Investigating the role of the Mediator complex in plant
defence
Thorya A Fallath
Master of Biotechnology Bachelor of biology
A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2016 School of Agriculture & Food Sciences
Abstract
The Mediator complex is an evolutionarily conserved protein complex involved in transcriptional regulation. In plants, the Mediator complex plays an important role in regulating development as well as the response to abiotic and biotic stress. In this thesis, I investigated three subunits of the Arabidopsis thaliana Mediator complex MEDIATOR25, MEDIATOR18 and MEDIATOR20 (MED25, MED18 and MED20) in plant defence.
MED25 has been shown to interact with several transcription factors (TFs) to control jasmonate (JA)-associated transcription. Here, I investigated these interactions further and characterized the minimum protein domains of the TFs needed for interaction and identified new proteins that interact with MED25. The results showed that the protein sequence corresponding to amino acids 138-218 of ETHYLENE RESPONSE FACTOR1 (ERF1) appears to be the minimum protein length for interaction with MED25 and contains the conserved motif (CMIX). Although the protein motif has been found in different proteins in A. thaliana that belong to a variety of families, only members from the IXc AP2/ERF family were found to interact with the MED25 ACID domain.
Apart from MED25, I found that the MED18 and MED20 subunits interact within the Mediator complex and infection of the corresponding mutants with Fusarium oxysporum revealed that they display a high level of resistance. RNAseq analysis of F. oxysporum infected med18 and med20 roots showed that salicylic acid (SA)-associated PATHOGENESIS RELATED genes and (ROS) reactive oxygen producing genes were up-regulated while some JA-regulated genes were repressed. We also noticed induction and repression of genes involved in glucosinolate production. This may suggest that ROS and antifungal metabolites are induced in med18 and med20 mutants and could potentially contribute to the reduced colonization of the mutants by F. oxysporum. Overall, the results reveal a new role for MED18 and MED20 in susceptibility to F. oxysporum, most likely via their involvement in JA signalling whose up-regulation would compromise SA and ROS signalling pathways that can confer resistance against this hemibiotrophic pathogen.
i Declaration by author
This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis.
I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my research higher degree candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.
I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School.
I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis.
ii Publications during candidature
1- Journal papers
Fallath TA, Kidd BN, Stiller J, Manners J, Kazan K and Schenk PM (2016). Mediator head domain subunits, MEDIATOR18 and MEDIATOR20 control susceptibility to Fusarium oxysporum in Arabidopsis thaliana (submitted to PLoS ONE)
2-Book chapters
Fallath TA, Bin Rosli A, Kidd BN, C. Carvalhais L and Schenk PM (2016). Towards plant defense mechanisms against root pathogens. In Agriculturally important microbes for sustainable agriculture. (submitted to Springer)
3- Conference papers Fallath TA, Kidd BN, Stiller J, Kazan K, Schenk PM (2015). Investigating the role of Mediator
complex in plant defence. The 11 Annual SCMB Research Student Symposiums,
Brisbane, Australia, 26 November.
Fallath TA, Kidd BN, Stiller J, Kazan K, Schenk PM (2015). Investigating the role of Mediator
complex in plant defence. ComBio Conference, Melbourne, Australia, 27 September-1
October.
Schenk PM, Rincon-Florez V, Rosli A, Chen YC, Liu H, Pretorius LS, Fallath T, Mirzaee H,
Shuey L, Al-Amery A, Dennis P, Iram S, Kidd B, Carvalhais LC (2014) Metagenomics
and transcriptomics to elucidate new plant-microbe interactions at the rhizosphere. 15th
International Symposium on Microbial Ecology, Seoul, South Korea, August 24-29.
Publications included in this thesis None
iii Contributions by others to the thesis
RNA sequencing was carried out by the Australian Genome Research Facility (AGRF). The initial analysis of RNAseq data was assisted by Dr. Jiri Stiller (CSIRO). The conception and design of this project was guided by Dr. Brendan Kidd and Prof. Peer Schenk.
Statement of parts of the thesis submitted to qualify for the award of another degree None
iv Acknowledgements
First and foremost, I would like to express my gratitude to Allah “God” (subhana wa taala) for endowing me with health, patience, and knowledge to complete this thesis.
Secondly, I would like to thank my supervisor Prof Peer Schenk who gave me the opportunity to work in a wonderfully vibrant and hardworking lab and for his guidance, advice and invaluable help during my project. My deepest gratitude and thanks go to Dr Brendan Kidd; he was a wonderful source of knowledge and whose assistance and advice was greatly appreciated throughout my project. He also was never too busy to help with all my ridiculous inquiries and problems and who provided a greatly deal of support and guidance. Without them this project would not have been possible.
I would like to thanks Dr. Max Chen, Dr. Lilia Carvalhais, Dr. Ahmad Radhzlan Rosli, Dr. Lara Pretorius and Dr. Anaheed Al-Ameir, Dr. Hongwei Liu, Asmaa Ali and Amreen Kwaja for helping me and providing a great advice and knowledge since the beginning of my work in the lab. I would like to thank all the members of the Schenk Lab for the very educational and entertaining lab meetings, making Mondays easier to handle and more importantly for their friendship.
Also, my gratitude and thanks goes to the Saudi Arabian government in particular The Ministry Of High Education for providing me with this great opportunity to study overseas at the University of Queensland and all the financial support during my studies.
My greatest thanks go to my dearest darling mum for all her night prayers and moral support and blessings. I would like to express a deep sense of gratitude to my wonderful husband Sami Howsawi for his endless patience, support, encouragement and sacrifices to achieve my dreams and I simply could not have done it without him. Special thanks are due to my loving brothers and sisters for all their emotional and financial support. Sweet thank is also due to my lovely sons Mohammed, Abdulrahman and Ahmad for their puerile support. Last but not the least I would like to gift all of my work to my dad may God keep his soul in peace in heaven.
Finally, I am also thankful to my friends here in Brisbane who helped make my stay in Australia a very pleasant one.
v Keywords Arabidopsis thaliana, Mediator complex, med18, med20, Fusarium oxysporum, root defence, disease resistance, gene expression, jasmonate, susceptibility
Australian and New Zealand Standard Research Classifications (ANZSRC) ANZSRC code: 060702 PLANT CELL AND MOLECULAR BIOLOGY 50%, 060704 PLANT PATHOLOGY 50%
Fields of Research (FoR) Classification
FoR code: 0607, Plant Biology, 100%
vi Table of Contents
LIST OF FIGURES ...... IX LIST OF TABLES ...... X LIST OF ABBREVIATIONS ...... XI CHAPTER I ...... 1 1.1 INTRODUCTION ...... 2 1.2 REVIEW OF LITERATURE ...... 3 1.2.1 Plant Disease and Resistance ...... 3 1.2.2 The role of Mediator complex in plant defence ...... 9 a) The Mediator Complex Subunit8 (MED8) ...... 15 a) The Mediator Complex Subunit18 (MED18) ...... 16 b) The Mediator Complex Subunit20 (MED20) ...... 18 c) The Mediator Complex Subunit21 (MED21) ...... 19 SUBSEQUENT CHAPTERS ...... 22 PH.D. RESEARCH PLAN...... 22 1.3 RESEARCH RATIONALE ...... 23 1.4 RESEARCH AIMS ...... 23 1.5 THE RESEARCH OBJECTIVES ...... 23 1.5.1 Aims of the project ...... 24 1.5.2 Aim 1 ...... 24 1.5.3 Aim 2 ...... 24 1.5.4 Aim 3 ...... 24 1.6 RESEARCH TIMELINE ...... 25 2 CHAPTER II: ...... 26 INVESTIGATING THE MINIMUM DOMAIN FOR MED25 INTERACTION IN TFS...... 26 2.1 INTRODUCTION ...... 27 2.2 MATERIALS AND METHODS ...... 28 2.2.1 Determine the minimum domain for MED25 interaction ...... 28 2.2.2 Search for novel proteins containing the ELLEL motif ...... 29 2.2.3 Cloning into entry vector ...... 29 2.2.4 Yeast (Saccharomyces cerevisiae) two-hybrid (Y2H) screening ...... 31 2.3 RESULTS ...... 32 2.3.1 Identification of ELLEL motif containing proteins ...... 32 2.3.2 Cloning of novel ELLEL motif containing genes ...... 32 2.3.3 Screening of MED25 and its candidate interacting TFs ...... 34 2.3.4 Y2H Screening for protein’s fragments that interact with the conserved ACID domain in Arabidopsis MED25...... 36 2.4 DISCUSSION ...... 37 2.4.1 The role of ELLEL conserved motif for MED25 interaction ...... 37 2.4.2 Screening for protein’s fragments that interact with the conserved ACID domain in Arabidopsis MED25...... 39 2.5 CONCLUSION ...... 40 3 CHAPTER III: ...... 41 IDENTIFYING THE ROLE OF MED18 AND MED20 IN CONFERRING F. OXYSPORUM RESISTANCE ...... 41 3.1 INTRODUCTION ...... 42 3.2 MATERIALS AND METHODS ...... 43 3.2.1 Plasmid preparation ...... 43 3.2.2 Y2H screening ...... 43 vii 3.2.3 Filter lifting assay ...... 43 3.2.4 Bimolecular Fluorescence Complementation (BiFC) assay ...... 44 3.2.5 Plant growth and growth conditions ...... 45 3.2.6 F. oxysporum inoculation ...... 45 3.2.7 RNA sequencing experiment ...... 45 3.2.8 Root colonisation analysis ...... 45 3.2.9 Disease resistance assays with F. oxysporum ...... 46 3.3 RESULTS AND DISCUSSION ...... 46 3.3.1 MED18 and MED20 interact with each other in plant ...... 46 3.3.2 Bimolecular Fluorescence Complementation (BiFC) assay ...... 47 3.3.3 med18 and med20 show different growth patterns to WT ...... 47 3.3.4 med18 and med20 roots display reduced colonisation of a GFP-tagged F. oxysporum ...... 51 3.3.5 MED18 and MED20 regulate similar gene sets in Arabidopsis ...... 52 3.3.6 med18 and med20 display different responses to F. oxysporum infection compared to WT Arabidopsis plants ...... 54 3.3.7 The role of glucosinolates in F. oxysporum resistance ...... 58 3.4 CONCLUSION ...... 61 4 CHAPTER VI: ...... 62 GENE EXPRESSION PROFILING OF JA, SA AND ROS MARKER GENES IN MED18 AND MED20 MUTANTS...... 62 4.1 INTRODUCTION ...... 63 4.2 METHODS: ...... 64 4.2.1 Plant growth and growth conditions ...... 64 4.2.2 Methyl jasmonate, ethylene and salicylic acid treatment ...... 64 4.2.3 F. oxysporum inoculation ...... 64 4.2.4 Primer design for RT-Q-PCR ...... 64 4.2.5 RT-Q-PCR analysis ...... 66 4.2.6 DAB Staining ...... 67 4.3 RESULTS ...... 68 4.3.1 JA signalling genes show altered expression in Arabidopsis med18 and med20 roots ...... 68 4.3.2 SA pathway associated genes show high expression in Arabidopsis med18 and med20 roots ... 68 4.3.3 MeJA, ET and SA treatment of med18 and med20 leaf tissue ...... 69 4.3.4 med18 and med20 show higher expression of ROS related genes ...... 70 4.3.5 ROS production in the roots ...... 71 4.4 ...... 79 4.5 CONCLUSIONS ...... 80 5 GENERAL CONCLUSIONS ...... 81 REFERENCE: ...... 87
viii List of Figures
Figure 1: The structure of the Mediator complex...... 11 Figure 2: Arabidopsis MED25 conserved domains...... 11 Figure 3: The conserved motif (CMIXc) in MED25 interacting IXc AP2/ERF...... 17 Figure 4: Model showing the functions of MED18 and its partners...... 18 Figure 5: Schematic diagrams of MED20 paralogs MED20a, MED20b, and MED20c...... 19 Figure 7: Typical disease phenotypes of wild-type (Columbia-0), med18 and med20a plants after inoculations of the roots with F. oxysporum...... 20 Figure 8: (A) Phylogenetic tree of the proteins containing the ELLEL motifs identified using a PROSITE scan of Arabidopsis proteins...... 33 Figure 9: (A) The conserved motif ELLEL amino acid residues that are found in the carboxy- terminal region sequence of RNA55, AGL, ERF14 and ERF96...... 34 Figure 10: Y2H analyses of interaction between ACID domain of MED25 with the other ELLEL proteins...... 35 Figure 11: Schematic representation of the ERF1 protein...... 36 Figure 12: The Y2H analyses of interaction between ACID domain of MED25 with the different fragments of ERF1 and DREB2A Arabidopsis TFs...... 37 Figure 13: Y2H analyses of interaction between different Mediator subunits in Arabidopsis...... 48 Figure 14: The in vivo interaction between MED18 and MED20 subunits in the leaves of N. benthamiana...... 49 Figure 15: Growth and development characteristics of WT, med18 and med20...... 50 Figure 16: Confocal images for the colonisation of a GFP-tagged F. oxysporum in different plants roots...... 52 Figure 17: Venn diagram of differentially regulated genes between each Arabidopsis mutant and the WT...... 53 Figure 18: Genes induced or repressed in each Arabidopsis mutant and the WT at early time-points after F. oxysporum infection...... 54 Figure 19: Top ten most significantly enriched GO terms for genes induced in Arabidopsis WT vs. med18 or med20...... 56 Figure 20: Top ten most significantly enriched GO terms for genes induced in med18 and med20 vs. WT...... 56 Figure 21: Proportion of plant processes identified by GO term enrichment analysis in WT compared to med18 or med20 in response to F. oxysporum infection in roots...... 57 Figure 22: Disease symptoms and scores of tgg1, tgg2, pen2, pen1/pen2/pen3 plants after F. oxysporum infection...... 60 Figure 23: RT-Q-PCR data for different JA associated genes in Arabidopsis WT, med18 and med20 roots with and without F. oxysporum infection...... 73 Figure 24: RT-Q-PCR data of SA related genes in WT, med18 and med20 roots with and without F. oxysporum infection...... 74 Figure 25: RT-Q-PCR data for hormone associated genes in WT, med18 and med20 leaves after MeJA, ET or SA treatment...... 76 Figure 26: RT-Q-PCR data of ROS-related genes shown as the different relative abundance in WT, med18 and med20 Plants...... 78 Figure 27: DAB staining of WT, MED18 and MED20 roots...... 79
ix List of Tables
Table 1: A comprehensive overview listing all of the known TFs interacting with MED25, MED8, MED18 and MED21 Mediator subunits, and the method by which they have been identified...... 21 Table 2: Primers that were used in amplification of the different fragments of TFs. F= forward primer, R= reverse primer...... 28 Table 3: Primers that were used in amplification of the different genes that contain the ELLEL protein motif. F= forward primer, R= reverse primer...... 30 Table 4: List of primers that were used in amplification of the different Mediator subunits. F= forward primer, R= reverse primer...... 43 Table 5: Primer pairs used in real time RT-Q-PCR. F= forward primer, R= reverse primer...... 65 Table 6: LIST OF GENES Accession Numbers ...... 86
x List of Abbreviations
GTF General Transcription Factor RNA Pol II RNA Polymerase II TF Transcription Factor MED25 Mediator Subunit 25 ERF1 ETHYLENE RESPONSE FACTOR1 ORA59 OCTADECANOID RESPONSIVE AP2/ERF59 DREB2A DROUGHT RESPONSE ELEMENT PROTEIN B MYC2 BASIC HELIX- LOOP-HELIX PROTEIN PCR Polymerase Chain Reaction Y2H Yeast Two-Hybrid cDNA Complementary Deoxyribonucleic Acid RNA Ribonucleic Acid ACID Activator-Interacting Domain SC Synthetic Complete Medium dpi days post infection SC-Leu-Trp-His Synthetic Complete Medium that lacks Leu-Trp-His amino acid (SC-LWH) SC-Leu-Trp Synthetic Complete Medium that lacks Leu-Trp amino acid (SC-LW) LB Lysogeny Broth AGRF Australian Genome Research Facility JA Jasmonic Acid SA Salicylic Acid Real time RT-PCR Real-Time Reverse-Transcriptase-PCR WT Wild-Type T-DNA Transfer DNA ROS Reactive Oxygen Species
xi
Chapter I
1 Introduction and Literature Review
1 1.1 Introduction Plants are a very important source of food for many organisms such as bacteria, fungi, protists, insects, and vertebrates. Therefore, to keep themselves save from invading by these organisms and inhibit them before they are able to cause extensive harm, plants need to develop a remarkable variety of structural, chemical, and protein-based defences. Plants are vital for people not only for food, but also for several essential non-food products such as wood, dyes, textiles, medicines, cosmetics, soaps, rubber, plastics, inks, and industrial chemicals. Thus it is necessary to understand the defence process that plants use to protect themselves from pathogens in order to defend this key supply and develop highly disease-resistant plant varieties.
The transcription process in eukaryotes is highly complex due to the involvement of a variety of proteins that work together in synchrony. The core proteins involved during this transcriptional machinery are the general transcription factors (GTFs), the RNA polymerase II (pol II) enzyme, a range of transacting activators and repressors, and the Mediator complex. The Mediator and its subunits play a crucial role as a bridge between the pol II enzyme and DNA-bound TFs. Until now there is a limited understanding of how different TFs interact with different subunits of the Mediator complex.
There are approximately 1,500 TFs in the genome of Arabidopsis thaliana (Ratcliffe and Riechmann, 2002) that are allocated into several gene families based on the similarity of the DNA binding domains (McGrath et al., 2005). It is generally agreed that TFs in plants play a critical role in how plants respond to both abiotic and biotic stress. In response to a pathogen attack, TFs can either activate or suppress the expression of particular defence pathways, depending on the pathogen that is invading. In addition, they can fine-tune other plant signalling pathways to suppress non-essential pathways to prioritise the defence response (Anderson et al., 2004). Recently, an interaction between one of the Mediator complex subunits, MED25, and a number of TFs has been reported (Elfving et al., 2011; Blomberg et al., 2012; Chen et al., 2012; Cevik et al., 2012). Some of the TFs were known to play an important role in plant hormone signalling pathways during plant defence against pathogens (Chen et al., 2012; Cevik et al., 2012).
In light of this, the study of MED25 and the Mediator complex subunits, not only offers a better understanding of plant defence mechanisms, it also provides an understanding of how the Mediator complex can interact with TFs to control the broader transcriptional process. This literature background will provide a broad overview of findings and progression that has been made on the research of the Mediator complex and also their subunits.
2 1.2 Review of literature Plant health can be disrupted by a wide variety of living agents (biotic), like viruses, bacterial and fungal pathogens, or by environmental (abiotic) factors including nutrient shortage, drought stress, oxygen deficiency, extreme temperature, ultraviolet radiation, or pollution. In order to respond to the vast array of potential biotic stresses, plants have evolved a multi-level defence system that includes both constitutive and inducible defences. Constitutive (continuous) defence is the first layer that plants use to defend themselves from infection by potentially harmful organisms. This layer consists of various preformed barriers such as cell walls, waxy epidermal cuticles, and bark (Hematy et al., 2009; Reina-Pinto and Yephremov, 2009). These physical barriers play an important role in protecting plants from invasion as well as giving them strength and rigidity. The only way for pathogens to pass these barriers is either by possessing specific mechanisms that allow them to enter the plant tissue such as physical pressure (e.g. appressoria) or by producing enzymes that can degrade the cell wall. The second layer that plant cells use to stop pathogen entry is inducible defences that include chemical defence mechanisms. After a pathogen penetrates the cell wall plants not only produce toxic chemicals and enzymes that can degrade pathogens, they may also initiate hypersensitive response (HR)-mediated programmed cell death in order to isolate the pathogen from the rest of the plant (VanEtten et al., 1994).
1.2.1 Plant Disease and Resistance
1.2.1.1 The Plant Immune System A vast array of microorganisms surrounds plant roots in the rhizosphere. These microorganisms can be either harmful or beneficial to plants (Whipps, 2001). Thus plants have developed basal resistance, also known as innate immunity. There are two layers of sophisticated surveillance used to detect potential pathogens: pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) (Jones and Dangl, 2006). PAMPs include microbes’ cell wall components or specific pathogen proteins (such as bacterial flagellin). PTI is activated when PAMPs of potential pathogens have been recognised by PAMP receptors in plants (Nicaise et al., 2009). PAMP receptor activation leads to reactive oxygen species (ROS) production (Lamb and Dixon, 1997) as well as activation of the MAP Kinase signalling cascades which then leads to increased ion flux, phytoalexins, hormone production and defence gene expression (Nicaise et al., 2009).
3 On the other hand, pathogens have evolved proteins known as effectors that can suppress PAMP- triggered immunity and allow the pathogens to colonise inside the plant. In this situation, plants might respond by recognising these effector proteins and activting the second line of defence known as ETI that may lead to HR at the infection site. If pathogens overcome ETI as well, the plants must respond by evolving new resistance (R) genes that are able to recognise these effectors and again recruit a successful defence response to protect the plant (Bent and Mackey, 2007). It seems that plants and pathogens are in constant competition to develop new methods to outsmart one another.
1.2.1.2 Plant Pathogens Plant pathogens can be classified according to their lifestyles into three categories, biotrophic, necrotrophic or hemi-biotrophic. Biotrophs keep their host alive and extract nutrients from its tissues (Voegele et al., 2003; Ellis et al., 2006), and include examples such as the powdery mildew fungus Blumeria graminis and the bacterial rice pathogen Xanthomonas oryzae. Necrotrophic pathogens produce toxins and/or enzymes that degrade the plant cell so they can overwhelm plant defences and absorb nutrients, such as the gray mold fungus Botrytis cinerea and the bacterial soft- rot pathogen Erwinia carotovora (Agrios, 2005). The third type of pathogen is the hemi-biotrophic pathogen. This type is a combination of the two previous categories as it starts its infection as a biotroph and after initial infection it alters its strategy to necrotrophy to complete its life cycle (Brown and Ogle, 1997). An example of hemi-biotrophic pathogens is the wilt causing fungus Fusarium oxysporum.
Pathogen effectors evolved to play a positive role in virulence by enabling growth and reproduction in host plants (Dong et al.,. 2015 and Lo Presti et al.,. 2015). Nonetheless, effectors can meet their match with host immune receptors that recognise their presence, a result that is detrimental for the pathogen. Such immunity-triggering proteins are known as avirulence (Avr) effectors. When an Avr effector triggers a host immune receptor, the pathogen’s survival depends upon generating variants that escape, suppress, or alter this recognition event in ways that allow the pathogen to grow and reproduce. This can be accomplished by numerous means. Transposon insertions or mutations to the DNA sequence encoding the Avr gene, or its complete loss, are commonly encountered as gain of virulence mechanisms (Na and Gijzen, 2016). The immunity can also be overcome without modification of the Avr gene. One approach is by gaining or developing an additional, epistatic effector that subdues the immune-triggering incident caused by the Avr effector. The best examples are, in the potato late blight pathogen Phytophthora infestans (Chen et al.,. 2012), the wheat 4 powdery mildew pathogen Blumeria graminis (Bourras et al.,. 2015), the tomato wilt pathogen F. oxysporum (Houterman et al.,. 2008), and the canola blackleg pathogen Leptosphaeria maculans (Plissonneau et al.,. 2016). Another approach is by changing the expression of the Avr gene to defeat immunity. This could simply result from a DNA mutation in the Avr gene’s regulatory region or in an epistatic location in the genome that affects Avr gene transcription (Na and Gijzen, 2016).
1.2.1.3 Plant defence hormones The plant hormones most commonly associated with plant defence include salicylic acid (SA), ethylene (ET) and jasmonate (JA). The former is commonly induced in response to biotrophic pathogens, while the latter two are often associated with a response to necrotrophic pathogens (Glazebrook, 2005). SA plays a role in mediating the systemic acquired resistance (SAR) pathway that results in the systemic activation of defence mechanisms such as PR (Pathogenesis-Related) gene expression, like PR1 and PR5 (Uknes et al., 1993). The JA-dependent defence response is mediated by jasmonoyl isoleucine (JA-ile) and leads to the induction of defence related genes such as PLANT DEFENSIN1.2 (PDF1.2) and THIONIN2.1 (THI2.1) (Epple et al., 1995; Penninekx et al., 1996). In addition to its involvement in plant defence, the ET pathway is involved in a variety of plant growth and developmental processes, such as seed germination, root hair development, root nodulation, flower senescence, abscission and fruit ripening (Johnson and Ecker, 1998). The JA, ET and SA pathways interact with each other and this cross-talk can be quite complex. Generally, the JA and SA pathways are said to be antagonistic to each other but at low concentrations they can also be synergistic (Schenk et al., 2000; Mur et al., 2006). For example, SA has been stated to stop not only the JA-biosynthesis, but also JA-responsive gene expression (Pennickx et al., 1996), whereas, JA has been shown to suppress the pathway of SA signalling. Defence hormone cross-talk is controlled by TFs that can activate target genes of one pathway, while inhibiting those of the other pathway. The three closely related Arabidopsis basic leucine zipper (bZIP) TFs, TGA2, TGA5 and TGA6 are examples of TFs that are required to activate SA regulated defence genes and at the same time repress the JA pathway (Zander et al., 2010).
1.2.1.4 Defence against the root pathogen Fusarium oxysporum More than 100 different plant species are infected by the root pathogen F. oxysporum, including cotton, tomato, banana and Arabidopsis. Being a root infecting pathogen poses some unique challenges in studying the plant-pathogen interaction. However, a number of scientific studies have established some general methods to study the early infection process and response of the plant, in tomato (Beckman et al., 1989; Gao et al., 1995; Olivain et al., 2006), cotton (Shi et al., 1991;
5 Rodriguezgalvez and Mendgen, 1995), banana (Vandermolen et al., 1987; Visser et al., 2004) and Arabidopsis pathosystems (Czymmek et al., 2007). These investigations have uncovered some strategies that the host plant uses to resist the pathogen.
