild decrease in the b-wave amplitude; the photopic ffERG and the multifocal ERG were normal. He also presented with a mutation in allele 1 of the ABCA4 gene.

Genes 2020, 11, x FOR PEER Genes 2020, 11REVIEW, 773 14 of 24 12 of 24

Figure 7. ExamplesFigure 7. Examples of ERGs. of ERGs On. theOn the left-hand left-hand side side is a normal normal ffERGffERG from from F8-II- F8-II-22 (A,B,C,D,E (A–)E, ),and and next to it the ffERGnext shows to it the the ffERG decreased shows the photopic decreased photopic and scotopic and scotopic amplitude amplitude in in patient patient F5c-IV-4F5c-IV-4 with with CACD (F–J). AmplitudesCACD (F,G,H,I,J of the). bA-wavemplitudes are of even the b- lowerwave are in even a case lower from in a case F2-III-6 from withF2-III-6 extensive with extensive chorioretinal chorioretinal degeneration (K,L,LL,M,N). Finally, the ffERG of a case from F7-III-1 with autosomal degeneration (K,L,LL,M,N). Finally, the ffERG of a case from F7-III-1 with autosomal dominant retinitis dominant retinitis pigmentosa (ADRP) shows a flat scotopic and photopic ffERG (Ñ,O,P,Q,R). On the pigmentosaright (ADRP)-hand side shows, the image a flat at scotopic the top shows and a photopic normal multifocalffERG (ERGÑ,O,P,Q,R above (S).), the On ERG the from right-hand the F3- side, the image at theV-2 top patient shows showing a normal some areas multifocal of decreased ERG P1 wave above amplitude (S), the is ERG in the frommiddle the (T), F3-V-2 and a case patient from showing F2-III-6 with ECA showing generalized decrease of the P1 wave amplitude is at the bottom (U). someGenes areas of decreased20 P120, wave amplitude11, is in the middlex (T), and a caseFOR from F2-III-6 withPEER ECA showingREVIEW generalized decrease of the P1 wave amplitude is at the bottom (U). 13 of 24Family 3 included a 37-year-old man who presented to our clinic for a second opinion to confirm a diagnosis of FF. His paternal great grandmother was blind and had tubular vision, and his paternal great aunt and her two daughters had poor vision. Thus, the pedigree shows apparent non-penetrant inheritance (Figure 8). The patient’s BCVA was 20/16 in the RE and 20/20 in his LE. The VF showed only a mild decrease in sensitivity in the RE. Yellow flecks were seen in the posterior pole and mid- periphery bilaterally. SD-OCT showed an irregularity or mild disruption of the outer nuclear layer and the ellipsoid zone was limited to the foveal region. FA showed a dark choroid and a combination of hypo- and hyper-fluorescent flecks with some areas of extrafoveal incipient retinal atrophy (Figure 6C,D). The scotopic ffERG showed a mild decrease in the b-wave amplitude; the photopic ffERG and the multifocal ERG were normal. He also presented with a mutation in allele 1 of the ABCA4 gene.

FigureFigure 8. The 8. familyThe family 3 pedigree3 pedigree shows apparent apparent non- non-penetrance.penetrance.

Family 4Family was comprised 4 was comprised of a of mother a mother and and twotwo daughters, daughters, aged aged 78, 53, 78, and 53, 51 andyears, 51 respectively. years, respectively. The motherThe reported mother reported that her that mother her mother and and maternal maternal aunt aunt lost lost vision vision from fromthe seventh the seventh decade of decade life of life (Figure 9). The patient F4-III-1 had been diagnosed with macular atrophy at age 68 years after cataract (Figure9).surgery The patient, but achieved F4-III-1 20/25 had beenBCVA diagnosed bilaterally. withThe ophthalmologic macular atrophy examination at age 68showed years small after cataract surgery, butyellowish achieved flecks 20 in/25 the BCVA posterior bilaterally. pole with large The ophthalmologicplaques of outer retinal examination atrophy that showed extended small to the yellowish flecks in theentire posterior mid-peripheral pole retina. with These large changes plaques were of bilateral, outer retinal symmetrical, atrophy and much that more extended evident to in the entire AF. The atrophic plaques progressed slowly over 10 years; the patient currently has a BCVA of 20/100 in the right eye (RE) and 20/25 in the left eye (LE). Her daughters were asymptomatic and presented with BCVAs of 20/20, but had yellow flecks in the posterior pole that were more numerous in F4-IV- 1, who also had small areas of eccentric macular atrophy more evident on AF (Figure 10). The ffERG and VFs were normal in the F4-IV-2 daughter and we diagnosed PDsFF. F4-IV-1 had subnormal photopic and scotopic ffERGs and we diagnosed ECA, but F4-III-1 had an abolished scotopic ffERG with subnormal photopic ffERG and reported night blindness, and therefore we diagnosed ADRP (Figure 7).

Genes 2020, 11, 773 15 of 24 mid-peripheral retina. These changes were bilateral, symmetrical, and much more evident in AF. The atrophic plaques progressed slowly over 10 years; the patient currently has a BCVA of 20/100 in the right eye (RE) and 20/25 in the left eye (LE). Her daughters were asymptomatic and presented with BCVAs of 20/20, but had yellow flecks in the posterior pole that were more numerous in F4-IV-1, who also had small areas of eccentric macular atrophy more evident on AF (Figure 10). The ffERG and VFs were normal in the F4-IV-2 daughter and we diagnosed PDsFF. F4-IV-1 had subnormal photopic and scotopic ffERGs and we diagnosed ECA, but F4-III-1 had an abolished scotopic ffERG Genes 2020, 11, x FOR PEER with subnormalREVIEWGenes photopic ff20ERG20, and reported11, night blindness,x and thereforeFOR we diagnosedPEER ADRP 14REVIEW of 24 (Figure7). 14 of 24

Figure 9. The family 4 pedigree shows a dominant inheritance pattern. Figure 9.FigureThe 9. family The family 4 pedigree 4 pedigree shows shows a adominant dominant inheritance inheritance pattern.pattern.

