© 2014 Nature America, Inc. All rights reserved. M.P.R. ( Institute, The Rockefeller University, New York, New York, USA. Canada. USA. The Rockefeller University, New York, New York, USA. 1 chain found in polypeptide single antigen-binding is the smallest homodimers devoid of light chains heavy-chain of consisting immunoglobulins of subset make unique a which llamas, as such camelids from derived usually are Nanobodies antibodies. traditional to alternative an as emerged studies proteomic batch variation have often proven problematic for or biochemical However,poses. their large size, and limited availability batch-to- pur these for available reagents bait primary the are antibodies required is isolation affinity when particularly tags, protein these against antibodies high-quality demand studies Most invaluable. are antibodies, known have do as such GFP, which tags protein and common Flag, est, mCherry high-affinity antibodies are not available for the molecule of inter When specificity. and affinity high with molecules target ognize rec that for antibodies biomedicine in need is a continual There biomedical applications. routine production of capturehigh-affinity reagents for various as ~30 p ultrahigh-affinitydimeric nanobodies with mapping diverse epitopes on GFP, we were also able to design m repertoires of nanobodies against two antigens, GFP and the efficacy ofthis approach through the production oflarge and specificitiesagainst a given antigen. Wedemonstrate readily expressible recombinant nanobodies with high affinities implementation. proven time consuming and difficult, hampering nanobody identification of repertoireswith sufficiently high affinity has (~ and therapeutics owing to their high specificity,small size show promise as high-affinity reagents for research, diagnostics variable regions of N Marlene Oeffinger Peter C Fridy nanobody repertoires A robust pipeline for rapid production of versatile Received Laboratory Laboratory of Cellular and Biology,Structural The Rockefeller University, New York, New York, USA. anobodies anobodies are antibodies single-domain derived from the C igedmi atbde, eerd o s nanobodies as to referred antibodies, Single-domain 1 herry, with 5 5 k 4 Laboratory Laboratory of Molecular Immunology, The Rockefeller University, New York, New York, USA. [email protected] D 6

Département Département de Biochimie et Médecine Moléculaire, Faculté de Médecine, Université de Montréal, Montreal, Canada. Quebec, 5 a) a) and straightforward bacterial expression. M

Ap . . r T il; he he approach presented here is well suited for the a K 1 d ccepted , values into the subnanomolar range. After 8 O 5 , , Yinyin Li ur ur approach generates large repertoires of . C amelidae amelidae atypical immunoglobulins. 5

), ), B.T.C. ( 25 , 6 , , Michel C Nussenzweig

Septembe [email protected] 2 , 8 r , Sarah , KeeganSarah 7– ; 1–

publi 9 4 ; their variable region (V . Monoclonal or polyclonal polyclonal or Monoclonal . s hed 3

K Center Center for Health Informatics and Bioinformatics, New York University School of Medicine, New York, New York, online d values as low ) ) or D.F. (

2 3 8 N These These authors contributed equally to this work. Correspondence should be addressed to , Mary , K Mary Thompson 4 ovembe H , 7 [email protected] owever, , , David Fenyö 6 T , have have , hey r r 2014; H H) - - -

doi :10.1038/nmeth.317 in the nanomolar range and are smaller in size (approximately (approximately size in smaller are and affinities range with nanomolar the antigens in bind can stable, systems extremely usually are expression bacterial in in amounts large produced be can readily they antibodies, clonal binding domains derived from V these antibody natural any structures, they are evolutionarily divergent and divergent thus are are they distinct evolutionarily structures, Furthermore, studies. biological proteins cell fluorescent have these although broadly similar in roles owing antigens central target their first to our as tags mCherry and GFP the ( optimized highly been has stage each which in production body cDNA databases antibody patient-specific with conjunction in MS antibodies by humans in HIV neutralizing circulating identify to efforts ous ( animal same the llama, using individual a DNA generated database sequence from an from isolated antibodies heavy-chain of affinity-purified tion identifica MS on centers discovery nanobody to approach Our S RESULTS animal. same the of serum V high-affinity of identification (MS) spectrometric mass with combined llama immunized an from V lymphocyte marrow a high-throughput of on sequencing DNA based is approach The proteins. selected production of large repertoires of high-affinity nanobodies against supply exceeds greatly nanobodies for demand reagents these of use widespread the for are of approaches a current major bottleneck and efficiency poor labor-intensiveness the elusive: proven have nanobodies affinity of high- repertoires extensive for isolating and robust techniques constructs antibody other than kDa) 15 Supplementary Protocol Supplementary trategy for nanobody identification nanobody for trategy ). To generate nanobody repertoires of maximal utility, we chose of maximal Torepertoires nanobody generate Here we present a highly optimized pipeline that allows the rapid 3 , , Brian T Chait 1 , , Ilona Nudelman 5 Institut de Recherches Cliniques de Montréal, Montreal, Quebec, 2 Laboratory Laboratory of Massand Spectrometry Gaseous Ion Chemistry, n 0 1 a 9 ture methods Fig. Fig. . Our approach represents a pipeline for a . nano approach pipeline Our represents 8– 2 & Michael P Rout 1 1 2 ). This concept is inspired by our previ our by inspired is concept This ). . Nanobodies are recombinant antigen- recombinant are Nanobodies . ). 1 , , Johannes F Scheid

| ADVANCE 9 , 1 3 . Moreover, nanobodies nanobodies Moreover, . H 7 H Howard Hughes Medical H H regions. Unlike mono H regions derived from from derived regions H 11

8 ONLINE , , 14– 12 1 , 1 1 H 4 8 8 , explaining why why explaining , . However, rapid rapid However, . H cDNA library library cDNA H .

Articles PUBLICATION

4 , β -barrel -barrel |

 - - - -

© 2014 Nature America, Inc. All rights reserved. Figure Figure V for the G protein of and A protein advantage of affinities taking different antibodies, heavy-chain V exclusively ­containing obtain to bleeds we serum response, fractionated immune serially an of confirmation and antigens these immunogens  (ref. PDB from obtained was shown structure nanobody example The

Articles | ADVANCE 2 9 1 ). LC-MS/MS, liquid chromatography–tandem mass spectrometry. mass chromatography–tandem liquid LC-MS/MS, ). | cDNA preparation DNA sequencing and nestedPCR sequence library High-throughput Overview of nanobody identification and production pipeline. pipeline. production and identification of nanobody Overview V V sequences Bone marrow H H translation V H primar H amplicon In silico H

H DNA ONLINE 2 0 . After immunization of individual llamas with with llamas individual of immunization After . y Gene synthesisandbacterialexpression

PUBLICATION Diverse t Recombinant llamaantibody V H Peptide sequence sequence grouping H proteinsequences Peptide mapping, and ranking library arget antigens | n a ture methods IgG fractionationand affinity purification Identified peptides Antigen-specific Antigen-specific

150 Abundance b 2 Crude serum V V b 3 LC-MS/M X! Tandem y 2 H H H spectra H fraction search b 4 y 3 b 5 M y 4 2+ –18 b 6 m/ y 5 z b 7 y 6 b 8 S y 7 H y 8 3K1 1000 H versus versus H K

H H- sion or display libraries, and thus we removed the need for efficient immunoglobulin mRNA of levels elevated transcribe which cells, plasma body-secreting anti long-lived for enriching aspirates, marrow bone from cells llamas for high-throughput sequencing. We isolated mononuclear immunized individual from samples RNA lymphocyte obtained analysis. MS aiding washes, which also decreased the complexity of the eluted sample, V highest-affinity the ( (MS/MS) MS tandem and raphy–MS chromatog liquid by analyzed and digested trypsin were bands ( kDa) (~50 antibodies undigested and kDa) ~25 (both Fc and fragments Fab fragments was chosen for follow-up (LaM 1–8; 1–8; (LaM for follow-up chosen was ­antibodies against mCherry (LaM), a smaller subset of eight clones further screening ( to them and 1–44 against GFP as subjected (LaG) antibody llama high- 44 these GFP. Weclassified against provided nanobodies for and hits ­probability issues these overcame inspection, ual genes V(D)J rearranged ments and already seg gene V upstream between occurs recombination secondary recombination, V(D)J after which, in conversion, gene somatic is probably This a ofresult and sequences. CDR1 CDR2 different V multiple between shared frequently are sequences CDR3 identical that revealed regions CDR3 their by and ( peptides matched of values expectation V V diverse most the (CDR3, 3 region complementarity-determining of age cover sequence MS on based metric a by ranked are sequences (Llama Magic; highest-probability matches from a pool of related V the identifies that pipeline bioinformatic a developed we lenges, be generated for Toanimal. each immunized with deal both chal V for proteins, other for available are distinguished by MS. Moreover, whereas well-established databases large part of highly conserved framework regions that are in lessconsist they as easily identification, protein MS-based typical a than ( silico in digested trypsin and filtered translated, were reads These tively. platform resulted in ~800,000 or ~3,000,000 unique reads, respec Roche high-throughput 454 (GFP) or Illumina (mCherry) MiSeq V formed nested PCR to specifically amplify sequences encoding the clones. of the and presentation folding expression, exogenous tion of ~15-kDa V of tion ~15-kDa ments were eluted and separated by SDS-PAGE, allowing purifica V of constant regions and leave behind the desired fragments minimal Fig. MgCl with washed purified the V antibodies conventional Fig. Fig. H H To create an animal-specific antibody sequence database, we we database, sequence antibody animal-specific an create To u atmtc akn ppln, ope wt crfl man careful with coupled pipeline, ranking automatic Our The identification of specific V per and RNA lymphocyte total from cDNA generated We H coverage, sequencing counts, mass spectral counts and the the and counts spectral mass counts, sequencing coverage, H H variable regions H variable 3

