Molecular Phylogenetics and Evolution 97 (2016) 55–68
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier.com/locate/ympev
Evolution around the Red Sea: Systematics and biogeography of the agamid genus Pseudotrapelus (Squamata: Agamidae) from North Africa and Arabia q ⇑ Karin Tamar a,b, , Sebastian Scholz c, Pierre-André Crochet d, Philippe Geniez d, Shai Meiri a,b, Andreas Schmitz c, Thomas Wilms e, Salvador Carranza f a Department of Zoology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv 6997801, Israel b The Steinhardt Museum of Natural History, Israel National Center for Biodiversity Studies, Tel Aviv University, Tel Aviv 6997801, Israel c Natural History Museum of Geneva (MHNG), Department of Herpetology & Ichthyology, Route de Malagnou 1, 1208 Geneva, Switzerland d CNRS-UMR5175, CEFE – Centre d’Ecologie Fonctionnelle et Evolutive, 1919 route de Mende, 34293 Montpellier cedex 5, France e Zoologischer Garten Frankfurt, Bernhard-Grzimek-Allee 1D, 60316 Frankfurt am Main, Germany f Institute of Evolutionary Biology (CSIC-Universitat Pompeu Fabra), Passeig Marítim de la Barceloneta, 37-49, E-08003 Barcelona, Spain article info abstract
Article history: Since the Oligocene, regions adjacent to the Red Sea have experienced major environmental changes, Received 15 August 2015 from tectonic movements and continuous geological activity to shifting climatic conditions. The effect Revised 22 November 2015 of these events on the distribution and diversity of the regional biota is still poorly understood. Accepted 30 December 2015 Agamid members of the genus Pseudotrapelus are diurnal, arid-adapted lizards distributed around the Available online 6 January 2016 Red Sea from north-eastern Africa, across the mountains and rocky plateaus of the Sinai and Arabian Peninsulas northwards to Syria. Despite recent taxonomic work and the interest in the group as a model Keywords: for studying biogeographic and diversity patterns of the arid areas of North Africa and Arabia, its taxon- Molecular clock omy is poorly understood and a comprehensive phylogeny is still lacking. In this study, we analyzed 92 Multilocus phylogeny Phylogeny Pseudotrapelus specimens from across the entire distribution range of the genus. We included all known Phylogeography species and subspecies, and sequenced them for mitochondrial (16S, ND4 and tRNAs) and nuclear (MC1R, Reptiles c-mos) markers. This enabled us to obtain the first time-calibrated molecular phylogeny of the genus, Taxonomy using gene trees, species trees and coalescent-based methods for species delimitation. Our results revealed Pseudotrapelus as a monophyletic genus comprised of two major clades and six independently evolving lineages. These lineages correspond to the five currently recognized species and a sixth lineage relating to the synonymized P. neumanni. The subspecific validity of P. sinaitus werneri needs further assessment as it does not form a distinct cluster relative to P. s. sinaitus. The onset of Pseudotrapelus diver- sification is estimated to have occurred in Arabia during the late Miocene. Radiation has likely resulted from vicariance and dispersal events due to the continued geological instability, sea level fluctuations and climatic changes within the region. Ó 2016 Elsevier Inc. All rights reserved.
1. Introduction tectonic movements and climatic changes which took place during the mid-Cenozoic (Ruddiman et al., 1989; Le Houérou, 1992, 1997; The unique biota of North Africa and Arabia inhabits a diverse Schandelmeier et al., 1997; Rögl, 1999; Bojar et al., 2002; Bosworth array of habitats ranging from rocky plains and sandy deserts to et al., 2005). One of the most influential geological episodes in the high mountain ranges, high plateaus and low valleys, and has a Saharo–Arabian region began in the Oligocene with the counter- complex and dynamic evolutionary history. The distinctiveness clockwise movement of the Arabian plate. This event created the and diversity of the biota were greatly influenced by the massive Red Sea, the Gulfs of Aden, Suez and Aqaba, and caused the uplift of the peripheral mountain ridges in western Arabia and north- eastern Africa (Girdler and Southren, 1987; Bohannon et al., q This paper was edited by the Associate Editor J.A. Schulte. 1989; Rögl, 1999; Bojar et al., 2002; Bosworth et al., 2005). The ⇑ Corresponding author at: Department of Zoology, George S. Wise Faculty of Life geological instability and volcanic activity around the Red Sea per- Sciences, Tel Aviv University, Tel Aviv 6997801, Israel. sist to this day (Powers et al., 1966; Bosworth et al., 2005; Edgell, E-mail address: [email protected] (K. Tamar). http://dx.doi.org/10.1016/j.ympev.2015.12.021 1055-7903/Ó 2016 Elsevier Inc. All rights reserved. 56 K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68
2006). Global climate change during the Miocene and the subse- studies have reported it as ranging from southern Oman and quent aridification process were additional factors that greatly Yemen to Saudi Arabia (Melnikov and Melnikova, 2013). influenced the fauna of the Saharo–Arabian region. In particular, Melnikov et al. (2013a) described P. jensvindumi from Jebel Al Akh- the expansion and contraction of desert areas in North Africa and dar in northern Oman, based on a single specimen. It is so far Arabia (Hsü et al., 1977; Ruddiman et al., 1989; Flower and known only from that particular area of eastern Arabia (Melnikov Kennett, 1994; Le Houérou, 1992, 1997; Zachos et al., 2001; and Melnikova, 2013). Recently, Melnikov et al. (2015) described Griffin, 2002), had a major effect on the distribution and diversifi- P. chlodnickii from a single specimen collected at Gamamiya in cation of the local fauna (e.g., Douady et al., 2003; Fonseca et al., the Bayuda Desert, Sudan. An additional species, P. neumanni 2009; Zhou et al., 2012). (Tornier, 1905), was described from the Lahej area in southern The influence of these dramatic geological and climatic events Yemen, though it was later synonymized with P. sinaitus by on the biogeography and diversification of the African and Arabian Arnold (1980) due to intermediate forms with neighboring popula- herpetofauna is not well understood. Extensive studies have only tions (synonym accepted by Fritz and Schütte, 1988; Schätti and recently been carried out, providing important information regard- Gasperetti, 1994). This species was regarded as valid by Melnikov ing the origin, diversity, cladogenesis and biogeography of the et al. (2012) and their later studies, with incomplete systematic regional herpetofauna assemblage (e.g., Pook et al., 2009; details. Carranza and Arnold, 2012; Metallinou et al., 2012, 2015; Portik In this study we seek to clarify the systematics of Pseudotrapelus and Papenfuss, 2012, 2015; Šmíd et al., 2013; Kapli et al., 2015). and to elucidate the different diversification processes affecting its The agamid lizards of the genus Pseudotrapelus Fitzinger, 1843 evolutionary history. Pseudotrapelus, being mainly endemic to the are medium sized, saxicolous and heliophilous, typically active mountains and rocky habitats around the Red Sea, provides an during the hottest time of day (Baha El Din, 2006). Pseudotrapelus excellent model to assess the biogeographic patterns of the fauna range throughout the mountainous areas surrounding the Red connecting Arabia and Africa around the Red Sea. We therefore Sea, from western Eritrea in Africa across the southern Sinai Penin- use the genus as a model to assess the influence of the dynamic sula and southern Israel to the southern and eastern coasts of the geological history and climatic shifts on the origin and evolution Arabian Peninsula, and northwards to southern Syria (Sindaco of the regional fauna, inferring phylogenetic relationships using and Jeremcˇenko, 2008; Fig. 1). These lizards occupy a diverse array multilocus genetic data. We also use gene trees and species trees of arid rocky habitats in hilly and mountainous regions, including and species-delimitation methods based on coalescence to identify well vegetated wadis and slopes, barren rocky hillsides, and the different taxonomic units in order to compare them with the boulder-strewn plains (Arnold, 1980; Disi et al., 2001; Baha El current taxonomy and to determine whether there is still unde- Din, 2006; Gardner, 2013). scribed diversity. Systematic studies of Pseudotrapelus have long been hindered by the morphological similarity among African and Arabian popu- 2. Material and methods lations. For many years Pseudotrapelus was thought to be com- prised of a single species, P. sinaitus, albeit suspected to be a 2.1. Taxon sampling species complex (e.g., Baha El Din, 2006). Although identifying dif- ferent morphological forms, authors conservatively classified the In order to assess the systematic status of species and popula- diversity among populations as intraspecific variation of P. sinaitus tions, test biogeographic hypotheses, and investigate relationships, (Anderson, 1896, 1898, 1901; Arnold, 1980; Fritz and Schütte, a comprehensive sampling from across the known distribution 1988; Schätti and Gasperetti, 1994; Baha El Din, 2006). A recent range of the genus was carried out. We analyzed 92 samples of flurry of studies on Pseudotrapelus has left the systematics and bio- all currently recognized species and subspecies of Pseudotrapelus, geography of the genus obscured (i.e., Melnikov et al., 2012, 2013a, including specimens from the type localities of four species 2013b, 2014, 2015; Melnikov and Pierson, 2012; Melnikov and (Fig. 1; Table S1; one sequence was retrieved from GenBank). The Melnikova, 2013; Melnikova et al., 2015). Descriptions of four phylogenetic position of Pseudotrapelus within the Agaminae sub- new species were mainly based on single specimens, thus creating family has so far only been studied based on a single specimen much biogeographic uncertainty and taxonomic confusion. Current (Joger, 1991; Macey et al., 2006; Pyron et al., 2013; Leaché et al., classifications are predominantly based on external morphology, 2014). We therefore included specimens from several phylogenet- with no comprehensive comparisons among species. Phylogenetic ically closely-related genera to test the monophyly of the genus. studies on the genus were all based on extremely low sample sizes, We used Acanthocercus and Xenagama specimens as close out- and were mostly based on the mitochondrial COI gene only. groups based on published evidence, and members of Trapelus as To date, Pseudotrapelus includes five (Uetz, 2015) or six a distant outgroup to root the tree (Joger, 1991; Macey et al., (Melnikov et al., 2015) recognized species. Before 2012 the only 2006; Pyron et al., 2013; Leaché et al., 2014). Sample codes, vouch- recognized species across the whole range was P. sinaitus ers, localities and GenBank accession numbers are given in (Heyden, 1827), described from the Sinai Peninsula (probably from Table S1. Sampling localities of Pseudotrapelus specimens are close to Mt. Sinai in the southern Sinai Peninsula; Moravec, 2002; shown in Fig. 1. Samples were allocated to species on the basis of Melnikov and Pierson, 2012). The subspecies P. sinaitus werneri, the genetic results rather than on the basis of their morphological endemic to the basalt desert of northern Jordan and southern Syria, characters, as the diagnosis available for the species is still too was described by Moravec (2002). The four recently described spe- incomplete and distributional ranges within the genus are unclear cies, P. aqabensis, P. dhofarensis, P. jensvindumi and P. chlodnickii, are (see Section 4.1 ‘‘taxonomic account” for details). said to be differentiated by several morphological traits: body size, length of the third toe, number and position of the pre-anal pores, and the head and dorsal scalation. Pseudotrapelus aqabensis, 2.2. DNA extraction, amplification and sequence analysis described from a single specimen, was collected in the hills adja- cent to the city of Aqaba, Jordan (Melnikov et al., 2012) and occurs Genomic DNA was isolated from ethanol-preserved tissue sam- in north-western Saudi Arabia, southern Israel and the eastern ples using the SpeedTools Tissue DNA Extraction kit (Biotools, Sinai Peninsula (Melnikov et al., 2013b, 2014; Aloufi and Amr, Madrid, Spain). Individuals were sequenced for both strands of 2015). Melnikov and Pierson (2012) described P. dhofarensis from three loci. The mitochondrial dataset included two mitochondrial the Dhofar governorate in southern Oman, although subsequent gene fragments, the ribosomal 16S rRNA (16S) and the protein cod- K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 57