Figure 10. The clinical features of family 4 (p.Gly167Ser). (A) The fundus appearance of a case from Figure 10. The clinical features of family 4 (p.Gly167Ser). (A) The fundus appearance of a case from Figure 10. The clinical features of family 4 (p.Gly167Ser). (A) The fundus appearance of a case from F4-III-1 showsF4-III large-1 shows confluent large confluent areas areas of chorioretinalof chorioretinal atrophy atrophy and and pigment pigment clumps clumpsin mid-periphery in mid-periphery,, F4-III-1 shows large confluent areas of chorioretinal atrophy and pigment clumps in mid-periphery, (B) AF images(B) AF with images a largewith a arealarge area of hypoautofluorescence of hypoautofluorescence and and speckled speckled points pointsof hypo-AF of hypo-AFin the in the (B) AF images with a large area of hypoautofluorescence and speckled points of hypo-AF in the posterior pole and mid-periphery, and (C) SD-OCT shows areas of outer retinal atrophy (yellow posterior poleposterior and mid-periphery,pole and mid-periphery and (, Cand) SD-OCT (C) SD-OCT shows shows areas areas ofof outerouter retinal retinal atrophy atrophy (yellow (yellow brace). brace). (D) The fundus images obtained from F4-IV-1 show whitish stippling over the posterior pole (D) The fundusbrace). images(D) The fundus obtained images from obtained F4-IV-1 from F4 show-IV-1 show whitish whitish stippling stippling over over the the posterior posterior pole pole and and (E) speckled points of hypo- and hyper-AF in the posterior pole and mid-periphery are seen in and (E) speckled points of hypo- and hyper-AF in the posterior pole and mid-periphery are seen in (E) speckledher points AF. (F) of The hypo- fundus and features hyper-AF from F4- inIV- the2 show posterior yellow triradiate pole and flecks mid-periphery in the posterior pole are, seen(G) in her AF. her AF. (F) The fundus features from F4-IV-2 show yellow triradiate flecks in the posterior pole, (G) (F) The fundusAF image featuress show from scarce F4-IV-2 speckled show hyper yellow-AF and triradiatehypo-AF at flecksthe posterior in the pole posterior and mid- pole,periphery (G), AF images AF images show scarce speckled hyper-AF and hypo-AF at the posterior pole and mid-periphery, and (H) SD-OCT images show disruption of the ellipsoid and interdigitation zones of the juxtafoveal show scarceand speckled (H) SD-OCT hyper-AF images show and disruption hypo-AF of at the the ellipsoid posterior and interdigitation pole and mid-periphery, zones of the juxta andfoveal (H ) SD-OCT region (yellow arrows) and foveal hypertransmissibility to the choroid (yellow brace). images showregion disruption (yellow arrows) of the and ellipsoid foveal hypertransmis and interdigitationsibility to the choroid zones (yellow of the brace) juxtafoveal. region (yellow

arrows) and foveal hypertransmissibility to the choroid (yellow brace). Genes 2020, 11, 773 16 of 24

We alsoGenes present four di2020fferent, branches11, of family 5 (Figurex 11). MembersFOR of this largePEER family had REVIEW a common15 ancestorof 24 in a small valley in the northern Spanish region of Cantabria. The first branch (family 5a) included three siblings aged 59, 58, and 42 years and their 53-year-old paternal cousin who all presentedWe also with present CACD four different (Figure branches 12). The of family second 5 (Figure branch 11). (familyMembers 5b)of this was large comprised family had of a man, a common ancestor in a small valley in the northern Spanish region of Cantabria. The first branch his mother,(family and 5 twoa) include maternald three siblings male (F5b-IV-1) aged 59, 58, andand 42 female years and (F5b-IV-2) their 53-year cousins.-old paternal They cousin all presented with ECAwho that all was presented more with aggressive CACD (Figure the younger12). The second the age branch of symptom(family 5b) was onset comprised and the of oldera man, the age of each patient.his mother, The exception and two maternal was a male 31-year-old (F5b-IV-1) and female female cousin (F5b-IV who-2) cousins. presented They all with presented clinical with features of CACD (FigureECA that 13 was) and more a centralaggressive scotoma the younger (Figure the age5), of butsymptom still hadonset well-preservedand the older the age vision. of each The third patient. The exception was a 31-year-old female cousin who presented with clinical features of CACD branch (family(Figure 5c) 13) includedand a central an scotoma 18-year-old (Figure woman, 5), but still her had mother, well-preserved and the vision. mother’s The third maternal branch great aunt (F5c-IV-4).(f Theamily 18-year-old 5c) included an and 18- heryear- motherold woman, had her central mother, visual and the loss mother’s and verymaternal small great shiny aunt whitish(F5c- dots in the mid-periphery,IV-4). The 18 with-year a-old subnormal and her mother scotopic had centralffERG visual and flatloss photopicand very smallffERG. shiny The whitish great dots aunt in primarily had macularthe atrophymid-periphery, that waswithmore a subnormal compatible scotopic with ffERG CACD and (Figureflat photopic 14). Finally,ffERG. The (family great 5d)aunt we present primarily had macular atrophy that was more compatible with CACD (Figure 14). Finally, we present a 45-year-olda 45-year man-old (F5d-IV-1) man (F5d-IV with-1) with ECA, ECA, who who reported reported night night blindness blindness and had and an had abolished an abolished scotopic scotopic ffERG withffERG a subnormal with a subnormal photopic photopicffERG. ffERG.

FigureGenes 11.Figure The pedigrees11. The pedigrees20 from20, from the the four four branches branches11, of family family 5 xexhibit 5 exhibit a dominant a dominantFOR inheritance inheritance pattern. PEER pattern. The familyREVIEWThe tree family is based tree is onbased clinical on clinical data data shown shown here. here. The The knownknown affected affected individuals individuals in each in family each family are 16 of 24 indicatedare by indicated a black symbol.by a black symbol.