H 1b 1 ). Preliminary attempts to identify V identify to attempts Preliminary ). H variable region. Finally, the antigen-bound V antigen-bound the Finally, region. variable H and and ) and digested with papain on-resin to cleave away the the away cleave to on-resin papain with digested and ) to create a searchable peptide database for MS analysis analysis MS for database peptide searchable a create to H H region) as well as CDR1 and CDR2 coverage, total total coverage, CDR2 and CDR1 as well as region) H Supplementary Fig. 2 Fig. Supplementary H http:// H-containing fraction over antigen-coupled resin, Supplementary Supplementary Fig. 4 H H fragments free from residual conventional conventional residual from free H fragments 2 www.llamamagic.org t aiu srnece ( stringencies various at 1 H 4 Supplementary Fig. 1c Supplementary . Sequencing of this PCR product using a using product PCR of this . Sequencing H fragments via the highest-stringency highest-stringency the via fragments H 7 19 ( , 21 Supplementary Fig. 1a Fig. Supplementary , 2 2 . . Notably, we did not create expres H H sequences is more challenging ). Supplementary Fig. 5 Fig. Supplementary H H a cDNA database must database cDNA a H ). ). In the analysis of llama Fig. 2 Fig. Supplementary Figs. 2 Figs. Supplementary / ). In 23 H H H regions that have have that regions H , 2 H sequences solely solely sequences H 4

). The gel-purified ). The gel-purified this pipeline, V . a ). We recovered recovered We ). Supplementary Supplementary ). We ). H H sequences H

affinity- H frag H ). H H ------© 2014 Nature America, Inc. All rights reserved. even a few positive clones positive few a even of phage display, in which up to 10 is steps selection and panning (57–75%) final the to step comparison in favorable screening single this of rate success high the to our phage analogous display,is protocol not Although directly sub stantial sequence diversity among revealed clones mCherry. ( nanobodies against verified the 6 of and analysis GFP Phylogenetic against nanobodies specific 25 specific and high as ( affinity well as expression robust displayed that nanobodies to identify resin we over antigen-coupled lysates passed expression, After vector. expression bacterial a into cloned are identified by asterisks. Eluted proteins were analyzed by SDS-PAGE followed by MS. ( V candidate regions of CDR three Figure the nanobodies further by either surface plasmon resonance resonance plasmon surface either by further nanobodies the stained bands of known Nup84-complex components. Data are representative of two experiments dimer( with a glycine-rich peptide linker. The complex was isolated at various time points,are andlabeled relative with theyield was determined by quantification of Coomassie- by MS. Breakdown products of H2B are labeled ( three hypothetical ligand concentrations (blue lines). ( affinities for GFP (green dots). Theoretical curves of the expected fraction of ligand bound to an immobilized binding partner at various f b LaG-41 LaG-16 LaG-9 a ) Affinity isolation of mCherry-tagged histone H2B (HTB2) from , Codon-optimized genes for these hits were synthesized and and synthesized were hits these for genes Codon-optimized c ) Affinity isolations of Nup84-GFP from 110 150 100 Abundance Abundance Abundance b2 y1 b3 2 b2 b2 y2 | y2 y2 Characterization of V Characterization b3 Supplementary Fig. 6 Fig. Supplementary b4 b3 y3 y3 y3 M M b4 b5 2+ y4 2+ –18 –18 M y4 b6 m/ m/ m/ b4 2+ y5 b5 –18 b7 y4 z z z y6 y5 b6 b5 K b8 y6 d y5 b6 y7 for mCherry. ( b7 y8 y6 1,000 a 850 920 K d taken from published value (ref. 29). ( 200 300 Abundance Abundance 200 Abundance 12 H b2 y2 H H IgG and recombinant nanobodies. ( nanobodies. H IgG and recombinant b2 b3 , H sequences. The MS-covered regions of these sequences are underlined. Dashed lines indicate overlapping peaks. peaks. overlapping indicate lines Dashed are underlined. sequences regions of these The MS-covered H sequences. y2 b4 14 y3 y2 b3 b5 g M M y4 , y3 b5 b6 b4 25 ) Affinity isolations of yeast Nup84-GFP using the commercial nanobody GFP-Trap, polyclonal anti-GFP or a LaG-16–LaG-2 2+ 2+ y3 ). From these screens, we found found we screens, these From ). y5 b7 –36 –3 y4 y14 b6 , y4 b6 7 6 2 y6 clones are screened to 6 2+ M M y5 y7 m/ m/ m/z M b7 y5 . We assessed the affinity of of affinity the assessed We . b7 2+ 2+ y8 y9 S. cerevisiae y6 2+ b11 –1 –18 z z b8 –18 y6 b8 8 y7 y7 y10 ∆ b12 b13 y8 y8 y11 H2B-mCherry. Asterisk indicates LaM nanobody that leaked during the affinity-purification procedure. LaM lanes y12 b9 b9 Supplementary Supplementary Fig. 7 y13 y9 y9 1,300 1,300 1,600 e ( ) Signal-to-noise ratio of three Nup84-complex components plotted against each LaG’s b MW (kDa) ) or RBM7-GFP from HeLa cells ( b K K f MW (kDa) d d (nM): K values for GFP are listed. MW, molecular weight. ND, not determined. Contaminant bands 188 d d 28 38 49 62 98 188 (nM): 28 38 49 62 98 14 17 Relative yield S. cerevisiae 0.25 0.50 0.75 1.00

PC identify identify ND 0 d 10 Trap RFP- ) Relative yields of affinity-isolated Nup84-GFP protein plotted against LaG ND Trap GFP- –1 0.6 a ) Tandem mass spectra of identified peptides (shown boxed), mapped to the to mapped boxed), (shown ) Tandem of peptides identified spectra mass a 1 22 10 0.9 41 ). ). - 0 0.49 by LaMs or RFP-Trap. Eluted proteins were analyzed by SDS-PAGE and identified

4 2 0.6 16 10 1.9 3 LaM isolation of GFP-tagged Nup84, a structural nuclear-pore-complex teins in yeast and human cells. All 25 positive LaGs were first affinity-isolated endogenous usedGFP- forand pro mCherry-tagged the We performed a variety of experiments to assess S our nanobodies. We 9 Fig. Supplementary with 8 Fig. binding ( with high-affinity nanobodies stants ( con dissociation with affinities, of range wide a revealed ments ( or (SPR) 1 3.5 Supplementary Supplementary Figs. 8 9 pecificity and efficacy of recombinant nanobodies of recombinant efficacy and pecificity K 0.18 d 10 (nM) 24 35 2 0.26 K 6 ). The affinities of the six LaMs were consistently strong, strong, consistently were LaMs six the of affinities The ). LaG 43 c 13 d K 10 ) using LaGs, GFP-Trap or polyclonal anti-GFP llama antibody (PC). values ranging from 0.18 nM to 63 nM nM 63 to nM 0.18 from ranging values 63 d 3 8 ) ) from 0.5 nM to over 20 100 nM in vitro in 10 nM 1 nM 35 24 10 ∆ H2B-mCherry Nap1 H2A H4 H3 37 H2B-mCherry 25 a 4 – c 390 n , 10 6 * f a binding assays with immobilized nanobodies nanobodies immobilized with assays binding ) or are means experiments from two 5 ture methods 22,900 1 1 ). Sec13 Seh1 Nup145c Nup85 and Nup120 Nup84-GF Nup133 e – g

10 Signal/noise Relative yield 0.25 0.50 0.75 1.00 0. 1. ). ). For the LaG repertoire these experi 5 0 0 0 P 10 –1 MW (kDa)

| c ADVANCE 1 K 10 µ d 188 (nM) M M ( 28 38 49 62 98 0 : 10 Time (min) Table PC ND ≤ 1 50 50 nM; K

d 10 ONLINE 10 (nM) 24 35 2 Po GFP LaG-1 1 K d 3.5 ), ), and identified 16 ly 9 values are shown for 10 LaG clonal anti-GFP -T 3 Supplementary Supplementary 6–LaG-2

± ra Articles 0.6 16 PUBLICATION s.e.m. ( p K (Table 10 d 100 0.9 41 . 4 in vitro

* * * * * 10 RBM7-GF ZCCHC8 SKIV2L2 d 5

, 1 e

, and and g ). | P

 - - -

© 2014 Nature America, Inc. All rights reserved. tunity to demonstrate the importance of very low of very importance the to demonstrate tunity against raised lar a nanobodies antigen single provided an oppor in solution bound proteins target yeast of low-abundance for percentage the predicted theoretically relationship the with consistent is which low GFP-Trap than ( yields higher slightly displayed LaG-16 blot, western by Nup84-GFP of tion ( nM 0.59 a has GFP-Trap nanobody, which (ChromoTek), anti-GFP antibodies polyclonal performed as many well as and or better thanproteins, either our best associated affinity-purified its and Nup84-GFP of amounts capture ( affinity Nup84-GFP a from yield or ratio background observed LaG’s yeast budding in component, LaG-12 LaG-10 LaG-9 LaG-6 LaG-3 LaG-2 C T  a showed Nanobodies application. of type this in performance LaG-29 LaG-27 LaG-26 LaG-24 LaG-21 LaG-19 LaG-17 LaG-16 LaG-14 LaG-35 LaG-30 LaG-42 LaG-37 LaG-8 LaG-5 LaG-43 LaG-41 LaG-18 LaG-11 LaG-16–G a Also shown are the number of residues identified in the binding site and the site’s calculated accessible surface area (ASA). MW, inmolecular specificity weight; for ND, not determined; N/A, not applicable. specific and nonspecific bands were used to calculate signal-to-noise (S:N) ratios. Bead binding assays were used to determine affinity for fluorescentG proteins, and the table highlights differences K LaM-8 LaM-6 LaM-4 LaM-3 LaM-2 LaG-41–G LaG-16–3×Flag–LaG-2 LaM-1 K d Fig. 2d Fig. 4 able lone

Articles d values for GFP and mCherry binding were determined by SPR unless otherwise noted. S) or by a 3×Flag linker. For yeast Nup84-GFP and mammalian RBM7-GFP affinity isolations using LaGs, Coomassie-stained bands from elutions separated by SDS-PAGE were quantified, and known determined bybeadbinding assay. | Generally speaking, there were strong correlations between between correlations strong were there speaking, Generally ADVANCE K

ID d 1 and both high signal-to-background ratio and high yield, yield, and high ratio signal-to-background high and both | 4 4 , Characteristics of LaG, LaG dimer, and LaM proteins e S–LaG-2 S–LaG-2 and and Fig. 2b Fig. 3 A. macrodactyla