Fig. 1. Sampling localities of the Pseudotrapelus specimens, including type localities and the global distribution range of the genus (modified from Sindaco and Jeremcˇenko (2008)). Numbers correlate to specimens listed in Table S1 and colors to specimens in Figs. 2–4, S1 and S2. Taxon names correspond to changes proposed in this paper. 58 K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 ing NADH dehydrogenase subunit 4 (ND4) with the adjacent his- Haplotype networks were constructed for the nuclear genes tidine, serine, and leucine tRNA genes (tRNA). Two nuclear protein MC1R and c-mos (only full length sequences included). To resolve coding gene fragments were also amplified: the melano-cortin 1 the multiple heterozygous single nucleotide polymorphisms, the receptor (MC1R) and the oocyte maturation factor Mos (c-mos). on-line web tool SeqPHASE (Flot, 2010) was used to convert the Primers, PCR conditions and source references are listed in input files, and the software PHASE v.2.1.1 to resolve phased hap- Table S2. lotypes (Stephens et al., 2001; Stephens and Scheet, 2005). Default Chromatographs were checked manually, assembled and edited settings of PHASE were used, except for phase probabilities, which using Geneious v.7.1.5 (Biomatter Ltd.). For the nuclear genes, were set as 0.9 for c-mos and 0.5 for MC1R. The phased nuclear MC1R and c-mos, heterozygous individuals were identified and sequences were used to generate median-joining networks using coded according to the IUPAC ambiguity codes. Coding gene frag- NETWORKS v.4.6.1.3 (Bandelt et al., 1999). ments (ND4, MC1R and c-mos) were trimmed so that all started at the first codon position and were translated into amino acids 2.4. Species delimitation approaches and coalescent-based species tree to ensure that there were no premature stop codons. DNA sequences were aligned, for each gene independently, using the To evaluate the relationships and species boundaries within online application of MAFFT v.7 (Katoh and Standley, 2013) with Pseudotrapelus, we used different species delimitation approaches, default parameters (Auto strategy, Gap opening penalty: 1.53, Off- including a Bayesian coalescence approach (species tree; Edwards, set value: 0.0). For the 16S and tRNA fragments we applied the Q- 2009) and two delimitation methods. INS-i strategy, in which information on the secondary structure of We first used the Generalized Mixed Yule-coalescent analysis the RNA is considered. In order to remove regions without specific (GMYC; Pons et al., 2006) for estimating species boundaries. As this conservation, and poorly aligned positions of 16S and tRNA, we method relies on single locus data, we used a Bayesian concate- used G-blocks (Castresana, 2000) with low stringency options nated mitochondrial phylogenetic tree including haplotypes only, (Talavera and Castresana, 2007). Inter and intra-specific uncor- reconstructed with BEAST v.1.8.0 (Drummond et al., 2012). Infor- rected p-distances with pairwise deletion of the mitochondrial mation on the models, priors and runs is presented in Table S3, fragments, and the number of variable (V) and parsimony informa- and parameters applied were as above. We performed the tive (Pi) sites were calculated in MEGA v.5.2 (Tamura et al., 2011). GMYC function implemented in R (R development Core Team, 2013) using the ‘‘splits” package (Species Limits by Threshold Statistics; Ezard et al., 2009). We applied a single threshold algo- 2.3. Phylogenetic and nuclear network analyses rithm and compared to the null model (i.e., all individuals belong to a single species) using a log-likelihood ratio test as implemented Phylogenetic analyses were performed for the complete data- in the GMYC package. sets simultaneously using partitions by gene, and as specified by Multilocus coalescence-based Bayesian species trees for Pseudo- PartitionFinder v.1.1.0 (Lanfear et al., 2012) with the following trapelus were estimated using *BEAST (Heled and Drummond, parameters: linked branch length; BEAST models; BIC model selec- 2010). The first tree was based on the results obtained from the tion; greedy schemes search; single partition of the complete 16S GMYC analysis to define the lineages to be used as putative species and tRNA and by codons for the other protein coding genes and the second species tree was based on the BP&P ‘species’ (see (ND4, MC1R and c-mos). We used jModeltest v2.1.3 (Guindon below). Outgroups were excluded and only GMYC and BP&P and Gascuel, 2003; Darriba et al., 2012) to select the best model linages with a full set of genes were included. Analyses were run of nucleotide substitution for each gene partition independently. with phased nuclear genes, unlinked parameter values for clock, A summary of DNA partitions and relevant models is presented substitution models and trees (linked trees for the mtDNA parti- in Table S3. tions). The Yule process was used as the species tree prior with a Phylogenetic analyses for each dataset were performed using random starting tree. Information on the models, priors and runs maximum likelihood (ML) and Bayesian (BI) methods. Maximum is presented in Table S3. likelihood analyses were performed with RAxML v.7.4.2 Multilocus Bayesian coalescent species delimitation analyses (Stamatakis, 2006) using RAxMLGUI v.1.3 (Silvestro and were conducted with Bayesian Phylogenetics and Phylogeography Michalak, 2012) with a GTR+G model of evolution and parameters (BP&P v.2.2; Rannala and Yang, 2003; Yang and Rannala, 2010) estimated independently for each partition. All ML analyses were using nuclear loci (MC1R and c-mos) only. We used the first species performed with 100 random addition replicates and reliability of tree recovered from *BEAST (based on the GMYC analysis) as our the tree was assessed by 1000 bootstrap iterations (Felsenstein, guide tree. Both algorithms 0 and 1 were used, assigning each 1985). Bayesian analyses were performed with BEAST v.1.8.0 species delimitation model equal prior probability. As prior (Drummond et al., 2012) with the same dataset used in the ML distributions on the ancestral population size (h) and root age (s) analysis but without outgroups. Parameter values both for clock can affect the posterior probabilities for models (Yang and and substitution models were unlinked across partitions. Informa- Rannala, 2010), and since no empirical data were available for tion on the models, priors and runs is presented in Table S3. The . Pseudotrapelus, we tested four different combinations of priors xml file was manually modified to ‘‘Ambiguities = true” for the (Leaché and Fujita, 2010; see Table S3). We ran each of the rjMCMC nuclear partitions to account for variability in the heterozygote analysis twice to confirm consistency between runs (with sam- positions, instead of treating them as missing data. All BEAST anal- pling intervals of five). We considered speciation probability values yses were carried out in CIPRES science gateway (Miller et al., P0.95 as strong evidence of a speciation event. 2010). Posterior trace plots and effective sample size values of parameters (>200) of each run were assessed in Tracer v.1.5 2.5. Estimation of divergence times (Rambaut and Drummond, 2009). LogCombiner and TreeAnnotator (both available in BEAST package) were used to infer the ultramet- Lineage divergence times were estimated in BEAST v.1.8.0 ric tree. We treated alignment gaps as missing data, and the (Drummond et al., 2012) with one representative of each indepen- nuclear gene sequences were not phased. Nodes were considered dent GMYC lineage (based on gene partitions; the nuclear genes strongly supported if they received ML bootstrap values P70% unphased; see Table S1). For these analyses we included outgroups and posterior probability (pp) support values P0.95 (Wilcox and combined the ND4 and tRNA datasets together in order to be et al., 2002; Huelsenbeck and Rannala, 2004). able to implement evolutionary rates for the same mitochondrial K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 59 region available from the literature (see below). We used two dat- 2003; Table S3). Additional specifications were: symmetric dis- ing approaches, in both of which the .xml file was manually mod- crete trait substitution model; strict clock model for the location ified to ‘‘Ambiguities = true” for the nuclear genes (MC1R and c- trait; exponential prior for the discrete location state rate (loca- mos). Information on the models, priors and runs for each calibra- tions.clock.rate) with mean of 1.0 and offset of 0. tion approach is presented in Table S3. The first dating analysis was based on the average sequence evo- 3. Results lution rates estimated for the agamid genus Phrynocephalus (Macey et al., 2006; Pyron et al., 2013) according to Pang et al. (2003): 3.1. Taxon sampling and sequence data 0.0073–0.0132 substitutions/site/million years for 16S and 0.0113–0.0204 substitutions/site/million years for ND4 + tRNA. Our dataset comprised 92 Pseudotrapelus specimens sampled The ucld.mean priors of 16S (initial 0.0073; lower 0.0073; upper from localities across the distribution range of the genus, including 0.0132) and ND4 + tRNA (initial 0.0113; lower 0.0113; upper type localities (Fig. 1; Table S1). Sequences of 19 individuals 0.0204) were Uniform. The clock.rate priors for MC1R and c-mos belonging to other genera, sampled and retrieved from GenBank, were Uniform (initial 0.001; lower 0; upper 0.0204). were used as outgroups (Fig. 2; Table S1). The dataset included For the second dating analysis we used the posteriors of mitochondrial gene fragments of 16S (492 bp; V = 71; Pi = 66), selected nodes from Leaché et al. (2014): (a) the split between ND4 (681 bp; V = 265; Pi = 245) and tRNA (153 bp; V = 47; Xenagama taylori and X. batillifera (Normal distribution, mean 0.3, Pi = 45), and nuclear gene fragments of MC1R (663 bp; V = 31; stdev 0.15); (b) the split of X. zonura (Normal distribution, mean Pi = 25) and c-mos (372 bp; V = 6; Pi = 4) totaling 2361 bp. The con- 2.2, stdev 1) from other Xenagama species; (c) the root, split of Tra- catenated mitochondrial dataset revealed 67 unique haplotypes. pelus (Normal distribution, mean 38.8, stdev 5.5). The ucld.mean Nuclear markers included 47 haplotypes for MC1R and 55 for c- priors of 16S and ND4 + tRNA and clock.rates priors for MC1R mos with a 0.5 and 0.9 probability phasing threshold, respectively. and c-mos were Uniform (initial 0.001; lower 0; upper 1). Uncorrected genetic variation (p-distance) between and within Divergence times for the ingroup only (Pseudotrapelus) were species for the 16S and the ND4 gene fragments is presented in also estimated using a coalescent species tree approach in *BEAST Table S4. applying the rates of Pang et al. (2003), which gave very similar results to the other calibration strategy (see results; Table 1). ‘‘Species” were defined based on the results of the BP&P analyses. 3.2. Phylogenetic analyses and nuclear networks See Section 2.4 and Table S3 for the models, priors and parameter specifications. The results of the phylogenetic analyses indicate that Pseudo- trapelus is monophyletic (Fig. 2). The African genus Xenagama, from which we analyzed three of four recognized species, is also mono- 2.6. Ancestral area reconstruction phyletic. However, the genus Acanthocercus is polyphyletic, as two African Acanthocercus species (A. annectens and A. atricollis) form a To infer the phylogeographic history and estimate the ancestral clade with Xenagama, whereas the two Arabian species form a range of Pseudotrapelus, we used the Bayesian Stochastic Search clade with Pseudotrapelus. Moreover, the African Acanthocercus Variable Selection (BSSVS; Lemey et al., 2009) of the discrete phy- cyanogaster is the sister taxon to all these lineages. logeographic model implemented in BEAST. We analyzed the data Pseudotrapelus is divided into two major clades, Eastern and (including those of the closely related outgroups, Acanthocercus Western (Fig. 2). The two clades are composed of six clearly dis- and Xenagama), assigning three discrete biogeographic areas corre- tinct and well-supported lineages that mostly correspond to cur- sponding to the mountain ranges in the current distribution range rent taxonomic classifications (Figs. 2 and S1). The six lineages of Pseudotrapelus: (1) eastern Arabia – including the Hajar Moun- are well differentiated from each other in both mitochondrial tains in northern Oman and the United Arab Emirates (UAE); (2) and concatenated gene trees, in the *BEAST species tree, the species southern and western Arabia – including southern Oman, Yemen, delimitation analyses (GMYC, BP&P) and nuclear haplotype net- Saudi Arabia, Israel, Jordan and the Sinai Peninsula; (3) Africa – works (Figs. 2–4, S1 and S2). Bayesian and ML analyses yielded including Egypt and Sudan, and the Horn of Africa region. almost identical topologies for both partition approaches (Parti- We used the same dataset (GMYC representatives), models and tionFinder and independent genes; see material and methods prior settings as in the dating analysis, and for a temporal frame we and Table S3) with high Bayesian posterior probabilities and boot- applied the dating of evolution rates (rates based on Pang et al., strap values (Figs. 2 and S1). Genetic distances (p-distance) appear
Table 1 Results for each of the three calibration approaches used in this study (mean and the HPD 95% confidence interval): (i) rates of 16S and ND4 + tRNA based on Pang et al. (2003); (ii) calibration points based on the posteriors of Leaché et al. (2014); (iii) *BEAST analysis based on the rates of Pang et al. (2003).