Figure 12. Family 5a (p.Arg195Leu) presents with CACD. (A) F5a-III-7 had whitish stippling only in Figure 12. Family 5a (p.Arg195Leu) presents with CACD. (A) F5a-III-7 had whitish stippling only in B C the macularthe area. macular ( )area. F5a-III-10 (B) F5a-III had-10 ha incipientd incipient macular macular atrophy atrophy as aswell. well. (C) F5a ( -)III F5a-III-2-2 had typical had foveal typical foveal preservation.preservation. (D) F5a-III-6 (D) F5a had-III-6 totalhad total macular macular atrophy. atrophy.

Figure 13. The clinical appearance of family 5b (p.Arg195Leu). F5b-III-4 had (A) a large area of atrophy in the posterior pole and (B) extensive atrophy in the mid-periphery. The least affected patient was F5b-IV-2 with mild macular changes in the (C) fundus and (D) AF. F5b-IV-1 had clear macular atrophy in (E) the fundus and (F) AF. (G) F5b-IV-4 had atrophy in the posterior pole and mid-periphery, outer retinal atrophy (red brace and red arrow) was much more evident in the (H) SD-OCT and (I) autofluorescence images, and (J) extension of atrophy to the mid-periphery was evident in the fluorescein angiogram.

Genes 2020, 11, x FOR PEER REVIEW 16 of 24

Figure 12. Family 5a (p.Arg195Leu) presents with CACD. (A) F5a-III-7 had whitish stippling only in Genes 2020, 11,the 773 macular area. (B) F5a-III-10 had incipient macular atrophy as well. (C) F5a-III-2 had typical foveal 17 of 24 preservation. (D) F5a-III-6 had total macular atrophy.

Figure 13. The clinical appearance of family 5b (p.Arg195Leu). F5b-III-4 had (A) a large area of Figure 13. The clinical appearance of family 5b (p.Arg195Leu). F5b-III-4 had (A) a large area of B atrophyatrophy in the posteriorin the posterior pole and pole ( and) extensive (B) extensive atrophy atrophy in the in the mid-periphery. mid-periphery. The The least least aaffectedffected patient was F5b-IV-2patient withwas F5b mild-IV- macular2 with mild changes macular inchanges the (C in) fundusthe (C) fundus and ( Dand) AF. (D) F5b-IV-1AF. F5b-IV had-1 ha cleard clear macular atrophymacular in (E) the atrophy fundus in ( andE) the (F )fundus AF. (G and) F5b-IV-4 (F) AF. ( hadG) F5b atrophy-IV-4 ha ind theatrophy posterior in the poleposterior and pole mid-periphery, and outerGenes retinal mid-periphery atrophy, outer20 (red20, retinal brace atrophy and red (red11 arrow), brace and was red much arrow)x more was much evident moreFOR in evident the (H in) the SD-OCT (H)PEER and (I)REVIEW autofluorescenceSD -OCT and (I images,) autofluorescence and (J) extensionimages, and of (J atrophy) extension to of the atrophy mid-periphery to the mid-periphery was evident was in the 17 of 24evident in the fluorescein angiogram. fluorescein angiogram.

Figure 14. The clinical appearance of family 5c (p.Arg195Leu). (A) The posterior pole and Figure 14. The clinical appearance of family 5c (p.Arg195Leu). (A) The posterior pole and (B) mid- (B) mid-peripheryperiphery from from F5c-VI F5c-VI-2-2 had very had small very whitish small dots. whitish (C) F5c- dots.V-2 had (C a) more F5c-V-2 advanced had appearance. a more advanced appearance.(D) F5c (-DIV)-4 F5c-IV-4 had macular had atrophy macular consistent atrophy with consistent the diagnosis with of the CACD diagnosis, with evident of CACD, atrophy with in evident atrophythe in (E the) AF (E and) AF (F and) SC-OCT (F) SC-OCT (red brace) (red images. brace) images.

FamilyFamily 6 included 6 included a 56-year-old a 56-year-old man man (F6-I-5) (F6-I-5) with with a amild mild central central vision vision disturbance disturbance and clinical and clinical featuresfeatures compatible compatible with with AVMD AVMD at at his his first first visit,visit, who who presented presented an area an area of macular of macular atrophy atrophy and and decreased BCVA after 14 years (Figure 3D–F). F6-II-2 came to the clinic several years later, at the age decreased BCVA after 14 years (Figure3D–F). F6-II-2 came to the clinic several years later, at the age of of 51, presenting with fine parafoveal yellowish deposits in her LE and hyper-AF that caused a small 51, presentingdisruption with of the fine RPE parafoveal line on the SD yellowish-OCT (Figure deposits 15). in her LE and hyper-AF that caused a small disruption of the RPE line on the SD-OCT (Figure 15).

Figure 15. The family 6 pedigree.

F7-III-1, a member of a large family with ADRP, was first examined by us at age 48 years (Figure 16). She presented with pigmented spicules in the retinal periphery and concentric VF retraction (Figure 17). The scotopic and photopic ffERG were abolished (Figure 7).

Genes 2020, 11, x FOR PEER REVIEW 17 of 24

Figure 14. The clinical appearance of family 5c (p.Arg195Leu). (A) The posterior pole and (B) mid- periphery from F5c-VI-2 had very small whitish dots. (C) F5c-V-2 had a more advanced appearance. (D) F5c-IV-4 had macular atrophy consistent with the diagnosis of CACD, with evident atrophy in the (E) AF and (F) SC-OCT (red brace) images.

Family 6 included a 56-year-old man (F6-I-5) with a mild central vision disturbance and clinical features compatible with AVMD at his first visit, who presented an area of macular atrophy and decreased BCVA after 14 years (Figure 3D–F). F6-II-2 came to the clinic several years later, at the age Genes 2020, 11of, 773 51, presenting with fine parafoveal yellowish deposits in her LE and hyper-AF that caused a small 18 of 24 disruption of the RPE line on the SD-OCT (Figure 15).