The infection of F. oxysporum starts from the root toward the vascular tissue, where it proliferates and causes the plant to wilt. The disease symptom progression mainly relies on the extent to which the xylem is blocked or not. Several studies that conducted electron microscopy have indicated that a variety of physical alterations occur in response to infection. One of the prior studies in F. oxysporum infection illustrated that within 1 h post inoculation of resistant tomato plants, the contact parenchyma cells (parenchyma cells adjacent to infected xylem cells) display an expanded cytoplasm opposite the infection (Beckman et al., 1991). In addition, Beckman et al., (1989) and Mueller et al., (1994) have reported that these contact cells deposit apposition layers made of callose to secure the cell wall. According to the results of these studies, the plants can sense the presence of the pathogens in the xylem; therefore, callose-containing apposition layers are synthesised in the nearby cells to inhibit the lateral spread of the pathogen.
Moreover, plants possess numerous armaments to block off longitudinal extent of the fungus. Shi et al. (1992) have showed that after cotton plant infection, the contact cells play an important role to secrete a combination of gels and gums to block off the vasculature. Tyloses can be produced as well to impede the infection. Tyloses are parenchyma cells that balloon out into the lumen through the xylem pits (Vandermolen et al., 1987). Also, wide ranges of phenolic compounds are released to support both tyloses and gel-gum secretions (Beckman, 2000). The phenolic compounds oxidise in the xylem and polymerise together to form stable lignified barriers (Beckman et al., 1974). Nevertheless, it is not known if all plants can produce defence mechanisms such as tyloses or gum secretions to block F. oxysporum infection. Furthermore, more research is needed to determine the signalling pathway that is required to trigger these defence responses.
1.2.1.5 Defence against F. oxysporum in Arabidopsis Investigating the plant defence signalling network is a worthy alternative approach to understanding F. oxysporum resistance. These signalling processes can be modified to study which genes may be required for resistance or susceptibility to pathogens. Arabidopsis is a good model system to study these defence signalling pathways as numerous genes encoding mutants of known defence regulators have been studied to assess their involvement in plant defence.
6 Mutants deficient in SA-mediated defences were shown to be more susceptible to F. oxysporum. For example, the sid2 mutant that is impaired in SA biosynthesis is more susceptible to F. oxysporum f.sp. conglutinans (Berrocal-Lobo and Molina, 2004; Diener and Ausubel, 2005). In addition, treatment of SA to the leaves of Arabidopsis plants resulted in a partial increase in resistance (Edgar et al., 2006).
The Arabidopsis R genes, RESISTANCE TO FUSARIUM OXYSPORUM (RFO1, RFO2, RFO3 etc), have also been successfully cloned. Diener and Ausubel, (2005) discovered the RFO1 gene by using a cross between the moderately resistant ecotype Columbia-0 (Col-0) and the susceptible ecotype Taynuilt-0 (Ty-0). RFO1 encodes a wall-associated kinase-like kinase 22 (WAKL22). RFO1 is an atypical R gene in that it provides broad-spectrum resistance to three dissimilar types of F. oxysporum as opposed to a single race. Furthermore, the resistance provided by RFO1, RFO2, RFO3 is quantitative and hence provides only partial resistance. However, RFO3 only confers specific resistance to F. oxysporum f.sp. matthioli, and provides no resistance to two other species; F. oxysporum f.sp. conglutinans or F. oxysporum f.sp. raphani. A recent study has shown that RFO2 provides strong pathogen-specific resistance (Shen and Diener 2013). The extracellular leucine-rich repeats (eLRRs) in RFO2 and the related receptor like protein (RLP) 2 protein are interchangeable for resistance and remarkably similar to eLRRs in the receptor-like kinase PSY1R, which perceives tyrosine-sulfated peptide PSY1 (Shen and Diener, 2013). The study also found reduced infection in psy1r. Consequently, the results of this suggest that F. oxysporum produces an effector that prevents the normal negative feedback regulation of PSY1R, which stabilises PSY1 signalling and induces susceptibility. However, RFO2, acting as a decoy receptor of PSY1R, is also stabilised by the effector and instead induces host immunity (Shen and Diener 2013). The RFO R genes are unique in that they provide protection to multiple formae speciales of F. oxysporum and provide only partial resistance in some host-pathogen combinations. Nonetheless, the process by which these genes provide F. oxysporum resistance is still unknown.
There is also evidence that plants insensitive to JA are more resistant to F. oxysporum. MYC2, BASIC HELIX- LOOP-HELIX PROTEIN transcription factor, is a positive regulator of insect defence, wound responses, flavonoid metabolism, and oxidative stress tolerance during JA signalling (Dombrecht et al., 2007). In contrast, MYC2 is thought to act predominantly as a negative regulator of JA/ET-associated pathogen defence (Kazan and Manners, 2008). However, the JA signalling-compromised MYC2 mutant shows increased resistance to F. oxysporum (Anderson et al., 2004), and has increased SA defence gene expression which could explain the enhanced resistance to F. oxysporum.
7 Similarly, the coi1 mutant has also been shown to possess increased resistance to F. oxysporum (Thatcher et al., 2009; Trusov et al., 2009). COI1 (CORONATINE INSENSITIVE1) is an integral part of the SCF (Skp-Cullin-F-box) type E3 ubiquitin ligase complex that acts as co-receptor with the JAZ repressor for the active form of jasmonate, jasmonoyl isoleucine, (JA-ile) (Thines et al., 2007; Yan et al., 2009; Sheard et al., 2010). Mutation of COI1 abolishes JA function, including the expression of JA-associated defence genes, such as PDF1.2 (Penninckx et al., 1996). Therefore the increased resistance of the coi1 mutant suggests that functional JA signalling is required for susceptibility to F. oxysporum and that activation of this susceptibility program may overwhelm any benefit of increased JA defence gene expression. Grafting studies performed with the coi1 mutant showed that the root section is required for resistance/susceptibility to F. oxysporum. A coi1 rootstock grafted to a WT scion resulted in almost complete resistance, suggesting that roots play a significant role in plant defence against F. oxysporum. In additional, Pantelides et al. (2013)’s study showed that mutant on receptor 1 ethylene (etr1-1) plants exhibited statistically less Fusarium wilt symptoms compared to the other mutant col-0 plants. Quantitative polymerase chain reaction analysis associated the decrease in symptom severity shown in etr1-1 plants with reduced vascular growth of the pathogen, suggesting the activation of defence mechanisms in etr1-1 plants against F. oxysporum in the roots. This study suggested F. oxysporum also requires ETR1 mediated ethylene signalling to promote disease development in plants.
A microarray analysis carried out by Chen et al., (2014) showed that in contrast to the leaf response, root tissue did not show a strong induction of defence-associated gene expression and instead showed a greater proportion of repressed genes. Screening insertion mutants from differentially expressed genes in the microarray uncovered a role for the transcription factor ETHYLENE RESPONSE FACTOR72 (ERF72) in susceptibility to F. oxysporum. Due to the role of ERF72 in suppressing programmed cell death and detoxifying reactive oxygen species (ROS), they examined the pub22/pub23/pub24 U-box type E3 ubiquitin ligase triple mutant which is known to possess enhanced ROS production in response to pathogen challenge. they found that pub22/23/24 is more resistant to F. oxysporum infection, suggesting that a heightened innate immune response provides protection against F. oxysporum (Chen et al., (2014). This demonstrates again that root-mediated defencess against soil-borne pathogens could be provided at multiple levels.
8 1.2.2 The role of Mediator complex in plant defence
1.2.2.1 The discovery of the Mediator complex The first identification of the Mediator complex was from yeast, Saccharomyces cerevisiae by Flanagan and colleagues during their studies of in vitro transcription (Flanagan et al., 1990; Kelleher et al., 1990; Flanagan et al., 1991). In the following years, investigation of the Mediator complex established its role as an essential requirement for activator-dependent stimulation of Pol II-mediated transcription.
1.2.2.2 The Mediator complex in plants Thirteen years after the discovery of the Mediator complex in yeast, Bäckström and colleagues reported their purification of the Mediator complex and its subunits in Arabidopsis thaliana and classified these proteins as new components of the transcriptional machinery in plants (Bäckström et al., 2007). The Mediator complex is a multi-protein complex and is present in all eukaryotes (Bäckström et al., 2007; Chadick et al., 2005; Malik and Roeder 2005), although the primary sequence of Mediator subunits diverges significantly between eukaryotic kingdoms.
To date, there are 21 conserved and six plant-specific subunits that have been identified in
Arabidopsis thaliana (Bäckström et al., 2007). The investigation of these proteins as subunits of the Mediator complex has demonstrated the important as well as diverse roles that single subunits can possess. A single subunit is expected to differentiate and respond to diverse TFs within the Arabidopsis genome (Kidd et al., 2011). Consequently, determining which TFs that individual Mediator subunits can recognise would definitely speed up our understanding of how the Mediator complex manages to integrate the complex transcriptional information in plants.
1.2.2.3 The structure of the Mediator complex The subunits of the Mediator complex are organised in four sub-modules; the head, the middle, the tail and the Cyclin Dependent Kinase module (CDK) (Dotson et al., 2000). The head sub-module (most conserved) is thought to serve as an interface for RNA Pol II–binding and interacts through the Pol II C-terminal domain. While the tail sub-module (least conserved) is responsible for linking to sequence-specific transcription factors (Chadick and Asturias, 2005, Malik and Roeder, 2005). The middle module of Mediator is responsible for the signal transfer from the tail to the head, and the CDK module usually functions as a transcriptional repressor (Figure 1; Casamassimi and Napoli, 2007). In addition to these direct interactions, contemporary publications illustrate that the
9 subunits of this complex have further multiple functions and can link to and facilitate the roles of diverse co-activators and co-repressors, including those acting at the level of chromatin (Malik and Roeder, 2005; Chen and Roeder, 2011; Hentges, 2011; Kidd et al., 2011). Although the subunit composition and the structure of Mediator have been intensely studied, relatively little is known about how Mediator operates to integrate and convey signals from DNA-bound transcriptional regulators.
1.2.2.4 The function of the plant Mediator complex Since its identification in plants, the multi-protein complex has been discovered to regulate numerous biological activities, such as the response to biotic and abiotic stress, controlling growth and development of plant organs as well as regulating flowering time and fertility (Kidd et al., 2011). Furthermore, a number of subunits from this complex have been indicated to play an important role in nuclear functions; for example, some subunits possess DNA helicase activity, or are involved in RNA processing e.g. mRNA splicing or rRNA methylation (Kidd et al., 2011). In addition, a recent study identified an important role for this large protein complex in noncoding RNA production (Kim et al., 2011).
1.2.2.5 The structure of the Mediator subunit 25 (Med 25) MED25 encodes a protein of 836 amino acids in length. It contains three different conserved domains (Figure 2). The conserved Von Willebrand factor type A (vWF Pfam · PF00093) domain in its amino terminus that is crucial for Mediator binding. An ACID domain that is required for the interaction with transcription factors as well as a glutamine rich region in the carboxyl terminus (Bäckström et al., 2007; Cerdán and Chory 2003; Mittler et al., 2003). Cerdan and Chory (2003) proposed that MED25 is a transcriptional co-regulator due to its ability to activate transcription in yeast when fused to the LexA DNA binding domain. The structure of the MED25 activator interaction domain (ACID) was recently solved using NMR (Milbradt et al., 2011; Vojnic et al., 2011; Landrieu et al., 2015). They proposed that the ACID domain consists of a closed β-barrel with seven strands framed by three α-helices (H1-H3).
10 the Mediator complex
Tail
TF Med21 Middle
Head Med24
Mediator GTFs GTFs
Figure 1: The structure of the Mediator complex. The head sub-module serves as interface of RNA Pol II, interacting through the C-terminal domain, while the tail sub-module links to sequence- specific transcription factors. The middle module of Mediator is responsible for the signal transfer from the tail to the head. GTFs – general transcription factors, TF- transcription factor. (reproduced from (Sohail and Robert, 2010))
Figure 2: Arabidopsis MED25 conserved domains. The MED25 protein contains a vWF-A domain (blue), a middle domain (MD) (white), an ACID domain (red), and a GD domain (gray). Bar = 100 amino acids (aa) (Chen et al., 2012).
11 1.2.2.6 The identification and role of MED25 in plant development The MED25 subunit was first identified as PHYTOCHROME AND FLOWERING TIME1 (PFT1) based on its role in stem elongation and floral transition when there is a change in light quality (Cerdán and Chory, 2003). When red light is decreasing and far red light is increasing this acts as an indicator of increasing shade and can act as a warning signal of potential competition for light from neighboring plants. As a result the plant will decide whether to initiate stem elongation to reach more light or induce flowering if the shade is prolonged and unavoidable (Franklin and Whitelam, 2005). The studies of this mechanism showed that MED25 has an important role in regulating this adaptive process called shade avoidance (Cerdań and Chory, 2003; Wollenberg et al., 2008).
1.2.2.7 The role of MED25 in biotic stress responses Besides controlling flowering time, recent publications reported that MED25 has an essential function in pathogen defence (Kidd et al., 2009). The authors of this report showed MED25 mutant plants to be more susceptible to the leaf infecting necrotrophic fungal pathogens Alternaria brassicicola and Botrytis cinerea. On the other hand there was an increase in resistance to the root infecting hemi-biotrophic fungal pathogen, Fusarium oxysporum (Kidd et al., 2009). Remarkably, there was a decrease in the level of the transcription of numerous plant defence genes, including those responsive to JA (Kidd et al., 2009). Importantly this mechanism justified the varied phenotypes in response to these fungal pathogens, as defences regulated by JA signalling are recognised to be needed for resistance to necrotrophic pathogens (Onatẽ -Sancheź and Singh, 2002), whereas F. oxysporum is believed to hijack JA signalling for stimulating senescence responses hypothesised to increase symptoms in response to this pathogen (Thatcher et al., 2009). In addition, the reduced JA responses also result in increased resistance to the hemibiotrophic pathogen Pseudomonas syringae pv tomato (Pst) DC3000 which also requires JA signalling to induce disease (Chen et al., 2012). Therefore these data possibly implicate MED25 as an interacting partner for JA-associated TFs in the Mediator complex.
1.2.2.8 Interaction of MED25 To date researchers have identified 25 TFs that interact with MED25. These TFs belong to a variety of transcription factor families including AP2/ERF, bHLH, MYB, WRKY, bZIP and zinc finger, demonstrating that Arabidopsis MED25 plays regulatory roles in diverse physiological processes including JA-dependent defence response (Chen et al., 2012, Elfving et al., 2011, Ceviķ et al., 2012, Ou et al., 2011). A recent study found that the MED25 subunit could interact with eight different
12 transcription factors by using a high-throughput Y2H analysis (Ou et al., 2011). Five of these TFs identified can interact with the promoter region of the PDF1.2 gene, a commonly used marker for the JA signalling pathway (Ou et al., 2011). Three of these TFs, all from the AP2-EREBP family, interact directly both with MED25 and the GCC-box of PDF1.2, suggesting that MED25 regulates PDF1.2 expression through these three TFs. A failed interaction with these transcription factors in the MED25 mutant could potentially explain why JA-associated gene expression is reduced with the associated effects on plant–microbe interactions.
Subsequently, an additional three transcription factors were found to interact with MED25 (Elfving et al., 2011). Two of the transcription factors that were identified, ZFHD1 and DREB2A, have published roles in abiotic stress tolerance (Sakuma et al., 2006, Maruyama et al., 2006, Tran et al., 2007). The authors were able to show that MED25 mutant plants also displayed alterations in both drought and salt stress; however the increased drought resistance phenotype of MED25 was not consistent with the increased drought sensitivity of the two transcription factor mutants (Elfving et al., 2011). The increased drought tolerance of the MED25 mutant may also be related to the positive role that MED25 plays in jasmonate signalling, as this pathway is known to antagonise abscisic acid (ABA) signalling that is associated with drought tolerance responses (Anderson et al 2004).
Moreover, Cevik and colleagues (2012) have pointed out that MED25 physically interacts with several key transcriptional regulators of the JA signalling pathway, including the APETALA2 (AP2)/ETHYLENE RESPONSE FACTOR (ERF) transcription factors such as ERF1 and OCTADECANOID RESPONSIVE ARABIDOPSIS AP2/ERF59 (ORA59) as well as the master regulator MYC2. Physical interaction detected between MED25 and four group IX AP2/ERF transcription factors was shown to require the activator interaction domain of MED25 as well as the recently discovered Conserved Motif IX-1/EDLL transcription activation motif of MED25- interacting AP2/ERF (Figure 3). Using transcriptional activation experiments, they also indicated that ORA59 and ERF1-dependent activation of PDF1.2 as well as MYC2-dependent activation of VEGETATIVE STORAGE PROTEIN1 (VSP1) requires a functional MED25. In addition, MED25 is required for MYC2-dependent repression of pathogen defence genes. Together these findings demonstrate the versatility of the MED25 subunit in regulating multiple pathways, from hormone signalling and flowering to biotic stress responses.
Recently, research by Yang et al. (2014) has shown that MED25 interacts with another subunit of the Mediator complex, YID1/MED16, to carry out its role in iron homeostasis. Their study demonstrated that disruption of MED25 led to the hypersensitivity of plants to iron deficiency.
13 They found that MED25 interacts with Ethylene - Insensitive 3 (EIN3) and Ethylene - Insensitive 3 - Like 1 (EIL1), two transcription factors in ethylene signalling involved in iron homeostasis regulation in Arabidopsis. Moreover, the transcripts of Fe-deficiency Induced Transcription factor (FIT), Ferric Reduction Oxidase 2 (FRO2) and Iron–Regulated Transporter 1 (IRT1) were reduced during an iron deficiency in yid1/med16 and med25 mutants when compared with those in the wild type. Their results demonstrate that MED25, together with YID1/MED16, regulates iron homeostasis by interacting with EIN3/EIL1 to regulate the expression of downstream genes (Yang et al., 2014).
Direct interactions between transcriptional regulators and different Mediator subunits are believed to recruit and stabilise Mediator at the promoter, and there are indications that interactions with transcriptional regulators induce conformational changes or structural shifts in Mediator (Wands et al., 2012 and Meyer et al., 2010). It is possible that such conformational changes in Mediator are propagated to induce further structural shifts in components of the general transcription machinery. These changes, combined with other signal pathways that cause posttranslational modifications of different transcription factors, might therefore determine the level of transcription from each gene (Blomberg et al., 2012). Consistent with this idea, Blomberg and colleagues have found that binding of DREB2A to its canonical DNA sequence leads to an increase in secondary structure of the transcription factor. Similarly, interaction between the DREB2A and MED25 in the absence of DNA results in conformational changes. However, the presence of the canonical DREB2A DNA- binding site reduces the affinity between DREB2A and MED25. They stated that transcription regulation is facilitated by small but distinct changes in energetic and structural parameters of the involved proteins (Blomberg et al., 2012).
Surprisingly, Blomberg et al. (2012) demonstrated that DREB2A from Arabidopsis can interact with the human MED25 ACID domain and displayed similar complex kinetics as the Arabidopsis MED25 ACID domain with DREB2A interaction. This result not only suggests that there is sequence similarity in the ACID domain between the two species, but also it proposes that whatever is discovered in plant gene regulation through the Mediators complex may be applied to the human Mediator complex. Indeed, physical interactions between MED25 and a diversity of transcription factors suggest that MED25 acts as an integrative hub within Mediator to regulate a wide range of physiological processes including the plant defence response (Chen et al., 2012; Cevik et al., 2012)
14 1.2.2.9 Human MED25
Similar to the MED25 protein in plants, the human MED25 protein also seems to have a function in host defence. The human MED25 has been shown to be the cellular target of a number of viral activators through its C-terminus such as the well-studied transcriptional activator belonging to Herpes Simplex Virus, VP16, (Mittler et al., 2003; Yang et al., 2004) and Lana-1 the activator from the Kaposi Sarcoma associated herpes virus (Roupelieva et al., 2010), as well as the activator IE62, from the closely related Varicella Zoster virus, the virus responsible for chicken pox and shingles (Yang et al., 2008), whereas the N-terminus of human MED25 forms contact with the Mediator complex (Mittler et al., 2003). The Arabidopsis MED25 protein shows similarity to human MED25 in its N-terminus, however the sequence is less conserved in the C-terminus. In addition to the defence functions, human MED25 has been shown to be involved in Retinoic acid signalling, xenobiotic and lipid metabolism, cranofacial development as well as the motor and sensory neuropathy Charcot Marie Tooth Disease (Lee et al., 2007; Nakamura et al., 2011; Rana et al., 2011; Youn et al., 2011).
1.2.2.10 Other significant Mediator subunits
Intriguingly however, the MED25 subunit is not the only Mediator subunit to control multiple pathways and a number of other Mediator subunits have been reported to have regulatory roles in flowering time [MED8, MED17, MED18, MED20a; (Kidd et al., 2011; Kim et al., 2011)], biotic stress [MED8, MED21; (Kidd et al., 2011; Dhawan et al., 2009)] or abiotic stress [MED16 (Wathugala et al., 2011 and Knight et al., 2009)].
a) The Mediator Complex Subunit8 (MED8) MEDIATOR8 (MED8) is part of the head module of the Mediator complex. Studies on MED8 show that the mutation of this Mediator subunit not only has a stronger delay in flowering time than MED25 under both LD and SD conditions, but also plays a significant role in plant defence. The med8 mutant is susceptible to A. brassicicola but resistant to F. oxysporum in Arabidopsis (Kidd et al., 2009). Moreover, the med8 mutant shows enhanced susceptibility to Pseudomonas syringae DC3000, but has no significant defects in biological induction of SAR (Zhang et al., 2012). The study of Kidd and co-worker (2009) also state that even though there is only a minor reduction in MeJA-induced PDF1.2 expression in the med8 mutant, the effect of med8 on PDF1.2 expression is more visible in the med25 mutant background, as the double mutant shows a further decrease in
15 PDF1.2 expression. As expected, the med8 mutation has an additive effect with the med25 mutation on F. oxysporum resistance (Kidd et al., 2009). Therefore, MED8 and MED25 may act independently within Mediator to influence the plant defence response.
a) The Mediator Complex Subunit18 (MED18) MEDIATOR18 (MED18) is part of the head module of the Mediator complex. It is a multifunctional protein that has a key role in regulating plant immunity, development, flowering time and responses to hormones through interactions with distinct transcription factors as well as its role in non-coding RNA production. Mutant med18 plants possess similar developmental phenotypes to med20a and display reduced miRNA levels (Kim et al., 2011). MED18 represents a unique immunity regulator that functions distinctly from other immune response factors. The immune response function of MED18 is carried out through at least two mechanisms involving activation (PTR3) and suppression (thioredoxins and glutaredoxin) of gene expression. PTR3 is a di- and tri-peptide transporter implicated in plant responses to wounding and infection (Stacey et al., 2002; Karim et al., 2007). It is possible that deficiency in the uptake of amino acids compromises the synthesis of some defence compounds. A recent paper demonstrates that MED18 interacts with zinc finger TF YY1 (YIN YANG1) to suppress disease susceptibility genes glutaredoxins GRX480, GRXS13 and thioredoxin TRX-h5. Consequently, yy1 and med18 mutants exhibit deregulated expression of these genes and enhanced susceptibility to fungal infection. Intriguingly, MED18 is also required for pathogen-induced expression of PTR3, a positive regulator of plant defence (Lai et al., 2014). Moreover, MED18 is recruited to ABI5 and FLOWERING LOCUS C (FLC) promoters through interaction with TFs ABI4 (ABA INSENSITIVE 4) and SUF4 (SUPPRESSOR OF FRIGIDA4) to regulate responses to ABA and flowering time, respectively. Interestingly, in addition to transcription initiation, MED18 is involved in transcription elongation, termination, as well as recruitment of RNA Pol II to target genes in the various pathways (Lai et al., 2014). Notably, RNA polymerase II occupancy and histone H3 lysine tri-methylation (H3K36me3) on chromatin of target genes are affected in the med18 mutant (Lai et al., 2014), reinforcing MED18’s function in different mechanisms of transcriptional control. Overall, MED18 conveys distinct cues to engender transcription underpinning plant responses (figure 4).
16 A
B
Figure 3: The conserved motif (CMIXc) in MED25 interacting IXc AP2/ERF. The group IX family of AP2/ERF can be divided into three groups (Nakano et al., 2006). All Group C proteins have the conserved domain CMIXc (showing in pink) in their carboxy- terminal region and six of these proteins interact with MED25 (A). Also shown is the sequence of the conserved domain CMIXc which is important for interaction with MED25 and the conserved ELLEL motif identified in MED25 interacting AP2/ERF proteins (Cevik et al., 2012) (the conserved amino acids are shaded in grey boxes) (B). The EDLL motif previously identified by Tiwari et al., (2012) is also shown in red.