0 ONLINE ( Fig. 2 Fig. Table K , g d

M ) against a quantification of either signal-to- either of quantification a against PUBLICATION 2 15,700 15,329 15,919 16,221 14,763 15,452 15,528 15,823 16,306 16,002 16,090 15,748 16,062 16,159 15,449 15,565 16,329 16,010 15,589 16,167 15,490 15,471 16,221 15,953 30,791 16,459 32,972 14,666 14,428 14,866 15,196 15,151 15,380 29,956 d W ( 9 1 ). Our ability to compare structurally simi structurally to compare ability ). Our . For instance, when we determined deple determined we when instance, For . CFP among LaGs and for DsRed among LaMs. GFP epitopes for LaGs were determined by NMR and classified into three groups according to their location (I–III). ). Almost all LaGs pulled down detectable detectable down pulled LaGs all Almost ). 1 D or the single commercially available available commercially single the or a) 20,000 14,200 22,900 K 19 3,800 d 0.268 0.036 0.150 Supplementary Fig. 11 Fig. Supplementary 24.6 23.5 (n a 0.26 0.18 0.49 27 , , 16 310 110 600 | 2.6 0.7 1.9 3.5 0.5 9.5 0.9 1.9

25 56 97 41 50 11 24 63 22 , M n 2 7 a a a a a a 8 ) a ( ture methods i. 2 Fig. N up8 4 0.12 0.77 1.03 1.00 1.05 1.09 0.95 0.67 1.05 0.84 0.20 0.17 1.02 1.04 0.31 1.04 0.36 0.70 0.11 0.69 0.21 1.12 0.10 0.10 0.13 N/A N/A N/A N/A N/A N/A ND ND ND -GFP b ). We plotted each each plotted We ). S : N K d to antibody to antibody R B ). M 7-GFP 1.13 0.42 1.09 1.06 0.92 1.04 0.58 0.41 N/A N/A N/A N/A N/A N/A ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND K K d d values are also listed for LaG dimers fused by a glycine-rich peptide linker (three repeats of GGGGS, or of S : - - - N

Binds with LaMs conjugated to Dynabeads (Life Technologies; (Life conjugated to with LaMs Dynabeads application. particular any for optimal be will one least at that chances the improve to to useful obtain and test large of repertoires such reagents affinity duce unpredictable background in certain cell types. It is therefore These results underscore that even reagents high-affinity can pro ( cells HeLa in purifications and yeast in purifications between differed contaminants of amount the LaG-41, notably LaGs, certain for However, Nup84-GFP. with seen those to ble cells HeLa RBM7, a tagged component of the human nuclear exosome, from studies. interactome and proteome for here, described nanobodies the as such reagents, ultrahigh-affinity for need highlight the findings These antibody. an for affinity high sidered K as their performance affinity-purification in decline precipitous All six LaMs efficiently isolated the core nucleosome complex, complex, nucleosome core the isolated efficiently LaMs six All ( L d Similarly, we isolated mCherry-tagged histone H2B from yeast Similarly, we mCherry-tagged isolated GFP- with experiments affinity-capture performed also We aG) or values rose, even at values as low as 10 nM—typically con nM—typically 10 as low as values at even rose, values A. macrodactyla D ND ND ND ND ND ND ND + − − + + + + + + + + + + + + + + + + + + − − + + − − s 4 R ( ed ( Fig. 2 Fig. L a M

c C ) ). We observed yields and purities compara purities and yields We ). observed FP epitope group N/A N/A N/A N/A N/A N/A GFP ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND III II II II II II I I I I I

N site residues o. of binding- N/A N/A N/A N/A N/A N/A ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND 55 62 57 53 56 54 60 60 66 53 55 A S A of binding-site residues (Å 2,551 2,204 2,340 2,404 2,543 2,605 2,519 2,216 2,070 2,091 2,381 N/A N/A N/A N/A N/A N/A Fig. 2b Fig. ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND Fig. Fig. 2 2 ) , c f ). ). ). ). - - - © 2014 Nature America, Inc. All rights reserved. BFP variants (>96% EGFP identity). Two LaGs did not bind a pro fluorescent cyan identity) bind EGFP (78% divergent moderately not did LaGs Two identity). EGFP (>96% variants BFP standard bound All from derived Phialidium (Evrogen), TurboYFP bound two none and mCherry, (<30%), or DsRed bound Discosoma nanobodies these of None BFP, ( and DsRed variants, protein mCherry fluorescent proteins: EGFP, two yellow protein fluorescent variants, two cyan against LaGs tested a the 13 of variety highest-affinity fluorescent homologs of fluorescent other recognize to nanobodies our of ability the was ( 60% mately approxi of intensity fluorescence in increase maximum a with We moderate observed increases in fluorescence for several LaGs, or presence binding. upon shifts the for spectral to look LaGs of various in absence GFP of spectra fluorescence the nanobodies compared by activity fluorescence GFP of modulation ( staining nuclear colocalized specific, in resulting H2B, mCherry-tagged and stained 488 Fluor Alexa to LaM-4 conjugated we microscopy, immunofluorescence for were well suited similarly nanobodies our whether anti-mCherry nuclear rim and the reticulum endoplasmic of staining expected the produce to EGFP with colocalized coated vesicles, and indeed, the Alexa Fluor 568–nanobody signal COPII- and complex pore nuclear the both to localizes protein a immunofluorescence in for them used also we reagents, these of ( cells staining untransfected of nonspecific negligible with structures, mitochondrial or microtubules EmGFP-tagged of staining strong and producing specific Technologies), (Life 568 Fluor Alexa to conjugated cells HeLa into transfected transiently EmGFP, mitochondria-targeted and tubulin tagged Fig. 12 for microscopy ( immunofluorescence effectiveness of selected members of the LaG and LaM repertoires super-resolution and standard both yields. lower had and parallel The RFP-Trapnanobody commercial (ChromoTek) was tested in were high. isolations of affinity all and the yield specificity LaMs, nanobodies. Consistent with the low of group of second this and specificity the affinity demonstrating experiments. three least 10 bars, Scale (AF488). 488 Fluor Alexa to conjugated LaM-4 with stained directly then and permeabilized ( counterstaining. DAPI with LaG-16–AF568, with stained and fixed cells, wild-type with 1:1 mixed were Sec13 EGFP-tagged expressing ( (blue). DAPI with counterstained were Nuclei red). in (AF568, 568 Fluor Alexa to conjugated LaG-16 with immunostained and fixed were green) (in marker mitochondrial EmGFP-tagged an or ( microscopy. 3 Figure tein sequence from from sequence tein d ) An ) An One additional question of specificity we sought to address address to sought we specificity of question additional One useful potentially demonstrated have studies previous As Nanobodies are powerful new tools for fluorescence microscopy, Trypanosoma brucei Trypanosoma S. cerevisiae S. ). ). As target proteins, we first used Emerald GFP (EmGFP)- | Efficacy of LaG and LaM nanobodies in immunofluorescence immunofluorescence in nanobodies LaM and of LaG Efficacy Fig. 3 Fig. -derived proteins with low sequence identity to EGFP to EGFP identity low sequence with proteins -derived sp., which has 53% sequence identity to EGFP identity sequence 53% has sp., which a Aequorea victoria , Supplementary Fig. 13 Fig. Supplementary b ) HeLa cells transiently transfected with tubulin-EmGFP tubulin-EmGFP with transfected transiently cells ) HeLa d strain with mCherry-tagged histone H2B was fixed, fixed, was H2B histone mCherry-tagged with strain ). Aequorea macrodactyla Aequorea eura victoria Aequorea Fig. 3a Fig. strain with EGFP-tagged Sec13. This This Sec13. EGFP-tagged with strain 3 2 Saccharomyces cerevisiae Saccharomyces . We stained fixed cells with LaG-16 LaG-16 with . cells We fixed stained GFP and µ , m. Images are representative of at representative are Images m. b ). To demonstrate the versatility versatility the To ). demonstrate K ). 3 1 d Discosoma Fig. Fig. . We therefore tested the the tested therefore We . values of all the identified 3 –derived CFP, YFP and and YFP CFP, –derived 3 ( Fig. Fig. 3 3 and , whereas all others others all whereas , c c sp. mCherry. We ) ) Supplementary Supplementary ). ). To determine T. brucei expressing expressing Fig. 4 Fig. cells cells

20

2

9 , 34 , we we , , a 3 5 ). ). - - .

and measured and their measured ­complexes between 12 LaGs and high-affinity of basis published the those on assignments shift chemical obtained and trum pared pre we identity), sequence 97% EGFP, with standard to related variant GFPuv the for assignments shift chemical a to ligand sample protein unlabeled an adding from result that the (typically spectrum ‘fingerprint’ characteristic its in changes following by protein a on sites ing bind map to researchers allows method This technique. NMR affinity LaGs using chemical shift perturbation, a well-established by 12 highest- the on recognized GFP epitopes Wethe identified M proteins. tagged fluorescently multiple expressing ously simultane cells from experiments affinity-capture and labeling differential in uses potential diverse have reagents these DsRed, for specificity in and LaM nanobodies for fluorescent proteins, including variation sequence identity to mCherry. Given the different affinities of LaG has to bound which approximately DsRed, standard LaM-4) 80% ( tested we proteins fluorescent but or not to cyan yellow any of green, to the mCherry bound ies of LaM nanobod variants from Our anti-mCherry other species. use through can be obtained EGFP, activities binding differential to proteins fluorescent that have bind to specifically identity high did apping of the nanobody epitopes on GFP on epitopes nanobody of the apping Because previous studies have already made backbone backbone made have already studies previous Because 3 6 . These results indicate that although the identified LaGs LaGs identified the although that indicate results These . 15 d c b a N-labeled GFPuv, measured its its measured GFPuv, N-labeled S. cerevisiae T. brucei HeLa HeLa H2B-mCherry Sec13-EGFP mitochondria-EmGFP tubulin-EmGFP 3 n 7 38 a . A. macrodactyla A. ture methods , 3 9 15 ( mCherry N- Supplementary Fig. 14a Fig. Supplementary GFP 1 H HSQC spectra. For H spectra. HSQC 11 of the 12 cases,