Clade/taxon Calibration analysis (Mya) Pang et al. (2003) Leaché et al. (2014) *BEAST Root 31.8 (25.4, 38.9) 32.1 (21.9, 42.3) – Xenagama–Acanthocercus–Pseudotrapelus 18.3 (15, 21.7) 17.7 (11.2, 24.4) – Acanthocercus cyanogaster 16.1 (12.9, 19.5) 15.5 (9.8, 21.7) – Acanthocercus atricollis-Xenagama 7.6 (5.9, 9.5) 7.3 (4.5, 10.3) – Xenagama zonura 2.8 (1.9, 3.8) 2.5 (1.6, 3.7) – Xenagama taylori–X. bitillifera 0.28 (0.1, 0.5) 0.25 (0.1, 0.4) – Acanthocercus–Pseudotrapelus 15.9 (12.6, 19.3) 15.3 (9.7, 21.4) – Acanthocercus adramitanus–A. yemensis 6.7 (5.1, 8.4) 6.4 (3.9, 9.1) – Pseudotrapelus 8.1 (6.6, 9.8) 7.8 (4.9, 10.9) 8.1 (5.6, 10.8) Pseudotrapelus chlodnickii–P. sinaitus 5.1 (3.8, 6.6) 4.9 (2.9, 7.2) 5.2 (3.2, 7.4) Pseudotrapelus jensvindumi 5.6 (4.4, 6.8) 5.3 (3.2, 7.4) 5.2 (3.3, 7.2) Pseudotrapelus dhofarensis 4.2 (3.3, 5.2) 3.9 (2.4, 5.6) 4.1 (2.5, 5.7) Pseudotrapelus aqabensis–P. neumanni 3.6 (2.7, 4.5) 3.3 (2, 4.8) 3.4 (2, 4.8) 60 K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68
Fig. 2. Maximum likelihood (ML) gene tree of Pseudotrapelus inferred from 2361 bp of mitochondrial (16S, ND4-tRNA) and nuclear (MC1R, c-mos) gene fragments. Black dotes on the nodes indicate posterior probability in the Bayesian analysis (values P0.95, for both gene partitions and partitions by PartitionFinder [PF]; see Section 2.3 of Materials and Methods), and the ML bootstrap support values are indicated near the nodes (values P70%; ML, ML-PF). Age estimates based on the rates of Pang et al. (2003) are indicated near the relevant nodes and include the mean and, between brackets, the HPD 95% confidence interval. Asterisks indicate representatives used in the GMYC analysis (see Fig. S2). Taxon names correspond to changes proposed in this paper. Sample codes and colors correlate to specimens in Table S1 and in Figs. 1–5, S1 and S2. K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 61
Fig. 3. Species trees inferred in *BEAST. Posterior probabilities are indicated above the nodes (values P0.95 shown). (A) Specimens assigned to putative species based on the GMYC species delimitation result (see Fig. S2). Black rectangles on the nodes indicate taxa recognized by the species delimitation analyses inferred by BP&P (nuclear genes only; posterior values unite for all analyses are indicated below the nodes; see details in Table S3 and Section 2.4 in Material and Methods). (B) Specimens recognized as putative species by BP&P with time estimates based on the rates of Pang et al. (2003) (see Section 2.5 in Material and Methods). Taxon names correspond to changes proposed in this paper. Colors correspond to species in Figs. 1–5, S1 and S2. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
to be low within each lineage (16S: 0–1.1%; ND4: 0.3–7.4%; alleles. The c-mos network shows private alleles for the two sym- Table S4), especially within P. chlodnickii, P. sinaitus and P. jensvin- patric species from the Western clade (P. sinaitus and P. chlodnickii), dumi (Table S4). whereas, again, the two subspecies of P. sinaitus share alleles. The Western clade includes two lineages (Fig. 2) taxonomically Ancestral alleles are shared among the four Arabian species of recognized as P. chlodnickii and P. sinaitus. The lineages are clearly the Eastern clade, suggesting incomplete lineage sorting. distinct from one another, with high genetic distances (16S: 5%; ND4: 14.1%; Table S4). Pseudotrapelus chlodnickii includes speci- 3.3. Species delimitation and species trees mens from north-eastern Africa (Egypt and Sudan) and the western Sinai Peninsula (Fig. 1). Pseudotrapelus sinaitus includes specimens The level of genetic variability within Pseudotrapelus is not high, from Jordan, Syria and the Sinai Peninsula, ascribed to both sub- as reflected in both the genetic distances (p-distance; Table S4) and species of P. sinaitus – P. s. sinaitus and P. s. werneri. This lineage the results of the GMYC analysis with the single threshold includes samples from the proposed type locality of the species approach (Fig. S2; based on the concatenated mitochondrial haplo- from the Sinai Peninsula (Mt. Sinai in the southern Peninsula). type dataset). The latter analysis recovered two clades and 10 The Eastern clade includes the four remaining lineages. A north- effective putative species for both partition approaches ern Arabian lineage corresponding to P. jensvindumi (including the (logLnull = 501.521, 499.842; logLGMYC = 512.195, 511.434; holotype and specimens from the type locality at Jebel Al Akhdar; LR = 21.35, 23.183; p < 0.001; based on gene partition and Parti- Fig. 1) is sister to the other three, and ranges throughout the Hajar tionFinder, respectively; Fig. S2). The result of the likelihood ratio Mountains in northern Oman and the UAE. The three remaining test was significant for both partition approaches, indicating that lineages are from central and southern Oman; Yemen and southern the null model (i.e., a single population) could be rejected. Saudi Arabia; and northern Saudi Arabia to the Sinai Peninsula. The The Bayesian coalescent approach, using *BEAST, was performed Omani lineage is sister to the other two lineages and is recognized by treating each of the 10 GMYC entities as a separate putative spe- as P. dhofarensis (specimens sampled from and around the type cies (Fig. 3A). Several GMYC ‘‘species” unite together (IV and V; VI locality at Jebel Samhan in Dhofar; Fig. 1). It is comprised of sam- and VII; VIII, IX and X), resulting in a similar topology to that of the ples from the Al-Wusta and Dhofar Governorates in central and ML and BI concatenated and mitochondrial phylogenetic trees southern Oman, respectively, including the population from (Figs. 2 and S1). Besides the posterior probability for the grouping Masirah Island. The samples from the Sinai Peninsula are phyloge- of VI and VII (0.96; Fig. 3A), the posterior probability of the other netically closely related to samples collected from southern Israel, relationships is 0.99–1, implying that essentially all species trees Aqaba in Jordan and western Saudi Arabia, recognized as P. aqaben- in the posterior distribution had each lineage as monophyletic. sis (including samples from the type locality in Aqaba, Jordan; The relationships within the Eastern clade are not supported (i.e., Fig.1). The Yemeni and southern Saudi Arabian lineage corresponds posterior probability values of 0.88 for the separation of P. dho- to P. neumanni, previously recognized as a synonym of P. sinaitus farensis, and 0.92 for the separation between P. aqabensis and P. (see Section 4.1 for the taxonomic account). The separation neumanni). between P. aqabensis and P. neumanni is strongly supported in The results of the coalescent species delimitation analyses the concatenated tree (Fig. 2), but weakly supported in the mito- (BP&P; nuclear data only), using the *BEAST tree inferred with chondrial analyses (ML: 70%, 64%; BI: 0.94, 0.97; Fig. S1). the 10 GMYC ‘‘species” as the guide tree, yielded a six putative spe- The haplotype networks, constructed for the phased, full length cies model, with mostly consistent results regardless of the nuclear markers MC1R and c-mos, are presented in Fig. 4. The rjMCMC algorithm, (h) and (s) priors, and starting tree used MC1R network shows similar patterns and closely agrees with (Fig. 3A). the phylogenetic trees, as most of the observed polymorphism con- The *BEAST tree, based on the BP&P six species model guide tree tributes to the differentiation of specimens assigned to six lin- (Fig. 3B), supports the separation into two clades, and the distinc- eages/species. Within this network, clear haplotype tiveness of three species – P. chlodnickii, P. sinaitus and P. jensvin- differentiation is evident as no derived alleles are shared between dumi. The tree, however, did not support the relationships among species, including sympatric species, which are clearly distinct three lineages within the Eastern clade, which should be regarded from each other. The subspecies of P. sinaitus, however, do share as distinct species according to the previous BP&P analysis. 62 K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68
Fig. 4. Unrooted haplotype networks of MC1R and c-mos nuclear markers. Circle size is proportional to the number of alleles, with colors corresponding to species in Figs. 1– 3, S1 and S2. Codes correlate to the two alleles (i.e., a and b) of specimens listed in Table S1. Taxon names correspond to changes proposed in this paper. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 63
3.4. Divergence time estimates 4. Discussion
High effective sample sizes were observed for all parameters in This study provides the first, robust, time-calibrated phyloge- the BEAST analyses for each dating approach. The dates from each netic reconstruction of the relationships and diversity of the genus approach are presented in Table 1. As the two approaches resulted Pseudotrapelus. Furthermore, we evaluate the evolution and bio- in almost identical dates, we continued with the dating rates pub- geography of Pseudotrapelus, including representatives of all recog- lished in Pang et al. (2003). The results of the dating analyses using nized populations and species from across the entire distributional both the gene-tree and species-tree were almost identical (Table 1; range of the genus (Fig. 1). All molecular analyses in this study pre- Figs. 2 and 3B), with younger dates for the species tree. sent high levels of nodal support (Figs. 2–5, S1 and S2). The diver- Our results, based on the concatenated dataset (Table 1; Fig. 2), gence time estimates derived from two calibrations, between the indicate that Pseudotrapelus split from Arabian Acanthocercus gene tree and species tree approaches, resulted in almost identical around 15.9 million years ago (Mya; 95% HPD: 19.3–12.6 Mya). dates, thus strengthening our confidence in these results (Table 1). Based on the species tree analysis (Table 1; Fig. 3B) the genus started diverging through the late-Miocene ca. 8.1 Mya (95% HPD: 10.8–5.6 Mya), mostly radiating during the late-Miocene 4.1. Taxonomic accounts within Pseudotrapelus and early- mid-Pliocene. Speciation within the Western clade into P. chlodnickii and P. sinaitus appears to have occurred approxi- The molecular results of this study reveal Pseudotrapelus as a mately 5.2 Mya (95% HPD: 7.4–3.2 Mya). The split of P. jensvindumi diverse genus. Species delimitation analyses revealed six distinct from the Eastern clade occurred at a similar time, around 5.2 Mya lineages that warrant species status (Figs. 2–4, S1 and S2), sup- (95% HPD: 7.2–3.3 Mya). The divergence of P. dhofarensis is esti- ported also by morphological differences (Melnikov et al., 2015; mated to have occurred during the Pliocene at ca. 4.1 Mya (95% Photographic material, data not shown). Regarding nomenclature, HPD: 5.7–2.5 Mya) and cladogenesis of P. neumanni and P. aqaben- we consider the species’ names ascribed by Melnikov et al. sis at ca. 3.4 Mya (95% HPD: 4.8–2 Mya). (2012, 2013a, 2015) and Melnikov and Pierson (2012) to be consis- tent with the distinct lineages we identified (as we sampled them at or close to the type localities). We advocate that these names 3.5. Biogeographic reconstructions remain valid according to the rules of zoological nomenclature. The three species occurring in the Sinai Peninsula are morpho- Results of the discrete phylogeographic analyses within a tem- logically different from each other, have distinct mitochondrial poral framework are summarized in Fig. 5. Node ages were similar assignations, no shared nuclear alleles in any analysis and no to the dating analysis with the same dataset (Table 1; Fig. 2). Pseu- heterozygote specimens were detected (Figs. 2–4, S1 and S2). Pseu- dotrapelus most likely originated in western Arabia (78% probabil- dotrapelus sinaitus was described from ‘‘Sinai” with no further data ity; Fig. 5) at the same time as its Arabian relatives, Acanthocercus (Heyden, 1827). According to Moravec (2002), followed by yemensis and A. adramitanus. Subsequent splits within the genus Melnikov and Pierson (2012), the type locality should be regarded separated P. chlodnickii (to Africa) and P. jensvindumi (to north- as Mt. Sinai. Our samples from this location and from Jordan are eastern Arabia). therefore assigned to P. sinaitus. The lack of sampling of P. sinaitus