17 NATURE COMMUNICATIONS | DOI: 10.1038/ncomms4064 ARTICLE
PTR3 TATA box ABI5 TATA box FLC TATA box 2 0.3 a 2 c a 0.2 c 1 1 0.1 a c b %ChIP signal/input %ChIP signal/input %ChIP signal/input b b b b d 0 0 0 Wt med18-1 Wt med18-1 Wt med18-1
PTR3 coding ABI5 coding FLC coding 4 1 2 a c
a 2 0.5 1 a
c c %ChIP signal/input %ChIP signal/input b b b b %ChIP signal/input bb 0 0 0 Wt med18-1 Wt med18-1 Wt med18-1
Figure 8 | MED18 modulates histone H3K36 tri-methylation at the coding region of target genes. (a) H3K36 tri-methylation at PTR3, (b) ABI5 and (c) FLC loci in wild-type and med18 mutant plants. ChIP was conducted with H3K36me3-specific antibodies (Abcam). ChIP for PTR3 was performed on 4-week-old plants at 2 dai with B. cinerea. AB15 ChIP was on 2-week-old seedlings treated with 50 mM ABA for 3 h. FLC ChIP was conducted on 2-week-old untreated seedlings. Data are representative of two independent experiments. Error bars indicate s.e. (n 3). ¼
Biotic Light Hormones Abiotic infection. Third, SUF4 interaction with MED18 plays a critical stress stress role for normal expression of the floral repressor FLC. However, MED18 the regulation of FLC is generally more intricate with other factors and regulatory processes involved. Mutation in SUF4 results in early flowering by reducing FLC gene expression39. The ABI4 YY1 SUF4 genetic data suggest that SUF4 and MED18 have contrasting TF (ERF/AP2) (Zinc finger) ? (Zinc finger) functions. In the wild-type background MED18 may suppress the function of SUF4 in promoting FLC expression. Congruent with Target ABI5 TRX and GRX PTR3 FLC this, the med18 mutant exhibits enhanced FLC expression and genes extremely delayed flowering, which suggests the function of the wild-type MED18 protein is to promote flowering. This is Process: ABA Fungal Resistance Flowering consistent with our observation that MED18 suppresses SUF4 response (B. cinerea) function through physical interaction and association at the FLC locus. Fourth, MED18 regulates PTR3 through direct association FigureFigure 94: |Model Model showing showing the functionsthe functions of MED18 of MED18 and its partners. and its MED18 partners. is required for MED18signalling is required from upstream forsignaling regulators from to downstream upstream components regulators through to downstream interaction withwith the PTR3 regulatory regions. The intermediary TF through transcription factors ABI4, YY1 and SUF4 to regulate plant responses to ABA, infection and components through interaction with transcription factors ABI4, YY1 and which this association occurs is not known. Together, the above flowering time, respectively. These interactions directly regulate the expression of the SUF4 to regulate plant responses to ABA, infection and flowering time, data suggest that MED18 functional specificity and its role in corresponding target genes ABI5, TRX-GRX, PTR3 and FLC genes. The transcription factoractivation, or repression of gene expression are conferred by the respectively.mediating PTR3 Those regulation interactions by MED18, directlyis unknown regulate (Lai et al., the 2014). expression of the sequence-specific DNA-binding zinc finger (YY1, SUF4) or ERF/ corresponding target genes ABI5, TRX-GRX, PTR3 and FLC genes. The transcription factor mediating PTR3 regulation by MED18 is unknown. AP2 (ABI4) domain TF proteins in response to upstream extra- b) The Mediator Complex Subunit20 (MED20) and intracellular cues. Overall, MED18 is involved in multiple MEDIATOR20 (MED20) is also belong to the head module of the Mediator complex. Inand seemingly independent biological functions and cellular Arabidopsis there are three different paralogs of MED20. They were named MED20a, MED20b, and MED20c (Figure 5). MED20a and MED20b have 85% identity at the nucleotide level.processes. MED20cThe interactions is shorter than MED20a between and MED2 MED18,0b. There TFs is 93% and identity their at targetthe nucleotide genes level in Plant responses to infection involve specific and broad areexon summarized 2 among the three ingenes the (Kim model et al., 2011). for Kim MED18 et al., (2011) functions have provided (Fig. eviden 9,ce thatreprogramming of gene expression. MED18 is required to SupplementaryMED20a is crucial Fig.in regulating 12). MED18 development interacts and non-coding with RNA ABI4, production. YY1 m anded20a hasintegrate and transmit defence-related signals from TFs to the reduced fertility and altered leaf phyllotaxis and this gene is important for non-coding RNA SUF4biogenesis TFs (Kim that et al., are 2011) known to bind to different DNA sequences in transcriptional machinery contributing to the up and down- their respective target genes performing different physiological regulation of diverse immune factors. Interestingly, markers of functions. First, MED18 interaction at the ABI4-binding site of 18canonical immune response pathways such as effector-triggered ABI5 modulates ABI5 gene expression, consistent with the immunity, particularly R-genes, PAMP-triggered immunity, positive role of MED18 on ABA responses. The impaired systemic acquired resistance and JA/ET-mediated such as responses to ABA, reduced expression of ABI5 in med18 mutant responses show no altered gene expression responses in med18 and physical interaction with ABI4 demonstrate the critical role mutant. Thus, MED18 represents a novel immunity regulator that of MED18 in ABA responses. Interestingly, the disease resistance functions distinctly from other immune response factors. The and ABA response functions of MED18 appear independent. immune response function of MED18 is carried out through at Second, the negative regulation of GRX480, GRXS13 and TRX-h5 least two mechanisms involving activation (PTR3) and suppres- is clearly mediated by MED18 interaction with the transcriptional sion (thioredoxins and glutaredoxin) of gene expression. PTR3 is repressor YY1. YY1 maintains normal expression of GRX480, a di- and tri-peptide transporter implicated in plant responses to GRXS13 and TRX-h5 that are plant susceptibility factors to wounding and infection30,40. It is possible that deficiency in the
NATURE COMMUNICATIONS | 5:3064 | DOI: 10.1038/ncomms4064 | www.nature.com/naturecommunications 11 & 2014 Macmillan Publishers Limited. All rights reserved. Mediator in noncoding RNA production YJ Kim et al repeats and transposons (reviewed in Chen, 2009), raises the Figure S1B), and fertility was reduced (Figure 1B; Supple- question of whether Mediator acts in transcriptional gene mentary Figure S1D). At a frequency of B20%, the mutant silencing (TGS) and whether Mediator promotes the activities developed three cotyledons and three first true leaves instead of Pol IV or Pol V. of a pair of each in wild type (Supplementary Figure S1A). Here, we evaluate the effects of three Mediator mutations The mutation was mapped to a 120-kb region covered by in the expression of protein coding as well as noncoding RNA the BACs T3B23 and T1B3 on chromosome 2. Sequencing genes in Arabidopsis. We show that Mediator is likely a candidate genes in this region revealed a C-to-T mutation in general transcription factor that promotes Pol II transcription At2g28230, which encodes a subunit of the head submodule of a large number of protein-coding genes. We also show that in Mediator (Figure 1C). The mutation is at the 58th nucleo- Mediator promotes the transcription of miRNA genes (MIR) tide of the coding region in the second exon and results in a by recruiting Pol II to their promoters. In addition, we reveal a premature stop codon (Figure 1C). A genomic construct previously unsuspected role of Mediator in noncoding RNA covering 2.5 kb of the promoter and the entire coding region production at, and TGS of, loci regulated by endogenous of At2g28230 was introduced into the mutant—the morpho- siRNAs. These findings broaden our knowledge of the role logical phenotypes of the mutant were rescued in all 39 of Mediator in gene expression and genome defense. independent transgenic lines (Supplementary Figure S1C and data not shown). Therefore, the med20a mutation was responsible for the morphological defects. A homology-based Results search identified two more paralogs in Arabidopsis: Arabidopsis mutants in three Mediator subunit genes At2g28020 and At4g09070. Therefore, At2g28230, display pleiotropic developmental defects At4g09070, and At2g28020 were named MED20a, MED20b, A mutant with pleiotropic developmental phenotypes was and MED20c, respectively (Figure 1C). MED20a and MED20b isolated in a forward genetic screen in the Columbia (wild have 85% identity at the nucleotide level. MED20c is shorter type) background. The mutant was smaller than wild type in than MED20a and MED20b; there is 93% identity at the stature and late flowering (Figure 1A). The leaves had shorter nucleotide level in exon 2 among the three genes. petioles and curled downward (Supplementary Figure S1A), Transcriptome studies using Affymetrix ATH1 microarrays the phyllotaxy of flowers was abnormal (Supplementary found MED20a and MED20c to be expressed throughout the
A B
Col med20a med17 med18
Col med20a med17 med18 nrpb2-3
C E med20a MED20a MED17 MED18 * MED20a Col med20a Col med17 Col med18 MED20b UBQ5 MED20c RT(–)
med17 FigureD 5: Schematic diagrams of MED20 paralogs MED20a, MED20b, and MED20c. The asterisk indicates the mutation causing a premature stop codon in the med20a mutant. Black rectangles representMED17 exons and lines represent introns. MED20a and MED20b are composed of three exons showing 85% identity at the nucleotide level. MED20c only encodes the conserved second exon (At5g20170) SALK_102813 compared with MED20a med18and MED20b.
c) MED18The Mediator Complex Subunit21 (MED21) MEDIATOR(At2g22370)21 (MED21) is part of the middle module of the Mediator complex. MED21 is believed to have a criticalSALK_027178 role in regulating development and plant defence. It regulates defence against necrotrophic fungal pathogens by interacting with HUB1 (Histone Monoubiquitination1). Figure 1 IsolationHUB1 and is a RING characterization E3 ligase functioning of mutants in histone in H2B Mediator monoubiquitination genes. ( andA) contributes Four-week-old to plants of wild type (Col), med20a, med17, med18, and nrpb2-3.(resistanceB) Siliques against from A. brassicicola Col, med20a and B., cinereamed17 in, and Arabidopsismed18 (Dhawanplants. et al., (C ) 2009). Schematic RNA diagrams of MED20 paralogs MED20a, MED20b, and MED20c. The asteriskinterference indicates (RNAi) lines the wit mutationh reduced MED21 causing gene aexpression premature exhibit stop increased codon susceptibility in the med20a to mutant. Black rectangles represent exons and lines represent introns.A. brassicicolaMED20a andand B. cinereaMED20b, whereasare MED21 composed over-expressing of three plants exons do not showingshow any significant 85% identity at the nucleotide level. MED20c only encodes the conserved seconddifferen exonce compared compared to the wild with typeMED20a (Dhawan etand al., 2009).MED20b In addition.(D, )T- SchematicDNA insertion diagramsmutants of T-DNA insertion mutants of MED17 and MED18. Large trianglesare represent embryo lethal T-DNA (Dhawan insertions. et al., 2009). Black An and rectangles Mou (2013) have represent pointed out exons. that MED21 (E) RT–PCR may analysis of MED20a, MED17, and MED18 expression in med20a, med17relay signals, and frommed18 upstreammutants, regulators respectively. and chromatin modifications The images to the in RNA the polymerase top row represent the indicated Mediator genes. UBIQUITIN5 (UBQ5) was used as an internal loading control. The ‘ÀRT’ reactions were performed with the UBQ5 primers. The PCR primers used are indicated by small arrowheads in (C, D). 1.2.2.11 The role of med18 and med20 mutants in F. oxysporum susceptibility
&2011 EuropeanFusarium Molecular oxysporum Biology is considered Organization to be one of the most significant fungal pathogens for a wide The EMBO Journal VOL 30 | NO 5 | 2011 815 range of plant species. It is a hemi-biotrophic pathogen that has a complicated, multi-stage infection lifestyle. The infection process starts with a biotrophic root colonisation stage, followed by invasion
19 of the vascular system through the xylem. The pathogen then switches to a necrotrophic lifestyle involving host wilting, stem browning, senescence and finally necrosis.
Recently, new research in the Schenk laboratory, has found that mutations in the MED18 and MED20 subunits of the Mediator complex lead to surprisingly strong resistance to F. oxysporum (figure 7). Initial qRT-PCR experiments suggest that the resistance of med18 plants seems to be independent of JA signalling as the med18 mutant shows WT levels of PDF1.2 expression (data not shown). We therefore would like to investigate the cause of resistance in the med18 and med20 mutants further using RNAseq expression analyses.
Figure 6: Typical disease phenotypes of wild-type (Columbia-0), med18 and med20a plants after inoculations of the roots with F. oxysporum. The med18 and med20 mutants show resistance to F. oxysporum and also delayed flowering.
20 Table 1: A comprehensive overview listing all of the known TFs interacting with MED25, MED8, MED18 and MED21 Mediator subunits, and the method by which they have been identified.
21
SUBSEQUENT CHAPTERS
Ph.D. Research Plan.
22 1.3 Research Rationale
Consistent with what has been discussed in the above literature review, there are fundamental questions that arise in our understanding. • For example, the mechanism of how Mediator subunits regulate gene expression in plants through interaction with TFs is currently unknown. • Transcriptional activation domains in TFs have long been identified through functional testing, but how these domains interact on the Mediator surface is unknown. • What is the role of additional subunits such as MED18 and MED20 in controlling plant defence and particularly in defence against F. oxysporum?
1.4 Research aims To date, the potential roles of Mediator subunits have not been systematically analysed in plants. Research in the Schenk laboratory at UQ and the Kazan laboratory at CSIRO Agriculture has shown that manipulating genes encoding individual Mediator subunits offers yet unexplored control points to regulate innate immunity and other important physiological processes in plants. Therefore, the first aim of this project is to identify and characterise the potential functions of the MED25 subunit by identifying new interacting proteins and characterising further its interaction with the known MED25 interacting TFs. The interacting proteins are likely to belong to a set of transcription factors which provide additional control points to regulate physiological pathways in plants. In addition, other Mediator subunits, in particular MED18 and MED20 will be characterised for their role in plant defence. The outcome of this project will not only be a new set of molecular tools enabling us to better understand and bioengineer important traits in plants, but also will provide an increased understanding of how Mediator-regulated gene expression functions in plants and in humans.
1.5 The research objectives The following three objectives chosen to be investigated in the present PhD study are:
1. To investigate the domain required for MED25 subunit interaction in TFs. 2. To identify the role of MED18 and MED20 in regulating gene expression in med18 and med20 mutants in response to F. oxysporum infection. 3. To explore stress response signalling of med18 and med20, particularly ROS, SA and JA responses, and their function in F. oxysporum resistance.
23 1.5.1 Aims of the project
1.5.2 Aim 1 Investigating the domain for MED25 interaction in TFs.
• Perform Y2H assays with MED25 and its interacting TFs: ERF1, ORA59, DREB2A and MYC2 to test whether we can identify the minimum domain for MED25 interaction amongst different TFs. • Using sequence comparisons to identify novel TFs that may interact with MED25 through the identified domain.
1.5.3 Aim 2 Identifying the role of MED18 and MED20 in conferring F. oxysporum resistance • Characterise the resistance phenotype of med18 and med20 mutants by identifying the extent of colonisation of F. oxysporum using microscopy at early time-points. • Perform an RNAseq experiment to identify candidate genes that may be providing resistance in these mutants. The RNAseq experiment will be performed with AGRF and analysed together with bioinformatics support from CSIRO Agriculture. • Investigate this resistance phenomenon further by screening mutants of the candidate genes to confirm the source of resistance in the med18 and med20 mutants.
1.5.4 Aim 3 Gene expression profiling of JA, SA and ROS marker genes in med18 and med20 mutants infected with F. oxysporum. • Time course experiment for jasmonate acid and salicylic acid treatment. • Perform qRT-PCR to measure the gene expression of some JA, SA, ET and ROS related genes. • Study the ROS activity of both mutants after F. oxysporum infection.
24 1.6 Research Timeline Research activity 20 2014 2015 2016 13 Q Q3 Q4 Q1 Q2 Q3 Q4 Q1 Q2 Q3 Q4 Q1 2 • Chapter1: Literature review.
• Chapter2: Investigating the minimum domain for MED25 interaction in TFs • Determine the minimum domain for MED25 interaction • Identify novel TFs contain CMIXc conserved motif • Test binding capability using Y2H Mileston 1:PhD Confirmation document
Chapter3: Identifying the role of med18 and med20 in conferring F. oxysporum resistance • Investigate other MED subunits that have roles similar to MED25 in flowering time and plant defence by Y2H • Bimolecular Fluorescence Complementation (BiFC) assay • Gus measurement (MUG assay) • • Look at colonization of F.oxysporum in med18 and med20 roots. • Perform RNAseq of the WT and med18 roots • Disease resistance assays with F.oxysporum Mileston 2:PhD Mid-candidature review
Chapter4: Gene expression profiling of JA, SA and ROS marker genes in med18 and med20 mutants.
• Real time qRT- PCR following RNA- seq • Real time qRT-PCR to study ROS related genes. • GUS production in med18 and med20
• Methyl jasmonate and salicylic acid treatment
Mileston 3:PhD thesis reviewand and final write-up
25
2 Chapter II:
Investigating the minimum domain for MED25 interaction in TFs.
26 2.1 Introduction
The MEDIATOR25 (MED25) subunit is one of a few genetically characterised Arabidopsis Mediator subunits and it illustrates the various functions that one Mediator subunit can have in diverse plant activities. MED25 has not only been shown to have role in organism development and propagation (Xu and Li, 2011), but also in numerous abiotic and biotic stress responses (Kidd et al., 2009; Elfving et al., 2011; Iñigo et al., 2012; Sundaravelpandian et al., 2013; Raya-González et al., 2014; Carvalhais et al., 2015; Seguela-Arnaud et al., 2015).
MED25 has been shown to interact with numerous TFs that belong to several families including AP2/ERF, bHLH, MYB, WRKY, bZIP and zinc finger. Thus, MED25 in Arabidopsis takes an important part in regulating various physiological activities including the JA-dependent defence response (Chen et al., 2012, Elfving et al., 2011, Ceviķ et al., 2012, Ou et al., 2011).
Moreover, a study done by Cevik and colleagues (2012) illustrated that MED25 physically interacts with several key transcriptional regulators of the JA signalling pathway, including ERF1 and ORA59 as well as the master regulator MYC2. Physical interaction detected between MED25 and four group IX AP2/ERF transcription factors was shown to require the activator interaction domain of MED25 as well as the recently discovered Conserved Motif IX-1/EDLL transcription activation motif of MED25-interacting AP2/ERF.
There are eight members of the AP2/ERF IXc subfamily. Cevik et al., (2012) identified six of the eight in a large screen of Arabidopsis TFs, but ERF14 and ERF96 were not identified and have not been studied before. Therefore in this thesis I have examined three members of the AP2/ERF IXc subfamily, ERF1 (as a positive control), as well as ERF14 and ERF96. Figure 3 (Page 17) and Figure 9 (Page 34) show the members of the IXc subfamily with and without the ELLEL motif
This chapter aimed to identify new interacting proteins that have the Conserved Motif IX-1/EDLL. Also investigated was the minimum domain required for the interaction between MED25 and ERF1. To achieve this, the interaction results were compared with the known MED25 interacting TFs. Determining the minimal protein domain that is necessary for activation of MED25 may enable the creation of engineered activation domains and provide additional control points to regulate physiological pathways in plants.
27 2.2 Materials and Methods
2.2.1 Determine the minimum domain for MED25 interaction
A cDNA sequence encoding amino acids 551–680 of A. thaliana MED25 (ACID) was amplified by
PCR using the appropriate forward and reverse primer pairs (Table 1). Also, the nucleotide sequence corresponding to amino acids ERF1 1-138 and ERF1 138-218, DREB2A 1-168 and DREB2A 168-
335, and MYC2 1-188, MYC2 149-188, MYC2 189-624 and MYC2 100-200, were amplified from Arabidopsis cDNA using the appropriate forward and reverse primer pairs (Table 2). All PCR products were cloned into the pCR8 vector using the pCR 8/GW/TOPO TA Cloning Kit (Invitrogen), and the Pure Yield Plasmid Miniprep System kit (Invitrogen) was used to purify plasmids according to the manufacturer’s instructions. All plasmid constructs were confirmed by restriction analysis and sequencing. The PCR conditions, plasmid cloning and purification steps were as stated previously.
Table 2: Primers that were used in amplification of the different fragments of TFs. F= forward primer, R= reverse primer.
Gene name Primer Primer
type 5’- -3’
Med 25 F 5′-ACTTCACAATCCAAATATGTG (ACID) R 5′-ATTTGGAATTTGTGGTTTAA
ERF11-138 F 5’-ATGGATCCATTTTTAATTCAGTCCCC R 5’-TCGGCGGAGAGAGTTCAAGA
ERF1138-218 F 5’-TCGGCGGAGAGAGTTCAAGA R 5′-TCACCAAGTCCCACTATTTTCAGA
DREB2A1-168 F 5′-ATGGCAGTTT ATGATCAGAGTGGA R 5′-ATCTGGATCCTCTGTTTTCACATG
DREB2A168-335 F 5′-GATTGTGAATCTAAACCCTTCTCC R 5′-TTAGTTCTCCAGATCCAAGTAACTC
MYC21-188 F 5′-ATGACTGATTACCGGCTACAACCA R 5′-TGCAAACGCTTTACCAGCTAATCC
MYC2149-188 F 5′-GGTGTTGCTCCGTCGGATGACG R 5′-TGCAAACGCTTTACCAGCTAATCC
28 MYC2189-624 F 5′-ACGGGTAACGCGGTTTGGGTT R 5′-TTAACCGATTTTTGAAATCAAACTTG
MYC2100-200 F 5′- CTCGGATGGGGAGATGGTTATTA R 5′-TCATTGATCTGACCCGGAAACCC
2.2.2 Search for novel proteins containing the ELLEL motif
A PROSITE scan (http://prosite.expasy.org/scanprosite/) using the ELLEL (ExLxxxxLExL) motif was performed to identify Arabidopsis proteins that contain the ELLEL conserved motif and may potentially interact with MED25.
2.2.3 Cloning into entry vector
2.2.3.1 PCR amplification Four candidate genes (RNA55, AGL, ERF14 and ERF96) that contain the ELLEL protein motif were amplified by PCR. The PCR reaction was made up by adding 11.7 μL of dH2O, 4 μL of 5x phire II buffer, 0.4 μL of 10mM dNTPs, 0.4 μL of phire II and 2 μL of (forward and reverse) gene- specific primer pair (see Table 1) with 1 μL of cDNA template in each PCR tube. After that, the tubes were incubated at 98 ºC for 5 min, 60 ºC for 20 s, then 72 ºC for 1.5 min. These incubation periods were repeated for 40 cycles before the reaction was incubated at 72 ºC for 5 min.
2.2.3.2 Transformation The PCR products were separated on a 1% agarose gel and the bands were cut and measured before they were cleaned up using a Wizard ® SV Gel and PCR Clean Up System (Promega). After the clean up, a mixture of 2 μL of 10x Taq Polymerase buffer, 1 μL of 10 mM dNTPs and 1.5 μL of Taq Polymerase was added to all PCR tubes. Then these tubes were incubated at 72 ºC for 15 min. Thereafter, each PCR product was ligated into the pCR8 vector using the pCR8/GW/TOPO® TA Cloning ® Kit (Invitrogen) according to the manufacturer’s instructions and then transformed into E. coli Top10 cells and plated on Lysogeny broth (LB) agar medium containing the antibiotics spectinomycin with a final concentration of 50 µg/mL.
The reference vectors; pDEST32 and pDEST22 with MED25 or other TFs previously identified to interact with MED25 were a kind gift from Volkan Cevik. A total of 2 μL of these plasmids were
29 transformed into competent DH5α E. coli cells for plasmid bulking. Cloned TF genes were transferred from pCR8/GW/TOPO using LR Clonase II (Invitrogen) into either pDEST32 or pDEST22 according to the manufacturer’s protocol. Finally, 150 μL of bacterial culture was spread on LB agar plates containing gentamycin with a final concentration of 10 µg/mL for pDest32 plasmids that contain MED25 fragments or Ampicillin with a final concentration of 100 µg/mL for pDest22 plasmids that contain the different TF genes and plates were incubated overnight at 37 ºC.
Table 3: Primers that were used in amplification of the different genes that contain the
ELLEL protein motif. F= forward primer, R= reverse primer.
Gene Primer type name F R 5’- -3’ RNA55
ATGGATTCATCGCCACCGAACAC CTATAATCTCAAATTCATTTCTTCTTC
AGL
ATGGCGAGAGAGAAGATAAGGA TCATTCCCAAGATGGAAGC
ERF14
ATGGATCAAGGAGGTCGTAGC TTATTGCCTCTTGCCCATGT
ERF96
ATGGATCAAGGAGGTCGAGGT TCATTTCTTCTTGCCCTTGTT
2.2.3.3 Plasmid purification 10 colonies of each plate were streaked out into a new plate and incubated overnight at 37 ºC. The next day, four colonies from the new plates were inoculated into 5 mL of LB liquid medium in a 50 mL Falcon tube and incubated on a shaker overnight at 37 ºC to grow. The tubes contained either the antibiotics spectinomycin, gentamicin or ampicillin. Next, the Pure Yield Plasmid Miniprep System kit (Invitrogen) was used to purify plasmids according to the manufacturer’s instructions with the exception of using nuclease-free water in eluting the plasmid DNA instead of TE buffer. For the restriction digestion EcoRI restriction enzyme (New England Biolabs) was used to cut the PCR8/ GW/ TOPO vector and BsrgI or BamHI restriction enzymes (New England Biolabs) were used to cut pDest32 and pDest22 to confirm that the genes of interest were cloned into the plasmid.
30 The plasmid DNA yields were measured by a spectrophotometer (NanoDrop® ND-1000). The plasmid DNA was sent for sequencing to make sure that the reading frame of the entry clones is correct for insertion into pDEST22.
2.2.4 Yeast (Saccharomyces cerevisiae) two-hybrid (Y2H) screening
2.2.4.1 Preparation of media Three types of media were prepared to carry out Y2H screening. YPAD agar and liquid contained 20 g of Bacto Peptone, 20 g of agar (except for the liquid YPAD), 10 g of Yeast Extract, 50 mL of 40% glucose solution and 100 mg of adenine sulfate. The pH of these media was adjusted to pH 6 before they were autoclaved and poured into plates. Two forms of Synthetic Complete Medium (SC) were made; SC-L-W-H which contains an amino acid mix that does not contain leucine, tryptophan and histidine amino acids and SC-L-W which does not contain leucine and tryptophan amino acids (Sunrise Science Products, San Diego, CA).
2.2.4.2 Yeast Two-Hybrid (Y2H) Screen.
To carry out Y2H screening of the TFs in the prey constructs with the MED25 (ACID) 551–680 in the bait constructs, I co-transformed 10 μL of both bait and prey plasmids into the yeast strain Saccharomyces cerevisiae cells (MaV203) according to the S. c. EasyComp Transformation Kit system manual (Invitrogen). The transformed reaction was then plated into two different plates, SC- Leu-Trp (SC_LW) plates (50 μL and 25 μL) and YPAD plates (10 μL and 1 μL). Selection of the positive clones was carried out on SC-Leu-Trp-His plates, SC- Leu-Trp-His with 12.5 mM analogue 3-amino-1,2,4-triazole (3-AT) and SC- Leu-Trp-His with 25 mM 3-AT plates.
2.2.4.3 Filter lifting assay The X-Gal filter assay was carried out on YPAD plates according to the protocol of Gietz et al.