Fig. 4 Fig. | ADVANCE cyan fluorescent protein and and protein fluorescent cyan b 15 ). Two LaMs (LaM-3 and and (LaM-3 Two LaMs ). N- LaG-16–AF568 LaM-4–AF488

ONLINE 1 15 H HSQC spectrum) spectrum) HSQC H N- 15 ). We then tested tested Wethen ). N-labeled N-labeled GFPuv 1 HQ spec HSQC H

Articles PUBLICATION 38 15 , 3 N-labeled N-labeled 9 (closely (closely 15 N- | 1

H  - - - - -

© 2014 Nature America, Inc. All rights reserved. group III nanobody (LaG-2) has a binding epitope on the opposite the whereas LaG-41), and LaG-27 LaG-26, LaG-21, (LaG-19, ies nanobod five containing also II, group of site binding the with overlaps LaG-17), and LaG-43 LaG-14, LaG-9, (LaG-16, bodies nano five containing I, group of site binding The groups. tinct into can of epitopes binding be dis three divided the nanobodies ( observed we binding high-affinity the with consistent more acids, 50 than amino comprising interfaces ( interface binding the Fig. in p.p.m. be 0.03 to than judged greater were difference a exhibiting residues and variant. GFPuv the bind not did 14b Figs. the to compared cross-peaks of percentage large a of shifts chemical in changes specific and clear observed we experiments. two least prediction ( 1EM PDB from obtained were models Structural from DsRed and mCherry and from protein fluorescent from derived protein fluorescent a cyan YFP; and victoria A. proteins: fluorescent recombinant various with incubated and beads magnetic to conjugated ( LaGs affinity ( binding. Figure  Ds

17 43 14 9 16 Articles | A chemical shift difference was calculated for all spectra, spectra, all for calculated was difference shift chemical A ) ADVANCE A 5 15

4 A. macrodactyla A. 14b ( ; the ; the N- Av 4 | ) , a ( 1 Nanobody fluorescent protein protein fluorescent Nanobody 36 5 c H HSQC spectrum of GFPuv alone ( alone GFPuv of spectrum HSQC H , , 2 Am Av ) c b , , PDB , PDB 5 37 and and Group I ) SDS-PAGE analysis of high- analysis ) SDS-PAGE 5

) GFP and its variants CFP, variants BFP its and ) GFP a ONLINE . Gels are representative of at representative are . Gels CFP model is a Phyre server server a Phyre is model CFP , 4 ) or LaMs ( LaMs ) or 0 . All the identified epitopes corresponded to large corresponded epitopes . the identified All 180 180 180 180 180 4HE 15 ° ° ( ° ° °

). In the twelfth case, LaG-24, the nanobody nanobody the LaG-24, case, twelfth the In ). 4 PUBLICATION Am ( Phialidium Phi CFP); a yellow a yellow CFP); b ) that were were ) that ) 5 Discosoma 3 and PDB PDB and 19 41 2 27 26 ( 1 | Phi n ( YFP); YFP); a 1GG Ds ture methods ). ). X

Fig. Fig. Group II 180 180 180 180 180 5 and and ° ° ° ° ° A Ph a Ds Av m Supplementary Supplementary Supplementary Supplementary i Table 1 GFP-Trap GFP GFP dimer 2 ). The The ). mCherry DsRed GFP CFP CFP YFP YFP BFP - - - 3 2 and showed that the NMR-mapped epitope matched the pub lished results the matched epitope NMR-mapped the that showed and (PDB determined crystallographically been has GFP with complex whose of structure the nanobody, GFP-Trap cial commer the of site binding GFPuv the determine to approach NMR this used also we control, a As molecule. GFP the of side an approach that has been used successfully in various applica various in affinity, successfully higher used been with has that approach bind an potentially could that GFP on sites binding nonoverlapping with LaGs of heterodimers engineered we LaGs, 12 for these epitopes multiple identified NMR Because D ( overlap substantial GFP, of shows face same the on binds which III, group whereas site, GFP-Trapbinding the with overlap no or little show II and I GFP-Trap, groups of that with nanobodies our of epitopes ing Group III imerized nanobodies as ultrahigh-affinity reagents ultrahigh-affinity as nanobodies imerized 1 9 180 180 180 1 4 ° ° ° 1 6 1 7 LaG 2 9 29 , 2 1 4 1 ( 2 4 Supplementary Fig. Supplementary 16 2 6 Fig. Fig. 3 7 faster affinity isolations after conjugation conjugation after isolations affinity faster yielded dimers of these affinity higher the pM. We whether to sought also determine played dis tag) 3×Flag (a linker different a with those and LaGs other of Dimers pM. 36 a with SPR, by measured as affinity (encoding highest the had GGGGS) of repeats linker three peptide flexible glycine-rich a with fusion LaG-16-LaG-2 A other panels. other as orientation of GFPuv, same the in elements structure secondary depicts right bottom at diagram ribbon the reference, For (center). interface homodimerization GFPuv’s and (top) epitope binding nanobody’s GFP-Trap the show column right the in III Group below Maps panels. all in orientation same the have and mode space-filling in represented are molecules GFPuv All green. colored nanobody respective of the site binding the with axis), a vertical along rotation a 180° (via shown are of GFPuv sides nanobody,opposite two each For location. their to according groups three in shown are GFPuv on nanobodies highest-affinity 11 the of epitopes Binding NMR. by GFP on epitopes 5 Figure tions to develop reagentshigh-avidity 4 0 5 1 ). K | b Am Ph Ds Av Mapping of nanobody binding binding of nanobody Mapping d values in the range of 100–200 100–200 of range the in values i mCherry DsRed GF CF YF ). ). Comparing the bind P P P 1 4 2 3 LaM 3K1 6 K K 42 d 8 ) , of of 2 4 9 3 - - - - - . ,

© 2014 Nature America, Inc. All rights reserved. Note: Note: Any Information Supplementary and Source Data files are available in the versio and are Methods references any in available the associated M reagents. such generate to years take can otherwise that field a advance significantly to potential the has generation domains, protein other with molecules or drugs fusion a as or dimer) nanobody tumor as such targets cells, either independently (as a disease monomer or an to ultrahigh-affinity efficacy and specificity great with bind can they as development, drug in potential great have and ‘humanized’ can be readily aggregation resist ies, research community the of of interest the potential by and reflected as huge, versatility is The nanobodies tag. to difficult are that teins pro including targets, protein of types various against reagents tags. these of visualization enhanced and isolation used GFP tags, be will and of mCherry use general for the affinity widely the against generated reagents, LaG and LaM Our bility. capa high-throughput specialized require often which available, approaches other than direct more and faster is This laboratory. generated, with only standard required techniques in the primary process can take as little as 4–6 weeks after an immune response is entire The weeks. 1–2 in out carried be typically can each times, turnaround on depending and outsourced, be readily can thesis Animal handling, high-throughput sequencing, MS and gene syn and screening (3–6 d), can be performed over approximately 10 d. (2 d), MS (2 d), cDNA generation and PCR (2 d), and final cloning IgG purification including work required, The direct generated). once an is immune response immunization, d initial (50–70 after llamas from of samples collection the after is required effort tory proteins used in this mCherry-tagged study. Only modest labora the in use as such GFP- the and for macromolecules, of target characterization nanobodies high-affinity specific, of repertoire a comprehensive produce can quickly pipeline The systems. sion in the animal’s immune system and avoiding intermediary expres tage of the complex and selection maturation processes occurring advan taking serum, animal from directly sequences nanobody in a chosen antigen. Notably, this approach identifies high-affinity generation of a large antibody repertoire against multiple epitopes Our optimized pipeline for nanobody production allows for rapid DISCUSSION applications. diagnostic many for required ity would allow for of the antigens, as detection low-abundance is components for In studies. interactome their high avid addition, complex associated or transiently of capture weakly the allowing open the door for increasingly rapid affinity isolations, potentially and of ( 80% min 10 after 90% approximately and min 5 only after reaching yield maximum points, time earlier at yields higher showed dimer LaG-16-LaG-2 The components. complex GFP isolations and compared the relative Nup84- yields of known yeast Nup84- of courses time analyzed therefore Weanti-GFP. or polyclonal nanobodies to single compared beads, to magnetic onlin ethods Our approach is well suited to the development of nanobody nanobody of development the to suited well is approach Our e e version of the pape Supplementary Fig. 17 Fig. Supplementary n of the pape the of n 8 , 10 , 44 , 4 5 48– r . Nanobodies are . than Nanobodies antibod much smaller . r . 5 1 . . Application of our method for nanobody ). These picomolar-affinity reagents reagents picomolar-affinity These ). 8 , 46 , 4 Fig. 2 Fig. 7 online online . . They g ------

17. 16. 15. 14. 13. 12. 11. online version of the pape The authors declare competing financial interests: details are available in the COM authors. M.P.R. communed with llamas in the Atacama desert. cowritten by P.C.F., Y.L., I.N., M.P.R. and B.T.C., with contributions from all by P.C.F. and M.K.T. NMR analyses were performed by I.N. The manuscript was Production and characterization of recombinant nanobodies was performed M.P.R. and B.T.C. Bioinformatic analysis was performed by Y.L., S.K. and D.F. processing. MS was carried out by Y.L. Experimental work was supervised by were performed by P.C.F., M.K.T. and M.O.; J.F.S. assisted with bone marrow Experiments relating to immunization, sample collection and processing The project was conceived of by M.P.R., B.T.C., P.C.F., Y.L., D.F. and M.C.N. A H. Jiang and S. Obado. helpful discussions and technical assistance, particularly A. Ferguson, K. Wei, husbandry; and members of the Rout and Chait laboratories, past and present, for S. Reed-Paske and the other members of Capralogics, Inc., for advice and animal support with high-throughput sequencing; A. Luz for assistance with SPR; for assistance with immunofluorescence microscopy; A. Viale and C. Zhao for Health Research and Fonds de recherches du Québec - Santé. We thank A. North Sciences and Engineering Research Council of Canada, Canadian Institutes of Howard Hughes Medical Institute (M.C.N.). M.O. was supported by the Natural and AI072529-08 and (M.C.N.) AI037526-20A1 and support from the GM103511 and P41 GM109824 (M.P.R. and B.T.C.), P41 GM103314 (B.T.C.), We acknowledge support from US National Institutes of Health grants U54 Ackno 10. 9. 3. 2. 1. c R 8. 7. 6. 5. 4. om/reprints/index.htm eprints and permissions information is available online at UTHOR