FigureFigure 15. 15.The The familyfamily 6 pedigree. 6 pedigree.

F7-III-1, a member of a large family with ADRP, was first examined by us at age 48 years (Figure F7-III-1, a member of a large family with ADRP,was first examined by us at age 48 years (Figure 16). 16).Genes She presented with2020, pigmented spicules11, in the retinalx periphery and concentricFOR VF retractionPEER Genes 2020, 11, x FOR PEER She presented(FigureREVIEW with 17) pigmented. The scotopic spiculesand photopic in theffERG retinal were abolished periphery (Fig andure 7) concentric. VF retraction (Figure 17). REVIEW 18 of 24 The scotopic18 of and 24 photopic ffERG were abolished (Figure7).

Figure 16. The family 7 pedigree shows a clear autosomal-dominant family tree. Figure 16.FigureThe 16. family The family 7 pedigree 7 pedigree shows shows a clear clear autosomal autosomal-dominant-dominant family tree. family tree.

Figure 17. TheFigure RP 17. phenotype The RP phenotype in the in p.Pro216Serthe p.Pro216SerPRPH2 PRPH2 genegene mutation mutation from F7 from-III-1 F7-III-1.. (A,B) The (ocularA,B) The ocular Figure 17. The RP phenotype in the p.Pro216Ser PRPH2 gene mutation from F7-III-1. (A,B) The ocular fundus had pigmented spiculae in the periphery; the SD-OCT images (C,D) and autofluorescent fundus hadfundus pigmented had pigmented spiculae spiculae in the periphery;in the periphery the; SD-OCTthe SD-OCT images images ((C,DC,D)) and and autofluorescent autofluorescent images images show atrophic macular areas of the LE (E) and RE (F) at the age of 48 years that increased 19 show atrophicimages macular show atrophic areas macular of the LE areas (E of)and the LE RE (E () Fand) at RE the (F) age at the of age 48 of years 48 years that that increased increased 19 years later years later in the RE (G), the photopic ffERG was unrecordable at this moment. in the RE (Gyears), the later photopic in the RE (ffGERG), the photopic was unrecordable ffERG was unrecordable at this moment. at this moment. Family 8 included the isolated case of a 34-year-old man (Figure 18), who reported Family 8 included the isolated case of a 34-year-old man (Figure 18), who reported metamorphopsia and central visual loss. He had no family history of ocular disease (Figure 19). The metamorphopsia and central visual loss. He had no family history of ocular disease (Figure 19). The ocular fundus showed a subfoveal yellowish deposit that suggested AVMD (Figure 11). The VF and ocular fundus showed a subfoveal yellowish deposit that suggested AVMD (Figure 11). The VF and ffERG were normal. ffERG were normal.

Genes 2020, 11, 773 19 of 24

Genes Family 8 included2020 the, isolated case of1 a1 34-year-old, man (Figurex 18), who reportedFOR metamorphopsiaPEER andREVIEW central visual loss. He had no family history of ocular disease (Figure 19). The ocular fundus showed a19 subfoveal of 24 yellowish deposit that suggested AVMD (Figure 11). The VF and ffERG were normal. Genes 2020, 11, x FOR PEER REVIEW 19 of 24

Figure 18.FigureThe 18. family The family 8 pedigree 8 pedigree of of an an apparently apparently isolated case, case, although although the deceased the deceased mother mother had an had an Figure 18. The family 8 pedigree of an apparently isolated case, although the deceased mother had an ocular pathology.ocular pathology. ocular pathology.

FigureFigure 19. 19.The The clinical clinical appearanceappearance of of the the case case from from F8-II F8-II-2-2 with withthe new the newmutation, mutation, c.824_828c.824_828+3delinsCATTTGGGCTCCTCATTTGG+3delinsCATTTGGGCTCCTCATTTGG.. The The fundus fundus appearance appearance of AVMD of AVMD shows shows(A,B) (A,B) yellow fovealyellow deposits,foveal deposits, which which is (C is) hyperautofluorescent(C) hyperautofluorescent inin thethe RE a andnd (D (D) )hypofluorescent hypofluorescent in the in the LE; (E,F) FALE; shows (E,F) hyperfluorescenceFA shows hyperfluorescence of the lesion of the inlesion both in eyes both and eyes ( G,Hand ()G,H SD-OCT) SD-OCT shows shows hyper-reflective hyper- subfovealreflective deposits subfoveal bilaterally deposits that bilaterally (G) extend that to (G the) exten innerd to retina the inner of the retina RE of (yellow the RE arrow)(yellow andarrow) (H ) cause Figure and19. ( H)The cause clinicalchoroidal hyperappearance-reflectivity of at the foveal case region from on theF8 LE-II -(yellow2 with brace) the. new mutation, choroidal hyper-reflectivity at the foveal region on the LE (yellow brace). c.824_828+3delinsCATTTGGGCTCCTCATTTGG. The fundus appearance of AVMD shows (A,B) 4. Discussion 4. Discussionyellow foveal deposits, which is (C) hyperautofluorescent in the RE and (D) hypofluorescent in the LE; (E,FThe) FA association shows hyperfluorescence between mutations of in the the lesion PRPH2 in gene both and eyes IRDs and was (G,H reported) SD-OCT first inshows 1993 [18hyper– - Thereflective20 association]. Currently, subfoveal betweento the deposits best mutationsof bilaterallyour knowledge, in that the more(PRPH2G) exten thangened 175 to pathogenic andthe inner IRDs retina variants was reportedof havethe RE beenfirst (yellow described, in 1993 arrow) [18 –20]. Currently,andincluding (H to) cause the missense bestchoroidal of and our hyper nonsense knowledge,-reflectivity mutations, more at the small thanfoveal in 175- frameregion pathogenic deletions on the LE and variants(yellow insertions, brace) have small. been indels, described, includingtwo missense gross deletions, and nonsense one gross mutations, insertion, and small one in-frame complex deletionsrearrangement, and insertions,usually heterozygous. small indels, two gross4. Discussion deletions, one gross insertion, and one complex rearrangement, usually heterozygous. They all The association between mutations in the PRPH2 gene and IRDs was reported first in 1993 [18– 20]. Currently, to the best of our knowledge, more than 175 pathogenic variants have been described, including missense and nonsense mutations, small in-frame deletions and insertions, small indels, two gross deletions, one gross insertion, and one complex rearrangement, usually heterozygous.