(1997) with the exception of using 10.7 g of Na2HPO4x2H2O and 6.2 g of Na2PO4x2H2O instead of
16.1 g of Na2HPO4x7H2O and 5.5 g of Na2PO4xH2O respectively in the Z-buffer solution. The filter papers were wrapped with a plastic wrap and incubated at 37 ºC until colonies turn blue.
31 2.3 Results
2.3.1 Identification of ELLEL motif containing proteins
Previous research identified six AP2/ERF TFs that interact with MED25 (Cevik et al., 2012). These six TFs belong to the same sub class of AP2/ERF proteins (group IX) and share a common domain in the C-terminus with a conserved sequence of ELLEL (see Figure 9B below). This motif had previously been described to be a potent transcriptional activation domain and was termed EDLL (Tiwari et al., 2012). In addition mutation of the last two L amino acids in the sequence inhibited MED25 interaction. As the ELLEL amino acids were conserved amongst the six TF proteins, we performed a PROSITE scan using the ELLEL motif and identified 48 Arabidopsis proteins that contain the ELLEL motif and may potentially interact with MED25 (Figure 8). Included in this list were additional ERF TFs, ERF96, and AGL24, as well as RNA helicase proteins and defence associated proteins. ERF96 along with ERF14 are two AP2/ERF TFs from subgroup IX that had not been identified in our original screens (Cevik et al., 2012). While ERF96 was identified by the PROSITE scan, ERF14 TF was not identified as it contains a modification of the conserved sequence replacing the last E with a D (Figure 9A). It is interesting to determine whether this motif can still interact with MED25.
2.3.2 Cloning of novel ELLEL motif containing genes
To test whether the identified proteins interact with MED25, PCR amplification was carried out for three different candidate genes that have the conserved ELLEL motif (RNA55, AGL, ERF96). These proteins were chosen as they represented TFs or RNA associated proteins that may interact with MED25. We also included ERF14 which was not identified by the PROSITE scan. The cloned PCR products were of the expected size; RNA55 1498 bp, AGL 663 bp, ERF14 402 bp and ERF96 496 bp and were subsequently sequenced in their cloning vectors before transferring to the Gateway compatible Y2H vectors pDEST22 and pDEST32.
32
Figure 7: (A) Phylogenetic tree of the proteins containing the ELLEL motifs identified using a PROSITE scan of Arabidopsis proteins.
33 ERF14 402 bp and ERF96 496 bp (see figure 5a, and 5b). We managed to get the others genes
that did not produce any bands under different annealing temperatures (Data not shown).
ERF14After amplification 402 bp and, ERF96we gel extracted496 bp (see the figurPCRe products. 5a, and 5Asb). RNA55 We managed produce to twoget verythe others close bandsgenes
thatwe cutdid outnot produce both bands any and bands added under A -differenttails to theannealing PCR products temperatures using (Data Taq notpolymerase shown). to allow
them ligate into PCR8 vector that has T in its open site. The transformation procedure was carried After amplification, we gel extracted the PCR products. As RNA55 produce two very close bands outERF14 according 402 bp to and PCR ERF96 TM 8/GW/TOPO 496 bp (see® TAfigur Clone 5a,ing and ® Kit 5b). (Invitrogen). We managed After to getthe theincubation others genestime, we cut out both bands and added A A-tails to the PCR products using Taq polymerase to allow wethat check did noted producethe plate any and bands we noticed under differentthat there annealing were more temperatures colonies in (Dataour candidate not shown) genes. plates them ligate into PCR8 vector that has T in its open site. The transformation procedure was carried compare to the control plates. After amplification, we gel extracted the PCR products. As RNA55 produce two very close bands out according to PCR TM 8/GW/TOPO® TA Cloning ® Kit (Invitrogen). After the incubation time,
we cut out both bands and added A-tails to the PCR products using Taq polymerase to allow we checked the plate and we noticed that there were more colonies in our candidate genes plates DCL4them ligate E into R L PCR8 DEES vector L E H that L has T in its open site. The transformation procedure was carried compare to the control plates. out RNA49 according E F to L PCRDFRN TM L 8/GW/TOPO E I L ® TA Cloning ® Kit (Invitrogen). After the incubation time,
we DRL31 check ed E the S Lplate HCPK and LE we T noticed L that there were more colonies in our candidate genes plates AGL as well as RNA helicase and defense associated proteins. The ERF14 TF contained a compare DCL4RNA55 to E the RN Lcontrol DEESDFRN plates L E H.R L modification of the conserved sequence replacing the last E with a D (Figure 3). It will be AGLRNA49 E FD LL DFRNDGLN LL EE EI L interesting to determine whether this motif can still interact with MED25.
RPS2DRL31 E SF LL HCPKSREN LLE E T R LL A B DCL4RNA55RNA18 E RNI L DFRNDEESDFRN LL EE HIR L ERF1 VVVF E D L GEQY L E E L L ERF15 LVVF E D L GAEY L E Q L L AGLFH6RNA49 E SFD LL DFRNDGLNGAEL LLEL EE TEI L ORA59 LVVL E D L GAEY L E E L M DRL31 E S L HCPK LE T L RPS2ERF14 EE FY LL DDSVSREN L DE ER L TDR1 VFEF E Y L DDKV L E E L L
ERF96RNA18RNA55 E INY LL DFRNDFRDDSVN LLE E EIR LL ERF091 LFEF E D L GSDY L E T L L ERF95 VIEF E Y L DDSL L E E L L FH6AGL E* SD *L DGLN GAEL LEL* *E TE L* : . : * * . * * * : Conserved ERF14RPS2 EE FY LL DDSVSREN LL DEE E R LL Conserved E L L E L
ERF96RNA18 E IY LL DFRNDDSV LLE E EI LL
Figure 4. Shows the conserved motif ELLEL aminoFigure acid 3. The residues conserved that ELLEL found motif in the identified carboxy in- MED25terminal interacting proteins (Cevik et al., Figure FH6 8 : (A) E* T S he *L conservedGAEL LE* * motif T L* ELLEL amino acid residues that are found in the carboxy- 2012). The EDLL motif previously identified by Tiwari et al., (2012) is also shown in red. The terminalregion sequenceregion sequence of DCL4, of RNA49,RNA55, DRL31, AGL, ERF14 RNA55, and AGL, ERF96. RPS2, The RNA18, ELLEL FH6, motif ERF14 is highlighted and ERF96. in The ERF14 E Y L DDSV LD E L blue,Conserved and the E non L conserved L E D amino L acid in conserved ERF14 is amino highlighted acids are inshaded red. in(B) grey The boxes conserved ELLEL motif is highlighted in blue, and the non conserved D amino acid in ERF14 is highlighted in red. ELLEL motif identified in MED25 interacting proteins (Cevik et al., 2012); the EDLL motif ERF96 E Y L DDSV LE E L previouslyFigure 4. identified Shows the by conserved Tiwari et motif al., (2012) ELLEL is amino also shown acid residues in red, thatthe conserved found in theamino carboxy acids- terminalare Cloning of novel ELLEL motif containing genes shaded in grey * boxes * . * * * region sequence of DCL4, RNA49, DRL31, RNA55,To test AGL, whether RPS2, the RNA18,identified FH6, proteins ERF14 interact and with ERF MED25,96. The PCR amplification was carried out Conserved E L L E L ELLEL motif is highlighted in blue, and the non conservedfor the 10 Ddifferent amino candidateacid in ERF14 genes thatis highlighted have the conserved in red. ELLEL motif (see figure 4 below). 2.3.3 ! Screening of MED25 and its candidate interacting TFs 23! DCL4, RNA49, DRL31 and RNA55 were amplified by using the erf6 cDNA samples as Figure 4. Shows the conserved motif ELLEL amino acid residues that found in the carboxy- terminal To identify the interaction between MED25 andtemplates. the proteins While that AGL, contains RPS2, RNA18, the ELLEL FH6, ERF14 conserved and ERF96 were amplified by using the WT region sequence of DCL4, RNA49, DRL31, RNA55, AGL, RPS2, RNA18, FH6, ERF14 and ERF96. The motif, I carried out Y2H screening using MED25DvWF-A/Q-rich as bait construct and the ERF14, cDNA samples as templates. The sizes of PCR products were determined by Agarose gel ERF96,ELLEL motif RNA55 is highlighted or AGL24 in as blue prey, and construct the non sconserved. I also coD -aminotransformed acid in ERF1ERF14 as is highlighted a control preyin red. electrophoresis. Eight out of 10 genes were detected in the gel. No bands were detected for DCL4 construct! which has previously been shown to interact with MED25 (Cevik et al., 2012). 23! MED25DvWF -A/Q-rich consists of the MED25 andactivator RNA49 interaction genes although domain we ( performedACID; amino six PCR acids reactions using a sensitive polymerase. 551–680), minus the vWF-A domain for Mediator interaction and the C-terminal Q-rich domain. Compare to the ladder our candidate genes fragments were in the expected size; DRL31 2625 This domain was previously used to test interaction with the DREB2A TF and therefore the same domain was chosen for the candidate interactionsbase in this pair study (bp), RNA55(Blomberg 1498 et bp, al., AGL 2012). 663 Thebp, RPS2bait and 2730 bp, RNA18 1782 bp, FH6 2700 bp, ! 23! the prey construct were co-transformed into MaV203 yeast and streaked out onto plasmid selective media SC_LW plates and non selective YPAD ! plates. In the two previous media (SC- LW and 22! YPAD), we observed growth with ERF14, ERF96, RNA55 and AGL24 as well as the control TF ERF1 as expected. In parallel I performed a serial dilution of the yeast colonies onto selective plates
34 that lacked histidine (SC-LWH) with or without 12.5 mM 3-AT to assess the interaction with MED25.
Our results from preliminary Y2H screening indicate that only AP2/ERF proteins belonging to the group IX sub-class (ERF14 and ERF96) and not the other ELLEL motif containing proteins RNA55 or AGL can interact with MED25 (see Figure 10 below). Interestingly, ERF14 which has a non conserved aspartate in place of a conserved leucine in the ELLEL motif, had reduced colony growth relative to ERF96 and ERF1 constructs.
MED25-BD MED25-BD -1 -2 -3 -1 -2 -3 1 10 10 10 1 10 10 10
(-ve) AD-GFP
(+ve) AD-ERF1
AD-AGL
AD-AGL
AD-ERF96
AD-RNA55
AD-ERF14
-LW -LWH 12.5mM 3-AT
Figure 9: Y2H analyses of interaction between ACID domain of MED25 with the other ELLEL proteins. Only ERF1, ERF96 and ERF14 showed positive results (growth) on SC-LWH 12.5 mM 3- AT medium. Similar results were found on SC-LWH without the addition of 3-AT (data not shown). ERF1 was used as a positive control for the reliability of our Y2H system. All transformed colonies grew equally well on YPAD media (data not shown)
35 2.3.4 Y2H Screening for protein’s fragments that interact with the conserved ACID domain in Arabidopsis MED25.
To identify plant transcriptional regulators that operate by interaction with MED25, we used a bait composed of amino acids 551–680 of Arabidopsis MED25, in a yeast-two-hybrid screen with prey composed of different fragments of ERF1 (see Figure 11 below), DREB2A and MYC2. Cells were plated on high-stringency media (SD-Trp/-Leu/-His, SD-Trp/-Leu/-His+12,5 AT, and SD-Trp/- Leu/-His+ 25AT) and incubated at 30°C for 3 days. We localised the minimal domain of ERF1 required for interaction with MED25 551-680 to amino acids 138-218 (see Figure 12 below). We also confirmed that the minimal domain of DREB2A required for interaction with MED25 551-680 is to amino acids 169–254 (see Figure 12 below), however I was unable to determine the minimum domain for MYC2 interaction as none of the three fragments that I tested were sufficient for MED25 interaction (data not shown).
Figure 10: Schematic representation of the ERF1 protein. (A) full protein 218 aa. (B) ERF1 1-138 and (C) ERF1 138-218, the two fragments used in the Y2H analysis. The green box represents the AP2/ERF binding domain while the red box represents the transcriptional activation domain (TAD- The EDLL motif).
36
X+Gal-filter-assay-- SC+LWH-12.5mM-3+AT-
(+ve) SC+LW-
MED25(ACID)-BD
1+138 ( - AD#ERF1(
138+218 ( - ERF1- AD#
1+168 ( - DREB2A- AD#
168+335 ( - DREB2A- X-Gal filter assay AD#
GFP+BD- MED25(ACID)+BD- GFP+BD- MED25(ACID)+BD- GFP+BD- Figure 11: The Y2H analyses of interaction between ACID domain of MED25 with the different MED25(ACID)+BD-
(+ve)- )- ve (+ )- ve (+ )- ve (+ )- ve (+ )- ve fragments of ERF1 and DREB2A Arabidopsis TFs. Only ERF1 138-218 and DREB2A 168-335 (+ fragments show positive results. Y2Hs were performed with SD-Leu-Trp as well as SD-Leu-Trp- His supplemented with 12.5mM 3-AT. Positive interactions were confirmed with an X-Gal filter lift assay.
.
2.4 Discussion
2.4.1 The role of ELLEL conserved motif for MED25 interaction
In this chapter, we examined the ability of Arabidopsis ERF transcription factors and ELLEL containing proteins to interact with the Mediator complex through MED25. In 2007, the Mediator complex was purified from Arabidopsis and identified as a new component of the transcriptional machinery (Bäckström et al., 2007). The Mediator complex plays a key role as a universal adaptor between the RNA polymerase II complex and gene-specific transcription factors to start transcription (Malik and Roeder 2005). In addition, there are various biological activities that the Arabidopsis Mediator complex has been discovered to control; including the abiotic and biotic stress response, regulating of the organisms growth and development as well as controlling flowering time and fertility (Kidd et al., 2011; Borggrefe and Yue, 2011; Mathur et al., 2011).
37
In agreement with this, the MED25 subunit has been shown to have a role in controlling plants development (Xu and Li, 2011) and flowering time (Cerdán and Chory, 2003; Wollenberg et al., 2008), but also in numerous abiotic and biotic stress responses (Kidd et al., 2009; Elfving et al., 2011). In recent studies the MED25 subunit has also been shown to physically interact with several key transcriptional regulators of the JA and ET defence signalling pathways by the ELLEL conserved motif (Cevik et al., 2012). Therefore, in the chapter of my study, we investigated whether a small subset of Arabidopsis proteins that contain the ELLEL conserved motif is able to interact with MED25 in yeast 2 hybrid (Y2H) experiments.
We initially chose four proteins to study, based on their reported roles in transcription. Two of the four candidate proteins (ERF14 and ERF96) belong to the subgroup IX family of AP2/ERF TFs that are well known for their role in plant pathogen defence (Camehl and Oelmüller, 2010). Both ERF96 and ERF14 have published roles in plant defence signalling (Catinot et al., 2015; Oñate-Sánchez et al., 2007), with ERF14 demonstrating a role in resistance against pathogens including Fusarium oxysporum (Oñate-Sánchez et al., 2007) as well as being involved in the beneficial interaction between Arabidopsis and Piriformospora indica (Nakano et al., 2006; Oñate-Sánchez et al., 2007). Previous research showed six members of the AP2/ERF subgroup IX interact with MED25 through the ELLEL conserved motif (Cevik et al., 2012). Therefore we hypothesised that these two proteins would also interact. However, the ELLEL motif of ERF14 has one amino acid different from the other members of group IX from the AP2/ERF TF family. Interestingly, it did not grow as strongly as the other related AP2/ERF ERF1 and ERF96 (Figure 10). This could potentially suggest that the binding of ERF14 to MED25 is either weak or transitory and may suggest that the ELLDL motif of ERF14 is not optimal for MED25 binding. Further experimentation on the proteins using in vitro binding studies or additional in planta transcriptional activation assays is needed to make firm conclusions about the interaction strength of the ERF14 motif. Additionally, further experiments, such as protein pull-downs or bimolecular fluorescence complementation experiments are required to verify that the proteins physically interact in vivo with each other through the ELLEL conserved motif. Interestingly, the MED25 ACID domain did not interact with AGL or RNA55. AGL (At4g24540) is a MADS-box TF that has a role in flowering time (Torti and Fornara, 2012), and RNA55 (At1g71280) is an uncharacterised DEA(D/H) box RNA helicase. We hypothesised that these might be good candidates to test for an interaction with MED25, given MED25’s role in transcription and flowering time. While a negative interaction in Y2H is not conclusive evidence of non-interaction, the results suggest that the ELLEL motifs in these proteins are not sufficient for interaction. Therefore either amino acids adjacent or within the ELLEL motif might be required or a
38 general topology of the surrounding protein may also play a role in interaction. These results are intriguing, given that just 24 aa of the ELLEL domain of ERF98 were shown to activate transcription when fused to a DNA binding domain (Tiwari et al., 2012). Further investigation of the key amino acids of this domain, such as the amino acid changes in ERF14 will potentially provide opportunities to modify a strong activation domain to a potentially weaker domain that could be attached to proteins of interest for fine-tuned expression in plants through the MED25 subunit of the Mediator complex.
2.4.2 Screening for protein’s fragments that interact with the conserved ACID domain in Arabidopsis MED25.
To further explore the transcriptional activation domain that interacts with MED25 we aimed to clone the minimum protein domains of different TFs (ERF1, DREB2A, and MYC2) to test their binding strength in vitro with MED25 purified from E. coli. We wished to determine the minimum protein domain necessary to assist future studies such as NMR heteronuclear single quantum coherence spectroscopy. To start this work we cloned fragments of the TFs for Y2H interaction. It was previously reported that the transcription activation domain of DREB2a is located to amino acids 254–335 (Sakuma et al., 2006) but the minimal domain required for interaction with MED25- ACID in Y2H assays is located to amino acids 168–254 ( Elfving et al., 2011). In a study done by Blomberg et al. (2012) they found that a fragment of DREB2a (residues 168–335; DREB2a 168– 335), which includes both the TAD and the MED25 interaction domain was required to bind MED25-ACID with a high affinity in vitro (Blomberg et al., 2012). Also Chen et al. (2012) have shown that the transcription activation domain of MYC2 is located to the residues 149–188 and required the full length of MED25 (Chen et al., 2012).
In the current study, we localised the minimal domain of ERF1 required for interaction with MED25-ACID to residues 138-218 (see Figure 12). We also confirmed that the minimal domain of DREB2A required for interaction with MED25-ACID is amino acids 169–254. These data support the finding by Blomberg et al. (2012). On the other hand, our result shows that the ACID domain of MED25 is not enough for MYC2 interaction as this TF required the full MED25 protein for its interaction, as stated by Chen et al. (2012). Our data also show that the AP2/ERF DNA binding domain of ERF1 is not required for its interaction with MED25, whereas the transcriptional activation domain (TAD-The EDLL motif) is important for interaction with MED25. More investigations using smaller fragments of ERF1, such as ERF1178-218 and ERF1195-218 are to be done
39 to confirm this result. Although the DREB2A1-168 fragment showed a positive result in the X-gal assay, there is no interaction between this sequence and MED25 (ACID) in the selective SC-LWH plates. The positive result may stem from ACID overexpression, and the SC-LWH+3AT result confirmed that (see Figure 12).
2.5 Conclusion In conclusion, the Y2H results suggest that the ELLEL conserved motif previously involved in transcriptional activation is important for interaction of ERF14 and ERF96 to MED25. Although the ELLEL conserved motif has been found in different proteins that belong to a variety of families, only members from the subgroup IXc AP2/ERF family can interact with the MED25 domain. Screening the other members of this family in the Y2H system will provide a framework to determine which variations of the ELLEL motif bind and which do not. Further investigation of this domain will potentially provide a strong activation domain that can attach to proteins of interest for high expression in plants through the MED25 subunit. Further studies in other key motifs in MED25 interaction could facilitate our knowledge of which motifs are required to control gene expression through the MED25 subunit.
In addition, our results showed that the nucleotide sequence corresponding to amino ERF1 138-218 appear to be the key domain for its interaction with Med 25. This sequence represents the conserved motif (CMIXc) from the IXc AP2/ERF family that previously has been reported for its importance in transcriptional activation. With the identification of the minimum region of the ERF1 TF, it is now possible to proceed to in vitro binding experiments. The interaction of TFs with Mediator subunits has generated significant interest with several papers analysing both human and Arabidopsis MED25 with TFs and viral activators (Vojnic et al., 2011; Milbradt et al., 2011; Blomberg et al., 2012; Aguilar et al., 2014; Sela et al., 2013). Recent studies have analysed MED25 interaction with DREB2A and MYC3 in vitro (Blomberg et al., 2012; Zhang et al., 2015), and interactions with ERF1 may assist in expanding our knowledge on how TFs from diverse families containing different secondary structures are able to interact with the same ACID domain of MED25. More investigation also needs to be performed in other members of the AP2/ERF super family to determine what the key amino acids are, required for their interaction with MED25 and other Mediator subunits.
40
3 Chapter IlI:
Identifying the role of MED18 and MED20 in conferring F.
oxysporum resistance
41 3.1 Introduction The Mediator complex plays an important role in plant defence and several plant Mediator subunits have been identified with altered hormone and pathogen signalling (Samanta and Thakur, 2015). For example, the MED25 subunit of the plant Mediator complex has been shown to be required for jasmonate-dependent defence gene expression and resistance to leaf-infecting necrotrophic fungal pathogens. A MED25 over-expressing line was found to be highly susceptible to F. oxysporum. Therefore, MED25 has a key role in modulating plant susceptibility to F. oxysporum (Kidd et al., 2009). As med25 mutants have reduced expression of defence genes, yet an increased resistance to F. oxysporum, it indicates that F. oxysporum hijacks non-defensive aspects of the JA-signalling pathway to cause wilt-disease symptoms that lead to plant death in Arabidopsis (Thatcher et al., 2009). Kidd et al. (2009) also pointed out that although the med8 mutant displayed no change in the expression of JA-associated marker genes, the double mutant med25 med8 exhibited additive resistance over the single mutations. To investigate whether other head domain subunits play a role in susceptibility to F. oxysporum, we investigated mutants in the head domain subunits MED18 and MED20.
MED8, MED18 and MED20 from the yeast Mediator head module have been shown to depend on each other for folding and complex formation (Shaikhibrahim et al., 2009). These subunitsbind to the yeast TATA binding protein and other general transcription factors (Plaschka et al., 2015)
In this chapter I investigated if there is interaction between these Mediator subunits in plants by using the methods of Y2H as well as Bimolecular Fluorescence Complementation (BiFC). I also studied the role of med18 and med20 mutants in F. oxysporum susceptibility. Our results show that there is an interaction between MED18 and MED20 suggesting that they interact within the plant Mediator complex, but no interaction was found with MED8. In addition, infection with F. oxysporum revealed that these two mutants have a high level of resistance compared to the WT and other F. oxysporum resistant Mediator subunits. I also conducted an RNA sequencing analysis of WT, med-18 and med-20 roots one-day post infection to identify root genes involved in defence against F. oxysporum. Overall, our results suggest a potentially novel mechanism for susceptibility to F. oxysporum that is conferred by the MED18 and MED20 genes.
42 3.2 Materials and Methods
3.2.1 Plasmid preparation To test the interaction between different plant Mediator subunits, the full length coding sequence of MED8, MED8N (MED8 N-terminal sequence), MED18, MED20a, MED20b, MED20c, MED21 and MED25 were amplified with primers listed in Table 3 from cDNA. The PCR products were cloned into the vector pCR8GW-TOPO according to the manufacturer’s instructions (Invitrogen). All plasmid constructs were confirmed by restriction analysis and sequencing. The bait constructs (BD-MEDs) were generated by LR recombination reaction with pCR8GW– MEDs and pDEST32. The prey constructs (AD-MEDs) were generated by LR recombination reaction with pDEST22 and each of pCR8GW–MEDs. The LR recombination reaction was done using Invitrogen Gateway® LR Clonase II Enzyme kit according to the manufacturer’s instructions.
Pure Yield TM Plasmid Miniprep System kit (Invitrogen) was used to purify the plasmids according to the manufacturer’s instructions. All plasmid constructs were confirmed by restriction analysis and sequencing.
3.2.2 Y2H screening To carry out Y2H screening of the MEDs in the prey constructs with the MED25 in bait constructs, I co-transformed both of the bait and prey plasmids into the yeast strain S. cerevisiae (MaV203) (Invitrogen) according to the S. c. EasyComp Transformation Kit system manual. The transformed reaction was then plated into two different plates, SC-Leu-Trp (SC_LW) plates (50 μL and 25 μL) and YPDA plates (10 μL and 1 μL). Selection of the positive clones was carried out on SC-Leu- Trp-His plates, SC- Leu-Trp-His with 12.5 mM 3-AT and SC- Leu-Trp-His with 25 mM 3-AT plates.
3.2.3 Filter lifting assay
The X-Gal filter assay was carried out on YPDA plats according to the protocol of Gietz et al.
(1997) with the exception of using 10.7 g of Na2HPO4x2H2O and 6.2 g of NaH2PO4x2H2O instead of 16.1 g of Na2HPO4x7H2O and 5.5 g of Na2PO4xH2O, respectively, in the Z-buffer solution. The filter papers were wrapped with a plastic wrap and incubated at 37ºC until colonies turned blue.
Table 4: List of primers that were used in amplification of the different Mediator subunits. F= forward primer, R= reverse primer.