P fragment in fragment (1988). 423–426 Immunopathol. Immunol. Vet. nanobodies.fluorescent antibodies. antibodies. heavy-chain camel from fragments antibody domain single identification of and Selection stability.conformational (2011). 882–887 molecular for proteins 77 exploration.proteome and characterization complex probes. proteomic of camelid single-domain antibody fragments.antibody single-domain camelid of Biochem. chains. conjugate. (2005). spectrometry.mass using analysis Biotechniques levels.endogenous near at expressed complexes protein human (2002). cerevisiae Saccharomyces (1999). 1030–1032 Skerra, A. & Pluckthun, A. Assembly of a functional immunoglobulin Fv immunoglobulinfunctional a of Assembly A. Pluckthun, & A. Skerra, R.E. Bird, Muyldermans,S. U. Rothbauer, of expressionProkaryotic MacKenzie,R. & J. Tanha, M., Arbabi-Ghahroudi, Muyldermans,& Hamers,Desmyter,Ghahroudi,S. R.ArbabiWyns,L., M., A., M. Dumoulin, Romer, T., Leonhardt, H. & Rothbauer, U. Engineering antibodies and antibodiesEngineering U. Rothbauer, & H. Leonhardt,Romer,T., applications andproduction, Properties, H.J. Haard, De & M.M. Harmsen, Y.Ho, G. Rigaut, as proteinsM.P.Fluorescent Rout, B.T.& Chait, R., Williams, I.M., Cristea, Muyldermans, S. Nanobodies: natural single-domain antibodies.single-domain natural Nanobodies: Muyldermans,S. C. Hamers-Casterman, V.Cortez-Retamozo, complex protein in Advances B. Raught, & R. Aebersold, A.C., Gingras, M. Domanski, ETIN w , 13–22 (2007). 13–22 ,

led CONTRI G G F et al. et Nature g

IN ments 8 et al. et et al. et 2 Cancer Res. Cancer A Cancer Metastasis Rev. Metastasis Cancer B Systematic identification of protein complexes in complexes protein identification of Systematic , 775–797 (2013). 775–797 , Escherichia coli Escherichia NCI

UTIONS et al. et

et al. et doi:10.2144/00011386 et al. et n 3 Single-chain antigen-bindingproteins. Single-chain A generic protein purification method for protein for method purification protein generic A a A 6 et al. et ture methods 3 L Mol. Cell. Proteomics Cell. Mol.

, 446–448 (1993). 446–448 , Single-domain antibody fragments with high with fragmentsantibody Single-domain Improved methodology for the affinity isolation of isolation affinity the for methodology Improved INTERESTS Targeting and tracing antigens in live cells with cells live in antigenstracing Targetingand l et al. et r . . Camelid immunoglobulins and nanobody technology.nanobody and immunoglobulinsCamelid

et al. et in vivo in 64 by mass spectrometry.mass by Nat. Methods Nat. Protein Sci. Protein , 2853–2857 (2004). 2853–2857 , Efficient cancer therapy with a nanobody-based a with therapy cancer Efficient . Naturally occurring antibodies devoid of light of devoid antibodies occurring Naturally Science imaging.

12 FEBS Lett. FEBS 8

24 J. Physiol. (Lond.) Physiol. J. , 178–183 (2009). 178–183 , |

ADVANCE

4 24 , 501–519 (2005). 501–519 , 11

(May 2012) (May 3

, 887–889 (2006). 887–889 , 0 Curr. Opin. Biotechnol. Opin. Curr. , 500–515 (2002). 500–515 , 4 , 1038–1041 (1988). 1038–1041 ,

, 1933–1941 (2005). 1933–1941 , 414 , 521–526 (1997). 521–526 , Appl. Microbiol. Biotechnol. Microbiol. Appl.

ONLINE Nature Nat. Biotechnol. Nat.

5

6 41

http://www.nature. Science Articles PUBLICATION 3 , 11–21 , 5 , 180–183 ,

22

242 Annu. Rev. Annu. ,

,

1 7 |

,



© 2014 Nature America, Inc. All rights reserved. 36. 35. 34. 33. 32. 31. 30. 29. 28. 27. 26. 25. 24. 23. 22. 21. 20. 19. 18. 

Articles |

ADVANCE (2002). Sea. China East the in species jellyfish 4 mFruits. in color control charges buried andchromophores species. Proteomics Cell. Mol. ancestor.eukaryotic common last the from conserved is that architecture 6 structures. vesicular for reagents and labeling BacMam I: part structures, and compartments cellular of microscopy fluorescence nanobodies. via microscopy super-resolution GFP-based for method versatile Nature nanobodies. complex. pore nuclear the in module age.atomicenteredthe hascomplex pore (2007). 1680–1690 hapten. prototypical methotrexate,a against Chemother. camelidae.the in elicited fragmentsantibody rabbit. in diversity Cell rabbits. in conversion gene somatic for evidencegenes: VDJ chain heavy formation. antibody of site neglected a still but immunoglobulins, serum of source Immunity 21 complexity.structural and features functional of evolution binding.CD4antibodiesmimic thatHIV fragments. Xia, N.S. Xia, Novel S.J. Remington, & R.Y.Tsien, C.A., Yarbrough, Shaner,N.C., X., Shu, M.V.Matz, J.A. DeGrasse, for reagents of review M.W.A Davidson, & J.A. Kilgore, N.J., Dolman, simple, A H. Ewers, & H. Eghlidi, E., Platonova, C., Kaplan, J., Ries, S. Ghaemmaghami, Kirchhofer,A. Fernandez-Martinez,J. nuclearT.U.Schwartz,The Partridge, & S.G.,Brohawn,Whittle,J.R. J.R., N. Alvarez-Rueda, K.E. Conrath, antibody ofgeneration and usage gene VH Restricted K.L. Knight, immunoglobulin of diversification Somatic K.L. Knight, & Becker,R.S. major the marrow: bone The J.J. Haaijman, W.& Hijmans, Benner,R., immunity.viral in memory cell B and Antibodies A. Radbruch, & Dörner,T. D.A. Shagin, Scheid,J.F. Fv single-chain antibody of engineering Stability A. Pluckthun, & A. Wörn, 5 5 , 9639–9647 (2006). 9639–9647 , (2013). 12.30 , (2004). 841–850 ,

6 3

, 987–997 (1990). 987–997 , 42 Nat. Biotechnol. Nat.

et al. et 5

2

ONLINE Clin. Exp. Immunol. Exp. Clin. et al. et J. Mol. Biol. Mol. J. , 737–741 (2003). 737–741 , 4 7 et al. et Nat. Methods Nat. Biol. Mol. Struct. Nat. 5 , 384–392 (2007). 384–392 , et al. et et al. et , 2807–2812 (2001). 2807–2812 , et al. et Bioluminescence of Bioluminescence et al. et Fluorescent proteins from nonbioluminescent Anthozoanonbioluminescent from proteinsFluorescent Sequence and structuralpotentSequenceandconvergenceandbroad of et al. et

GFP-like proteins as ubiquitous metazoan superfamily: metazoan ubiquitous as proteins GFP-like Beta-lactamase inhibitors derived from single-domain from derived inhibitors Beta-lactamase PUBLICATION Annu. Rev. Immunol. Rev. Annu. Modulation of protein properties in living cells using cells living in properties protein of Modulation et al. et Evidence for a shared nuclear pore complex pore nuclear shared a for Evidence

8 , 2119–2130 (2009). 2119–2130 , et al. et

Generation of llama single-domain antibodiessingle-domain llama of Generation 305

Global analysis of protein expression in yeast. in expression protein of analysis Global 1

9 7 , 582–584 (2012). 582–584 , , 969–973 (1999). 969–973 , , 989–1010 (2001). 989–1010 , Structure-function mapping of a heptameric a of mappingStructure-function

46 , 1–8 (1981). 1–8 ,

| 1

Aequorea macrodactyla Aequorea 7 n J. Cell Biol. Cell J. , 133–138 (2010). 133–138 , a Mar. Biotechnol. (NY) Biotechnol. Mar. ture methods

Science 1 0 Structure , 593–616 (1992). 593–616 , Mol. Immunol. Mol. Antimicrob. Agents Antimicrob.

333

1

9 1 , 1633–1637(2011). , 6 7 , 419–434 (2012). 419–434 , , 1156–1168 (2009).1156–1168 , Curr. Protoc. Cytom. Protoc.Curr. , a common a , Mol. Biol. Evol. Biol. Mol. Biochemistry

44

4 , 155–162 , ,

47. 46. 45. 44. 43. 42. 41. 40. 39. 38. 37. 55. 54. 53. 52. 51. 50. 49. 48.