Genes 2020, 11, 773 20 of 24 were associated with retinal phenotypes that could be grouped into three broad categories: ADRP, progressive macular atrophy that sometimes spreads to the mid-periphery, and pattern dystrophies [4]. The relationships between the clinical features and genetic variants are still unclear because the same genetic variant can affect rods and cones differently [21]. In addition, the incomplete penetrance described in several unaffected carriers is not explained by the mutational position in the protein sequence or the mutational type, and the interpretation of genotype–phenotype relationships in animal models is complex [22]. Therefore, without consistent genotype–phenotype correlations, the accepted view is that a single mutation in PRPH2 may cause a spectrum of phenotypes [21]. Most of these mutations are in the cysteine-rich large intradiscal loop (ID2) (Figure1), a domain needed to associate peripherin with itself to form homo-oligomers or with its homolog, the ROM1 protein, to form hetero-tetramers and hetero-octamers [8]. We found that most of our patients had central involvement and most mutations were in the large intradiscal loop ID2. We report three missense mutations (p.Gly167Ser, p.Val209Ile, and p.Arg195Leu), a nonsense mutation (p.Arg46Ter), one in-frame deletion (p.Lys154del), and one complex mutation (c.824_828+3delinsCATTTGGGCTCCTCATTTGG). The missense and in-frame mutations were in the intradiscal domains of the PRPH2 protein; in this sense, our hypothesis is that the variant alleles (167Ser, 209Ile or 195Leu, 154del) may alter protein function. To the best of our knowledge, this is the first time that the c.824_828+3delinsCATTTGGGCTCCTCATTTGG genetic variant in heterozygosity was associated with IRDs. In fact, one must be cautious interpreting truncating or splicing variants without a functional assay or familial segregation of the variant and disease. Unfortunately, a segregation analysis in this case was not possible since it was an apparently isolated case and other family members were not available. Nevertheless, this mutation causes a frameshift mutation affecting two residues at the 3’ end of the second exon of the PRPH2 gene, but it also changes the first three bases of the canonical donor splice site of the second intron. This type of variants affecting +1 or 2 splice sites are often assumed to disrupt gene function. Nevertheless, to classify such variants as pathogenic, one must ensure that null variants of these genes are a known mechanism of pathogenicity. We have checked that eleven out of twelve pathogenic or likely pathogenic mutations listed in the ClinVar database downstream from the amino acid residue 275 are null mutations. Moreover, the pathogenic mutation c.828+3A>T (VCV000098713) affects the same donor splice site and other two pathogenic mutations involve the 1 and 4 positions at the 3 end of the same intron and finally, − − 0 alternative splicing has not been described in the PRPH2 gene. In summary, in our opinion, the variant c.824_828+3delinsCATTTGGGCTCCTCATTTGG meets the criteria to be considered as a likely pathogenic mutation following the ACMG Standards and Guidelines for the interpretation of sequence variants [23]. To explain the pathogenicity of different genetic variants, it has been hypothesized that mutations induce protein retention in the rod inner segments resulting in a haploinsufficiency/loss-of-function phenotype affecting rods more than cones. Nevertheless, recently, it was reported that normal PRPH2 oligomerization is not required for disc enclosure [24] and that subtle changes can lead to mutant proteins that are sufficiently stable to exert gain-of-function defects in the rods and cones [25]. Moreover, haploinsufficiency may also cause a relatively equal rod and cone cell loss [8]. In addition, some mutations probably induce a dominant negative effect on the rod outer segment structure, resulting in the formation of a dysfunctional PRPH2 tetramer. Finally, other mutations cause a shorter C-terminal domain that may lead to an absent location signal. This highlights the difficulty in targeting PRPH2-associated gain-of-function disease and suggests that the elimination of the mutant protein is a prerequisite for any curative therapeutic strategy and encourages us to continue investigating the basis of PRPH2 gene-related diseases. Other factors, such as genetic background, modifying genes, and/or environmental factors, obviously affect phenotypes and outcomes [26]. Modifying genes may include the ROM1 gene, although it has been reported that variations in this gene do not constitute an important modulating factor [27]; the RPE65 gene, through modulation of rhodopsin regeneration kinetics and light-damage Genes 2020, 11, 773 21 of 24 susceptibility [28]; or the ABCA4 gene [29]. PRPH2 and ROM1 protein assembly is necessary for proper formation of photoreceptor outer segment discs [5,30], whereas ROM1 and ABCA4 genes may alter progression of the related disease with faster progression of visual loss [29]. Concerning this, we report families 2 and 3 with mutations in both the ABCA4 and the PRPH2 genes. Interestingly, both showed apparent incomplete penetrance, something that although rare, has been reported previously for PRPH2 gene mutations [8], and the dominant inheritance pattern was not clearly established before doing the genetic diagnosis of the family. These supposedly healthy family members could not be checked at the genetic level, and they may have had asymptomatic retinal conditions. However, finding multilocus mutations is relevant as the patient from family 2 could have a blended phenotype. Unfortunately, his parents passed away and we could not prove that the mutations in the ABCA4 gene were in two different alleles. We assume that its modifying effect is more than probable in both families 2 and 3. The phenotype found in family 1 with the p.Arg46Ter PRPH2 gene mutation had been previously described (AVMD), and the patients had mild visual impairment [13]. However, retinal degeneration became more severe in family 2 when the same mutation was associated with two ABCA4 gene mutations (p.Leu2027Phe and p.Gly1977Ser). Family 3 had the p.Lys154del PRPH2 gene mutation, previously described to cause ADRP [14], but our patients’ fundus more resembled Stargardt’s disease, probably due to the effect of the p.Arg2030Gln ABCA4 gene mutation. Interactions of known genes is a probable scenario for blended phenotypes, however there is a possibility for DNA variations in unknown genes to contribute a completely new phenotype. The targeted NGS testing is unable to exclude or reduce the possibility of unknown gene contributions. Thus, in our opinion it would be advisable to use retinal gene-targeted NGS for genetic diagnosis in any patient, even though the index case belongs to a large family with a known mutation, because this may help identify modifying genes to better explain phenotype–genotype correlations, which must be studied in the future to devise a successful therapy [31]. Nevertheless, targeted NGS gene panel could not be comprehensive enough to identify phenotype modifying variants in unknown genes. Whole exome sequencing (WES) or whole genome sequencing (WGS) are the optimal tools to identify the largest number of these variants. These approaches are able to identify variants potentially related to the primary clinical question. Nonetheless, the interpretation of variants with a subtle effect can be very difficult, especially in single cases or short pedigrees. Moreover, WES and WGS increase the risk of unexpected incidental findings. Another interesting finding was the new mutation found in family 8 (c.824_828+3delins CATTTGGGCTCCTCATTTGG), which caused a phenotype of AVMD starting in young adulthood. We also observed that the phenotype was mutation-specific in families 1 and 6 in that patients with the same mutation shared similar clinical pictures and showed the already described phenotype of AVMD [13]. However, the phenotype varied considerably in family 4 with the p.Gly167Ser mutation, which had been reported to cause only PD [32], but we report here multifocal PDsFF, ECA, and ADRP. Differences in age and therefore, disease progression seem to be insufficient to explain the variability of the clinical pictures or outcomes, which had been reported by Boon et al. for other PRPH2 gene mutations [8]. The very large family with the p.Arg195Leu mutation was very interesting too. This is a founder mutation that probably explains in part the high prevalence of mutations in the PRPH2 gene found in a Spanish cohort of autosomal-dominant central retinal dystrophies [33]. The mutation was first described to cause CACD [16], but soon after, a more widespread phenotype was described similar to what we found [34]. A limited phenotype variation was observed in this family, as most but not all members presented with ECA and those presenting CACD belonged mostly to the same branch of the family. The possible effect of different environmental factors on the phenotype must always be considered [8,35–37]. Thus, we advise both caution and not predicting the clinical course and/or the disease severity based solely on the description of a single mutation. Genes 2020, 11, 773 22 of 24