43 Gene name Primer Primer
type 5’- -3’
MED8 F ATGGAGACAC AGCCGCAG R ACAAAGGCAC CAAAATCCTC AATAA MED8N F ATGGAGACAC AGCCGCAG R TTACTGCTGATTCGTCTGCATAT MED20a F ATGCCCGTCAAGTGGGTT R GTTCAAGCTGTGAGAGGCTAA MED20b F ATGCCCGTCAAATGGCTTT R ATTCAAGCTGGGAGAGGCTAA MED20c F ATGGAAATAGCAAGAAAAGTGATGG R GTTCAAGCTGTGAGTGGCTAA MED 21 F ATGGATATAATCTCACAGTTGCA R GAACATG AAGAAACCTGAATGA MED 18 F ATGTCAATGGAGTGTGTGGT R TTACAATGTAGTACCTCCTCCATC MED25 F ATGTCGTCGG AGGTGAAACA R GAGCTGGCTTCATGGGATA A
3.2.4 Bimolecular Fluorescence Complementation (BiFC) assay The full-length MED8, MED18, MED20 and MED21 genes were cloned into either pSAT5A DEST-cYFP-C1B (CD3-1097) or pSAT4A DEST-nYFP-C1 (CD3-1089) using LR recombination reaction (Invitrogen) with pCR8GW–MEDs. To carry out Yellow Fluorescent Protein (YFP) screening through infiltration, as the pSAT5-MEDs and pSAT4A-MEDs are not binary vectors, I cut the MED-nYFP and MED-cYFP constructs using NotI/AgeI sites and then ligated into pGreenII 0229. The resulting vectors were transformed into Agrobacterium tumefaciens AGL1. The infiltration of the constructs of interest was performed in Nicotiana benthamiana plants according to the established protocol (Voinnet et al., 2003). The infiltrated plants were kept in long day (16:8 h day:night regime) growth cabinets for 2 days before observation with the confocal microscope (Zeiss LSM700).
44 3.2.5 Plant growth and growth conditions The seeds of all Arabidopsis plant types used in this chapter were sown onto sterilised moist soil (UC mix) in a 30-cell seedling tray and kept at 4ºC in the dark for 48 h. After the stratification period, the trays transferred to the short day growth cabinets at 24ºC, with an 8 h photoperiod (160 µE m-2s-1) and humidity of around 60%, and 16 hours dark with temperature dropped to 21ºC and humidity of 70%. After 2 weeks, seedlings were separated, and grown until the six to eight leaf stage.
3.2.6 F. oxysporum inoculation Arabidopsis plants were inoculated with F. oxysporum as described previously (Edgar et al., 2006). Briefly, at 1 h after the start of the photoperiod (t = 0 h) the plants were gently uprooted and dipped for 15 s in fungal spore suspension with a concentration of 106 spores/mL in water and then replanted. Mock plants were dipped in water and replanted.
3.2.7 RNA sequencing experiment WT (Arabidopsis thaliana Col-0), med18 and med20 plants were used in this experiment. Root tissues were harvested at 24 h after F. oxysporum inoculation or a mock treatment (three independent biological replicates of twenty plants per genotype). Once the root samples were harvested, the root tissue was snap-frozen in liquid nitrogen. The total RNA was isolated and DNAse treated using an RNeasy Plant Mini kit (Qiagen) according to the manufacturer’s instructions. RNA integrity was confirmed using the Agilent 2100 bioanalyser system (Agilent Biotechnologies).
The RNA from F. oxysporum-infected samples was sent to the Australian Genome Research Facility (AGRF) for library preparation and RNA- sequencing. Messenger RNA was selected using Poly-A tail selection prior to preparation of 100 bp paired end read libraries. Sequencing was performed on an Illumina HiSeq 2000 system generating an average of 23 million paired end RNA- seq reads per sample. The initial analysis of RNAseq data was assisted by Jiri Stiller (bioinformatics support from CSIRO Plant Industry) and Brendan Kidd (UQ).
3.2.8 Root colonisation analysis med18, med20 and WT Arabidopsis plants were used in this experiment. At the age of three to four weeks, plants were inoculated with F. oxysporum and replanted (three independent biological replicates). Two days and three days post infection the plants were removed and washed carefully
45 with water to remove adhering soil particles. The root slides were observed under the confocal microscope (Zeiss LSM700) using a 488nm laser line.
3.2.9 Disease resistance assays with F. oxysporum To test whether the genes identified from the RNA-seq study play a role in defence against F. oxysporum, I obtained T-DNA insertion mutants for, PEN2, TGG1 and TGG2 from the ABRC stock center while the pen1pen2pen3 triple mutant was a kind gift from Mats Andersson. The seeds were previously characterised mutants and were confirmed for homozygosity by PCR. The pen mutants, for instance, are loss of function mutants due to a point mutation so I did not check for a change in expression by RT-Q-PCR.”
3.3 Results and Discussion
3.3.1 MED18 and MED20 interact with each other in plant To identify whether different subunits from the plant Mediator complex interact with each other within the plant Mediator complex, I used a bait composed of either MED8, MED8 N-terminus, MED18, MED20a, MED20b, MED20c, MED21 and Green Fluorescent Protein (GFP) in a two- hybrid screen with prey composed of either MED8, MED8 N-terminus, MED18, MED20a, MED20c, MED21 and GFP. Cells were plated on media (YPDA, SD-Trp/-Leu, SD-Trp/-Leu/- His+12,5 AT, and SD-Trp/-Leu/-His+ 25AT) and incubated at 30°C for three days. MED20a, MED20b and MED20c refer to paralogs according to the naming convention of Kim et al., (2011). Our results show that only colonies corresponding to MED18 and MED20a displayed positive results in the selected plates and also turned blue using the X-Gal assay on the YPDA colonies. However, no interaction was found between MED8 with either MED18 or MED20 (Figure 13). Previous studies in the yeast Mediator complex reported that these three subunits interact with each other (Gugliemi et al., 2004; Lariviere et al., 2006; Shaikhibrahim et al., 2009) and they have been shown to display similar pathogen and developmental phenotypes in Arabidopsis. Our result potentially suggests that MED18 and MED20 may form a subdomain within the Arabidopsis Mediator complex with roles distinct from that of MED8. MED20a, MED20b and MED20c refer to paralogs corresponding to the naming convention of Kim et al., (2011).
46 3.3.2 Bimolecular Fluorescence Complementation (BiFC) assay To confirm the interactions between MED18 and MED20, I carried out a BiFC analysis. I co- transformed the nYFP-MED18 with cCFP-MED20 or cCFP without MED genes into the leaves of N. benthamiana. The obvious fluorescence in the nuclei was observed in both combinations of nYFP-MED18 / cCFP-MED20 and nYFP-MED20 / cCFP-MED18 (Figure 14A and 14B), suggesting that MED18 interacts with MED20 in vivo. No interaction was observed in the negative control nYFP-MED18/ cCFP or nYFP-MED20/ cCFP (Figure 14C). As the Y-2-H and the X-GAL assays show negative result of MED8 interaction with either MED18 or MED20, we did not pursue it further.
3.3.3 med18 and med20 show different growth patterns to WT To compare the growth and development of our mutants with WT, I measured the rosette diameter of med18, med20 and WT plants before the F. oxysporum infection. There was a big difference in growth between the WT and our mutants (Figure 15). However, med18 and med20 show similar growth pattern. In addition, both mutants have thin and quite yellowish leaves compared to WT plants (Figure 15C). Furthermore, these mutants displayed a delay in flowering time, especially med20 with an increase in the number of leaves before flowering, as previously reported (Kim et al., 2011). These results therefore confirm the role of MED18 and MED20 in controlling flowering time. We initially expected that the pale green/yellowish leaves would lead to increased susceptibility in these mutants so we were surprised that they were almost immune. However the strong vein chlorosis phenotype induced by F. oxysporum is easily distinguished from the med18 and med20 leaves so it would not interfere with the detection of symptoms. We initially expected that the pale green/yellowish leaves would lead to increased susceptibility in these mutants so we were surprised that they were almost immune. However the strong vein chlorosis phenotype induced by F. oxysporum is easily distinguished from the med18 and med20 leaves so it would not interfere with the detection of symptoms. Nevertheless, more studies need to be carried out to test wether these phenotypes play a role in the resistance/susceptibility of MED18 and MED20 to F. oxysporum infection.
47 A DBD-MED8 AD-MED21 AD-MED18 AD-MED20 DBD-MED18 AD-MED21 AD-MED8 AD-MED20
DBD-MED20 AD-MED21 AD-MED18 AD-MED8
DBD-GFP AD-MED8 AD-MED18 AD-MED20
B C D E
YPAD SC-LW SC-LWH 12.5mM 3-AT SC-LWH 25mM 3-AT G GF H GH I HI I J
YPAD SC-LWH SC-LWH XGAL assay 12.5mM 3-AT 25mM 3-AT Figure 12: Y2H analyses of interaction between different Mediator subunits in Arabidopsis. (A) The order of colonies in B-E. (B & F) show the growth of yeast colonies in normal YPAD media. Only colonies corresponding to MED18 and MED20a showed positive results in the selected plates (D, E, G & H) and also turned blue in the X-Gal assay (I). The order of colonies in F, G, H & I are as following: 1&2: p22MED8+p32MED20a, 3&4: p22MED8N+p32MED20a, 5&6: p22MED8+p32MED20c, 7&8: p22MED8N+p32MED20c, 9&10: p22MED8+p32MED18, 11&12: p22MED8N+p32MED18, 13&14: p22MED8+p32MED21, 15&16: p22MED18+p32MED20c, 17&18: p22MED18+p32MED20a, 19&20: p22MED18+p32MED21, 21&22: p22MED18+p32GFP, 23&24: p22MED8+p32 GFP, 25&26: p22MED20a+p32 GFP, 27&28: p22MED21+p32 GFP. Y2Hs were performed with YPDA medium as well as SD-Leu-Trp-His
medium supplemented with 12.5 3-AT or 25 3-AT
48 A
B
C
Figure 13: The in vivo interaction between MED18 and MED20 subunits in the leaves of N. benthamiana. (A) nYFP-MED18 with cCFP-MED20. (B) nYFP-MED20 with cCFP-MED18. (C) nYFP-MED18/ cCFP (-ve). The image on the left hand side is the fluorescence channel and the right hand side is a transmitted light image of the leaf.
49 A
C
WT med18 med20
Figure 14: Growth and development characteristics of WT, med18 and med20. (A) The first two columns are WT plants. The 3rd and 4th columns show med18 data. The last two columns show med20 data. (B) Rosette diameter of WT, med18, med20. The y-axis indicates the plant size. The result shown is from three independent biological replicates, each containing a pool of 20 plants. (C) Both mutants have thin and quite yellowish leaves compared to WT plants.
50 3.3.4 med18 and med20 roots display reduced colonisation of a GFP-tagged F. oxysporum The soil-borne fungus F. oxysporum causes vascular wilts of a wide variety of plant species by directly penetrating roots and colonising the vascular tissue. To observe the invasive growth and colonisation of F. oxysporum in wild-type and mutants, I inoculated 4 week-old plants with the GFP-expressing F. oxysporum. 2-3 days after inoculation, roots were uprooted and gently washed before microscopy observation. The confocal microscope scan readily detected hyphae of the GFP- expressing F. oxysporum in the vascular tissue of WT roots. In contrast, less mycelial structures of the GFP-expressing F. oxysporum were observed within the med18 and med20 tissues (Figure 16). This observation suggests that the reduced colonisation of a GFP-tagged F. oxysporum in med18 and med20 might be the reason behind their resistance to F. oxysporum. Additional experiments using a GUS-transformed F. oxysporum showed similar reductions in root colonisation in med18 and med20 relative to the WT (B. Kidd unpublished). Inoue and co-workers (2002) have shown that the colonisation of F. oxysporum in tomato plants changes according to the days post infection. They found that from 1 to 3 dpi, F. oxysporum hyphae started to colonise the root surface, growing along the junctions of the epidermal cells and outlining the cell borders. By day 4, most of the root surface was covered with dense mycelium, and only the root tips remained free of infection. By 5 to 6 dpi, mycelial growth expanded to larger areas along the root, and hyphae had colonised the central cylinder and grew in the xylem vessels. During this time, hyphae also colonised the grooves of cortex cells on the tertiary and secondary lateral roots (Inoue et al., 2002). Future studies of different time points need to be performed to know when and where F. oxysporum pathogen spread is arrested in med18 and med20 roots.
51 A
B
C
Figure 15: Confocal images for the colonisation of a GFP-tagged F. oxysporum in different plants roots. (A) GFP-tagged F. oxysporum in the WT was clearly distinguishable from that of the med18 (B) and med20 (C), as it was found in more than 80% of WT roots, while med18( B) and med20(C) showed reduced colonisation of the GFP-tagged F. oxysporum.
3.3.5 MED18 and MED20 regulate similar gene sets in Arabidopsis To identify root genes that might be altered in med18 and med20 roots, I conducted an RNA sequencing experiment using WT, med18 and med20 roots harvested 1 day after infection with F. oxysporum. We chose this time point because we wanted to study the early defence response to F. oxysporum infection, given we had observed penetration into the xylem by 2 days post infection. Overall, according to the differential reads analysis by Cuffdiff, there were 1269 genes and 1818 genes in med18 and med20, respectively, that were differentially regulated by >2 fold and significantly (FDR p<0.05) compared to the WT. Comparing the med18 and med20 RNAseq reads
52 to each other identified only 48 genes to be significantly different between the two mutants (21 expressed higher in med20 and 27 expressed higher in med18) (Figure 17). Comparing the differentially expressed genes between WT and med18 or WT and med20 indicated a high ratio of co-regulated genes (Figure 18). Thus the RNAseq analysis suggests MED18 and MED20 regulate similar gene groups in Arabidopsis in response to F. oxsporum.
Figure 16: Venn diagram of differentially regulated genes between each Arabidopsis mutant and the WT. The blue circle displays differentially expressed genes between WT and med18 (709 expressed higher in WT and 560 expressed higher in med18), while the yellow circle represents genes that were differentially regulated between WT and med20 (1007 expressed higher in WT and 811 expressed higher in med20). Most differentially expressed genes are shared between med18 and med20. Therefore med18 and med20 have similar gene expression profiles.
53
A B
Figure 17: Genes induced or repressed in each Arabidopsis mutant and the WT at early time-points after F. oxysporum infection. (A) Genes that were significantly up-regulated greater than 2-fold by F. oxysporum infection in WT vs. either med18 or med20. (B) Genes that were significantly induced greater than 2-fold by F. oxysporum infection in mutant(s) vs. WT.
3.3.6 med18 and med20 display different responses to F. oxysporum infection compared to WT Arabidopsis plants To investigate the genes that were expressed differentially in each mutant compared to the WT, I performed Gene ontology (GO) term singular enrichment analysis (Zhou et al., 2010). Comparing genes that were significantly up-regulated greater than 2-fold by F. oxysporum infection in Arabidopsis roots of our samples, we found that around 622 genes were up-regulated in WT vs. either med18 or med20. Whereas only 483 genes were up-regulated in mutant(s) vs. WT (Figure 18). The genes induced in WT versus each mutant belong to numerous defences and stress related GO terms that were significantly enriched including: response to chitin, response to fungus, response to hormones (jasmonate and abscisic acid) and plant cell wall modification. Looking at the gene lists themselves, we found pattern triggered immunity (PTI) associated genes such as FLAGELLIN SENSITIVE 2 (FLS2), PLANT U-BOX 23 (PUB23) and MITOGEN-ACTIVATED PROTEIN KINASE 3 (MPK3) as being induced higher in the WT, in addition to other genes that associated with defence induction, such as the cell wall synthase-encoding genes (CESA4 and CESA8), the plant defensin genes PDF1.4 and PDF2.2, as well as PROPEP1, a gene which activates PDF1.2 and reactive oxygen species (ROS). Interestingly, amongst the genes induced in the WT compared with our two mutants we identified a number of JA-associated genes. The
54 induced JA-associated genes list include the JA-associated transcription factor-encoding gene MYC2, the JASMONATE ZIM DOMAIN (JAZ) repressor proteins; JAZ1, JAZ5, JAZ7, JAZ8 and JAZ10, JA biosynthesis genes ALLENE OXIDE SYNTHATSE (AOS), ALLENE OXIDE CYCLASE (AOC3), LIPOXYGENASE4 (LOX4), the galactolipase DONGLE, a JA-ile-hydroxylase (CYP94B3), SULFOTRANSFERASE 2A (ST2A) which acts specifically on 11- and 12-hydroxyjasmonic acid and VEGETATIVE STORAGE PROTEINS; VSP1 and VSP2 (Figure 19-21). While we cannot rule out that many of the JA genes seen in the RNAseq data may be induced by the wounding process that occured during the F. oxysporum inoculation process, we have previously shown that JA gene expression is higher in inoculated vs. mock infected roots (Kidd et al., 2009). Therefore the differential gene expression of JA-associated genes between either med18 or med20 and WT roots in the RNAseq experiment suggests that the Mediator subunits are required for maintaining normal JA responsive gene expression in processes such as wounding and F. oxysporum infection.
Although, there were a small number of significantly enriched GO terms in the list of genes induced in med18 compared to WT, the med20 compared to WT list includes high numbers of differentially expressed genes including those from the med18 enriched GO terms together with other GO terms relating to oxidative stress and biosynthetic processes (Figure 19-21). Expectedly, the GO terms associated with transcription and RNA regulation were enriched in the two mutants’ induced genes which suggests that mutation of MED18 and MED20 changes transcription. Thus several TFs are included amongst the differentially expressed genes. Other enriched GO terms included ion transport and multi–drug transport. One of the transporters significantly induced was PDR12, encoding a pathogen and defence hormone inducible ABC transporter (Campbell et al., 2003). However, we were unable to find induction of defence responsive gene expression in the med18 and med20 mutants that could explain the significant F. oxysporum resistance phenotype. Overall, the WT responds to F. oxysporum infection with induction of PTI and JA-associated gene expression, whereas the med18 and med20 mutants seem to be encumbered in the expression of these gene sets.
55 Top ten most significantly enriched GO terms For genes induced in the WT vs med18 or med20
Enriched%in%WT%vs%med18% Enriched%in%WT%vs%med20%
response%to%sFmulus% response%to%sFmulus% response%to%chemical%sFmulus% response%to%chemical%sFmulus% response%to%organic%substance% lipid%localizaFon% response%to%endogenous%sFmulus% response%to%stress% response%to%jasmonic%acid%sFmulus% response%to%organic%substance% response%to%stress% response%to%wounding% response%to%hormone%sFmulus% response%to%endogenous%sFmulus% response%to%chiFn% response%to%jasmonic%acid%sFmulus% lipid%localizaFon% response%to%external%sFmulus% response%to%abioFc%sFmulus% response%to%abioFc%sFmulus%
Figure 18: Top tenFairly%similar%lists%–%see%Excel%for%the%full%set% most significantly enriched GO terms for genes induced in Arabidopsis WT vs.
med18 or med20.
Figure 19: Top ten most significantly enriched GO terms for genes induced in med18 and med20 vs.
WT.
56
Figure 20: Proportion of plant processes identified by GO term enrichment analysis in WT compared to med18 or med20 in response to F. oxysporum infection in roots. (A) Biological functions terms that were upregulated in WT vs. med20 (B) Biological functions terms that were upregulated in WT vs. med18.
57 3.3.7 The role of glucosinolates in F. oxysporum resistance
One of the highest genes expressed in the WT compared to both med18 and med20 was the thioglucoside glucohydrolase known as TGG2. . Similarly, TGG1 was also highly induced in the WT compared to both mutants. TGG1 and TGG2 encode myrosinases that convert glucosinolates into toxic metabolites to combat herbivores. In addition, glucosinolate breakdown products play a role in defence against both leaf and root pathogens (Barth and Jander, 2006). To test whether glucosinolates play a role in defence against F. oxysporum, we obtained T-DNA insertion mutants for tgg1, tgg2, as well as pen2 and the triple mutant pen1/pen2/pen3 The three proteins PEN1, PEN2 and PEN3 (penetration-resistance) have been found to act as central components in cell wall- based defence against the non-adapted powdery mildew Blumeria graminis fsp. hordei (Bgh). A study found that loss of function mutations in any of the three PEN genes cause decreased hypersensitive cell death triggered by recognition of effectors from oomycete and bacterial pathogens in Arabidopsis (Johansson et al., 2014). PEN1 encodes a syntaxin that plays an important role in vesicle fusion in plant immunity (Collins et al., 2003), while PEN3 is a ATP binding cassette transporter (Stein et al., 2006). I then performed disease resistance assays with F. oxysporum. Disease was measured by visually assessing symptom development on the leaves at different time points post inoculation using a scale of 0–5 with 0 being asymptomatic and 5 being dead as described previously (Thatcher et al., 2012). At least 40 plants were assessed per line. Inoculation of the mutant tgg2 with F. oxysporum revealed a relatively small but additive increase in disease symptoms relative to the mutant tgg1 or WT (Figures 22A). By contrast, the triple mutant pen1/pen2/pen3 showed no significant difference in F. oxysporum survival however interestingly the single mutant pen2 was more susceptible (Figure 22B). At 17 days after inoculation, the increased susceptibility of pen2 single mutant was more evident, with a noticeable difference in the survival rate and overall vigor of the triple mutant pen1/pen2/pen3 compared with pen2 lines (Figure 22B). It is possible that PEN1 and PEN3 might have opposite roles to PEN2 in F. oxysporum resistance, however we consider this unlikely as its previously hypothesized thatPEN2 and PEN3 act in a similar pathway separate to PEN1. However it was shown that the triple pen mutant has significant additive effects when it comes to plant defence and the hypersensitive response (Johansson et al., 2014), so this may explain the difference in susceptibility between the pen2 and pen triple mutant. More studies on the role of these two mutants in plant susceptibility to F. oxysporum need to be undertaken. In both assays, tgg2 and pen2 showed increased disease symptoms relative to WT, which suggests that these two genes may play an important role in protecting the plant during F. oxysporum infection. However, given that the expression of TGG1
58 was reduced in the med18 and med20 mutants and this leads to increased susceptibility, these genes are therefore not responsible for the increased resistance observed in the med18 and med20 mutants.
In addition to TGG1 and TGG2, a number of other glucosinolate modulating genes were differentially regulated in the med18 and med20 gene sets. INDOLE GLUCOSINOLATE O- METHYLTRANSFERASE 5 and FLAVIN-MONOOXYGENASE that encodes a glucosinolate S- oxygenase were up-regulated along with MYB34/ATR1 encoding a transcription factor involved in activation of the tryptophan metabolic pathway upstream of glucosinolate production.
One of the most highly expressed genes in med18 and med20 relative to the WT was the cytochrome CYP79F1. CYP79F1 metabolises mono- to hexahomomethionine, resulting in both short- and long-chain aliphatic glucosinolates. Differential regulation of these genes suggests that glucosinolate profiles in med18 and med20 might be affected and may contribute to altered resistance to F. oxysporum. It has previously been shown that the tryptophan pathway is induced in response to root pathogens F. oxysporum and Verticillium longisporum (Kidd et al., 2009; Iven et al., 2012).
Despite up-regulation of the TRP pathway, Iven et al. (2012) did not find an increase in potentially antifungal glucosinolate breakdown products in the roots of V. longisporum infected Col-0 plants. However, indole-3-carboxylic acid and the phytoalexin, camalexin, which are derived from TRP metabolism were induced in response to infection, and camalexin was found to be induced to levels that could potentially inhibit V. longisporum growth. Therefore, metabolite profiling of both aliphatic and indole glucosinolates is required to assess their contribution to resistance in med18 and med20.
59 A 4 3.5
3
2.5 wt 2 tgg1
1.5 tgg2
disease score 1
0.5
0 day8 day12 day15
B 6
5
4 wt 3 pen2
pen1+2+3 2 disease score
1
0 day7 day10 day13 day17 day20
C
Figure 21: Disease symptoms and scores of tgg1, tgg2, pen2, pen1/pen2/pen3 plants after F. oxysporum infection. (A) The disease score of WT, tgg1 and tgg2 plants at 8, 12 or 15 days after F. oxysporum inoculation. (B) The disease score of WT, pen2 and pen1/pen2/pen3 plants at 7, 10, 13, 17 or 20 days after F. oxysporum inoculation. (C) Representative disease symptoms characteristic of the 0-5 scoring system.
60 3.4 Conclusion To sum up our results in this chapter, I present evidence that MED18 and MED20 interact with one another in the Arabidopsis Mediator complex and mutation of these genes present similar developmental and defence associated phenotypes. MED8, MED18 and MED20 interact in the yeast Mediator complex to form a sub domain in the head module and are thought to be dependent on each other for correct folding (Shaikhibrahim et al., 2009). We did not find an interaction with MED8 and either MED18 or MED20, however it is possible that the Arabidopsis MED8 protein is not correctly folding in yeast. Further work using co-immunoprecipiation might determine whether MED8 does interact with the Arabidopsis MED18-MED20 dimer. While the increased rosette and delayed flowering phenotypes are similar to the previously characterised med8 mutant, the F. oxysporum resistance of med18 and med20 is much stronger, suggesting that MED18 and MED20 are the primary subunits involved in conferring F. oxysporum susceptibility, and F. oxysporum susceptibility in med8 may be through preventing MED18 and MED20 from properly interacting with the Mediator complex. These results might suggest that MED18 and MED20 can partially interact with the Mediator complex in the absence of MED8. While further work is needed to properly assess the impact that removal of Mediator Head domain subunits such as MED18 and MED20 has on plant transcription, the results presented here confirm the role of MED18 and MED20 in controlling growth, development and flowering time and reveal a new role for MED18 and MED20 in susceptibility to F. oxysporum and controlling the expression of glucosinolate and JA-associated genes.
61
4 Chapter VI:
Gene expression profiling of JA, SA and ROS marker genes in
med18 and med20 mutants.
62 4.1 Introduction A vast array of microorganisms surround plant roots in the rhizosphere. These microorganisms can be either harmful or beneficial to plants (Whipps, 2001). Thus plants have developed basal resistance, also known as innate immunity. There are two layers of sophisticated surveillance basal resistance: pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector- triggered immunity (ETI) (Jones and Dangl, 2006). PAMPs include microbes’ cell wall components or specific pathogen proteins (such as bacterial flagellin). PTI is activated when PAMPs of potential dangerous pathogens have been recognised by PAMP receptors in plants (Nicaise et al., 2009). PAMP receptor activation leads to reactive oxygen species (ROS) production (Lamb and Dixon, 1997), activation of the MAPK signalling cascades which then leads to hormone production and defence gene expression (Nicaise et al., 2009), phytoalexins and increased ion flux.