Fig. 5. The BEAST consensus tree using the BSSVS method of ancestral area reconstruction with a temporal framework based on the rates of Pang et al. (2003) (Mya; HPD 95% confidence interval bars at each node). Branch color indicates inferred ancestral range (ranges for Pseudotrapelus visualized in the lower left map), with posterior probabilities of ancestral range above the nodes (values P0.95 are shown). A pie chart describing the probability of each inferred area is presented near the major nodes. Taxon names correspond to changes proposed in this paper. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) 64 K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 in north-eastern Africa precludes us from assessing its presence in taxonomy of P. sinaitus needs re-evaluation, considering morpho- this area, though Melnikov et al. (2013a, 2013b, 2015) reported its logical and genetic variation, as well as additional ecological data. presence there based on a single sequence retrieved from GenBank. The lineage sampled at the type locality of P. aqabensis in Aqaba, 4.2. Phylogenetic relationships within Pseudotrapelus and its Jordan, is classified as Pseudotrapelus aqabensis, also distributed Agaminae relatives in the Sinai Peninsula, Israel, Jordan and northern Saudi Arabia (Fig. 1; similar to Melnikov et al., 2014). The lineage from north- The close phylogenetic relationships among Pseudotrapelus, eastern Africa, including the Sinai Peninsula, sampled close to the Acanthocercus and Xenagama, within the subfamily Agaminae, type locality of P. chlodnickii in Sudan, is thus assigned to Pseudo- were established in several studies based on a single Pseudo- trapelus chlodnickii, with a broader distribution than previously trapelus specimen (Joger, 1991; Macey et al., 2006; Pyron et al., thought in Melnikov et al. (2015) (Fig. 1). The Sinai P. chlodnickii 2013; Leaché et al., 2014). The broad sampling in our study sup- specimen (ZFMK64402; location code 6 in Fig. 1) has not been suc- ports Pseudotrapelus monophyly. The monophyletic African genus cessfully sequenced for nuclear loci, but exhibits a P. chlodnickii Xenagama comprises four recognized species, all endemic to the phenotype, thus excluding the possibility that the occurrence of Horn of Africa (Wagner et al., 2013; Leaché et al., 2014; Fig. 2). P. chlodnickii mitochondrial data in the Sinai Peninsula is due to The genus Acanthocercus is polyphyletic (also in Leaché et al., introgression with P. sinaitus. The two Omani species, P. dhofarensis 2014; Figs. 2 and 5) and is currently the subject of an ongoing and P. jensvindumi, were sampled from and around their type local- study (Wagner et al., unpubl. data). ity, including the holotype of the latter, and the genetic analyses Our results reveal that Pseudotrapelus is genetically diverse, presented in this study (Figs. 2–4, S1 and S2; Table S4) support comprised of two clades divided into six well-defined lineages. their specific distinctiveness. Pseudotrapelus jensvindumi is This study thus provides support for the specific status of P. restricted to the Al Hajar Mountains in northern Oman and the aqabensis; P. chlodnickii; P. dhofarensis; P. jensvindumi; P. neumanni UAE (Fig. 1), though Melnikov and Melnikova (2013) assigned its and P. sinaitus (Figs. 2–5, S1 and S2). The gene trees, species trees, range only to the western and central ridges of these mountains. species delimitation analyses and nuclear network of MC1R sup- Pseudotrapelus dhofarensis is distributed in central and southern port the six lineages as discrete (Figs. 2–4, S1 and S2). Incomplete Oman, though we cannot confirm its occurrence in the Hadhra- allele sorting is present in the nuclear marker c-mos for the four maut area in south-eastern Yemen, as reported in the morpholog- Arabian species, most probably as a result of their relatively recent ical study of Melnikov and Melnikova (2013). divergence and shared ancestral evolutionary history (Fig. 4). The Our results show distinctiveness of a lineage from Yemen and absence of allele sharing in the nuclear gene fragments (Fig. 4)in southern Saudi Arabia (Figs. 2–4, S1 and S2; Table S4), and it the Sinai Peninsula, where three species co-occur (Fig. 1), suggests should thus be assigned a different name. Tornier (1905) described restricted gene flow and reproductive isolation. Pseudotrapelus neumanni from the Lahej area in southern Yemen The coexistence of three sympatric agamid species, with similar based on the large dorsal scales on the head and body, their direc- body-sizes, activity times, habitat and dietary preferences, in the tion of imbrication, direction of the nostrils, four preanal pores and Sinai Peninsula, presents an interesting avenue for further equal length of the third and fourth toes (Tornier, 1905). Authors research. Furthermore, evaluating gene flow between species/ over the years have recognized the populations from southern populations will provide additional information regarding species and eastern Yemen as distinct morphological forms. However, boundaries. Environmental heterogeneity, e.g., altitudinal clines due to the conservative approach taken by these authors, these along mountains or different types of rocky habitats, is important populations were classified as intraspecific variations of P. sinaitus, in facilitating niche divergence and thus speciation or enabling as intermediate forms connect the specimens from Lahej to the species coexistence (Pianka, 1969; Keller et al., 2009). Studying population in the surrounding areas (Anderson, 1896, 1898, how sympatric species utilize their environment will undoubtedly 1901; Arnold, 1980; Fritz and Schütte, 1988; Schätti and help to elucidate the mechanisms enabling their coexistence. This Gasperetti, 1994). Based on the genetic results we resurrect the is particularly the case for species with relatively similar morphol- specific status of Pseudotrapelus neumanni (Tornier, 1905). ogy, ecology and habitats such as Pseudotrapelus. Arnold (1980) Species boundaries between P. dhofarensis and P. aqabensis rel- noted that morphological variation and differentiation along an ative to P. neumanni are less satisfactory and a meticulous assess- elevational gradient between the two Arabian Acanthocercus ment of their morphological and genetic distinctiveness is species (A. adramitanus, 0–2000 m a.s.l. and A. yemensis, required, especially in the connecting areas of Asir and Hadhra- 2000–3000 m a.s.l) were the potential traits enabling their coexis- maut (Fig. 1). We provisionally recognize six valid species of Pseu- tence. Pseudotrapelus, in the sympatric range with Acanthocercus, dotrapelus, but recommend further studies to fully examine the prefers drier habitats and lower elevations (Arnold, 1980). In the relationship of P. aqabensis and P. dhofarensis to P. neumanni.In Sinai Peninsula, Norfolk et al. (2010) compared habitat use and addition, the paucity of samples from the mountain ridges of Saudi behavioral patterns of two morphologically distinct, sympatric Arabia such as the Tuwayq Mountains around Riad and the coastal agamids (Stellagama stellio and Pseudotrapelus sinaitus) in order to Hejas and Asir mountain ridges, as well as the mountainous area understand how they utilize different niches to minimize between Jordan and Saudi Arabia (Fig. 1), leaves open the possibil- interspecific competition. The authors observed that the species ity that additional lineages may be revealed. had distinct ecological niches with different microhabitat use, The current systematics within P. sinaitus is interesting, with its color patterns, thermoregulatory activity times and territorial range extending from north-eastern Africa, throughout the Sinai social signaling. These studies highlight the potential mechanisms Peninsula, into southern Israel, Jordan, north-western Saudi Arabia driving ecological character differentiation in sympatric and southern Syria (Sindaco and Jeremcˇenko, 2008; Melnikov and Pseudotrapelus species. Melnikova, 2013; Fig. 1). The subspecies P. s. werneri Moravec, Genetic divergence among Pseudotrapelus species is similar to 2002 from the Basalt desert of Jordan and southern Syria is phylo- that found within the genus Agama (e.g., 16S: 3.9%; ND4: 9.1% genetically extremely closely related to the nominate subspecies. between Agama impalearis-A. boueti; Geniez et al., 2011; Specimens collected from the type localities of the two subspecies Gonçalves et al., 2012; respectively). Relatively low interspecific cluster together (Figs. 2–4, S1 and S2). In addition, the genetic dis- divergence is apparent between the south-eastern Arabian species tance within P. sinaitus is especially low for both 16S and ND4 (0.1% P. dhofarensis, P. neumanni and P. aqabensis (16S: 2.2–2.3%; ND4: and 0.3%, respectively; Table S4). Thus, we suggest that the 11.2–12.9%; Table S4). The degree of intraspecific genetic diversity K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 65 is remarkably high within P. neumanni (16S: 1.1%; ND4: 7.4%; dispersal via this route for both Acanthocercus and Xenagama is Table S4). As P. neumanni was not thoroughly sampled (Table S1), unlikely, as both genera are not currently found in this area. In we cannot rule out that this taxon is composed of several indepen- order for this to have been the dispersal route, both genera must dent lineages. We therefore recommend a more comprehensive have dispersed through this region and subsequently become analysis of this species, including additional samples from cur- extinct. rently un-sampled areas.