J. Biol. Chem. Biol. J. scaffold. nanobody humanized universal a identification of and antibody (2005). therapy.cancer for agents novel diagnostics. Res. Antiviral (2005). domains.receptorhumanof family a of (1995). 367–373 (CRAbs). antibodiesrecombinant chelating by binding protein. fluorescent green the of F99S/M153T/V163A mutant the of properties spectroscopy. (2003). (GFP). protein fluorescent green the of mutant. interactions.ligand a case study using the Phyre server.Phyre the using study case a (2000). 1133–1138 DsRed. homolog GFP tetrameric the in fluorescence Crystallogr. mutagenesis.structure-based and structure protein. drugs. antiplatelet marketed currently with compared safety and efficacy preclinical growth. tumour solid cells. stem mobilize and replication HIV-1 and chemotaxis inhibit potently domains) constructs.antibody bivalent and bispecific in units building modular as antibodies domain Vincke, C. Vincke, as Nanobodies Muyldermans,S. Baetselier,P.& De H., Revets, in proficient tools Nanobodies®: D. Saerens, & Muyldermans,S. L., Huang, P.Vanlandschoot, Silverman,J. antigen High-affinity Winter,G. & T.Prospero, M., Momo, D., Neri, refolding and structure Crystal G. Zanotti, & A. Negro, R., Battistutta, NMR by solution in interactionsprotein-protein Mapping E.R. Zuiderweg, S. Jackson, & K. Stott, F., Khan, J. Georgescu, protein- of studies NMR E. Giralt, & M. Gairi, Tarrago, T., M., Goldflam, Kelley, L.A. & Sternberg, M.J. Protein structure prediction on the Web: the on predictionstructure Protein M.J. Sternberg, & Kelley,L.A. red for basis structural The R. Ranganathan, & M. Socolich, M.A., Wall, N.V.Pletneva, M. Ormö, H. Ulrichts, R.C. Roovers, S. Jähnichen, single- Camel Muyldermans,S. & L. Wyns, M., Lauwereys, K., Conrath, Els J. Biomol. NMR Biomol. J. Proteins Science et al. et

et al. et 6 Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. et al. et Expert Rev. Mol. Diagn. Mol. Rev. Expert 9

et al. et 9

et al. et , 1005–1012 (2013). 1005–1012 , Biochemistry et al. et et al. et et al. et 2 2 Crystal structure of the of structure Crystal

General strategy to humanize a camelid single-domaincamelid a humanize to strategy General 8

, 389–407 (2011). 389–407 , 2 41 4 Antithrombotic drug candidate ALX-0081 shows superior shows ALX-0081 candidate drug Antithrombotic 73 et al. et Multivalent avimer proteins evolved by exon shufflingexon byMultivalent proteinsevolvedavimer , 3273–3284 (2009). 3273–3284 , A biparatopic anti-EGFR nanobody efficiently inhibits efficiently nanobody anti-EGFR biparatopic A Blood Backbone H Backbone CXCR4 nanobodies (VHH-based single variable single (VHH-based nanobodies CXCR4 Yellow fluorescent protein phiYFPv ( phiYFPv protein fluorescent Yellow , 429–437 (2000). 429–437 , Methods Mol. Biol. Mol. Methods , 1392–1395 (1996). 1392–1395 , J. Biol. Chem. Biol. J. Int. J. Cancer J. Int.

Nanobodies®: new ammunition to battle viruses. battle to ammunition new Nanobodies®: 2

11 5

41 , 161–162 (2003). 161–162 , 8 , 757–765 (2011). 757–765 , , 1–7 (2002). 1–7 , N Expert Opin. Biol. Ther. Biol. Opin. Expert , N, C N, , 1 H,

2 1 12

Nat. Protoc. Nat. 7 0 15 1

6 , 777–785 (2010). 777–785 , 9 α 83 07 N and N , 7346–7350 (2001). 7346–7350 , J. Biomol. NMR Biomol. J. Nat. Biotechnol.Nat. and C and Aequorea victoria Aequorea , 2013–2024 (2011). 2013–2024 , 1 , 20565–20570 (2010). 20565–20570 , , 233–259 (2012). 233–259 , Acta Crystallogr. D Biol. D Crystallogr.Acta 13 β assignment of the GFPuv the of assignment C backbone assignment backbone C

4 , 363–371 (2009). 363–371 , Nat. Struct. Biol. Struct. Nat.

J. Mol. Biol. Mol. J.

26 2 5 green fluorescent green Phialidium 3 , 111–124 , , 281–282 , , 1556–1561 ,

): 246

7 ,

,

© 2014 Nature America, Inc. All rights reserved. after emPCR amplification, on one Titer Pico For Plate. Illumina amplification, emPCR after system FLX GS 454 a on sequenced then purified, gel was tion underlined) CAG (5 454-VHH-reverse and ATGGCT[C/G]A[G/T]GTGCAGCTGGTGGAGTCTGG-3 (5 VHH-forward 5 with primers 4-specific and 1- V ing, CH1 domain was purified on an agarose gel. Next, for 454 sequenc V from band to 750-bp 600- approximately domain CH2 the into domain variable IgG the amplify to (5 CALL001 step, first the (5 In primers. specific IgG with formed per then was PCR nested A Technologies). (Life RETROscript Ambion using reverse-transcribed was cDNA manufactur the instructions. er’s to according Technologies), (Life reagent LS iso was 10 × RNA 1 approximately Ficoll from Healthcare). lated a (GE on serum Ficoll-Paque isolated using were with cells gradient plasma concurrent marrow llamas Bone bleeds. immunized from obtained sequencing. DNA and RT-PCR Inc., Capralogics, the by Use and Committee. Care approved Animal Institutional protocols to according were performed procedures out for animal and All MS. prepared V digested the to corresponding band with iodoacetamide and run on a 4–12% Bis-Tris gel. The ~15 kDa resuspended in LDS plus 25 mM DTT. The samples were alkylated EDTA, pH 8.0. These elutions were dried down in a SpeedVac and and PBS; protein was then eluted (iii) for 20 min with Tween-20; 0.1 M NH NH 0.1% M 0.1 plus (iv) PBS (ii) NaCl; mM 500 and pH 7.4, phosphate, 10 mM sodium (i) with washed then was resin The °C. 37 at h 4 for cysteine, mM 10 plus PBS in papain mg/ml 0.3 with digested then was resin The PBS. in equilibrated mM 500 and NaCl, followed by7.4, 1-4.5 M MgCl pH phosphate, sodium mM 10 with washed was resin GFP. This Sepharose-conjugated with V incubated then this of mg 3 PBS. into dialyzed and pooled acid, acetic mM 100 or were pH elutions and 3.5, 150 mM These A NaCl (Protein resin). resin), G (Protein NaCl mM 500 and V bound and 7.0, pH phosphate, sodium mM 20 with washed were resins was then incubated for 30 min with Protein A-agarose resin. Both resin bated for with Protein G-agarose 30 min. The flow-through incu and 7.0, pH phosphate, sodium mM 20 was in tenfold serum of diluted ml 2.5 injection. final the after days 10 obtained were bleeds Serum intervals. week three at performed IFAwere with protein mg 5 of injections additional CFA.Three with tein mCherry-His His ( the see please Protocol procedure, Supplementary identification nanobody entire the V of Isolation ONLINE doi: with performed instead was PCR second the sequencing, MiSeq Lama glama Lama ′ ′ -GGTACGTGCTGTTGA -GGTACGTGCTGTTGA ACTGTTCC-3 -GTCCTGGCTGCTCTTCTACAAGG-3 10.1038/nmeth.3170 6 , and a 4 year old male llama, Marley, with recombinant recombinant with Marley, llama, male old year 4 a and , GGAGACGGTGACCTGGGT-3 H H regions were specifically reamplified using framework framework using reamplified specifically were H regions

METHODS H H IgG was eluted with 100 mM acetic acid, pH 4.0, 4.0, pH acid, acetic mM 100 with eluted was IgG H 2 5 ), Barbie, was immunized with recombinant GFP- recombinant with immunized was Barbie, ), 6 . The approximately 400 bp product of this reac this of product bp 400 approximately The . through subcutaneous injections of 5 mg of pro of mg 5 of injections subcutaneous through 4 H OAc, 0.1 mM MgCl mM 0.1 OAc, antibodies. H ′ - CGTATCGCCTCCCTCGCGCCATCAG ′ . In short, a 5 year old female llama llama female old year 5 a short, In . - CTATGCGCCTTGCCAGCCCGCT 2 For detailed information on on information detailed For in 20 mM Tris, pH 7.5, and then ′ Bone marrow aspirates were were aspirates marrow Bone 7 454 adaptor sequences: 454- sequences: adaptor 454 to 6 × 10 × 6 to 2 , 0.02% Tween-20. Bound Bound Tween-20. 0.02% , ′ ) (adaptor sequences are are sequences (adaptor ) H H region was then cut cut then was region H H ′ H variants lacking a lacking H variants ) ) primers were used 7 ′ ) and CALL002 CALL002 and ) cells using Trizol using cells H 4 H fraction was was fraction H OH and 0.5mM 2 5 . The The . ′ ------)

redundancy. extreme such with presented if crash or slow very become either sequencing of the single-chain antibody locus, and search engines next-generation by provided is that redundancy extreme the dle han to equipped well not are they redundancy, sequence some handle can engines search most though even because peptides unique containing only FASTAfile It a file. construct FASTA to a important in is saved and constructed was longer or acids trypsin with digested was ORF selected The selected. was (ORF) frame reading open longest the read each for and frames, reading 6 all in reads sequencing translating by prepared were identification preparation. Database 300-bp × using 2 reads. with paired-end preparation sequencer MiSeq a library on run and before kits, Illumina adaptors MiSeq to ligated ACCTGGGT-3 MiSeq-VHH-reverse (5 ATGGCT[C/G]A[G/T]GTGCAGCTGGTGGAGTCTGG-3 (5 MiSeq-VHH-forward identification: cluster in aid to sequences, adaptor replacing 12-mers random (X representing any amino acid) between position 93 and 103 of 103 and 93 position between acid) any amino representing (X for searched the the anchor CDR3 left the region, algorithm YXC of locate to presence example, For acids. amino the trailing and and leading specific sequence the in position approximate of basis the on sequence the within located were regions CDR The above). described as only, ORF (longest reads sequencing DNA value, were mapped from to translated expectation the sequences X! Tandem search engine. Then the identified peptides, filtered by the using peptides tryptic of database custom the on performed of V identification MS-based 4.3.1). (version ReAdW with format mzXML into converted were files raw The scans. MS tandem from excluded were species charge unassigned and Single s). 60 duration: sion exclu s, 12 duration: repeat 2, counts: (repeat enabled were sion exclu AGC dynamic and predictive both more peptides, to scan mass (lock accuracy mass improved for used was calibration Internal ms). 5 = time activation 35%, width = (isolation 2 dissociation Th, CE = with collision-induced of the top twenty most intense Tandempeaks. MS was outcarried 5E3) = target (AGC trap ion the in MS tandem by followed 1E6) was outcarried in the orbitrap (resolution = 30,000, AGC target = scan survey a spectrometer, mass the In analysis. for Scientific) sprayed into an LTQ-Velos-Orbitrap mass spectrometer (Thermo directly and HPLC 1260 Agilent an by generated splitting) flow after nL/min 150 min, 120 acid, acetic 0.5% acetonitrile, 42% to (0% gradient a linear with separated subsequently were peptides (75 column 15 C18 phase reverse home-packed a onto with a was ing digest cleaned proteolytic STAGE tip solution (140 extraction with once extracted was gel The overnight. °C 37 at (80 trypsin proteomic-grade with digestion in-gel to subjected then excised, destained, and dehydrated. The dehydrated gel slices were spectrometry. Mass µ µ m tip) (New Objective) m with tip) a bomb. (New pressurized Objective) The loaded L; 25 ng trypsin, 25 mM ammonium bicarbonate) (Promega) in silico in µ L; 67% acetonitrile, 1.7% formic acid). The 1.7% formic acid). L; result 67% acetonitrile, and a list of unique tryptic peptides of 7 amino amino 7 of peptides tryptic unique of list a and ′ ). The product of this PCR was gel purified, purified, gel was PCR this of product The ). Gel sections containing V containing sections Gel ′ The protein sequence databases used for used databases sequence protein The -NNNNNNNNNNNN -NNNNNNNNNNNN GGAGACGGTG H H H sequences. m / ′ z -NNNNNNNNNNNN -NNNNNNNNNNNN = 371.1012). In order order In 371.1012). = The MS search was H H domains H were domains n a 5 ture methods 6 and loaded µ m I.D., I.D., m ′ ) ) and - - - -