In the previous chapter, the RNA-seq experiment identified numerous genes that play important roles in the expression of JA-associated genes and glucosinolate biosynthesis. In this chapter I studied the gene expression of JA, SA and ROS marker genes in med18 and med20 mutants in response against F. oxysporum as well as after hormone treatment using RT-Q-PCR. We hypothesised that increased SA signalling provides a better and earlier response to infection by this hemi-biotrophic pathogen through hypersensitive response (HR) and programmed cell death.
63 4.2 Methods:
4.2.1 Plant growth and growth conditions The growth condition remained the same as detailed in the previous chapter.
4.2.2 Methyl jasmonate, ethylene and salicylic acid treatment Methyl jasmonate (MeJA) treatment was performed by spraying a piece of cotton wool with MeJA in ethanol with a final concentration of 4 µM/L of air. The cotton was placed inside a sealed phytocon vessel containing the plants. Leaf tissues were collected after 24 hours for gene expression studies.
Salicylic acid (SA) treatment was performed by lightly and evenly spraying a solution of SA with a final concentration of 100 µM over plants. Leaf tissues were collected at 24 hours after spraying for gene expression studies.
Ethylene (ET) treatment was performed by injecting 20 mL of ethylene gas into each sealed 10 L phytocon vessel containing the plants.
4.2.3 F. oxysporum inoculation F. oxysporum inoculations were performed in the same manner as detailed in the previous chapter.
4.2.4 Primer design for RT-Q-PCR Primers were designed using Primer3. The software finds PCR primers for RT-Q-PCR by searching potential primer pairs against fixed parameters (Min Tm = 57, Max Tm = 63, optimum Tm = 60, Max primer length = 24, amplicon length =100-200, the remaining parameters are as per default). The selected primer pairs were checked by using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) for specificity. The primer pairs used in real time RT-Q-PCR are listed in Table 4.
64 Table 5: Primer pairs used in real time RT-Q-PCR. F= forward primer, R= reverse primer.
A
Gene name Gene ID Primer Primer type 5’- -3’
MYC2 At1g32640 F TCATACGACGGTTGCCAGAA R AGCAACGTTTACAAGCTTTGATTG JAZ1 At1g19180 F CGGTAGCTTTGGAGATCTGAG R TCACAAGGGAATAAACTCATGG JAZ2 At1g74950 F CCTCTGGGACCAAAGAAGAT R CCATAACTCGACCACCGTAG JAZ3 At3g17860 F TTTATGATTCAACCCGCAAA R CGACATGGAAACTGCGTTAG JAZ4 At1g48500 F CAATCTTTTATGCCGGTTCA R CGGTTTAGCATGAGGTCCAT JAZ5 At1g17380 F CACGTAGAGCTTCCCTCCAT R TGGGAGGATAACGATGATGA JAZ6 At1g72450 F GGAACGCATTGCAAGAAGA R GGAAGATGACTACCGTGTTGG JAZ7 At2g34600 F GACTTGGAACTTCGCCTTCTT R TCTGAGATTCTTGCTTTGGTTG JAZ8 At1g30135 F CAGCAAAATTGTGACTTGGAA R TGGATTTCCAGAACTGGTTG JAZ9 At1g70700 F CACAATCTTTTATGGCGGAAC R TCCAGTTTCACCTTTCAAACC JAZ10 At5g13220 F ATCTCGTTCGGTTCCGTCTA R ACAGTTCCCGAAACGAGTTC JAZ11 At3g43440 F TTTGGTGGGAGTTTTAGCGTA R TTGTCTCAGTGGCTTTAGCTG JAZ12 At5g20900 F GCTGCACAGCCATTTCCTA R CTCGAGGAATCGTTGAAGC PDF1.4 AT1G19610 F TTCCACTGAGATGATGGCGG R GTGAAGCACGTTCCCATCTC PDF2.2 AT2G02100 F AGGGTACATGCGTGAGTGC R CTGGTGCAGAAGCAACGAC
B ID Primer F Primer R
PR2 TACCTTGCCAAGTCCATCGG AACTGGGAACGTCGAGGATG
PR5 AATGTCAAGCTGGGGA AGGTGCTCGTTTCGTC
VSP2 GAAAACCATCTTTGGGAACG CGGTTTTGGAGTCGTATTGG
GST6 GGGTACTGACTCCAAGGTGC TAACCTTAGCCCAAGCAGGC
65 PR4 CGGACTACTGTTCTCCGACC ACGGCTTATCAGCATCCCAC
MPK3 TGCGCTTATTGACAGAGTTGC TTAGCTAAGGGCTGACGTGG
MPK6 GCGACTCTTAGCCATGGTGG CATAGCCGAACAAACGATGCC
RBOHD TTCGAGTGGTTCAAGGGAATAATG CGTACACACTCGTGCAATAATTGTG
AGGAAATGTACTTTCACTTTACATGTC ATTGTAATGGTGAGACGTCAGAACAG
RBOHB G
EX1 TCTGGTTTCCAGAGTTTCCTGC GATGAAATCCTTATCCACCCTTCC
CCTTAACCCATTCCCCACTAGTATTAT
OXI1 CCAAGAGATTTTTGCTGCAAGAC C
ZAT12 CCTAACAACGACGCTTTGTCG GTCCCATCGGAAACTCCACTC
HSFA4A CCAGGGCTTGCTTTGAACC GGTTCATCGGGAAAGAACTCG
HSF1 TCCCAGATACCACAATTGACACG TGAATGCCTCTGGAACATTCTTC
MDAR1 TTGGGTTCAAGGTGGTAAAGTGG TCGAGCTTTGGCGACTTTAGC
MDAR2 GGAAAGTGGTTGGAGCATTTTTAG CACTTCAAGGCTCTCAACAGAAGG
MDAR3 CTGAAGCCTGGTGAACTCGC GGTCGGATTGACTTCGAGGTC
DHAR1 CTCTGACAAACCCCAGTGGTTC CAACGATGACGTCGGAATCA
APX4 GCAACAGAGGCTGATCCAGAAG CCAATCCAACAGCAATGAACTTATC
CATALASE CGAGTTGCTAGTTTCTGTCCCAG
1 CGTGAAGCGTTTTGTTGAAGC
CATALASE TTCAGACGGCTTGCCAGC
2 CTATCCGACCCACGCATCAC
VTC2 GATGGCAGCAAATTCAACTTCAC GGCATGCAAGGGAAGAACTG
HSP17 TCATGAGGAGGTTTCGGTTGC CTCTCCTGAACTTTCGGCACC
4.2.5 RT-Q-PCR analysis Total RNA from roots for RT-Q-PCR analyses were isolated using the SV Total RNA Isolation Kit (Promega). The concentration and quality of the RNA were measured with a spectrophotometer (NanoDrop® ND-1000) and a 1% agarose gel, respectively. cDNA synthesis was performed with
66 0.2 µg root RNA in 8.7 µL, using the SuperScript™ III RT kit (Invitrogen) as follows. A total of 0.2 µL of 100 µM oligo-dT, 0.1 µL of 3 µg/µL random hexamers (Invitrogen) and 1 µL of 10 mM dNTPs were added to a final volume of 10 µL. The mixture was denatured at 65°C for 5 min followed by 2 min of chilling on ice. A total of 2 µL of 10x RT buffer, 4 µL of 25 mM MgCl2, 2 µL of 0.1 mM DTT (Invitrogen) and 1 µL (200 U/µL) SuperScriptTM III Reverse Transcriptase were added, followed by incubation at room temperature for 10 min. Tubes were then transferred to a PCR machine and incubated at 50°C for 50 min and 85°C for 5 min. The resulting cDNA was subsequently diluted to a final concentration of 20 ng/µL of input RNA for real time RT-Q-PCR.
Gene expression analysis by RT-Q-PCR was carried out in 384-well plates using an ePMotion automatic pipetting (Eppendorf epMotion 5075) robot and an ABI ViiA7 Sequence Detection System (Applied Biosystems). Each reaction contained 5 µL of SYBR green and 1 µL of 3 nM of each gene-specific primer pair and 4 µL of cDNA template to a final volume of 10 µL. The ViiA7 cycling conditions were as follows: 50°C for 2 min, 95°C for 10 min, then 40 cycles of: 95°C for 15 s, 60°C for 1 min.
The PCR primer efficiency (E) of each primer pair in each individual reaction was calculated from the changes in fluorescence values (∆Rn) of each amplification plot, using LinReg PCR software (Ramakers et al., 2003). E values for each gene were averaged across all samples, except in cases where linear regression of amplification plots yielded a R2 value of less than 0.99, in which case the derived E value for that sample was omitted from the calculation of mean E value. Amplification plots were analysed using a threshold of 0.20 to give a cycle threshold (Ct) value for each gene and cDNA combination. Gene expression levels relative to the Arabidopsis housekeeping genes β- ACTIN 2 (At3g18780), β-ACTIN 3 (At3g53750) and β-ACTIN 7 (At1g49240) were calculated for each cDNA sample using the following equation: Gene transcript levels relative to actin = (E gene^(-Ct gene)) / (E Actin ^(-Ct Actin)). Three biological replicates and three technical replicates were assessed per sample.
4.2.6 DAB Staining Detection of hydrogen peroxide was conducted using 3,3’-Diaminobenzidine (DAB) from Sigma- Aldrich. Briefly, plants were inoculated with F. oxysproum spore suspension and the root tissues were collected and mixed with 1 mL of the DAB liquid buffer solution with 30 µL of DAB liquid chromogen. After staining, the plant tissues were rinsed with distilled water 5 times and then observed under a microscope (Olympus BX60F5).
67 4.3 Results
4.3.1 JA signalling genes show altered expression in Arabidopsis med18 and med20 roots To independently confirm the results of RNAseq analyses, I performed real-time reverse transcriptase quantitative PCR (RT-Q-PCR) on JA-associated genes that were differentially expressed in the RNAseq experiment. Since the JAZ genes were found to be down-regulated in both mutants (med18 and med20), we chose to investigate the expression of these genes as well as the other members of the JAZ family.
The result illustrates that generally the expression of JAZ genes was higher in WT roots than med18 and med20 mutants (Figure 23). Some JAZ genes that were not identified in the RNAseq experiment, such as JAZ6 and JAZ9, were found to have reduced transcript abundance in the mutants. Furthermore, JAZ3, JAZ11 and JAZ12 had potentially higher expression compared with the WT in the med20 mutant (Figure 23). MYC2 and two defensins PDF1.4 and PDF2.2 which were identified in the RNAseq data to have reduced transcript abundance also had lower expression in the mutants compared to WT using RT-Q-PCR. Therefore these results confirm the differential expression for these genes noted from the RNAseq results. Lai et al. (2014) found increased expression of the JA/ET marker gene PDF1.2 in med18, however we could find no significant difference in PDF1.2 expression under our conditions (Davoine et al., 2015, submitted). However we did observe decreased MYC2 expression in med18 and med20 and decreased expression of MYC2 target genes, such as VSP1, VSP2, ATR1 and the JAZ genes (Dombrecht et al., 2006; Thines et al., 2007). Overall, these results suggest that some aspects of JA signalling are reduced in the med18 and med20 mutants. Given the role of JA in promoting F. oxysporum susceptibility, reduced JA signalling may be the cause of F. oxysporum resistance in these mutants. The RNA-seq and GO analysis were only performed on the infected samples. The mock samples have not been sequenced. Therefore there is a significant difference in JA gene expression between the mediator mutants and the WT, however no change between mock and infected samples was seen in by RT-Q-PCR.
4.3.2 SA pathway associated genes show high expression in Arabidopsis med18 and med20 roots Given the reduced expression of JA-associated genes, I looked at the expression of SA pathway- associated defence genes in F. oxysporum-infected med18 and med20 roots. Interestingly, med20 F. oxysporum infected roots showed a significant induction of SA-associated marker genes compared
68 to WT (Figure 24). RT-Q-PCR data showed that SA marker genes PR1 and PR2 were expressed significantly higher in the med20 mutant compared to WT and med18, whereas, PR5 appeared to be induced in both med18 and med20 (Figure 24). Therefore, the heightened expression of SA- associated marker gene PR5 could potentially contribute to the increased resistance of the mutants to F. oxysporum.
4.3.3 MeJA, ET and SA treatment of med18 and med20 leaf tissue
To examine how med18 and med20 mutants may be generally affected in hormone signalling, we also looked at how defence genes may be altered in the med18 and med20 mutants compared to WT plants with and without exogenous hormone treatment. The expression of a number of JA, ET and SA-associated marker genes was examined after treatment with either MeJA, ET or SA, respectively. Interestingly, RT-Q-PCR experiments in the leaves showed an increase in the transcript abundance of the SA-associated gene PR1 in both med18 and med20. Although med20 F. oxysporum infected roots showed a greater induction of PR5 (Figure 24), the expression of this gene in SA treated leaves was equivalent to that of the WT-SA treated samples (Figure 25A). By contrast, SA-associated marker genes PR1 and PR2 showed higher expression levels in med18 mutants in response to SA treatment (Figure 25A). Therefore, the effect of med18 and med20 on SA-associated PR gene expression is different in leaf tissue when treated with exogenous hormones. Separate experiments on the roots with exogenous hormone treatment should be studied in the future to determine the role of MED18 and MED20 in SA signalling.
We also investigated whether JA and ET-responsive defence genes showed any differential expression in the med18 mutant in the leaf tissue after hormone treatment. Interestingly, while JAZ gene expression was attenuated in leaf tissue, MYC2 expression was not reduced significantly in med18 leaves, relative to the WT (Figure 25B). Overall, it is likely that a reduction in JA-responses in med18 may be providing an increased tolerance to F. oxysporum, as is seen with the coi1 mutant (Thatcher et al., 2009), however these results also suggest that MED18 and MED20 regulate different gene sets in the roots and shoots.
We also looked at gene expression after ET treatment, however we could not find significant changes in the expression level of JAZ1, JAZ2, JAZ5, JAZ7, JAZ8, JAZ9, JAZ10, JAZ11, JAZ12 as well as PDF1.4 and PDF2.2 (data not shown). Given that we did not find any significant change in
69 expression in PDF1.2, other ET-associated genes will have to be investigated in the med18 and med20 mutant.
4.3.4 med18 and med20 show higher expression of ROS related genes
Reactive oxygen species (ROS) are produced in plant cells in response to diverse biotic and abiotic stresses as well as during normal growth and development. To investigate more the reason behind resistance to F. oxysporum in med18 and med20 mutants, I conducted RT-Q-PCR expression analyses of selected ROS-responsive genes. As shown in Figure 26 several ROS and stress associated genes were upregulated, particularly in med20. Genes induced higher in med20 after F. oxysporum infection included those encoding the ROS producing RESPIRATORY BURST OXIDASE HOHMOLOGS, RBOHB and RBOHD, the ROS scavenging enzymes MONODEHYDROASCORBATE REDUCTASE1 and MONODEHYDROASCORBATE REDUCTASE3, and VITAMIN C DEFECTIVE2. Also induced were the genes encoding the ROS responsive marker OXIDATIVE SIGNAL INDUCIBLE1 (Petersen et al., 2009) and MAP KINASE6. OXI1 is a positively regulator for ROS production, and activation of OXI1 is required for dual activation of MAPK3 and MAPK6 (Rentel et al., 2004). MAPK3 however was not differentially regulated in either of the mutants. Also, the gene encoding HEAT SHOCK FACTORA4A, (HSFA4A) was upregulated in med20, however HSF1 was not (Figure 26). HSFA4A is a oxidative stress inducible HSF and has been suggested to be a target of MAPK3 and MAPK6 phosphorylation (Pérez-Salamó et al., 2014).
Genes induced in both mutants included ROS scavenging genes such as CATALASE genes (CAT1 and CAT2) MONODEHYDROASCORBATE REDUCTASE2, and DEHYDROASCORBATE REDUCTASE1. Also induced in both mutants was EXECUTER1 (EX1) which is a plastid gene that is required for singlet oxygen mediated cell death (Lee et al., 2007). While stronger gene expression patterns were seen in med20 root tissues, overall, the up-regulation of CATALASE, DHAR1 and MDAR2 genes in both mutants support the increased ROS production observed in med18 and med20 roots. This may also explain the leaf bleaching phenotype that is observed in the leaves after F. oxysporum infection. It is interesting to find that these genes were up regulated in med18 and med20 F. oxysporum treated roots, suggesting that ROS responses to F. oxysporum are up-regulated in med18 and med20 mutants and that this may have contributed to the increased resistance observed for these mutants. The hypothesis is that med18 and med20 mutants have higher ROS production under control conditions and the accumulation of ROS through normal development
70 leads to less chlorophyll, and pale yellowish leaves. ROS levels may increase further in response to infection and have a positive effect on F. oxysporum resistance, however future work will need to confirm this experimentally.
4.3.5 ROS production in the roots
Activation of SA defence genes can often be associated with increased ROS production and stress responses in plants. To investigate and compare the involvement of ROS in F. oxysporum infection in the WT, med18 and med20, I undertook DAB staining experiments to detect local ROS production in the root. After 2 days inoculation with F. oxysporum, Arabidopsis seedlings showed strong accumulation of fungal growth around the root tip regions as previously identified (Czymmek et al., 2007; Kidd et al., 2011). Our results show that med18 and med20 roots produced more ROS in response to F. oxysporum infection. Despite large amounts of F. oxysporum hyphae surrounding the WT root, ROS production was barely detected in WT roots at this time point (Figure 27). This suggests that in med18 and med20 ROS is activated more strongly in the root during F. oxysporum infection compared to WT.
71 MYC2 JAZ1 c 1.000 2.5 a a 0.800 2 a b 0.600 a 1.5 b b b b b 0.400 ab 1 0.200 0.5 0.000 0 relative abundance to actin actin to abundance relative wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 relative abundance to actin actin to abundance relative MOCK INFECTED MOCK INFECTED
JAZ2 JAZ3 b b b 0.100 ab ab 5.000 ab 0.080 ab a 4.000 a a 0.060 3.000 a a 0.040 2.000 0.020 1.000 0.000 0.000 relative abundance to actin actin to abundance relative
relative abundance to actin actin to abundance relative wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 MOCK INFECTED MOCK INFECTED
JAZ4 JAZ5 a 0.004 a 0.400 ac ab ab 0.003 bc 0.300 bc bc c 0.002 0.200 b b b 0.001 0.100 0.000 0.000 relative abundance to actin actin to abundance relative relative abundance to actin actin to abundance relative wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 MOCK INFECTED MOCK INFECTED
JAZ6 JAZ7 c 0.300 a 0.600 0.250 ac 0.500 0.200 cb 0.400 a 0.150 b 0.300 b b ab 0.100 0.200 b b b 0.050 0.100 0.000 0.000 relative abundance to actin actin to abundance relative
wt med18 med20 wt med18 med20 actin to abundance relative wt med18 med20 wt med18 med20 MOCK INFECTED MOCK INFECTED
72 JAZ8 JAZ8 JAZ9 JAZ9 a" a" 0.200" 0.200" 0.020" a" 0.020" a" 0.150" a" 0.150" a" 0.015" 0.015" b" b" c" c" 0.100" 0.100" 0.010" 0.010" b" b" b" b" b" 0.050" b" b" 0.050" b" b" 0.005" b"b" b" 0.005" b" b"
0.000" 0.000" 0.000" 0.000" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" wt" med18"med20" wt" med18"wt"med20"med18"med20" wt" med18"wt" med20"med18"med20" wt" med18"med20"wt" med18"med20" wt" med18"med20" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" MOCK" INFECTED" MOCK" INFECTED"MOCK" INFECTED" MOCK" INFECTED"
JAZ10 JAZ10 JAZ11 JAZ11
0.200" 0.200" a" 0.050" 0.050" a" cd" d" cd" d" 0.150" c"0.150" 0.040"c" 0.040" bc" bc" 0.030" b" 0.030" b" 0.100" 0.100" a" ab" a" ab" 0.020" 0.020" b" b" 0.050" b" b" 0.050" b" b" b" b" 0.010" 0.010" 0.000" 0.000" 0.000" 0.000" wt" med18"med20" wt" med18"wt"med20"med18"med20" wt" med18"wt" med20"med18"med20" wt" med18"med20"wt" med18"med20" wt" med18"med20" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" MOCK" INFECTED" MOCK" INFECTED"MOCK" INFECTED" MOCK" INFECTED"
JAZ12 ab" JAZ12 ab" PDF2.2 PDF2.2 " " 0.120" 0.120" 2.500" a" 2.500" a" " b" " b" 0.100" 0.100" " 2.000" " 2.000" 0.080" ab" ab" 0.080" ab" ab" a" a" a" a" a" 1.500"a" 1.500" 0.060" 0.060" 1.000" 1.000"b" b" 0.040" 0.040" b" b" b" b" b" b" 0.020" 0.020" 0.500" 0.500" 0.000" 0.000" 0.000" 0.000" wt" med18"med20" wt" med18"wt"med20"med18"med20" wt" med18"wt" med20"med18"med20" wt" med18"med20"wt" med18"med20" wt" med18"med20" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" MOCK" INFECTED" MOCK" INFECTED"MOCK" INFECTED" MOCK" INFECTED"
PDF1.4 PDF1.4 ATGRXS13 ATGRXS13 a" 0.050" a" 0.050" a" a" a" 2" a" 2" 0.040" 0.040" a" a" b" 1.5" a" b" 1.5" a" 0.030" b" 0.030" b" b" b" 0.020" 0.020" 1" 1" b" b" 0.010" 0.010" 0.5" 0.5" 0.000" 0.000" wt" med18"med20" wt" med18"med20"wt" med18"med20" wt" med18"med20" 0" 0" rela;ve"abundance"to"ac;n"" rela;ve"abundance"to"ac;n"" MOCK" INFECTED" MOCK" INFECTED"wt" med18" med20"wt" med18" med20"
Figure 22: RT-Q-PCR data for different JA associated genes in Arabidopsis WT, med18 and med20 roots with and without F. oxysporum infection. Results were obtained from three independent biological replicates and three technical replicates; oneway ANOVA, LSD significant difference test (a,b,c&d) indicates p-value < 0.05; error bars represent standard deviation of the biological replicates.
73
PR1 PR2 2 1.600 b b 1.400 1.200 1.000 1 ab 0.800 0.600 0.400 a a a a a 0.200 a a a a relative abundance to actin actin to abundance relative 0 relative abundance to actin actin to abundance relative 0.000 wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 MOCK INFECTED MOCK INFECTED
0.300 PR5 0.250 b 0.200 b 0.150 0.100 0.050 a a a a
relative abundance to actin actin to abundance relative 0.000 wt med18 med20 wt med18 med20 MOCK INFECTED
Figure 23: RT-Q-PCR data of SA related genes in WT, med18 and med20 roots with and without F. RT-Q-PCR data of SA related genes in WT, med18 and med20 roots with and without F. oxysporumoxysporum infection. infection. Results Results were obtained were obtained from from three three independent independent biological biological replicates replicates and three technical three replicates; technical oneway replicates; ANOVA, oneway ANOVA, LSD significant LSD significant difference difference test (a&b)test (a&b indicates) indicates p -pvalue- < value < 0.05; error bars represent standard deviation of the biological replicates. 0.05; error bars represent standard deviation of the biological replicates.
74 A
PR1 PR2
12 b 0.900 b 11 b 0.800 10 9 0.700 8 0.600 7 0.500 6 0.400 5 a 4 0.300 a a 3 0.200 a a 2 1 a a a 0.100 a relative abundance to actin actin to abundance relative relative abundance to actin actin to abundance relative 0 0.000 wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 MOCK SA MOCK SA
PR5
0.900 b 0.800 0.700 0.600 ab ab 0.500 0.400 0.300 a a 0.200 a 0.100
relative abundance to actin actin to abundance relative 0.000 wt med18 med20 wt med18 med20 MOCK SA
RT-Q-PCR data for hormone associated genes in WT, med18 and med20 leaves after SA treatment.; oneway ANOVA, LSD significant difference test (a&b) indicates p-value < 0.05
75 B JA and ET
MYC2 2 JAZ1 JAZ2 0.400 0.800 1.5 0.300 0.600 1 0.200 0.400 0.5 * 0.100 0.200 0 0.000 0.000 wt med18 wt med18 wt med18 wt med18 relative abundance to actin to abundance relative
wt med18 wt med18 actin to abundance relative relative abundance to actin actin to abundance relative JA ET JA ET JA ET
JAZ5 2.000 JAZ6 JAZ4 3.000 0.080 1.500 0.060 2.000 1.000 0.040 1.000 0.500 0.020 0.000 0.000 0.000 relaDve abundance to acDn wt med18 wt med18 relaDve abundance to acDn wt med18 wt med18 wt med18 wt med18 relaDve abundance to acDn JA ET JA ET JA ET JAZ7 JAZ8 JAZ9 2.000 1.000 3.000
1.500 2.000 0.500 1.000 1.000 0.500 0.000 0.000 relative abundance to actin actin to abundance relative relative abundance to actin actin to abundance relative relative abundance to actin actin to abundance relative 0.000 wt med18 wt med18 wt med18 wt med18 wt med18 wt med18 JA ET JA ET JA ET JAZ10 JAZ11 JAZ12 0.250 6.000 5.000 0.200 5.000 4.000 0.150 4.000 3.000 3.000 0.100 2.000 2.000 0.050 1.000 1.000 0.000 0.000 0.000 relaDve abundance to acDn
wt med18 wt med18 relaDve abundance to acDn wt med18 wt med18 wt med18 wt med18 relaDve abundance to acDn JA ET JA ET JA ET
Figure 24: RT-Q-PCR data for hormone associated genes in WT, med18 and med20 leaves after MeJA, ET or SA treatment. (A) SA associated genes in WT med18 and med20 leaves after SA treatment; oneway ANOVA, LSD significant difference test (a&b) indicates p-value < 0.05 (B) JA and ET associated genes in WT med18 and med20 leaves after MeJA or ET treatment; asterisk (*) indicates p-value < 0.05 according to Student’s T test. RT-Q-PCR was performed using three independent biological replicates and three technical replicates; error bars represent standard deviations of the biological replicates.