A limitation of this study was the inability to ascertain parental genotypes because it was difficult to determine the de novo or inherited nature of these variants. This was a concern, but parents were not available for the study, although most families had a dominant inheritance pedigree which partly compensated for this limitation of the study. This also prevented from knowing whether the two ABCA4 gene mutations in the patient from family 2 were in the same allele or not; as a result, we can only hypothesize that this as a blended phenotype. Besides, we did not include the study of copy number variation, which sometimes contributes significantly to pathogenicity in IRDs [38]. In summary, we report a series of patients with diseases associated with PRPH2 gene mutations. We describe one new mutation (c.824_828+3delinsCATTTGGGCTCCTCATTTGG) associated with the AVMD phenotype. Family 2 presented with the p.Arg46Ter PRPH2 gene mutation and the p.Leu2027Phe and p.Gly1977Ser ABCA4 gene mutations jointly, making this a possible blended phenotype. The p.Lys154del PRPH2 gene mutation, previously described to cause ADRP, caused PDsFF in a current patient, probably due to the effect of the p.Arg2030Gln ABCA4 gene mutation, which could have worsened the patient’s visual outcome. Finally, we broadened the phenotypic spectrum of two other known PRPH2 gene mutations (p.Gly167Ser and p.Arg195Leu).

5. Conclusions Considering the current findings, we agree with Jones et al. [39] that families with large phenotypic variations or apparent non-penetrant individuals should raise suspicion for a complex inheritance. Caution should be taken when attributing a single gene disease-causing mutation to a family as a whole, as multiple genes contributing to the phenotype may be discovered using NGS techniques. For this reason, assessing a single mutation should be reconsidered even in families with known mutations.

Author Contributions: R.M.C.-M. conceived the study, collected and analyzed the data, wrote the manuscript, interpreted the data, and ensured that questions related to the accuracy or integrity of any part of the work were appropriately investigated. R.U.-M. and J.J.T. wrote the genetic description and added data interpretation. H.T.S.-T. and C.D. each contributed descriptive data from one of the families. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Acknowledgments: The authors are grateful for expert technical assistance from the Next Generation Sequencing Platform of the University of Barcelona through its spin-off DBGen, led by the prestigious geneticist Prof. Roser González-Duarte. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Pontikos, N.; Arno, G.; Jurkute, N.; Schiff, E.; Ba-Abbad, R.; Malka, S.; Gimenez, A.; Georgiou, M.; Wright, G.; Armengol, M.; et al. Genetic basis of inherited retinal disease in a molecularly characterized cohort of over 3000 families from the United Kingdom. Ophthalmology 2020, in press. [CrossRef][PubMed] 2. Birtel, J.; Eisenberger, T.; Gliem, M.; Müller, P.L.; Herrmann, P.; Betz, C.; Zahnleiter, D.; Neuhaus, C.; Lenzner, S.; Holz, F.G.; et al. Clinical and genetic characteristics of 251 consecutive patients with macular and cone/cone-rod dystrophy. Sci. Rep. 2018, 8, 4824. [CrossRef] 3. Chakraborty, D.; Conly, S.M.; Zulliger, R.; Naash, M.I. The K153Del PROH2 mutation differentially impacts photoreceptor structure and function. Hum. Mol. Genet. 2016, 25, 3500–3514. [CrossRef][PubMed] 4. Available online: http://www.retina-international.org/files/sci-news//rdsmut.htm (accessed on 28 May 2020). 5. Conley, S.M.; Naash, M.I. Focus on molecules: RDS. Exp. Eye Res. 2009, 89, 278–279. [CrossRef][PubMed] 6. Jacobson, S.; Cideciyan, A.V.; Maguire, A.V.; Bennet, J.; Sheffield, V.C.; Stone, E.M. Preferential rod and cone photoreceptor abnormalities in heterozygotes with point mutations in the RDS gene. Exp. Eye Res. 1996, 63, 603–608. [CrossRef] 7. Apfelstedt-Sylla, E.; Theischen, M.; Rüther, K.; Wedemann, H.; Gal, A.; Zrenner, E. Extensive intrafamilial and interfamilial phenotypic variation among patients with autosomal dominant retinal dystrophy and mutations in the human RDS/peripherin gene. Br. J. Ophthalmol. 1995, 79, 28–34. [CrossRef] Genes 2020, 11, 773 23 of 24