4.3. Biogeography of Pseudotrapelus and its closely-related agamid 4.4. General biogeography of Pseudotrapelus relatives Pseudotrapelus diversification began during the late-Miocene, The results of the ancestral area reconstruction clearly show around 8.1 Mya (Table 1; Fig 3B) probably in western Arabia distinct geographical groups extending along the opposite sides (Fig. 5), with later expansions into Africa (i.e., P. chlodnickii) and of the Red Sea and the Gulf of Aden (Fig. 5). These include an Afri- eastern Arabia (i.e., P. jensvindumi). According to our results, clado- can (Acanthocercus and Xenagama) and an Arabian (Acanthocercus genesis within the genus continued during the Pliocene (Table 1; and Pseudotrapelus) groups, which started diverging during the Fig. 3B). These divergence time estimations contrast with the Oli- early-Miocene approximately ca. 18 Mya (Table 1; Fig. 5). The gocene date suggested for Pseudotrapelus diversification in the ancestral area probability of the split between these groups is morphological study by Melnikov and Melnikova (2013; 23–28 almost equal for both African and Arabian origins (52% and 40%, Mya). The radiation within Pseudotrapelus and its current distribu- respectively) as opposed to a split originating in eastern Arabia tion may have been shaped by a combination of several environ- (8%). This inconclusive result may stems from the lack of biogeo- mental conditions around the Red Sea from the mid-Miocene graphical information regarding the geographical origin of the onwards. genus Trapelus. Wagner et al. (2011) suggested an Asian origin The mid-Miocene climate change, especially the aridification for Trapelus, thus indicating the probable Asian/Arabian origin of process, triggered the expansion of arid areas in North Africa and these three Afro-Arabian genera. The separation of the Arabian lin- Arabia (Ruddiman et al., 1989; Flower and Kennett, 1994; Le eage of Acanthocercus (A. yemensis and A. adramitanus) from Pseu- Houérou, 1997; Griffin, 2002; Edgell, 2006). The heliphilous nature dotrapelus is suggested to have occurred during the mid-Miocene, of Pseudotrapelus and their affinity to hot arid regions is likely to around 16 Mya (Table 1; Figs. 2 and 5). have enabled their dispersal, range expansion and subsequent Our divergence time estimates and those of two published stud- diversification within these areas. This environmental process ies on agamid lizards, suggest the origin of Pseudotrapelus occurred has also been hypothesized to have triggered diversification within around 15–19 Mya (Macey et al., 2006; Leaché et al., 2014; Table 1). the agamid genus Uromastyx (Wilms, 2001; Amer and Kumazawa, Our calibrations support the suggested role of the Gom- 2005). The progressive aridification and fluctuating climate photherium land bridge between Eurasia–Arabia–Africa increased sand areas in both Arabia and North Africa, and are likely (18 Mya; Tchernov, 1992; Rögl, 1999) in the evolutionary diver- to have promoted vicariance and isolation within montane or sification of Agamidae, as suggested by previous studies. Joger hard-substrate taxa, such as Pseudotrapelus (Fig. 1). Similar pat- (1991) suggested this as a potential dispersal route for agamids terns were also suggested for the agamid genus Agama from Asia into Arabia and later into Africa during the Miocene; (Gonçalves et al., 2012), the rock-dwelling Ptyodactylus geckos whereas Macey et al. (2006) suggested an Afro-Arabian origin (Metallinou et al., 2015) and snakes of the genus Echis (Arnold and the role of this land bridge as the later of two possible disper- et al., 2009; Pook et al., 2009). Sedimentary basins later forming sal routes into Asia. the Rub’ al Khali and Sharqiyah (formerly Wahiba) sand deserts The early-Miocene separation at 18 Mya (Table 1; Fig. 5) (Powers et al., 1966; Edgell, 2006; Preusser, 2009), characterize between the Arabian and African groups may correspond to the the interior of the Arabian Peninsula during the late-Miocene. expansion of the Red Sea. The tectonic breakage of the Arabian These areas are likely to have restricted saxicolous species within plate from Africa, estimated to have occurred from the Oligocene the Arabian Peninsula to the mountainous areas, resulting in their onwards, ultimately opened up the Red Sea, starting at the south- currently localized range patterns (Arnold, 1986; Schätti and ern end around the Gulf of Aden, expending at the northern end by Gasperetti, 1994; Gardner, 2013; Fig. 1). In Africa, the Sahara desert the early-Miocene (Menzies et al., 1992; Bosworth et al., 2005). restricts Pseudotrapelus to the mountains of north-eastern Africa Although the estimated time of tectonic divergence predates the (Schleich et al., 1996; Baha El Din, 2006). inferred dates in our phylogeny, the continuous rifting of the Red The late-Miocene (ca. 8.1 Mya) divergence between the Wes- Sea during the Miocene (Girdler et al., 1980; Girdler, 1991; tern and Eastern Pseudotrapelus clades is hypothesized to have Bosworth et al., 2005; Edgell, 2006; Autin et al., 2010) may have resulted from habitat fragmentation caused by the dynamic envi- acted as a vicariance event, playing a significant role in the diver- ronment around the Red Sea (Figs. 3B and 5). The continuous gence between these Afro-Arabian agamid groups. The dynamic mid- late-Miocene tectonic motions caused geological instability environment may have also contributed to the separation within in western Arabia, for example leading to the creation of the the Arabian group, between Acanthocercus and Pseudotrapelus,as Aqaba-Levant transform and periodic volcanic activity (Bosworth members of both genera prefer rocky habitats and are distributed et al., 2005). In addition, a temporal land connection existed in the mountainous areas of the Arabian shield (Arnold, 1980; between Africa and Arabia, which later became submerged with Schätti and Gasperetti, 1994). Several other routes were previously the expansion of the Red Sea (14–10 Mya; Richardson and hypothesized to enable the dispersal of reptiles from Africa to Ara- Arthur, 1988; Rögl, 1999; Bosworth et al., 2005). These proposed bia and vice versa (i.e., the Sinai Peninsula; a temporary land bridge vicariance events correspond to the divergence scenarios sug- of halite deposits in the Red Sea 14–10 Mya; Bab el Mandeb Strait gested for other reptile taxa in the region (e.g., Uromastyx, existing ca. 10–5.3 Mya; Bosworth et al., 2005) (e.g., Amer and Wilms, 2001; Amer and Kumazawa, 2005; Echis, Pook et al., Kumazawa, 2005; Pook et al., 2009; Portik and Papenfuss, 2012; 2009; Hemidactylus, Šmíd et al., 2013). The continuing habitat Šmíd et al., 2013). The origin of Pseudotrapelus or the divergence fragmentation during the Miocene-Pliocene transition may have of the Afro-Arabian agamid groups in our dating predates the also been associated with the divergence between P. chlodnickii two latter routes (Figs. 2 and 5). Although the northern land bridge and P. sinaitus in the northern area of the Red Sea ca. 5.2 Mya of the Sinai Peninsula was established during the Miocene, (Figs. 3B and 5). 66 K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68
The late-Miocene to mid-Pliocene divergence of the Arabian in 2013 was partially supported by the project ‘‘Field study for the Pseudotrapelus inhabiting the coastal shield mountains and north- conservation of reptiles in Oman” funded by the Ministry of Envi- ern Oman (P. aqabensis, P. neumanni, P. dhofarensis and P. jensvin- ronment and Climate Affairs, Oman (Ref: 22412027), and collecting dumi) remain difficult to interpret due to the poorly studied permit 31/2012 issued for SS. KT is supported by the Steinhardt climatic and geological trends within the Arabian interior. This per- Museum of Natural History, Israel National Center for Biodiversity iod was characterized by geological activity in the Arabian shield Studies, Tel Aviv University, Israel. We thank two anonymous and northern Oman and by the expansion of the Red Sea reviewers for helpful comments on an earlier version of the (Girdler, 1991; Bosworth et al., 2005; Kusky et al., 2005; Edgell, manuscript. 2006). Habitat fragmentation caused by environmental instability during this period is suggested to have facilitated the divergence Appendix A. Supplementary material in the agamid Uromastyx (Amer and Kumazawa, 2005), with five taxa occurring in south-western Yemen (Wilms and Schmitz, Supplementary data associated with this article can be found, in 2007), and within Hemidactylus geckos (Šmíd et al., 2013, 2015). the online version, at http://dx.doi.org/10.1016/j.ympev.2015.12. In northern Oman, the uplift of the Hajar Mountains continued 021. during the Miocene-Pliocene transition, and the region was sepa- rated from the southern mountainous areas of Arabia by low basins with fluviatile deposits, which later formed the Rub’ al Khali and References Sharqiyah sand deserts (Radies et al., 2004; Preusser et al., 2005; Edgell, 2006; Preusser, 2009). These basins and sandy deserts, Aloufi, A.A., Amr, Z.S., 2015. On the herpetofauna of the Province of Tabuk, northwest Saudi Arabia. Herpetozoa 27, 147–158. ranging from the coast of north-eastern Oman to the interior of Amer, S.A.M., Kumazawa, Y., 2005. Mitochondrial DNA sequences of the Afro- the Arabian Peninsula, formed biogeographical barriers which are Arabian spiny-tailed lizards (genus Uromastyx; family Agamidae): phylogenetic purported to have influenced the late-Miocene split of the snake analyses and evolution of gene arrangements. Biol. J. Linn. Soc. 85, 247–260. http://dx.doi.org/10.1111/j.1095-8312.2005.00485.x. Echis omanensis from Echis coloratus (Pook et al., 2009). These bar- Anderson, J., 1896. A Contribution to the Herpetology of Arabia: With a Preliminary riers may have also been responsible for the split of the northern List of the Reptiles and Batrachians of Egypt. RH Porter, London. Omani P. jensvindumi around the same time (5.2 Mya; Table 1; Anderson, J., 1898. Zoology of Egypt. Vol. I, Reptilia and Batrachia. B. Quatrich, Fig. 3B). This Pseudotrapelus divergence is another addition to London. Anderson, J., 1901. A list of the reptiles and batrachians obtained by Mr. A. Blayney recent studies presenting phylogenetic differences between north- Percival in Southern Arabia (with notes by the