76 RbohB 0.600 c b 40 RbohD
0.400 bc 30 ab
ab 20 0.200 a a a 10 a a a a 0.000 0 wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 rela%ve abundance to ac%n MOCK INFECTED rela%ve abundance to ac%n MOCK INFECTED
10.000 c 8.000 CAT1 b CAT2
6.000 b b 5.000 4.000 2.000 a a a a a a a a 0.000 0.000 wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 rela%ve abundance to ac%n rela%ve abundance to ac%n MOCK INFECTED MOCK INFECTED MDAR1 MDAR2 b 150.000 15.000 b b 100.000 ab 10.000 50.000 a a a a 5.000 a a a a 0.000 0.000 wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 rela%ve abundance to ac%n
rela%ve abundance to ac%n MOCK INFECTED MOCK INFECTED
2.000 MDAR3 b 0.600 APX4 b 1.500 ab 0.400 b 1.000 0.200 0.500 a a a a a a a a 0.000 0.000 wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 rela%ve abundance to ac%n rela%ve abundance to ac%n MOCK INFECTED MOCK INFECTED
MPK3 2.000 MPK6 b b b 5.000 b 1.500 4.000 ab 3.000 ab 1.000 2.000 ab a a 1.000 0.500 a a a 0.000 wt med18 med20 wt med18 med20 0.000 rela%ve abundance to ac%n rela%ve abundance to ac%n wt med18 med20 wt med18 med20 MOCK INFECTED MOCK INFECTED
77 HSFA4A b 8.000 HSF1 10.000 ab 6.000
5.000 4.000 ab a ab a 2.000 a a a a a a 0.000 0.000 wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 rela%ve abundance to ac%n
MOCK INFECTED rela%ve abundance to ac%n MOCK INFECTED
6.000 30.000 DHAR1 b EX1 b b 4.000 20.000 b 10.000 2.000 a a a a a a a a 0.000 0.000
rela%ve abundance to ac%n wt med18 med20 wt med18 med20 wt med18 med20 wt med18 med20 rela%ve abundance to ac%n MOCK INFECTED MOCK INFECTED
0.300 b OXI1 b VTC2 0.800 0.600 0.200 a 0.400 0.100 a 0.200 a a a a a a a a 0.000 0.000 wt med18 med20 wt med18 med20 rela%ve abundance to ac%n wt med18 med20 wt med18 med20 rela%ve abundance to ac%n MOCK INFECTED MOCK INFECTED
b 100.000 ZAT12
50.000 ab a a a a 0.000 wt med18 med20 wt med18 med20
rela%ve abundance to ac%n MOCK INFECTED
Figure 25: RT-Q-PCR data of ROS-related genes shown as the different relative abundance in WT, med18 and med20 Plants. Results were obtained using three independent biological replicates and three technical replicates; error bars represent SD of three independent biological replicates.
78 4.4 DAB staining
WT roots
med18
med20
Figure 26: DAB staining of WT, MED18 and MED20 roots. The roots were inoculated by F. oxysporum, and the increase production of ROS in med18 and med20 roots can be seen compared to WT roots by darker DAB staining.
79 4.5 Conclusions The aim of this chapter was to unravel the cause of F. oxysporum resistance in med18 and med20 mutants. The colonisation of F. oxysporum in the roots of these two mutants was found to be less extensive than for the WT. JA pathway genes were reduced in the RNAseq experiment. Here we confirmed the role of med18 and med20 in JA signalling, as MeJA treated leaves of med18 and med20 showed decreased expression of JA related genes compared to WT. In contrast, med18 and med20 leaves exhibited increased expression of SA marker genes after SA treatment. Moreover, RT-Q-PCR analysis on ROS-related genes as well as DAB staining in these two mutants’ roots indicated increased production of ROS in F. oxysporum infected roots. We propose that med18 and med20 mutants provide a strong ROS response to infection by this hemibiotrophic pathogen that might restrict the pathogen from colonising med18 and med20 roots.
80
5 General conclusions
81 Since the purification of the Mediator complex from A. thaliana in 2007, investigation into individual subunits of the Mediator complex has revealed diverse roles spanning plant development to abiotic and biotic stress responses. In this thesis I have studied three subunits MED25, MED18 and MED20 that have been identified to have a role in conferring susceptibility against F. oxysporum. While the role of MED18 in resistance against Botrytis cinerea has recently been published (Lai et al., 2014), the mechanism of conferring susceptibility to F. oxysporum by MED18 and MED20 was completely unknown. MED25 has been shown to interact with several JA- associated TFs to control JA-associated transcription. I investigated these interactions further and characterised the minimum domains of the TFs needed for interaction. I also looked to identify new proteins that might interact with MED25 based on the TF interaction motifs. Our results showed that the nucleotide sequence corresponding to amino acids ERF1 138-218 appear to be the key domain for its interaction with MED25. This sequence represents the conserved motif (CMIX) from the group IX AP2/ERF family. In addition, the Y2H results suggest that the ELLEL conserved motif previously involved in transcriptional activation could also be important for interaction of ERF14 and ERF96 with MED25. Although the ELLEL conserved motif has been found in different proteins in A. thaliana that belong to a variety of families, only members from the IXc AP2/ERF family can interact with the MED25 ACID domain. Mutational screening of the members of this family in the Y2H system will provide a framework of which variations of the ELLEL motif bind and which do not. Further investigation of this domain will potentially provide a strong activation domain that can attach to proteins of interest for high gene expression in plants through the MED25 subunit. Further study in other key motifs in MED25 interacting TFs could facilitate our knowledge of which motifs are required to control gene expression through the MED25 subunit and how they interact with the ACID domain. Of particular interest is how diverse proteins can bind to the same interaction site, and whether there are common amino acids required for this interaction.
In addition to studying the MED25 subunit interaction with TFs, this project also investigated the interaction of other subunits from the Mediator complex, as well as their response to F. oxysporum infection. By conducting Y2H, followed by BiCF assays, our results show an interaction between the two Mediator subunits, MED18 and MED20a that share similar phenotypes and function, but not with the MED8 subunit within the Mediator complex. This result suggests that MED18 and MED20 may form a subdomain within the Arabidopsis Mediator complex with roles distinct from that of MED8.
The med18 and med20 mutants were found to display a very strong resistance to F. oxysporum infection, stronger than either med25 or med8 and this was similar to the previously identified coi1
82 mutant (Thatcher et al., 2009). Using the data from the RNAseq analysis experiment, the project identified the types of processes that are induced or repressed in the med18 and med20 mutants compared to WT during F. oxysporum infection and investigated their role in providing resistance or susceptibility. From this analysis, it was revealed that JA responsive genes as well as numerous defence and stress responses were higher in the WT compared to the med18 and med20 mutants. On the other side, the two mutants showed increased expression of SA-associated marker genes. Consequently, the increased SA and increased ROS production could potentially contribute to the increased resistance of the mutants to F. oxysporum. The RNAseq analysis also suggests that MED18 and MED20 regulate similar gene groups in Arabidopsis. A similar finding was found in the yeast Mediator complex, with med18 and med20 mutants also having similar gene expression patterns (Larivière et al., 2008).
Our investigation aimed to identify the cause of resistance in med18 and med20 mutants. The observation of root colonisation after F. oxysporum treatment demonstrated reduced colonisation of analysis on ROS related genes as well as DAB staining in the mutant roots indicated high production of ROS that may lead to a fast activation of the defence response in med18 and med20 plants toward F. oxysporum infection. However, more investigation into the PAMP and ROS response of med18 and med20 need to be performed to determine the key processes behind med18 and med20 resistance to F. oxysporum infection. Also as we only investigated in this project the early response of these mutants to F. oxysporum infection, future experiments at several infection stages will provide a better picture of the resistance process.
Nevertheless, med18 and med20 infected roots showed a remarkable reduction in the expression of JA-associated genes. These genes not only affect the JA-accumulation such as AOS, AOC3, LOX4, DONGLE, and a JA-ile-hydroxylase as but also, the JA-signalling genes such as MYC2 and the JAZ genes. Our results propose that MED18 and MED20 play a role in the regulation of JA signalling in Arabidopsis. However, more investigation is needed to determine how disruption of MED18 and MED20 affects JA signalling and whether MED18 and MED20 can interact with MYC2 similarly to MED25 (Cevik et al., 2012).
The RT-Q-PCR analysis revealed that PR1 and PR5 were significantly expressed in med18 and med20 after treatment with SA and F. oxysporum respectively. It is generally agreed from previous researches that there is antagonistic interactions between JA- and SA-associated defence pathways, therefore these result are in line with these findings. Moreover, our result showed that the expression of EX1, and OXI1 (singlet oxygen stress responsive genes) together with the expression
83 of ROS scavenging genes such as CAT1 and the ascorbate reductases in med18 and med20 were up- regulated compare to the WT. Recent studied have shown that OXI1 and EX1 to regulate singlet oxygen mediated cell death through independent pathways (Lee et al., 2007; Shumbe et al., 2016). Jasmonate has also shown to have a major role in singlet oxygen mediated cell death through research into the flu and ch1 mutants (reviewed by Laloi and Havaux et al 2015). Thus, It may be suggest that both JA signaling and singlet oxygen stress signaling is controlled through the Mediator complex via MED18 and MED20 or alternatively, mis-regulation of the JA pathway in med18 and med20 leads to defects in ROS production and tolerance. Further study need to be done to understand how the interactions of MED18 or MED20 subunits with other Mediator subunits or with other transcriptional regulators work to produce these phenotypes.
Apart from being more resistant to F. oxysporum, previous finding revealed that MED8, MED18 and MED20 are also susceptible to necrotrophic leaf pathogens such as Alternaria brassicicola and Botrytis cinerea (Kidd et al., 2009; Lai et al., 2014). Therefore, it is possible that that MED8, MED18 and MED20 form a sub-domain within the Arabidopsis Mediator complex that regulates flowering time and pathogen defence. As I have mention before med18 has been found to interact with TFs YY1, ABI4 and SUF4 to suppress disease susceptibility genes, regulate responses to ABA and flowering time, respectively (Lai et al., 2014) and it would be interesting to test whether these TFs also affect F. oxysporum resistance. Notably, the stabilization of RNA Pol II and TFIIB interactions have been found to be affect by med18 and med20 mutations (Plascha et al., 2015). Thus any distraction to this sub-domain may possibly leads to an alteration in the binding surface that could consequently change these phenotypes throughout indirect mechanisms such as reduced Pol II occupancy and altered methylation (Lai et al 2014). ). Current research have identified numerous mutants in an RNA binding KH domain protein termed SHINY1/ENHANCED STRESS RESPONSES1 (SHINY/ESR1) using a forward genetic screen (Thatcher et al., 2015). . The esr1 mutants were found to have increased resistance to F. oxysporum as well as differential regulation in some but not all aspects of the JA pathway (Thatcher et al., 2015). Previously SHINY1/ESR1 was shown to interact with FIERY2/RNA POLYMERASE II CARBOXYL TERMINAL DOMAIN PHOSPHATASE-LIKE 1 (FRY2/CPL1), a protein that is able to de-phosphorylate the C terminal domain (CTD) of RNA Pol II (Koiwa et al., 2004). CPL1 has been shown to be essential for accurate miRNA processing and controls mRNA splicing and mRNA decay (Manavella et al., 2012; Chen et al., 2015; Cui et al., 2016). It has previously been shown that mutations in MED18 and MED20 also affect miRNA levels and a mutation in RNA Pol II leads to similar developmental phenotypes as med18 and med20 suggesting a connection between mutations in RNA binding proteins (Thatcher et al., 2015), the Mediator head domain and mutations in RNA Pol II itself (Kim
84 et al., 2011; this report). Additional researches have to be done to study the impact of these mutations on the function of RNA Pol II and might be speeded with recent progress in the structure of the transcriptional holoenzyme.
Overall, we found that med18 and med20 plants are highly resistant to F. oxysporum, suggesting a potentially novel mechanism for susceptibility to F. oxysporum that is conferred by the MED18 and MED20 genes. However it remains to be seen whether the strong resistance in coi1 also involves an upregulation of ROS. The investigations of these genes as subunits of the Mediator complex demonstrate the diverse role that a single subunit can possess. Accordingly, identification of interacting proteins of Mediator subunits will definitely speed up our understanding of their specific regulatory mechanisms in plant immunity. Future research should reveal new insights into the specific roles of the remaining Mediator subunits and help to advance our understanding of the transcriptional regulation of gene expression in plants that might provide help for agricultural improvement.
85 Table 6: LIST OF GENES Accession Numbers
Sequence data for genes that were used in this project can be found in the Arabidopsis Genome Initiative or GenBank/EMBL databases under the following accession numbers: Gene name Locus ID ETHYLENE RESPONSE F ACTOR1 (ERF1) AT3G23240 A basic helix- loop-helix transcription factor (MYC2) AT1G32640 DROUGHT RESPONSE ELEMENT PROTEIN B (DREB2A) AT5G05410 AP2/ERF 59 ORA59 AT1G06160 MEDIATOR SUBUNIT 8 (MED8) AT2G03070 MEDIATOR SUBUNIT 20a ( MED20a) AT2G28230 MEDIATOR SUBUNIT20b (MED20b ) AT4G09070-2 MEDIATOR SUBUNITS2c (MED20c) AT2G28020-1 MEDIATOR SUBUNIT 18 (MED18) AT2G22370 MEDIATOR SUBUNIT 21 (MED21) AT4G04780 MEDIATOR SUBUNIT 25 (MED25) AT1G25540 (TGG1) AT5G26000 (TGG2) AT5G25980 (PEN2) AT2G44490
86 Reference:
Aguilar, X., Blomberg, J., Brännström, K., Olofsson, A., Schleucher, J., & Björklund, S. (2014). Interaction studies of the human and arabidopsis thaliana Med25-ACID proteins with the herpes simplex virus VP16- and plant-specific Dreb2a transcription factors: E98575. PLoS One, 9(5) doi:10.1371/journal.pone.0098575 An, C., & Mou, Z. (2013). The function of the Mediator complex in plant immunity. Plant signaling & behavior, 8(3), e23182-e23182. doi: 10.4161/psb.23182 Anderson, J. P., Badruzsaufari, E., Schenk, P. M., Manners, J. M., Desmond, O. J., Ehlert, C., . . . Kazan, K. (2004). Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defence gene expression and disease resistance in Arabidopsis. Plant Cell, 16(12), 3460-3479. doi: 10.1105/tpc.104.025833 Backstrom, S., Elfving, N., Nilsson, R., Wingsle, G., & Bjorklund, S. (2007). Purification of a plant mediator from Arabidopsis thaliana identifies PFT1 as the Med25 subunit. Molecular Cell, 26(5), 717-729. doi: 10.1016/j.molcel.2007.05.007 Barth, C., & Jander, G. (2006). Arabidopsis myrosinases TGG1 and TGG2 have redundant function in glucosinolate breakdown and insect defense. The Plant Journal, 46(4), 549-562. doi:10.1111/j.1365-313X.2006.02716.x Beckman, C. H. (2000). Phenolic-storing cells: keys to programmed cell death and periderm formation in wilt disease resistance and in general defence responses in plants? Physiological and Molecular Plant Pathology, 57(3), 101-110. doi: 10.1006/pmpp.2000.0287 Beckman, C. H., Mueller, W. C., & Mace, M. E. (1974). Stabilization of artificial and natural cell- wall membranes by phenolic infusion and its relation to wilt disease resistance. Phytopathology, 64(9), 1214-1220. Beckman, C. H., Verdier, P. A., & Mueller, W. C. (1989). A system of defence in depth provided by vascular parenchyma cells of tomato in response to vascular infection with fusarium- oxysporum f-sp lycopersici, race-1. Physiological and Molecular Plant Pathology, 34(3), 227-239. doi: 10.1016/0885-5765(89)90046-5 Bent, A. F., & Mackey, D. (2007). Elicitors, effectors, and R genes: The new paradigm and a lifetime supply of questions Annual Review of Phytopathology (Vol. 45, pp. 399-436).
87 Berrocal‐Lobo, M., Molina, A., & Solano, R. (2002). Constitutive expression of ETHYLENE‐ RESPONSE‐FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. The Plant Journal, 29(1), 23-32. doi: 10.1046/j.1365-313x.2002.01191.x Blomberg, J., Aguilar, X., Brannstrom, K., Rautio, L., Olofsson, A., Wittung-Stafshede, P., & Bjorklund, S. (2012). Interactions between DNA, transcriptional regulator Dreb2a and the Med25 mediator subunit from Arabidopsis thaliana involve conformational changes. Nucleic Acids Research, 40(13), 5938-5950. doi: 10.1093/nar/gks265 Bontems, F., Verger, A., Dewitte, F., Lens, Z., Baert, J.-L., Ferreira, E., . . . Monte, D. (2011). NMR structure of the human Mediator MED25 ACID domain. Journal of Structural Biology, 174(1), 245-251. doi: 10.1016/j.jsb.2010.10.011 Bourras, S., McNally, K. E., Ben-David, R., Parlange, F., Roffler, S., Praz, C. R., . . . Keller, B. (2015). Multiple avirulence loci and allele-specific effector recognition control the Pm3 race-specific resistance of wheat to powdery mildew.(Report). 27(10), 2991. doi: 10.1105/tpc.15.00171 Borggrefe, T., & Yue, X. (2011). Interactions between subunits of the Mediator complex with gene- specific transcription factors. Seminars in Cell & Developmental Biology, 22(7), 759-768. doi: 10.1016/j.semcdb.2011.07.022 Brown, J. F., & Ogle, H. J. (1997). Plant pathogens and plant diseases. Armidale, N.S.W: Rockvale Publications for the Division of Botany, School of Rural Science and Natural Resources, University of New England. Carvalhais, L. C., Dennis, P. G., Badri, D. V., Kidd, B. N., Vivanco, J. M., & Schenk, P. M. (2015). Linking jasmonic acid signaling, root exudates, and rhizosphere microbiomes. Molecular Plant-Microbe Interactions : MPMI, 28(9), 1049. Casamassimi, A., & Napoli, C. (2007). Mediator complexes and eukaryotic transcription regulation: An overview. Biochimie, 89(12), 1439-1446. doi: 10.1016/j.biochi.2007.08.002 Catinot, J., Huang, J., Huang, P., Tseng, M., Chen, Y., Gu, S.. . Zimmerli, L. (2015). ETHYLENE RESPONSE FACTOR 96 positively regulates arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate – and ethylene‐responsive defence genes. Plant, Cell & Environment, 38(12), 2721-2734. doi:10.1111/pce.12583 Cerdan, P. D., & Chory, J. (2003). Regulation of flowering time by light quality. Nature, 423(6942), 881-885. doi: 10.1038/nature01636 Cevik, V., Kidd, B. N., Zhang, P., Hill, C., Kiddle, S., Denby, K. J., . . . Kazan, K. (2012). MEDIATOR25 Acts as an Integrative Hub for the Regulation of Jasmonate-Responsive Gene Expression in Arabidopsis. Plant Physiology, 160(1), 541-555. doi: 10.1104/pp.112.202697
88 Chadick, J. Z., & Asturias, F. J. (2005). Structure of eukaryotic Mediator complexes. Trends in Biochemical Sciences, 30(5), 264-271. doi: 10.1016/j.tibs.2005.03.001 Chen, R., Jiang, H., Li, L., Zhai, Q., Qi, L., Zhou, W., . . . Li, C. (2012). The Arabidopsis Mediator Subunit MED25 Differentially Regulates Jasmonate and Abscisic Acid Signaling through Interacting with the MYC2 and ABI5 Transcription Factors. Plant Cell, 24(7), 2898-2916. doi: 10.1105/tpc.112.098277 Chen, W., & Roeder, R. G. (2011). Mediator-dependent nuclear receptor function. Seminars in Cell & Developmental Biology, 22(7), 749-758. doi: 10.1016/j.semcdb.2011.07.026 Chen, Y. C., Wong, C. L., Muzzi, F., Vlaardingerbroek, I., Kidd, B. N., & Schenk, P. M. (2014). Root defense analysis against fusarium oxysporum reveals new regulators to confer resistance. Scientific Reports, 4, 5584. doi:10.1038/srep05584 Chen, Y., Liu, Z., & Halterman, D. A. (2012). Molecular Determinants of Resistance Activation and Suppression by Phytophthora infestans Effector IPI-O (Interactions Determining Resistance to Late Blight). PLoS Pathogens, 8(3), e1002595. doi: 10.1371/journal.ppat.1002595 Czymmek, K. J., Fogg, M., Powell, D. H., Sweigard, J., Park, S.-Y., & Kang, S. (2007). In vivo time-lapse documentation using confocal and multi-photon microscopy reveals the mechanisms of invasion into the Arabidopsis root vascular system by Fusarium oxysporum. Fungal Genetics and Biology, 44(10), 1011-1023. doi: 10.1016/j.fgb.2007.01.012 Dhawan, R., Luo, H., Foerster, A. M., AbuQamar, S., Du, H.-N., Briggs, S. D., . . . Mengiste, T. (2009). HISTONE MONOUBIQUITINATION1 Interacts with a Subunit of the Mediator Complex and Regulates Defence against Necrotrophic Fungal Pathogens in Arabidopsis. Plant Cell, 21(3), 1000-1019. doi: 10.1105/tpc.108.062364 Dombrecht, B., Xue, G. P., Sprague, S. J., Kirkegaard, J. A., Ross, J. J., Reid, J. B., . . . Kazan, K. (2007). MYC2 differentially modulates diverse jasmonate-dependent functions in Arabidopsis. Plant Cell, 19(7), 2225-2245. doi: 10.1105/tpc.106.048017 Dong, S., Raffaele, S., & Kamoun, S. (2015). The two-speed genomes of filamentous pathogens: waltz with plants. Current Opinion in Genetics & Development, 35, 57-65. doi: 10.1016/j.gde.2015.09.001 Dotson, M. R., Yuan, C. X., Roeder, R. G., Myers, L. C., Gustafsson, C. M., Jiang, Y. W., Asturias, F. J. (2000). Structural organization of yeast and mammalian mediator complexes. Proceedings of the National Academy of Sciences of the United States of America, 97(26), 14307-14310. doi: 10.1073/pnas.260489497 Du, Z., Zhou, X., Ling, Y., Zhang, Z., & Su, Z. (2010). agriGO: A GO analysis toolkit for the agricultural community. Nucleic Acids Research, 38, W64-W70. doi:10.1093/nar/gkq310
89 Edgar, C. I., McGrath, K. C., Dombrecht, B., Manners, J. M., Maclean, D. C., Schenk, P. M., & Kazan, K. (2006). Salicylic acid mediates resistance to the vascular wilt pathogen Fusarium oxysporum in the model host Arabidopsis thaliana. Australasian Plant Pathology, 35(6), 581-591. doi: 10.1071/ap06060 Eletsky, A., Ruyechan, W. T., Xiao, R., Acton, T. B., Montelione, G. T., & Szyperski, T. (2011). Solution NMR structure of MED25(391-543) comprising the activator-interacting domain (ACID) of human mediator subunit 25. Journal of structural and functional genomics, 12(3), 159-166. doi: 10.1007/s10969-011-9115-1 Elfving, N., Davoine, C., Benlloch, R., Blomberg, J., Brannstrom, K., Mueller, D., . . . Bjorklund, S. (2011). The Arabidopsis thaliana Med25 mediator subunit integrates environmental cues to control plant development. Proceedings of the National Academy of Sciences of the United States of America, 108(20), 8245-8250. doi: 10.1073/pnas.1002981108 Ellis, J., Catanzariti, A. M., & Dodds, P. (2006). The problem of how fungal and oomycete avirulence proteins enter plant cells. Trends in Plant Science, 11(2), 61-63. doi: 10.1016/j.tplants.2005.12.008 Flanagan, P. M., Kelleher, R. J., Feaver, W. J., Lue, N. F., Lapointe, J. W., & Kornberg, R. D. (1990). RESOLUTION OF FACTORS REQUIRED FOR THE INITIATION OF TRANSCRIPTION BY YEAST RNA POLYMERASE-II. Journal of Biological Chemistry, 265(19), 11105-11107. Flanagan, P. M., Kelleher, R. J., Sayre, M. H., Tschochner, H., & Kornberg, R. D. (1991). A MEDIATOR REQUIRED FOR ACTIVATION OF RNA POLYMERASE-II TRANSCRIPTION INVITRO. Nature, 350(6317), 436-438. doi: 10.1038/350436a0 Franklin, K. A., & Whitelam, G. C. (2005). Phytochromes and shade-avoidance responses in plants. Annals of Botany, 96(2), 169-175. doi: 10.1093/aob/mci165 Gao, H., Beckman, C. H., & Mueller, W. C. (1995). The rate of vascular colonization as a measure of the genotypic interaction between various cultivars of tomato and various formae or races of Fusarium oxysporum. Physiological and Molecular Plant Pathology, 46(1), 29-43. doi: 10.1006/pmpp.1995.1003 Gietz, R. D., TriggsRaine, B., Robbins, A., Graham, K. C., & Woods, R. A. (1997). Identification of proteins that interact with a protein of interest: Applications of the yeast two-hybrid system. Molecular and Cellular Biochemistry, 172(1-2), 67-79. doi: 10.1023/a:1006859319926 Glazebrook, J. (2005). Contrasting mechanisms of defence against biotrophic and necrotrophic pathogens Annual Review of Phytopathology (Vol. 43, pp. 205-227).