© 2014 Nature America, Inc. All rights reserved. TAAGTATTTCA-3 GGCCGCGAGTAATAACAATCCAGCGGCTGCCGTAGGCAA CCGGCCATGGCTG-3 CCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAG 5 primers: complementary sites using was cloned into sequence at pET21b NdeI and restriction BamHI sites at 5 XhoI restriction and BamHI incorporating Operon), MWG (Eurofins synthesis in expression Cloning. <100). score (uniqueness enough unique are peptides regions, have framework fragmentation pattern within the variable and regions; (ii) CDR3 regions variable both embrace which peptides, CDR3 long (i) sure make to Manual performed was inspection JavaScript. and HTML Perl, in implemented is Magic Llama rank. corresponding its and sequence each regarding tion interactive display of the candidate list showing informa detailed and ranking (iii) and grouping peptides of candidates are performed automatically, identified producing the an of mapping (ii) regions, CDR of annotation (i) Then saved. peptides matching MGF are the files X! uploaded, Tandem the and be search will executed the Once search. Tandem X! the for chosen be can error fragment and parent the and database, sequence peptide tryptic selected a for uploaded be can files (MGF) MS the Next, above. described as peptides, tryptic of cre database to MS-searchable an ate digested and translated automatically be will reads the uploaded, Once sequencing. DNA high-throughput from reads magi at available is code Source at interface web-based a through the has nanobody sequences been automated and can be accessed Magic’. ‘Llama identification: sequence for nanobody application Web-based 3 Figure Supplementary in shown is view list candidate a of example An Perl. in mented imple were above described algorithms All shown sequence. each for metrics ranking the and information mapping peptide and annotated regions CDR with inspection page HTML manual interactive for an as displayed was list candidate candidate The the of pool. diversity sequence overall the maximized we for production, groups different from hits sequence By choosing ent groups that have one shared sequence were combined. further differ and sequence, the in difference acid amino one i.e., was there 1, was member existing an to distance hamming group its a to where assigned was sequence A CDR3. particular a to ing the identification of the highest-confidence sequence correspond for allowing together, grouped were regions CDR3 similar sequences with Finally, sequence. the producing reads the of count a and region; framework including coverage overall weight; est and high of CDR length regions, with individual CDR3 carrying coverage MS were: metric the in included factors The available. evidence bioinformatics the of basis the on candidate their potential and sequences a the as sequence each rank to to calculated was a metric regions, CDR mapped were peptides the Once and position WG between anchor right the and sequence, the n with sites, restriction XhoI and BamHI using pET21b-pelB into a ture methods n c – 4 of the sequence, where where sequence, the of 4 – . Llama Magic allows upload of FASTA files containing containing files FASTA of upload allows Magic Llama . Nanobody sequences were codon-optimized for for codon-optimized were sequences Nanobody Escherichia coli Escherichia The pipeline that was used for identification of of identification for used was that pipeline The ′ . Nanobody sequences were then subcloned subcloned then were sequences Nanobody . ′ and 5 ′ . and 3 ht and cloned into pCR2.1 after gene gene after pCR2.1 into cloned and tps://github.com/Fen ′ -GATCCAGCCATGGCCGGCTG ′ ends, respectively. ends, A leader pelB n is the length of the sequence. sequence. the of length the is http://ww ′ -TATGAAATACTTATTG w.llamamagic.org yoLab/llama- n – 14 14 – / ------.

eluted with 15 was protein bound and buffer binding with washed were beads ofnanobody-Dynabead slurry. After 30-mina incubation at °C,4 0.1 M PMSF, 3 Tween-20,0.01% NaCl, mM 350 7.4, pH HEPES, mM (20 buffer 50 to added were protein–bindingassays.Fluorescent then was elution The PBS. into dialyzed imidazole). M 0.3 NaCl, M 0.5 8.0, pH phosphate, sodium mM (20 buffer elution buffer His with eluted wash and His with washed (20 mM sodium (Sigma), phosphate, pH 8.0, 1 M NaCl, 20 mM resin imidazole), affinity nickel a shock by osmotic by lated pelleted then °C, 5,000 12 at spin at 10-min h 18–20 for induced were Cells cells (DE3) of IPTG Express with at 0.1 induced mM. concentration a final (Agilent), Arctic in promoter T7 a under expressed nanobodies. of Purification His C-terminal the before just site cleavage Healthcare) (GE Protease PreScission a encoding also primers to 100 ng/mL in 1% BSA in PBS. Cells were washed four times times four washed were Cells PBS. in BSA 1% in ng/mL 100 to diluted Technologies), (Life ester succinimidyl 568 Fluor to Alexa at conjugated h 1 nanobody for recombinant with incubated temperature then room were They goat 10% PBS. with in h BSA 1 for serum/1% blocked and min. 10 0.5% for with X-100 Triton permeabilized were Cells mitochondria-GFP). (for for 10 min (for tubulin-GFP) or in 2% paraformaldehyde for 10 and processed min after 18–20 h. Cells were fixed in ice-cold methanol 4 using Technologies) (Life gents rea 2.0 BacMam mitochondria-GFP or tubulin-GFP CellLight tested negative for Cells with were mycoplasma. Cells transfected streptomycin at 37 °C with 8% CO penicillin/ and FBS 10% with medium DMEM in coverslips on microscopy. Immunofluorescence on and rate off grouped rate, using model, Langmuir a with data the to fit were curves Binding software. Manager ProteOn the using analyzed and processed were injections these from sensorgrams Binding MgCl residual bound protein was eliminated by regeneration with 4.5 M injections, of 90 time s, by 600 s. followed Between a dissociation at 50 injected were Proteins ning buffer of 20 mM HEPES, pH 8.0/150 mM NaCl/0.01% Tween. ing 4 or 5 concentrations of each protein, in with triplicate, a run ligand. of (RU) units response 600–800 approximately ethanolamine-HCl M 1 30 at 8.5) running (pH by deactivated was surface 25 at injected and 5.0, pH acetate, 5 to diluted then was ligand The s. 300 30 of rate flow a at run EDC, mM 50 and sulfo-NHS 50 with mM activated was first chip: the GLC chip sensor surface ProteOn a on immobilized was (Bio-Rad). mCherry or System GFP Recombinant Array Interaction Protein XPR36 Proteon K d K determinations. d values of recombinant nanobodies were determined by inject 2 in 10 mM Tris, pH 7.5, run at 100 100 at run 7.5, pH Tris, mM 10 in µ µ µ L LDS. Elutions were run on a 4–12% Bis-Tris gel. g/mL pepstatin A). This was incubated with 25 L/min for 300 s. This led to immobilization of of immobilization to led This s. 300 for L/min R µ max l of 2 mg/mL 2 of l P maueet wr otie o a on obtained were measurements SPR g values. . The periplasmic fraction was then iso then was fraction periplasmic The . 1 7 . This fraction was bound to His-Select His-Select to bound was fraction This . µ L/min for 120 s, or 100 or 100 s, 120 for L/min pelB-fused nanobodies were were nanobodies pelB-fused E. coli E. 2 µ in a environment. humidified µ L of reagent per 5,000 cells, cells, 5,000 per reagent of L L/min for 180 s. Finally, the the Finally, s. 180 for L/min HeLa cells were cultured cultured were cells HeLa 2 µ lysate diluted in binding in diluted lysate µ g/mL in 10 mM sodium sodium mM 10 in g/mL g of fluorescent proteinfluorescent of g 6 doi: tag. 10.1038/nmeth.3170 µ L/min for 36 s. s. 36 for L/min µ µ L/min for for L/min L/min for L/min µ L - - - -