collector). Proc. Zool. Soc. Lond. 2, ern and southern Omani populations (Hemidactylus, Carranza and 137–152. Arnold, 2012; Pristurus, Badiane et al., 2014; Ptyodactylus has- Arnold, E.N., 1980. Reptiles and amphibians of Dhofar, Southern Arabia. In: Shaw- Reade, S.N., Sale, J.B., Gallagher, M.D., Daly, R.H., (Eds.), The scientific results of selquistii, Metallinou et al., 2015). the Oman flora and fauna survey 1977 (Dhofar). J. Oman Stud., Special Report, This study provides a first time-calibrated perspective on the pp. 273–332. historical biogeography of the genus Pseudotrapelus and its phylo- Arnold, E.N., 1986. A key and annotated check list to the lizards and amphisbaenians of Arabia. Fauna Saudi Arabia 8, 385–435. genetically close relatives within the Agaminae, including their Arnold, E.N., Robinson, M.D., Carranza, S., 2009. A preliminary analysis of inferred geographical origin and proposed diversification drivers. phylogenetic relationships and biogeography of the dangerously venomous Our study suggests that strong environmental changes, including Carpet Vipers, Echis (Squamata, Serpentes, Viperidae) based on mitochondrial DNA sequences. Amphibia-Reptilia 30, 273–282. geological instability and aridification (Flower and Kennett, 1994; Autin, J., Leroy, S., Beslier, M.O., d’Acremont, E., Razin, P., Ribodetti, A., Bellahsen, N., Bosworth et al., 2005; Edgell, 2006), might have affected the distri- Robin, C., Al Toubi, K., 2010. Continental break-up history of a deep magma- bution of Pseudotrapelus, triggering the evolution and divergence of poor margin based on seismic reflection data (northeastern Gulf of Aden margin, offshore Oman). Geophys. J. Int. 180, 501–519. http://dx.doi.org/ lineages within Africa and Arabia. The distribution of Pseudo- 10.1111/j.1365-246X.2009.04424.x. trapelus between these regions is restricted to rocky habitats, sug- Badiane, A., Garcia-Porta, J., Cˇervenka, J., Kratochvíl, L., Sindaco, R., Robinson, M., gesting that the processes that led to its current range may also Morales, H., Mazuch, T., Price, T., Amat, F., Shobrak, M.Y., Wilms, T., Simó- relate to the biogeographical patterns of other taxa in the region. Riudalbas, M., Ahmadzadeh, F., Papenfuss, T.J., Cluchier, A., Viglione, J., Carranza, S., 2014. Phylogenetic relationships of Semaphore geckos (Squamata: Sphaerodactylidae: Pristurus) with an assessment of the taxonomy of Acknowledgments Pristurus rupestris. Zootaxa 3835, 33–58. Baha El Din, S., 2006. A Guide to Reptiles & Amphibians of Egypt. Oxford University Press. We wish to thank the following people for providing samples Bandelt, H.J., Forster, P., Röhl, A., 1999. Median-joining networks for inferring for this study, or helped in the field: F. Amat, D. Berkowic, T. intraspecific phylogenies. Mol. Biol. Evol. 16, 37–48. Böhm, A. Cluchier, P. de Pous, K. Ehrlich, S.M. Farook, A. Gainsbury, Bohannon, R.G., Naeser, C.W., Schmidt, D.L., Zimmermann, R.A., 1989. The timing of uplift, volcanism, and rifting peripheral to the Red Sea: a case for passive M. Metalllinou, J. Moravec, C. Radspieler, M. Simó, R. Sindaco, A. rifting? J. Geophys. Res.: Sol. Ea. (1978–2012) 94, 1683–1701. http://dx.doi.org/ Slavenko, J. Šmíd, N. Truskanov, R. Vasconcelos, J. Viglione and P. 10.1029/JB094iB02p01683. Wagner. We also wish to thank J. Vindum from the California Acad- Bojar, A.V., Fritz, H., Kargl, S., Unzog, W., 2002. Phanerozoic tectonothermal history of the Arabian-Nubian shield in the Eastern Desert of Egypt: evidence from emy of Sciences and to E. Maza from the Steinhardt Museum of fission track and paleostress data. J. Afr. Earth Sci. 34, 191–202. http://dx.doi. Natural History in Tel Aviv for their help with the tissue samples, org/10.1016/S0899-5362(02)00018-0. and especially to J. Roca for the help with the lab work. We are Bosworth, W., Huchon, P., McClay, K., 2005. The Red Sea and Gulf of Aden basins. J. Afr. Earth Sci. 43, 334–378. http://dx.doi.org/10.1016/j.jafrearsci.2005.07.020. mostly thankful to R. Sindaco for providing samples from the Sinai Carranza, S., Arnold, E.N., 2012. A review of the geckos of the genus Hemidactylus Peninsula and Jordan, and pictures for this study. We are grateful (Squamata: Gekkonidae) from Oman based on morphology, mitochondrial and to A. Leaché for sending the dating results from his previous study nuclear data, with descriptions of eight new species. Zootaxa 3378, 1–95. and to P. Hahn for sending pictures of P. sinaitus. Special thanks are Castresana, J., 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Phylogenet. Evol. 17, 540–552. due to Ahmad Disi for helping with the permits in Jordan and to Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. JModelTest 2: more models, Saleh Al Saadi, Mohammed Al Shariani, Thuraya Al Sariri, Ali Al new heuristics and parallel computing. Nat. Methods 9. http://dx.doi.org/ Kiyumi, Mohammed Abdullah Al Maharmi and the other members 10.1038/nmeth.2109, 772-772. Douady, C.J., Catzeflis, F., Raman, J., Springer, M.S., Stanhope, M.J., 2003. The Sahara of the Nature Conservation Department of the Ministry of Environ- as a vicariant agent, and the role of Miocene climatic events, in the ment and Climate, Sultanate of Oman for their help and support diversification of the mammalian order Macroscelidea (elephant shrews). and for issuing all the necessary permits. This work was funded Proc. Natl. Acad. Sci. USA 100, 8325–8330. http://dx.doi.org/10.1073/ pnas.0832467100. by grant CGL2012-36970 from the Ministerio de Economía y Com- Disi, A., Modry, D., Necas, P., Rifai, L., 2001. Amphibians and Reptiles of the petitividad, Spain (co-funded by FEDER – EU). Field work in Oman Hashemite Kingdom of Jordan: an atlas and field guide. Chimaira. K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68 67
Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian phylogenetics approach for species tree estimation in African Agama lizards with with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. http://dx.doi. applications to biogeography, character evolution, and diversification. Mol. org/10.1093/molbev/mss075. Phylogenet. Evol. 79, 215–230. http://dx.doi.org/10.1016/j.ympev.2014.06.013. Edgell, H.S., 2006. Arabian Deserts: Nature, Origin and Evolution. Springer Science & Le Houérou, H.N., 1992. Outline of the biological history of the Sahara. J. Arid Business Media. Environ. 22, 3–30. Edwards, S.V., 2009. Is a new and general theory of molecular systematics Le Houérou, H.N., 1997. Climate, flora and fauna changes in the Sahara over the past emerging? Evolution 63, 1–19. http://dx.doi.org/10.1111/j.1558- 500 million years. J. Arid Environ. 37, 619–647. http://dx.doi.org/ 5646.2008.00549.x. 10.1006/jare.1997.0315. Ezard, T., Fujisawa, T., Barraclough, T.G., 2009. Splits: Species Limits by Threshold Lemey, P., Rambaut, A., Drummond, A., Suchard, M., 2009. Bayesian phylogeography Statistics. R package version 1.0-11/r29. finds its roots. PLoS Comput. Biol. 5, e1000520. http://dx.doi.org/10.1371/ Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the journal.pcbi.1000520. bootstrap. Evolution, 783–791. Macey, J.R., Schulte, J.A., Fong, J.J., Das, I., Papenfuss, T.J., 2006. The complete Fitzinger, L., 1843. Systema Reptilium. Amblyglossae, Braumüller et Seidel, mitochondrial genome of an agamid lizard from the Afro-Asian subfamily Vindobonae. Vienna. Agaminae and the phylogenetic position of Bufoniceps and Xenagama. Flot, J.F., 2010. SeqPHASE: a web tool for interconverting PHASE input/output files Mol. Phylogenet. Evol. 39, 881–886. http://dx.doi.org/10.1016/j. and FASTA sequence alignments. Mol. Ecol. Resour. 10, 162–166. http://dx.doi. ympev.2005.08.020. org/10.1111/j.1755-0998.2009.02732.x. Melnikov, D., Ananjeva, N.B., Papenfuss, T.J., 2013a. A new species of Pseudotrapelus Flower, B.P., Kennett, J.P., 1994. The middle Miocene climatic transition: east (Agamidae, Sauria) from Nizwa, Oman. Russ. J. Herpetol. 20, 79–84. Antarctic ice sheet development, deep ocean circulation and global carbon Melnikov, D., Melnikova, E., 2013. Taxonomic diversity of the genus Pseudotrapelus cycling. Palaeogeogr. Palaeoclimatol. Palaeoecol. 108, 537–555. (Agamidae; Sauria) and biogeography of Afro-Arabia. Trudy Zool. Inst. RAN 317, Fonseca, M.M., Brito, J.C., Paulo, O.S., Carretero, M.A., Harris, D.J., 2009. Systematic 438–451. and phylogeographical assessment of the Acanthodactylus erythrurus group Melnikov, D., Melnikova, E., Bondarenko, D., Amr, Z., 2013b. Taxonomy and (Reptilia: Lacertidae) based on phylogenetic analyses of mitochondrial and distribution of Pseudotrapelus in Jordan. Russ. J. Herpetol. 20, 213–216. nuclear DNA. Mol. Phylogenet. Evol. 51, 131–142. http://dx.doi.org/10.1016/j. Melnikov, D., Melnikova, E., Milto, K., Ananjeva, N.B., 2014. On an occurrence of ympev.2008.11.021. Pseudotrapelus aqabensis Melnikov, Nazarov, Ananjeva and Disi, 2012 in the Fritz, J.P., Schütte, F., 1988. Agamen aus der Arabischen Republik Jemen. Bonn. Zool. Sinai Peninsula, Egypt. Curr. Studies Herpetol. 14, 27–31. Beitr. 39, 103–112. Melnikov, D., Nazarov, R., Ananjeva, N.B., Disi, A., 2012. A new species of Gardner, A.S., 2013. The Amphibians and Reptiles of Oman and the UAE. Chimaira. Pseudotrapelus (Agamidae, Sauria) from Aqaba, southern Jordan. Russ. J. Geniez, P., Padial, J.M., Crochet, P.A., 2011. Systematics of North African Agama Herpetol. 19, 143–154. (Reptilia: Agamidae): a new species from the central Saharan mountains. Melnikov, D., Pierson, T., 2012. A new species of Pseudotrapelus (Agamidae, Sauria) Zootaxa 3098, 26–46. from Dhofar, Oman. Curr. Stud. Herpetol. 12, 143–151. Girdler, R.W., 1991. The Afro-Arabian rift system – an overview. Tectonophysics Melnikov, D., S´miełowski, J., Melnikova, E., Nazarov, R., Ananjeva, N.B., 2015. 197, 139–153. http://dx.doi.org/10.1016/0040-1951(91)90038-T. Red’n’Blues: a new species of Pseudotrapelus (Agamidae, Sauria) from Sudan, Girdler, R.W., Brown, C., Noy, D.J.M., Styles, P., 1980. A geophysical survey of the Africa. Russ. J. Herpetol. 22, 53–60. westernmost Gulf of Aden. Philos. T. Roy. Soc. London A: Math., Phys. Eng. Sci. Melnikova, E., Melnikov, D., Ananjeva, N.B., 2015. Mitochondrial and nuclear gene 298, 1–43. http://dx.doi.org/10.1098/rsta.1980.0239. phylogeny of Pseudotrapelus (Sauria: Agamidae) with considerations on the Girdler, R.W., Southren, T.C., 1987. Structure and evolution of the northern Red Sea. hybridization and mt-DNA introgression between species. Russ. J. Herpetol. 