8. Boon, C.J.; Hollander, A.I.D.; Hoyng, C.B.; Cremers, F.P.; Klevering, B.J.; Keunen, J.E. The spectrum of retinal dystrophies caused by mutations in the peripherin/RDS gene. Prog. Retin. Eye Res. 2008, 27, 213–235. [CrossRef][PubMed] 9. McCulloch, D.L.; Marmor, M.F.; Brigell, M.G.; Hamilton, R.; Holder, G.E.; Tzekov, R.; Bach, M. ISCEV Standard for full-field clinical electroretinography (2015 update). Doc. Ophthalmol. 2014, 130, 1–12. [CrossRef] [PubMed] 10. Adzhubei, I.; Jordan, D.M.; Sunyaev, S.R. Predicting Functional Effect of Human Missense Mutations Using PolyPhen-2. Curr. Protoc. Hum. Genet. 2013, 76, Unit7.20. [CrossRef] 11. Ng, P.C.SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003, 31, 3812–3814. [CrossRef][PubMed] 12. Schwarz, J.M.; Rödelsperger, C.; Schuelke, M.; Seelow, D. MutationTaster evaluates disease-causing potential of sequence alterations. Nat. Methods 2010, 7, 575–576. [CrossRef][PubMed] 13. Coco-Martín, R.; Tellena, J.J.; Sanabria, M.R.; Rodríguez-Rúa, E.; Garcia, M.T. PRPH2 (Peripherin/RDS) Mutations Associated with Different Macular Dystrophies in a Spanish Population: A New Mutation. Eur. J. Ophthalmol. 2010, 20, 724–732. [CrossRef][PubMed] 14. Consugar, M.B.; Navarro-Gomez, D.; Place, E.M.; Bujakowska, K.M.; Sousa, M.E.; Fonseca-Kelly, Z.D.; Taub, D.; Janessian, M.; Wang, D.Y.; Au, E.D.; et al. Panel-based genetic diagnostic testing for inherited eye diseases is highly accurate and reproducible, and more sensitive for variant detection, than exome sequencing. Genet. Med. 2014, 17, 253–261. [CrossRef][PubMed] 15. Testa, F.; Marini, V.; Rossi, S.; Interlandi, E.; Nesti, A.; Rinaldi, M.; Varano, M.; Garrè, C.; Simonelli, F. A novel mutation in the RDS gene in an Italian family with pattern dystrophy. Br. J. Ophthalmol. 2005, 89, 1066–1068. [CrossRef] 16. Yanagihashi, S.; Nakazawa, M.; Kurotaki, J.; Sato, M.; Miyagawa, Y.; Ohguro, H. Autosomal Dominant Central Areolar Choroidal Dystrophy and a Novel Arg195Leu Mutation in the Peripherin/RDS Gene. Arch. Ophthalmol. 2003, 121, 1458–1461. [CrossRef] 17. Fishman, G.A.; Stone, E.M.; Gilbert, L.D.; VanDenburgh, K.; Sheffield, V.C.; Heckenlively, J.R. Clinical Features of a Previously Undescribed Codon 216 (proline to serine) Mutation in the Peripherin/Retinal Degeneration Slow Gene in Autosomal Dominant Retinitis Pigmentosa. Ophthalmology 1994, 101, 1409–1421. [CrossRef] 18. Weleber, R.G.; Carr, R.E.; Murphey, W.H.; Sheffield, V.C.; Stone, E.M. Phenotypic Variation Including Retinitis Pigmentosa, Pattern Dystrophy, and Fundus Flavimaculatus in a Single Family with a Deletion of Codon 153 or 154 of the Peripherin/RDS Gene. Arch. Ophthalmol. 1993, 111, 1531–1542. [CrossRef] 19. Wells, J.; Wroblewski, J.; Keen, J.; Inglehearn, C.; Jubb, C.; Eckstein, A.; Jay, M.; Arden, G.; Bhattacharya, S.; Fitzke, F.; et al. Mutations in the human retinal degeneration slow (RDS) gene can cause either retinitis pigmentosa or macular dystrophy. Nat. Genet. 1993, 3, 213–218. [CrossRef] 20. Travis, G.H.; Hepler, J.E. A medley of retinal dystrophies. Nat. Genet. 1993, 3, 191–192. [CrossRef] 21. Boon, C.J.F.; van Schooneveld, M.J.; den Hollander, A.I.; van Lith-Verhoeven, J.J.C.; Zonneveld-Vrieling, M.N.; Theelen, T.; Cremers, F.P.M.; Hoyng, C.B.; Klevering, B.J. Mutations in the peripherin/RDS gene are an important cause of multifocal patter dystrophy simulating STGD1/fundus flavimaculatus. Br. J. Ophthalmol. 2007, 91, 1504–1511. [CrossRef] 22. Goldberg, A.F. Role of Peripherin/rds in Vertebrate Photoreceptor Architecture and Inherited Retinal Degenerations. Int. Rev. Cytol. 2006, 253, 131–175. [CrossRef][PubMed] 23. Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–423. [CrossRef] 24. Lewis, T.R.; Makia, M.S.; Kakakhel, M.; Al-Ubaidi, M.R.; Arshavsky, V.Y.; Naash, M.I. Photoreceptor disc enclosure occurs in the absence of normal peripherin-2/rds oligomerization. Front. Cell. Neurosci. 2020, 28, 14–92. [CrossRef] 25. Chakraborty, D.; Strayve, D.G.; Makia, M.S.; Conley, S.M.; Kakahel, M.; Al-Ubaidi, M.R.; Naash, M.I. Novel molecular mechanisms for Prph2-associated pattern dystrophy. FASEB J. 2019, 34, 1211–1230. [CrossRef] [PubMed] Genes 2020, 11, 773 24 of 24