© 2014 Nature America, Inc. All rights reserved. lysate were taken before and after Dynabead binding. These were These binding. lysate were before and taken after Dynabead duplicate. in performed were Experiments components. Nup84-complex known to late corre not does which Seh1, and Nup85/Nup145c between lane the of region the of density the from estimated was Noise bands. the as defined was combined densities of Nup84-GFP,yield or Nup120, and Signal Nup85/Nup145c software. ImageJ using gels SDS-PAGE from densities band calculating by quantified were Complete Protease Inhibitor, EDTA free (Roche). of 20 mM HEPES, pH 7.4, 300 mM NaCl, 0.5% Triton X-100, with buffer binding a in cells, ofmg 100 with wereused slurry bead of GFP from HeLa cells were performed as previously described X-100, 0.1 M PMSF, and 3 pH 8.0, 300 mM NaCl, 110 mM KOAc, 0.1% Tween-20, 0.1% Tritoncentrifugation, and the binding buffer consisted of 20 mM HEPES, mCherry (from yeast with HTB2 genomically tagged at the C terminus with isolations forHTB2-mCherry conditionsused were Similar cells. 50 experiment, PMSF, 3 0.1M and CHAPS, 0.1% consisting of 20 mM HEPES, pH 7.4, 500 mM NaCl, 2 mM MgCl GFP were carried out as previously described, using binding buffer 18- to 20-h incubation at 30 °C. Affinity isolations of yeast Nup84- an with sulfate, ammonium M 1 and 8.0, pH phosphate, sodium used per 1 mg of Dynabeads, with conjugations magnetic carried out in 0.1 M lished IgG coupling conditions epoxy-activated to Dynabeads (Life conjugated Technologies), with minor modifications to pub were nanobodies complexes. protein tagged of isolations Affinity Healthcare). Precision/GE (Applied softWorX using software algorithm by a 60×/1.42 deconvolution processed were images or Raw cells. HeLa of case objective, the in objective (NA) aperture Olympus an with 100×/1.40–numerical Precision/Olympus), (Applied microscope glycerol/PBS. 70% in mounted were Cells five with times BSA 0.01% in PBS, two the final washes for 5 min. to diluted 3.3 nanobody with °C 4 at overnight stained were Cells milk/PBS Triton/2% 0.25% in min 30 for permeabilized and were and in fixed sucrose/PBS 4% blocked paraformaldehyde/2% phase Yeast coverslips. mid-log A–coated on concanavalin to to settle and allowed grown was mCherry with terminus C the at cells. HeLa to identically mounted and washed, stained, then were Cells min. 30 for PBS in BSA serum/1% goat 10% with blocked and min, 5 for Triton 0.1% with permeabilized min, for 30 to settle allowed coverslips, Approximately 1 × 10 4% formaldehyde. cold with min 10 for fixed and 1:1 mixed were strain each from 10 × 1 of density cell a to tured Technologies). (Life Diamond ProLong with mounted then wash, final the in included (DAPI) with PBS/0.01% BSA, with 300 nM 4,6-diamidino-2-phenylindole doi: To determine affinity isolation yields, samples of resuspended resuspended of samples yields, isolation affinity To determine ratio signal-to-noise and yield isolations, Nup84-GFP For Restoration Image DeltaVision a on obtained were images All An Sec13-GFP–tagged and Wild-type 10.1038/nmeth.3170 µ g/mL g/mL in Triton/1% 0.25% were They washed then BSA/PBS. S. cerevisiae S. 5 8 ), ), except lysate was sonicated four times for 10 s before µ L of bead slurry were used with 0.5 g of yeast yeast of g 0.5 with used were slurry bead of L W303 strain with Htb2 genomically tagged tagged genomically Htb2 with strain W303 µ g/mL pepstatin A. Isolations of RBM7- 5 7 7 . . 10 as previously described previously as µ g/mL pepstatin A pepstatin g/mL µ g g recombinant protein were T. brucei T. 6 cells were spotted onto were spotted cells strains were cul were strains Recombinant 5 7 . For each each For . 3 3 4 . Cells Cells . . 10 3 µ 1 2 - - - l . ,

interacting residues using PISA using residues interacting of PDB structure ing it to crystal the site by of and mapping GFPuv compar the dimerization verified and that of GFPuv_M ( a from a between comparison ( residues GFPuv of assignment our confirming thereby method, perturbation shift European the at pistart.htm service (PISA) Institute Bioinformatics Assemblies and Surfaces of by PDB analysis site (obtained PDB of GFP/GFP-Trapthe from structure is complex available crystal GFP-Trap nanobody, identified previously a of site binding the mapping by verified was assignment GFPuv in available was assignment of 97% for obtained two, the between variants of GFP were used in the preparation of NMR samples: samples: NMR of preparation the in used were GFP of variants Mapping of nanobody binding epitopes on GFP by NMR. service web fr Phylogeny. the using sequences acid amino LaG from generated analysis. Phylogenetic nm. 425 of wavelength excitation an at nm 600 to nm 450 from measured were spectra emission and nm, 560 of wavelength emission nm an at 530 taken were to nm 300 from spectra Excitation reader. microplate (BioTek) Neo Synergy a on obtained were spectra Fluorescence or 10 buffer either with mixed were PBS in spectra. Fluorescence ImageJ using quantified were software. Signals milk. dry TBST/2% in 1:3,000 diluted NA931V) no. cat. Healthcare, (GE antibody ary and milk, dry an TBST/2% HRP-conjugated anti-mouse, second in 1:1,000 diluted 11814460001) no. cat. (Roche, antibody GFP anti- mouse using blotting by and western probed Technologies) (Life buffer running MES in gel Bis-Tris Novex 4–12% a on run ( simulated a and a between comparison cryoprobe. TCI a with equipped spectrometer MHz Avance DPX-600 Bruker a on K at 310 sured H LaG, 10 phosphate mM buffer,of sodium pH 7.4, 150 mM NaCl and excess 90% molar 1–1.2 a of presence the in or alone either variants. GFP 1 Table GFPuv of version monomeric a (GFPuv_M), PBD from available was ture from available were backbone which for variant GFP-His upeetr Fg 14a Fig. Supplementary 2 Backbone Backbone Backbone 500 and 20 between contained NMR samples All O/10% D O/10% 3K1 summarizes the amino acid sequences of the three three the of sequences acid amino the summarizes 6 K (EGFP), the variant used for immunization; GFPuv, the (ref. (ref. l ) overlaps with the one determined by the chemical chemical the by determined one the with overlaps ) 2 1 O. All NMR spectra (2D (2D O. spectra NMR All 1 H- 59 H- , 6 2 15 15 0 1 9 . N assignments of N from were GFPuv a obtained assignments H- 1 ). The X-ray crystallography–derived binding binding crystallography–derived X-ray ). The N assignments of GFPuv_M were obtained obtained were GFPuv_M of assignments N H- Supplementary Fig. 16 Fig. Supplementary 15 BMRB 566 BMRB 15 Supplementary Fig. 14a 1 N HSQC based on on based HSQC N Samples of recombinant GFP at 0.5 0.5 at GFP recombinant of Samples 1 Phylogenetic trees and alignments were were alignments and trees Phylogenetic H- N backbone assignment of GFPuv was was GFPuv of assignment backbone N H- 6 2 ; ; 15 15 ). Owing to a very high similarity similarity high very a to Owing ). http://www N backbone resonances for which which for resonances backbone N 15 N HSQC spectrum of GFPuv alone alone GFPuv of spectrum HSQC N 1B9 BMRB 566 BMRB 1 N- H- 6 2 6 3K1 C 1 ). 15 (ref. (ref. H chemical shift assignments assignments shift chemical H (ref. (ref. N HSQC spectrum of GFPuv N spectrum HSQC 1B9 K 1 .ebi.ac.uk/pdbe/prot H- by the Protein Interfaces, by the Interfaces, Protein 3 4 C 6 9 1 15 . The accuracy of the the of accuracy The . (ref. (ref. ) and a crystal struc crystal a and ) ); and GFPuv_A206K GFPuv_A206K and ); BMRB 566 BMRB µ N HSQC) were mea N HSQC) ). M of a LaG protein. protein. M of a LaG 6 2 1 9 ). Assignment was . . , on GFPuv. The The GFPuv. on , 4 Supplementary Supplementary 1 n ) (analyzed for ) (analyzed a µ ture methods M M 6 15 (ref. N-GFP N-GFP Three _int/

µ 3 M 9 ­ - - - )

© 2014 Nature America, Inc. All rights reserved. Table 2 Table sites. binding LaG all GFP-Trap for p.p.m. 0.03 and site for dimerization GFPuv for and site p.p.m. binding 0.05 was residues binding-site for cutoff states bound and The CSD protons, respectively. nitrogens and amide the between free the in differences shift chemical the are where CSD is the total chemical shift difference and n a All LaG binding-site residues are listed in in listed are residues binding-site LaG All All chemical shift differences were calculated using equation (1) ture methods , and their respective respective their and , CS D =    ∆ 1 d 5 H- N 15    2 N HSQC spectra are shown shown are spectra HSQC N 2 + ∆ d H 2 Supplementary Supplementary ∆ δ N and ∆ δ (1) H 62. 61. 60. 59. 58. 57. 56. GFPuv_M. free the of spectrum in

Supplementary Figure 15 Figure Supplementary crystalline state. crystalline Science cells. live microdomains of membrane into GFPs monomeric lipid-modified non-specialist. buildingdatasetsphylogeneticfor analysis. mechanism. transport andarchitecture, assemblies. proteomics. in pretreatment sample LC/MSnanoelectrospray, desorption/ionization,and laser matrix-assisted Krissinel, E. & Henrick, K. Inference of macromolecular assemblies from assemblies macromolecular of Inference K. Henrick, & E. Krissinel, ofPartitioning R.Y.Tsien, & A.C. Newton, J.D., Violin, D.A., Zacharias, Dereeper,A. Dereeper,Audic,BLAST-EXPLORERA.,Claverie,Blanc,S., G.& J.M. helpsyou M.P.Rout, F.Alber, Ishiham J., Rappsilber,

2 et al. et 9 6 et al. et , 913–916 (2002). 913–916 , Nature et al. et Determining the architectures of macromolecular of architectures the Determining Nucleic Acids Res. Acids Nucleic The yeast nuclear pore complex: composition, complex: pore nuclear yeast The J. Mol. Bi Mol. J. Phylogeny.fr: robust phylogenetic analysis for the for analysisphylogenetic Phylogeny.fr:robust

4 50 a, Y. & Mann, M. Stop and go extraction tips for tips extraction go and Stop M. Mann, & Y. a, , 683–694 (2007). 683–694 , ol.

37

overlaid with the the with overlaid 2 3 , 774–797 (2007). 774–797 , 6 , W465–W469 (2008). W465–W469 , Anal. Chem. Anal. J. Cell Biol. Cell J. BMC Evol. Biol.Evol.BMC

75 doi:

, 663–670 (2003). 663–670 , 14 10.1038/nmeth.3170 8 , 635–651 (2000). 635–651 , 1

H- 1 0 , 8 (2010).8 , 15 N HSQC HSQC N