22, Nature 330, 716–721. http://dx.doi.org/10.1038/330716a0. 61–67. Gonçalves, D.V., Brito, J.C., Crochet, P.A., Geniez, P., Padial, J.M., Harris, D.J., 2012. Menzies, M.A., Baker, J., Bosence, D., Dart, C., Davison, I., Hurford, A., Al’Kadasi, M., Phylogeny of North African Agama lizards (Reptilia: Agamidae) and the role of McClay, K., Nichols, G., Al’Subbary, A., Yelland, A., 1992. The timing of the Sahara desert in vertebrate speciation. Mol. Phylogenet. Evol. 64, 582–591. magmatism, uplift and crustal extension: preliminary observations from http://dx.doi.org/10.1016/j.ympev.2012.05.007. Yemen. Geol. Soc., London 68, 293–304. http://dx.doi.org/10.1144/GSL. Griffin, D.L., 2002. Aridity and humidity: two aspects of the late Miocene climate of SP.1992.068.01.18, Special Publications. North Africa and the Mediterranean. Palaeogeogr. Palaeoclimatol. Palaeoecol. Metallinou, M., Arnold, E.N., Crochet, P.A., Geniez, P., Brito, J.C., Lymberakis, P., Baha 182, 65–91. http://dx.doi.org/10.1016/S0031-0182(01)00453-9. El Din, S., Sindaco, R., Robinson, M., Carranza, S., 2012. Conquering the Sahara Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate and Arabian deserts: systematics and biogeography of Stenodactylus geckos large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. http://dx. (Reptilia: Gekkonidae). BMC Evol. Biol. 12 (1), 258. http://dx.doi.org/10.1186/ doi.org/10.1080/10635150390235520. 1471-2148-12-258. Heled, J., Drummond, A.J., 2010. Bayesian inference of species trees from multilocus Metallinou, M., Cˇervenka, J., Crochet, P.A., Kratochvíl, L., Wilms, T., Geniez, P., data. Mol. Biol. Evol. 27, 570–580. http://dx.doi.org/10.1093/molbev/msp274. Shobrak, M.Y., Brito, J.C., Carranza, S., 2015. Species on the rocks: Systematics Heyden, C.H.G., 1827. Reptilien. In: Rüppell, E. (Ed.), Atlas zu der Reise im and biogeography of the rock-dwelling Ptyodactylus geckos (Squamata: nördlichen Africa von Eduard Rüppell. Heinrich Ludwig Brönner, Frankfurt am Phyllodactylidae) in North Africa and Arabia. Mol. Phylogenet. Evol. 85, 208– Main, pp. 1–24. 220. http://dx.doi.org/10.1016/j.ympev.2015.02.010. Hsü, K.J., Montadert, L., Bernoulli, D., Cita, M.B., Erickson, A., Garrison, R.E., Kidd, R.B., Miller, M., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway for Mèlierés, F., Müller, C., Wright, R., 1977. History of the Mediterranean salinity inference of large phylogenetic trees. In: Gateway Computing Environments crisis. Nature 267, 399–403. Workshop (GCE), 2010. IEEE, pp. 1–8. http://dx.doi.org/10.1109/ Huelsenbeck, J.P., Rannala, B., 2004. Frequentist properties of Bayesian posterior GCE.2010.5676129. probabilities of phylogenetic trees under simple and complex substitution Moravec, J., 2002. A new subspecies of the Sinai agama Pseudotrapelus sinaitus from models. Syst. Biol. 53, 904–913. http://dx.doi.org/10.1080/ Southern Syria and northern Jordan (Reptilia: Squamata: Sauria: Agamidae). 10635150490522629. Faun. Abh. Mus. Tierk. Dresden 23, 131–140. Joger, U., 1991. A molecular phylogeny of agamid lizards. Copeia, 616–622. Norfolk, O., Melotte, A., Gilbert, F., Zalat, S., Reader, T., 2010. A comparative study of Kapli, P., Lymberakis, P., Crochet, P.A., Geniez, P., Brito, J.C., Almutairi, M., two agamid lizards, Laudakia stellio and Pseudotrapelus sinaitus, in southern Ahmadzadeh, F., Schmitz, A., Wilms, T., Pouyani, N.R., Poulakakis, N., 2015. Sinai. Egypt. J. Biol. 12, 27–43. Historical biogeography of the lacertid lizard Mesalina in North Africa and the Pang, J., Wang, Y., Zhong, Y., Hoelzel, A.R., Papenfuss, T.J., Zeng, X., Ananjeva, N.b., Middle East. J. Biogeogr. 42 (2), 267–279. http://dx.doi.org/10.1111/jbi.12420. Zhang, Y.P., 2003. A phylogeny of Chinese species in the genus Phrynocephalus Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software (Agamidae) inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol. version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772– 27, 398–409. http://dx.doi.org/10.1016/S1055-7903(03)00019-8. 780. http://dx.doi.org/10.1093/molbev/mst010. Pianka, E.R., 1969. Habitat specificity, speciation, and species density in Australian Keller, A., Rödel, M.O., Linsenmair, K.E., Grafe, T.U., 2009. The importance of desert lizards. Ecology 50, 498–502. environmental heterogeneity for species diversity and assemblage structure in Pons, J., Barraclough, T.G., Gomez-Zurita, J., Cardoso, A., Duran, D.P., Hazell, S., Bornean stream frogs. J. Anim. Ecol. 78, 305–314. http://dx.doi.org/10.1111/ Kamoun, S., Sumlin, W.D., Vogler, A.P., 2006. Sequence-based species j.1365-2656.2008.01457.x. delimitation for the DNA taxonomy of undescribed insects. Syst. Biol. 55, Kusky, T., Robinson, C., El-Baz, F., 2005. Tertiary-Quaternary faulting and uplift in 595–609. http://dx.doi.org/10.1080/10635150600852011. the northern Oman Hajar Mountains. J. Geol. Soc. London 162, 871–888. http:// Pook, C.E., Joger, U., Stümpel, N., Wüster, W., 2009. When continents collide: dx.doi.org/10.1144/0016-764904-122. phylogeny, historical biogeography and systematics of the medically important Lanfear, R., Calcott, B., Ho, S.Y., Guindon, S., 2012. PartitionFinder: combined viper genus Echis (Squamata: Serpentes: Viperidae). Mol. Phylogenet. Evol. 53, selection of partitioning schemes and substitution models for phylogenetic 792–807. http://dx.doi.org/10.1016/j.ympev.2009.08.002. analyses. Mol. Biol. Evol. 29, 1695–1701. http://dx.doi.org/10.1093/molbev/ Portik, D.M., Papenfuss, T.J., 2012. Monitors cross the Red Sea: the biogeographic mss020. history of Varanus yemenensis. Mol. Phylogenet. Evol. 62, 561–565. http://dx. Leaché, A.D., Fujita, M.K., 2010. Bayesian species delimitation in West African forest doi.org/10.1016/j.ympev.2011.09.024. geckos (Hemidactylus fasciatus). Proc. R. Soc., B 277, 3071–3077. http://dx.doi. Portik, D.M., Papenfuss, T.J., 2015. Historical biogeography resolves the origins of org/10.1098/rspb.2010.0662. endemic Arabian toad lineages (Anura: Bufonidae): evidence for ancient Leaché, A.D., Wagner, P., Linkem, C.W., Böehme, W., Papenfuss, T.J., Chong, R.A., vicariance and dispersal events with the Horn of Africa and South Asia. BMC Lavin, B.R., Bauer, A.M., Nielsen, S.V., Greenbaum, E., Rödel, M.O., Schmitz, A., Evol. Biol. 15 (1), 152. http://dx.doi.org/10.1186/s12862-015-0417-y. LeBreton, M., Ineich, I., Chirio, L., Ofori-Boateng, C., Eniang, E.A., Baha El Din, S., Powers, R.W., Redmond, C.D., Elberg Jr., E.L., 1966. Geology of the Arabian Lemmon, A.R., Burbrink, F.T., 2014. A hybrid phylogenetic–phylogenomic Peninsula: sedimentary geology of Saudi Arabia. USGA Prof. Pap. D 560, 147. 68 K. Tamar et al. / Molecular Phylogenetics and Evolution 97 (2016) 55–68
Preusser, F., 2009. Chronology of the impact of Quaternary climate change on Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic continental environments in the Arabian Peninsula. C. R. Geosci. 341, 621–632. analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688– http://dx.doi.org/10.1016/j.crte.2009.02.003. 2690. http://dx.doi.org/10.1093/bioinformatics/btl446. Preusser, F., Radies, D., Driehorst, F., Matter, A., 2005. Late Quaternary history of the Stephens, M., Scheet, P., 2005. Accounting for decay of linkage disequilibrium in coastal Wahiba sands, Sultanate of Oman. J. Quaternary Sci. 20, 395–405. http:// haplotype inference and missing-data imputation. Am. J. Hum. Genet. 76, 449– dx.doi.org/10.1002/jqs.922. 462. http://dx.doi.org/10.1086/428594. Pyron, R.A., Burbrink, F.T., Wiens, J.J., 2013. A phylogeny and revised classification of Stephens, M., Smith, N.J., Donnelly, P., 2001. A new statistical method for haplotype Squamata, including 4161 species of lizards and snakes. BMC Evol. Biol. 13, 93. reconstruction from population data. Am. J. Hum. Genet. 68, 978–989. http://dx. http://dx.doi.org/10.1186/1471-2148-13-93. doi.org/10.1086/319501. R Core Team, 2013. R: A language and environment for statistical computing. R Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing Foundation for Statistical Computing, Vienna, Austria.
Karin Tamar, Sebastian Scholz, Pierre-André Crochet, Philippe Geniez, Shai Meiri, Andreas Schmitz, Thomas Wilms, Salvador Carranza Evolution around the Red Sea: Systematics and biogeography of the agamid genus Pseudotrapelus (Squamata: Agamidae) from North Africa and Arabia ☆ Molecular Phylogenetics and Evolution, Volume 97, 2016, 55–68 http://dx.doi.org/10.1016/j.ympev.2015.12.021
Supplementary Fig. S2. Results of the species delimitation analysis according to the GMYC single-threshold model (based on haplotype mtDNA). (A) Ultrametric tree obtained in BEAST, bold samples are representatives used for the divergence time estimation analys...
Karin Tamar, Sebastian Scholz, Pierre-André Crochet, Philippe Geniez, Shai Meiri, Andreas Schmitz, Thomas Wilms, Salvador Carranza Evolution around the Red Sea: Systematics and biogeography of the agamid genus Pseudotrapelus (Squamata: Agamidae) from North Africa and Arabia ☆ Molecular Phylogenetics and Evolution, Volume 97, 2016, 55–68 http://dx.doi.org/10.1016/j.ympev.2015.12.021
Table S1. Information on the specimens used in this study and related GenBank accession numbers. Localities are presented in Fig. 1. (a) Haplotypes (n=67); (b) Representatives of each GMYC entity (n=10). Taxon names correspond to changes proposed in this paper.
* Voucher code abbreviations: [AMNH] American Museum of Natural History, USA; [BEV] Laboratoire de Biogéographie et Écologie des Vertébrés de l'École Pratique des Hautes Etudes, Montpellier, France; [CAS] California Academy of Sciences, USA; [IBE] Institute of Evolutionary Biology, Barcelona, Spain; [MCCI-R] Museo Civico di Storia Naturale, Carmagnola, Torino, Italy; [MHNG] Muséum d'histoire naturelle de la Ville de Genève, Switzerland; [MNHN] Muséum national d'Histoire naturelle, Paris, France; [MVZ] Museum of Vertebrate Zoology (University of California, Berkeley), USA; [NMP6V] National Museum (Natural History), Prague, Czech Republic; [NMW] Naturhistorisches Museum Wien, Vienna, Austria; [TAU.R] The Steinhardt Museum of Natural History, Israel National Center for Biodiversity Studies, Tel Aviv University, Israel; [ZFMK] Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany.