90 Hematy, K., Cherk, C., & Somerville, S. (2009). Host-pathogen warfare at the plant cell wall. Current Opinion in Plant Biology, 12(4), 406-413. doi: 10.1016/j.pbi.2009.06.007 Hentges, K. E. (2011). Mediator complex proteins are required for diverse developmental processes. Seminars in Cell & Developmental Biology, 22(7), 769-775. doi: 10.1016/j.semcdb.2011.07.025 Houterman, P. M., Cornelissen, B. J. C., & Rep, M. (2008). Suppression of Plant Resistance Gene- Based Immunity by a Fungal Effector (Suppression of Plant R Gene-Based Immunity). PLoS Pathogens, 4(5), e1000061. doi: 10.1371/journal.ppat.1000061 Iñigo, S., Giraldez, A. N., Chory, J., & Cerdán, P. D. (2012). Proteasome-mediated turnover of arabidopsis MED25 is coupled to the activation of FLOWERING LOCUS T transcription. Plant Physiology, 160(3), 1662-1673. doi:10.1104/pp.112.205500 Inoue, I., Namiki, F., & Tsuge, T. (2002). Plant colonization by the vascular wilt fungus fusarium oxysporum requires FOW1, a gene encoding a mitochondrial protein. The Plant Cell, 14(8), 1869-1883. doi:10.1105/tpc.002576 Iven, T., König, S., Singh, S., Braus-Stromeyer, S. A., Bischoff, M., Tietze, L. F.. . Dröge-Laser, W. (2012). Transcriptional activation and production of tryptophan-derived secondary metabolites in arabidopsis roots contributes to the defense against the fungal vascular pathogen verticillium longisporum. Molecular Plant, 5(6), 1389-1402. doi:10.1093/mp/sss044 Johansson, O. N., Fantozzi, E., Fahlberg, P., Nilsson, A. K., Buhot, N., Tor, M., & Andersson, M. X. (2014). Role of the penetration-resistance genes PEN1, PEN2 and PEN3 in the hypersensitive response and race-specific resistance in Arabidopsis thaliana. Plant Journal, 79(3), 466-478. Johnson, P. R., & Ecker, J. R. (1998). The ethylene gas signal transduction pathway: A molecular perspective. Annual Review of Genetics, 32, 227-254. doi: 10.1146/annurev.genet.32.1.227 Jones, J. D. G., & Dangl, J. L. (2006). The plant immune system. Nature, 444(7117), 323-329. doi: 10.1038/nature05286 Karim, S., Holmstrom, K.-O., Mandal, A., Dahl, P., Hohmann, S., Brader, G., . . . Pirhonen, M. (2007). AtPTR3, a wound-induced peptide transporter needed for defence against virulent bacterial pathogens in Arabidopsis. Planta, 225(6), 1431-1445. doi: 10.1007/s00425-006- 0451-5 Kazan, K., Manners, J. M. (2008). Jasmonate signaling: toward an integrated view. Plant Physiology, 146(4), 1459(10).
91 Kelleher, R. J., Flanagan, P. M., & Kornberg, R. D. (1990). A novel mediator between activator proteins and the rna polymerase-ii transcription apparatus. Cell, 61(7), 1209-1215. doi: 10.1016/0092-8674(90)90685-8 Kidd, B. N., Aitken, E. A., Schenk, P. M., Manners, J. M., & Kazan, K. (2010). Plant mediator: mediating the jasmonate response. Plant signaling & behavior, 5(6), 718-720. doi: 10.4161/psb.5.6.11647 Kidd, B. N., Cahill, D. M., Manners, J. M., Schenk, P. M., & Kazan, K. (2011). Diverse roles of the Mediator complex in plants. Seminars in Cell & Developmental Biology, 22(7), 741-748. doi: 10.1016/j.semcdb.2011.07.012 Kidd, B. N., Edgar, C. I., Kumar, K. K., Aitken, E. A., Schenk, P. M., Manners, J. M., & Kazan, K. (2009). The Mediator Complex Subunit PFT1 Is a Key Regulator of Jasmonate-Dependent Defence in Arabidopsis. Plant Cell, 21(8), 2237-2252. doi: 10.1105/tpc.109.066910 Kim, Y. J., Zheng, B., Yu, Y., Won, S. Y., Mo, B., & Chen, X. (2011). The role of Mediator in small and long noncoding RNA production in Arabidopsis thaliana. Embo Journal, 30(5), 814-822. doi: 10.1038/emboj.2011.3 Kumafuji, M., Umemura, H., Furumoto, T., Fukasawa, R., Tanaka, A., & Ohkuma, Y. (2014). Mediator MED18 subunit plays a negative role in transcription via the CDK/cyclin module. Genes Cells, 19(7), 582-593. doi: 10.1111/gtc.12155 Lai, Z., Schluttenhofer, C. M., Bhide, K., Shreve, J., Thimmapuram, J., Lee, S. Y., . . . Mengiste, T. (2014). MED18 interaction with distinct transcription factors regulates multiple plant functions. Nature Communications, 5. doi: 10.1038/ncomms4064 Lamb, C., & Dixon, R. A. (1997). The oxidative burst in plant disease resistance. Annual Review of Plant Physiology and Plant Molecular Biology, 48(1), 251-275. doi: 10.1146/annurev.arplant.48.1.251 Larivière, L., Seizl, M., van Wageningen, S., Röther, S., van de Pasch, L., Feldmann, H., & Cramer, P. (2008). Structure-system correlation identifies a gene regulatory mediator submodule. Genes & Development, 22(7), 872-877. doi:10.1101/gad.465108 Leal, A., Huehne, K., Bauer, F., Sticht, H., Berger, P., Suter, U., . . . Rautenstrauss, B. (2009). Identification of the variant Ala335Val of MED25 as responsible for CMT2B2: molecular data, functional studies of the SH3 recognition motif and correlation between wild-type MED25 and PMP22 RNA levels in CMT1A animal models. Neurogenetics, 10(4), 275-287. doi: 10.1007/s10048-009-0183-3 Lee, H.-K., Park, U.-H., Kim, E.-J., & Um, S.-J. (2007). MED25 is distinct from TRAP220/MED1 in cooperating with CBP for retinoid receptor activation. Embo Journal, 26(15), 3545-3557. doi: 10.1038/sj.emboj.7601797
92 Lee, K. P., Kim, C., Landgraf, F., & Apel, K. (2007). EXECUTER1- and EXECUTER2-dependent transfer of stress-related signals from the plastid to the nucleus of arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America, 104(24), 10270-10275. doi:10.1073/pnas.0702061104 Lo Presti, L., Lanver, D., Schweizer, G., Tanaka, S., Liang, L., Tollot, M., . . . Kahmann, R. (2015). Fungal Effectors and Plant Susceptibility Annu. Rev. Plant Biol. (Vol. 66, pp. 513-545). Malik, S., & Roeder, R. G. (2005). Dynamic regulation of pol II transcription by the mammalian Mediator complex. Trends in Biochemical Sciences, 30(5), 256-263. doi: 10.1016/j.tibs.2005.03.009 Manojlovic, Z., & Stefanovic, B. (2012). A novel role of RNA helicase A in regulation of translation of type I collagen mRNAs. Rna-a Publication of the Rna Society, 18(2), 321- 334. doi: 10.1261/rna.030288.111 Mathur, S., Vyas, S., Kapoor, S., & Tyagi, A. K. (2011). The Mediator Complex in Plants: Structure, Phylogeny, and Expression Profiling of Representative Genes in a Dicot (Arabidopsis) and a Monocot (Rice) during Reproduction and Abiotic Stress. Plant Physiology, 157(4), 1609-1627. doi: 10.1104/pp.111.188300 McGrath, K. C., Dombrecht, B., Manners, J. M., Schenk, P. M., Edgar, C. I., Maclean, D. J., . . . Kazan, K. (2005). Repressor- and activator-type ethylene response factors functioning in jasmonate signaling and disease resistance identified via a genome-wide screen of Arabidopsis transcription factor gene expression. Plant Physiology, 139(2), 949-959. doi: 10.1104/pp.105.068544 Meyer, K. D., Lin, S.-c., Bernecky, C., Gao, Y., & Taatjes, D. J. (2010). p53 activates transcription by directing structural shifts in Mediator. Nature Structural & Molecular Biology, 17(6), 753-U131. doi: 10.1038/nsmb.1816 Milbradt, A. G., Kulkarni, M., Yi, T., Takeuchi, K., Sun, Z.-Y. J., Luna, R. E., . . . Wagner, G. (2011). Structure of the VP16 transactivator target in the Mediator. Nature Structural & Molecular Biology, 18(4), 410-U436. doi: 10.1038/nsmb.1999 Mittler, G., Stuhler, T., Santolin, L., Uhlmann, T., Kremmer, E., Lottspeich, F., . . . Meisterernst, M. (2003). A novel docking site on Mediator is critical for activation by VP16 in mammalian cells. Embo Journal, 22(24), 6494-6504. doi: 10.1093/emboj/cdg619 Mueller, W. C., Morgham, A. T., & Roberts, E. M. (1994). Immunocytochemical localization of callose in the vascular tissue of tomato and cotton plants infected with fusarium-oxysporum. Canadian Journal of Botany-Revue Canadienne De Botanique, 72(4), 505-509.
93 Mur, L. A. J., Kenton, P., Atzorn, R., Miersch, O., and Wasternack, C. 2006. The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol. 140:249-262. Na, R., & Gijzen, M. (2016). Escaping Host Immunity: New Tricks for Plant Pathogens. PLoS Pathogens, 12(7), e1005631. doi: 10.1371/journal.ppat.1005631 Nakamura, Y., Yamamoto, K., He, X., Otsuki, B., Kim, Y., Murao, H., . . . Akiyama, H. (2011). Wwp2 is essential for palatogenesis mediated by the interaction between Sox9 and mediator subunit 25. Nature Communications, 2. doi: 10.1038/ncomms1242 Nicaise, V., Roux, M., & Zipfel, C. (2009). Recent Advances in PAMP-Triggered Immunity against Bacteria: Pattern Recognition Receptors Watch over and Raise the Alarm. Plant Physiology, 150(4), 1638-1647. doi: 10.1104/pp.109.139709 Nicholas, C. C., Hans, T.-C., Volker, L., Stephan, B., Erich, K., Jin-Long, Q., .& Paul, S.-L. (2003). SNARE-protein-mediated disease resistance at the plant cell wall. Nature, 425(6961), 973. doi: 10.1038/nature02076 Olivain, C., Humbert, C., Nahalkova, J., Fatehi, J., L'Haridon, F., & Alabouvette, C. (2006). Colonization of tomato root by pathogenic and nonpathogenic Fusarium oxysporum strains inoculated together and separately into the soil. Applied and Environmental Microbiology, 72(2), 1523-1531. doi: 10.1128/aem.72.2.1523-1531.2006 Ou, B., Yin, K.-Q., Liu, S.-N., Yang, Y., Gu, T., Hui, J. M. W., . . . Qu, L.-J. (2011). A High- Throughput Screening System for Arabidopsis Transcription Factors and Its Application to Med25-Dependent Transcriptional Regulation. Molecular Plant, 4(3), 546-555. doi: 10.1093/mp/ssr002 Pantelides, I. S., Tjamos, S. E., Pappa, S., Kargakis, M., & Paplomatas, E. J. (2013). The ethylene receptor ETR1 is required for Fusarium oxysporum pathogenicity. Plant Pathology, 62(6), 1302-1309. doi: 10.1111/ppa.12042 Penninckx, I., Eggermont, K., Terras, F. R. G., Thomma, B., DeSamblanx, G. W., Buchala, A., . . . Broekaert, W. F. (1996). Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell, 8(12), 2309-2323. doi: 10.1105/tpc.8.12.2309 Penninckx, I., Thomma, B., Buchala, A., Metraux, J. P., & Broekaert, W. F. (1998). Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell, 10(12), 2103-2113. doi: 10.1105/tpc.10.12.2103 Pérez-Salamó, I., Papdi, C., Rigó, G., Zsigmond, L., Vilela, B., Lumbreras, V.. . Szabados, L. (2014). The heat shock factor A4A confers salt tolerance and is regulated by oxidative stress
94 and the mitogen-activated protein kinases MPK3 and MPK6. Plant Physiology, 165(1), 319- 334. doi:10.1104/pp.114.237891 Petersen, L. N., Ingle, R. A., Knight, M. R., & Denby, K. J. (2009). OXI1 protein kinase is required for plant immunity against pseudomonas syringae in arabidopsis. Journal of Experimental Botany, 60(13), 3727-3735. doi:10.1093/jxb/erp219 Plaschka, C., LariviËre, L., Wenzeck, L., Seizl, M., Hemann, M., Tegunov, D., & Cramer, P. (2015). Architecture of the RNA polymerase II-Mediator core initiation complex. Nature, 518(7539), 376. doi: 10.1038/nature14229 Plissonneau, C., Daverdin, G., Ollivier, B., Blaise, F., Degrave, A., Fudal, I., . . . Balesdent, M. H. (2016). A game of hide and seek between avirulence genes AvrLm4‐7 and AvrLm3 in Leptosphaeria maculans. New Phytologist, 209(4), 1613-1624. doi: 10.1111/nph.13736 Rana, R., Surapureddi, S., Kam, W., Ferguson, S., & Goldstein, J. A. (2011). Med25 Is Required for RNA Polymerase II Recruitment to Specific Promoters, Thus Regulating Xenobiotic and Lipid Metabolism in Human Liver. Molecular and Cellular Biology, 31(3), 466-481. doi: 10.1128/mcb.00847-10 Raya-Gonzalez, J., Ortiz-Castro, R., Ruiz-Herrera, L. F., Kazan, K., & Lopez-Bucio, J. (2014). PHYTOCHROME AND FLOWERING TIME1/MEDIATOR25 regulates lateral root formation via auxin signaling in arabidopsis. Plant Physiology, 165(2), 880-894. doi:10.1104/pp.114.239806 Reina-Pinto, J. J., & Yephremov, A. (2009). Surface lipids and plant defences. Plant Physiology and Biochemistry, 47(6), 540-549. doi: 10.1016/j.plaphy.2009.01.004 Rentel, M. C., Lecourieux, D., Ouaked, F., & Usher, S. L. (2004). OXI1 kinase is necessary for oxidative burst-mediated signalling in arabidopsis. Nature, 427(6977), 858. Rodriguezgalvez, E., & Mendgen, K. (1995). The infection process of fusarium-oxysporum in cotton root tips. Protoplasma, 189(1-2), 61-72. doi: 10.1007/bf01280291 Roupelieva, M., Griffiths, S. J., Kremmer, E., Meisterernst, M., Viejo-Borbolla, A., Schulz, T., & Haas, J. (2010). Kaposi's sarcoma-associated herpesvirus Lana-1 is a major activator of the serum response element and mitogen-activated protein kinase pathways via interactions with the Mediator complex. Journal of General Virology, 91, 1138-1149. doi: 10.1099/vir.0.017715-0 Sakuma, Y., Maruyama, K., Qin, F., Osakabe, Y., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2006). Dual function of an Arabidopsis transcription factor DREB2A in water-stress- responsive and heat-stress-responsive gene expression. Proceedings of the National Academy of Sciences of the United States of America, 103(49), 18822-18827. doi: 10.1073/pnas.0605639103
95 Samanta, S., & Thakur, J. K. (2015). Importance of mediator complex in the regulation and integration of diverse signaling pathways in plants. Frontiers in Plant Science, 6, 757. Schenk, P. M., Kazan, K., Wilson, I., Anderson, J. P., Richmond, T., Somerville, S. C., & Manners, J. M. (2000). Coordinated plant defence responses in Arabidopsis revealed by microarray analysis. Proceedings of the National Academy of Sciences of the United States of America, 97(21), 11655-11660. doi: 10.1073/pnas.97.21.11655 Seguela-Arnaud, M., Smith, C., Uribe, M. C., May, S., Fischl, H., McKenzie, N., & Bevan, M. W. (2015). The mediator complex subunits MED25/PFT1 and MED8 are required for transcriptional responses to changes in cell wall arabinose composition and glucose treatment in arabidopsis thaliana. BMC Plant Biology, 15, 215. doi:10.1186/s12870-015- 0592-4 Sela, D., Conkright, J. J., Chen, L., Gilmore, J., Washburn, M. P., Florens, L.. . Conaway, J. W. (2013). Role for human mediator subunit MED25 in recruitment of mediator to promoters by endoplasmic reticulum stress-responsive transcription factor ATF6. Journal of Biological Chemistry, 288(36), 26179-26187. doi:10.1074/jbc.M113.496968 Shaikhibrahim, Z., Rahaman, H., Wittung-Stafshede, P., & Bjorklund, S. (2009). Med8, Med18, and Med20 subunits of the Mediator head domain are interdependent upon each other for folding and complex formation. Proceedings of the National Academy of Sciences of the United States of America, 106(49), 20728-20733. doi: 10.1073/pnas.0907645106 Sheard, L. B., Tan, X., Mao, H., Withers, J., Ben-Nissan, G., Hinds, T. R., . . . Zheng, N. (2010). Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature, 468(7322), 400-U301. doi: 10.1038/nature09430 Shen, Y., & Diener, A. C. (2013). Arabidopsis thaliana resistance to fusarium oxysporum 2 Implicates Tyrosine-Sulfated Peptide Signaling in Susceptibility and Resistance to Root Infection. Plos Genetics, 9(5). doi: 10.1371/journal.pgen.1003525 Shi, J., Mueller, W. C., & Beckman, C. H. (1991). Ultrastructural responses of vessel contact cells in cotton plants resistant or susceptible to infection by fusarium-oxysporum-f-sp- vasinfectum. Physiological and Molecular Plant Pathology, 38(3), 211-222. doi: 10.1016/s0885-5765(05)80125-0 Shi, J., Mueller, W. C., & Beckman, C. H. (1992). Vessel occlusion and secretory activities of vessel contact cells in resistant or susceptible cotton plants infected with fusarium- oxysporum f-sp vasinfectum. Physiological and Molecular Plant Pathology, 40(2), 133- 147. doi: 10.1016/0885-5765(92)90040-3
96 Simon, B., Mourão, A., Vojnic, E., Wenzeck, L., Baumli, S., Larivière, L.. . Sattler, M. (2011). Structure and VP16 binding of the mediator Med25 activator interaction domain. Nature Structural & Molecular Biology, 18(4), 404-409. doi:10.1038/nsmb.1997 Sohail, M., & Robert, G. R. (2010). The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation. Nature Reviews Genetics, 11(11), 761. doi: 10.1038/nrg2901 Stacey, M. G., Koh, S., Becker, J., & Stacey, G. (2002). AtOPT3, a member of the oligopeptide transporter family, is essential for embryo development in Arabidopsis. Plant Cell, 14(11), 2799-2811. doi: 10.1105/tpc.005629 Stein, M., Dittgen, J., S·nchez-RodrÌguez, C., & Hou, B.-H. (2006). Arabidopsis PEN3/PDR8, an ATP Binding Cassette Transporter, Contributes to Nonhost Resistance to Inappropriate Pathogens That Enter by Direct Penetration(W)(OA). Plant Cell, 18(3), 731-746. Sundaravelpandian, K., Chandrika, N. N. P., & Schmidt, W. (2013). PFT1, a transcriptional mediator complex subunit, controls root hair differentiation through reactive oxygen species (ROS) distribution in arabidopsis. New Phytologist, 197(1), 151-161. doi:10.1111/nph.12000 Taatjes, D. J. (2010). The human Mediator complex: a versatile, genome-wide regulator of transcription. Trends in Biochemical Sciences, 35(6), 315-322. doi: 10.1016/j.tibs.2010.02.004 Thatcher, L. F., Powell, J. J., Aitken, E. A. B., Kazan, K., & Manners, J. M. (2012). The lateral organ boundaries domain transcription factor LBD20 functions in fusarium wilt susceptibility and jasmonate signaling in arabidopsis. Plant Physiology, 160(1), 407-418. doi:10.1104/pp.112.199067 Thatcher, L. F., Manners, J. M., & Kazan, K. (2009). Fusarium oxysporum hijacks COI1-mediated jasmonate signaling to promote disease development in Arabidopsis. Plant Journal, 58(6), 927-939. doi: 10.1111/j.1365-313X.2009.03831.x Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., . . . Browse, J. (2007). JAZ repressor proteins are targets of the SCFCO11 complex during jasmonate signalling. Nature, 448(7154), 661-U662. doi: 10.1038/nature05960 Tiwari, S. B., Belachew, A., Ma, S. F., Young, M., Ade, J., Shen, Y., . . . Repetti, P. P. (2012). The EDLL motif: a potent plant transcriptional activation domain from AP2/ERF transcription factors. Plant Journal, 70(5), 855-865. doi: 10.1111/j.1365-313X.2012.04935.x Torti, S., & Fornara, F. (2012). AGL24 acts in concert with SOC1 and FUL during arabidopsis floral transition. Plant Signaling & Behavior, 7(10), 1251-1254. doi:10.4161/psb.21552
97 Trusov, Y., Sewelam, N., Rookes, J. E., Kunkel, M., Nowak, E., Schenk, P. M., & Botella, J. R. (2009). Heterotrimeric G proteins‐mediated resistance to necrotrophic pathogens includes mechanisms independent of salicylic acid‐, jasmonic acid/ethylene‐ and abscisic acid‐ mediated defense signaling. The Plant Journal, 58(1), 69-81. doi:10.1111/j.1365- 313X.2008.03755.x Uknes, S., Winter, A. M., Delaney, T., Vernooij, B., Morse, A., Friedrich, L., . . . Ryals, J. (1993). Biological induction of systemic acquired-resistance in arabidopsis. Molecular Plant- Microbe Interactions, 6(6), 692-698. doi: 10.1094/mpmi-6-692 Vandermolen, G. E., Beckman, C. H., & Rodehorst, E. (1987). The ultrastructure of tylose formation in resistant banana following inoculation with fusarium-oxysporum f-sp cubense. Physiological and Molecular Plant Pathology, 31(2), 185-200. doi: 10.1016/0885- 5765(87)90063-4 Vanetten, H. D., Mansfield, J. W., Bailey, J. A., & Farmer, E. E. (1994). 2 classes of plant antibiotics - phytoalexins versus phytoanticipins. Plant Cell, 6(9), 1191-1192. Visser, M., Gordon, T. R., Wingfield, B. D., Wingfield, M. J., & Viljoen, A. (2004). Transformation of Fusarium oxysporum f. sp cubense, causal agent of Fusarium wilt of banana, with the green fluorescent protein (GFP) gene. Australasian Plant Pathology, 33(1), 69-75. doi: 10.1071/ap03084 Voegele, R. T., & Mendgen, K. (2003). Rust haustoria: nutrient uptake and beyond. New Phytologist, 159(1), 93-100. doi: 10.1046/j.1469-8137.2003.00761.x Voinnet, O., Rivas, S., Mestre, P., & Baulcombe, D. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. The Plant Journal, 33(5), 949-956. doi:10.1046/j.1365-313X.2003.01676.x Vojnic, E., Mourao, A., Seizl, M., Simon, B., Wenzeck, L., Lariviere, L., . . . Cramer, P. (2011). Structure and VP16 binding of the Mediator Med25 activator interaction domain. Nature Structural & Molecular Biology, 18(4), 404-U429. doi: 10.1038/nsmb.1997 Wands, A. M., Wang, N., Lum, J. K., Hsieh, J., Fierke, C. A., & Mapp, A. K. (2011). Transient- state Kinetic Analysis of Transcriptional Activator center dot DNA Complexes Interacting with a Key Coactivator. Journal of Biological Chemistry, 286(18). doi: 10.1074/jbc.M110.207589 Whipps, J. M. (2001). Microbial interactions and biocontrol in the rhizosphere. Journal of Experimental Botany, 52, 487-511. Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G. V., & Provart, N. J. (2007). An "Electronic Fluorescent Pictograph" Browser for Exploring and Analyzing Large-Scale Biological Data Sets. Plos One, 2(8). doi: 10.1371/journal.pone.0000718
98 Wollenberg, A. C., Strasser, B., Cerdan, P. D., & Amasino, R. M. (2008). Acceleration of Flowering during Shade Avoidance in Arabidopsis Alters the Balance between FLOWERING LOCUS C-Mediated Repression and Photoperiodic Induction of Flowering. Plant Physiology, 148(3), 1681-1694. doi: 10.1104/pp.108.125468 Xu, R., & Li, Y. (2011). Control of final organ size by Mediator complex subunit 25 in Arabidopsis thaliana. Development, 138(20), 4545-4554. doi: 10.1242/dev.071423 Yang, F. J., DeBeaumont, R., Zhou, S., & Naar, A. M. (2004). The activator-recruited cofactor/Mediator coactivator subunit ARC92 is a functionally important target of the VP16 transcriptional activator. Proceedings of the National Academy of Sciences of the United States of America, 101(8), 2339-2344. doi: 10.1073/pnas.0308676100 Yang, M., Hay, J., & Ruyechan, W. T. (2008). Varicella-Zoster Virus IE62 Protein Utilizes the Human Mediator Complex in Promoter Activation. Journal of Virology, 82(24), 12154- 12163. doi: 10.1128/jvi.01693-08 Youn, H.-S., Park, U.-H., Kim, E.-J., & Um, S.-J. (2011). PTOV1 antagonizes MED25 in RAR transcriptional activation. Biochemical and Biophysical Research Communications, 404(1), 239-244. doi: 10.1016/j.bbrc.2010.11.100 Zander, M., La Camera, S., Lamotte, O., Metraux, J.-P., & Gatz, C. (2010). Arabidopsis thaliana class-II TGA transcription factors are essential activators of jasmonic acid/ethylene-induced defence responses. Plant Journal, 61(2), 200-210. doi: 10.1111/j.1365-313X.2009.04044.x Zhang, F., Yao, J., Ke, J., Zhang, L., Lam, V. Q., Xin, X.-F., & He, S. Y. (2015). Structural basis of JAZ repression of MYC transcription factors in jasmonate signalling. Nature, 525(7568), 269. doi: 10.1038/nature14661 Zhou, K., Choe, K. T., Zaidi, Z., Wang, Q., Mathews, M. B., & Lee, C. G. (2003). RNA helicase A interacts with dsDNA and topoisomerase II alpha. Nucleic Acids Research, 31(9), 2253- 2260. doi: 10.1093/nar/gkg328 Zhu, Q. H., Stephen, S., Kazan, K., Jin, G., Fan, L., Taylor, J., . . . Wang, M. B. (2013). Characterization of the defence transcriptome responsive to Fusarium oxysporum-infection in Arabidopsis using RNA-seq. Gene, 512(2), 259-266. doi: 10.1016/j.gene.2012.10.036 Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., & Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology, 136(1), 2621-2632. doi: 10.1104/pp.104.046367
99