26. Scheetz, T.E.; Kim, K.-Y.; Swiderski, R.E.; Philp, A.R.; Braun, T.A.; Knudtson, K.L.; Dorrance, A.M.; DiBona, G.F.; Huang, J.; Casavant, T.L.; et al. Regulation of gene expression in the mammalian eye and its relevance to eye disease. Proc. Natl. Acad. Sci. USA 2006, 103, 14429–14434. [CrossRef] 27. Leroy, B.P.; Kailasanathan, A.; De Laey, J.-J.; Black, G.C.; Manson, F. Intrafamilial phenotypic variability in families with RDS mutations: Exclusion of ROM1 as a genetic modifier for those with retinitis pigmentosa. Br. J. Ophthalmol. 2006, 91, 89–93. [CrossRef][PubMed] 28. Samardzija, M.; Wenzel, A.; Naash, M.; Reme, C.E.; Grimm, C. Rpe65 as a modifier gene for inherited retinal degeneration. Eur. J. Neurosci. 2006, 23, 1028–1034. [CrossRef] 29. Poloschek, C.; Bach, M.; Lagreze, W.A.; Glaus, E.; Lemke, J.R.; Berger, W.; Neidhardt, J. ABCA4andROM1: Implications for Modification of thePRPH2-Associated Macular Dystrophy Phenotype. Investig. Ophthalmol. Vis. Sci. 2010, 51, 4253–4265. [CrossRef] 30. Stuck, M.W.; Conley, S.M.; Naash, M.I. PRPH2/RDs and ROM1: Historical context current views and future considerations. Prog. Retin. Eye Res. 2016, 52, 47–63. [CrossRef] 31. Tebbe, L.; Kakakhel, M.; Makia, M.S.; Al-Ubaidi, M.R.; Naash, M.I. The Interplay between Peripherin 2 Complex Formation and Degenerative Retinal Diseases. Cells 2020, 9, 784. [CrossRef] 32. Nichols, B.E.; Sheffield, V.C.; VanDenburgh, K.; Drack, A.V.; Kimura, A.E.; Stone, E.M. Butterfly–shaped pigment dystrophy of the fovea caused by a point mutation in codon 167 of the RDS gene. Nat. Genet. 1993, 3, 202–207. [CrossRef][PubMed] 33. Gamundi, M.J.; Hernan, I.; Muntanyola, M.; Trujillo, M.J.; García-Sandoval, B.; Ayuso, C.; Baiget, M.; Carballo, M. High prevalence of mutations in peripherin/RDS in autosomal dominant macular dystrophies in a Spanish population. Mol. Vis. 2007, 13, 1031–1037. [PubMed] 34. Keilhauer, C.N.; Meigen, T.; Weber, B.H.F. Clinical Findings in a Multigeneration Family With Autosomal Dominant Central Areolar Choroidal Dystrophy Associated With an Arg195Leu Mutation in the Peripherin/RDS Gene. Arch. Ophthalmol. 2006, 124, 1020–1027. [CrossRef] 35. Paskowitz, D.M.; Lavail, M.M.; Duncan, J.L. Light and inherited retinal degeneration. Br. J. Ophthalmol. 2006, 90, 1060–1066. [CrossRef][PubMed] 36. Despriet, M.D.G.; Klaver, C.C.W.; Witteman, J.C.; Bergen, A.A.; Kardys, I.; De Maat, M.P.M.; Boekhoorn, S.S.; Vingerling, J.R.; Hofman, A.; Oostra, B.A.; et al. Complement Factor H Polymorphism, Complement Activators, and Risk of Age-Related Macular Degeneration. JAMA 2006, 296, 301. [CrossRef] 37. Berson, E.L.; Rosner, B.A.; Sandberg, M.A.; Weigel-DiFranco, C.; Moser, A.; Brockhurst, R.J.; Hayes, K.C.; Johnson, C.A.; Anderson, E.J.; Gaudio, A.R.; et al. Clinical Trial of Docosahexaenoic Acid in Patients with Retinitis PigmentosaReceiving Vitamin A Treatment. Arch. Ophthalmol. 2004, 122, 1297–1305. [CrossRef] 38. Zampaglione, E.; Kinde, B.; Emily, M.; Place, E.M.; Navarro-Gomez, D.; Maher, M.; Jamshidi, F.; Nassiri, S.; Mazzone, J.A.; Finn, C.; et al. Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations. Genet. Med. 2020, 22, 1079–1087. [CrossRef] 39. Jones, K.D.; Wheaton, D.K.; Bowne, S.J.; Sullivan, L.S.; Birch, D.G.; Chen, R.; Daiger, S.P. Next-generation sequencing to solve complex inherited retinal dystrophy: A case series of multiple genes contributing to disease in extended families. Mol. Vis. 2017, 23, 470–481.

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).