Location Specimen code Voucher code* Species Country Latitude Longitude 16S ND4-tRNA MC1R c-mos 32 TAU.R16241 - Pseudotrapelus aqabensis Israel 29.5860 34.8800 KU097468 KU169192 KU097632 KU097561 33 TAU.R16659 TAU.R16659 Pseudotrapelus aqabensis Israel 31.4630 35.3870 KU097469 KU169195 KU097633 KU097562 34 TAU.R16713 a - Pseudotrapelus aqabensis Israel 31.4640 35.3870 KU097470 KU169196 KU097634 KU097563 30 TAU.R17122 a ,b - Pseudotrapelus aqabensis (Type locality) Jordan 29.5295 35.0235 KU097471 KU169193 KU097635 KU097564 31 TAU.R17123 - Pseudotrapelus aqabensis (Type locality) Jordan 29.5295 35.0235 KU097472 KU169194 KU097636 - 35 IBES10160 a, b IBES10160 Pseudotrapelus aqabensis Saudi Arabia 26.2893 36.5221 KU097464 KU169191 KU097630 KU097554 36 ZFMK87239 a ZFMK87239 Pseudotrapelus aqabensis Saudi Arabia 21.4199 40.3468 HQ901102 - - - 27 MCCI-R1563 MCCI-R1563 Pseudotrapelus aqabensis Egypt (Sinai) 28.7945 33.7320 KU097465 KU169197 KU097631 KU097557 29 MCCI-R1575 a, b MCCI-R1575 Pseudotrapelus aqabensis Egypt (Sinai) 29.0436 33.4340 KU097466 KU169198 KU097637 KU097558 28 ZFMK66488 a ZFMK66488 Pseudotrapelus aqabensis Egypt (Sinai) 28.9704 34.6396 KU097467 - - - 2 BEV10035 a BEV10035 Pseudotrapelus chlodnickii Egypt 23.1960 26.2698 KU097438 - KU097585 KU097515 Location Specimen code Voucher code* Species Country Latitude Longitude 16S ND4-tRNA MC1R c-mos 3 BEV10366 a BEV10366 Pseudotrapelus chlodnickii Egypt 24.2227 35.1780 KU097439 KU169151 KU097587 KU097513 4 BEV8997 a, b BEV8997 Pseudotrapelus chlodnickii Egypt 25.0207 33.5456 KU097437 KU169150 KU097586 KU097512 5 T6847 a - Pseudotrapelus chlodnickii Egypt 28.1627 32.5413 KU097440 KU169152 - KU097514 6 ZFMK64402 a ZFMK64402 Pseudotrapelus chlodnickii Egypt (Sinai) 28.7080 33.7728 KU097441 - - - 1 SUD12/2010-3 a - Pseudotrapelus chlodnickii Sudan 16.9345 33.7510 KU097436 KU169149 KU097584 KU097511 43 AO108 - Pseudotrapelus dhofarensis Oman 17.2497 53.8891 KU097443 KU169174 KU097602 KU097532 50 AO175 a - Pseudotrapelus dhofarensis Oman 17.0244 54.7983 KU097444 KU169181 KU097599 KU097569 48 CN2610 a - Pseudotrapelus dhofarensis Oman 16.9942 54.6912 KU097457 - KU097589 KU097580 47 CN2634 a - Pseudotrapelus dhofarensis Oman 16.9942 54.6912 KU097445 KU169182 KU097600 KU097570 57 CN2640 a, b - Pseudotrapelus dhofarensis Oman 19.8400 57.6639 KU097459 KU169186 KU097596 KU097566 54 CN2661 IBECN2661 Pseudotrapelus dhofarensis Oman 20.2100 57.7971 KU097460 KU169187 KU097591 KU097571 61 CN2675 a IBECN2675 Pseudotrapelus dhofarensis Oman 20.9501 57.9832 KU097446 KU169177 KU097603 KU097572 55 CN2676 IBECN2676 Pseudotrapelus dhofarensis Oman 20.2098 57.7976 KU097461 KU169188 KU097592 KU097539 46 CN2856 a - Pseudotrapelus dhofarensis Oman 16.9942 54.6912 KU097447 KU169175 - KU097531 56 CN2905 - Pseudotrapelus dhofarensis Oman 20.0843 57.7220 KU097462 KU169189 KU097593 KU097567 59 CN3552 a IBECN3552 Pseudotrapelus dhofarensis Oman 20.3349 58.7885 KU097448 KU169178 KU097597 KU097547 58 CN3672 a IBECN3672 Pseudotrapelus dhofarensis Oman 20.5215 58.9415 KU097449 KU169179 KU097605 KU097573 49 CN7665 a, b - Pseudotrapelus dhofarensis (Type locality) Oman 17.1482 54.7951 KU097450 KU169176 KU097590 KU097574 60 IBES3346 a - Pseudotrapelus dhofarensis Oman 20.2398 58.7293 KU097451 KU169180 KU097606 KU097552 44 IBES7058 a - Pseudotrapelus dhofarensis Oman 17.0413 54.3260 KU097452 KU169183 KU097594 KU097568 52 IBES7826 a - Pseudotrapelus dhofarensis Oman 17.0693 55.0936 KU097453 KU169185 KU097601 KU097575 53 JIR107 a - Pseudotrapelus dhofarensis Oman 17.9172 55.5766 KU097463 KU169190 KU097604 KU097579 40 OM04/2010-57 a - Pseudotrapelus dhofarensis Oman 16.8793 53.7743 KU097442 KU169172 KU097588 KU097528 41 OM04/2010-58 a - Pseudotrapelus dhofarensis Oman 16.8793 53.7743 KU097458 KU169173 KU097595 KU097530 51 S2810 a - Pseudotrapelus dhofarensis Oman 17.0708 55.0930 KU097454 KU169184 KU097598 KU097559 45 ZFMK70998 ZFMK70998 Pseudotrapelus dhofarensis Oman 17.0413 54.6110 KU097456 - - - 42 ZFMK70923 a ZFMK70923 Pseudotrapelus dhofarensis Oman 16.9774 53.7919 KU097455 - - - 71 CN263 a IBECN263 Pseudotrapelus jensvindumi Oman 22.9116 57.6746 KU097477 KU169217 KU097608 KU097534 77 CN2829 a IBECN2829 Pseudotrapelus jensvindumi Oman 23.1513 57.1918 KU097482 KU169211 KU097617 KU097540 Location Specimen code Voucher code* Species Country Latitude Longitude 16S ND4-tRNA MC1R c-mos 68 CN2832 a IBECN2832 Pseudotrapelus jensvindumi Oman 22.8892 58.8929 KU097483 KU169204 KU097609 KU097541 69 CN2838 a IBECN2838 Pseudotrapelus jensvindumi Oman 22.8855 58.9040 KU097484 KU169221 KU097624 KU097542 79 CN3291 - Pseudotrapelus jensvindumi Oman 23.2052 57.1457 KU097506 KU169214 KU097622 KU097543 76 CN3351 a IBECN3351 Pseudotrapelus jensvindumi Oman 22.9480 57.2847 KU097485 KU169220 KU097615 KU097544 81 CN3400 a, b IBECN3400 Pseudotrapelus jensvindumi Oman 23.1841 57.0426 KU097486 KU169212 KU097625 KU097545 62 CN3442 a IBECN3442 Pseudotrapelus jensvindumi Oman 22.1691 59.4135 KU097487 KU169206 KU097618 KU097546 80 CN3752 a IBECN3752 Pseudotrapelus jensvindumi Oman 23.1849 57.1412 KU097488 KU169215 KU097610 KU097548 64 CN3868 a - Pseudotrapelus jensvindumi Oman 22.5920 59.3011 KU097489 KU169207 KU097619 KU097549 72 CN3932 IBECN3932 Pseudotrapelus jensvindumi Oman 23.0026 57.7001 KU097490 KU169218 KU097612 KU097576 73 CN5724 a IBECN5724 Pseudotrapelus jensvindumi Oman 23.0510 57.7242 KU097491 KU169219 KU097611 KU097550 82 CN667 a IBECN667 Pseudotrapelus jensvindumi Oman 23.1499 56.8937 KU097478 KU169209 KU097628 KU097535 85 CN724 a IBECN724 Pseudotrapelus jensvindumi Oman 24.6203 56.3400 KU097479 KU169210 KU097614 KU097536 66 CN725 a - Pseudotrapelus jensvindumi Oman 23.0860 58.8673 KU097480 KU169216 KU097621 KU097537 78 OMAN 17 - Pseudotrapelus jensvindumi Oman 23.2484 57.1630 KU097498 - KU097620 - 70 OMAN 38 - Pseudotrapelus jensvindumi Oman 22.8476 58.3287 KU097499 - KU097613 - 67 CN846 a IBECN846 Pseudotrapelus jensvindumi Oman 23.0854 58.8673 KU097481 KU169205 - KU097538 92 CN8691 a - Pseudotrapelus jensvindumi Oman 25.7950 56.2205 KU097492 - KU097616 KU097551 63 IBES7618 a - Pseudotrapelus jensvindumi Oman 22.5747 59.4646 KU097493 KU169208 KU097623 KU097553 65 IBES7684 a IBES7684 Pseudotrapelus jensvindumi Oman 23.2084 58.9458 KU097494 KU169203 KU097626 KU097577 84 UAE32 a - Pseudotrapelus jensvindumi Oman 24.5152 56.4622 KU097502 KU169213 KU097627 KU097565 74 CAS225340 a CAS225340 Pseudotrapelus jensvindumi (Holotype) Oman 23.09 57.6826 KU097476 KU169202 KU097607 KU097533 86 NMW32293:5 NMW32293:5 Pseudotrapelus jensvindumi Oman 24.7361 56.1264 KU097505 - - - 75 NMW36411 NMW36411 Pseudotrapelus jensvindumi Oman 23.0968 57.4001 KU097495 - - - 90 NMW32293:1 NMW32293:1 Pseudotrapelus jensvindumi UAE 25.4530 56.0324 KU097496 - - - 91 NMW32293:2 NMW32293:2 Pseudotrapelus jensvindumi UAE 25.4530 56.0324 KU097497 - - - 83 NMW32293:3 a NMW32293:3 Pseudotrapelus jensvindumi UAE 24.0966 55.7672 KU097503 - - - 89 ZFMK63698 a ZFMK63698 Pseudotrapelus jensvindumi UAE 25.2711 56.0437 KU097504 - - - 87 SPM001524 - Pseudotrapelus jensvindumi UAE 25.2166 56.3000 KU097500 - - KU097560 88 SPM002881 - Pseudotrapelus jensvindumi UAE 25.2805 56.1863 KU097501 - KU097629 KU097578 Location Specimen code Voucher code* Species Country Latitude Longitude 16S ND4-tRNA MC1R c-mos 37 IBES10223 a, b IBES10223 Pseudotrapelus neumanni Saudi Arabia 17.5382 43.6298 KU097473 KU169199 KU097640 KU097555 39 JEM121 a, b - Pseudotrapelus neumanni Yemen 13.8770 45.8000 KU097474 KU169200 KU097638 KU097556 38 JEM152 a - Pseudotrapelus neumanni Yemen 14.8993 43.4834 KU097475 KU169201 KU097639 KU097529 14 NMP6V70861 a NMP6V70861 Pseudotrapelus sinaitus sinaitus Jordan 30.6865 35.5477 KU097423 KU169170 - - 16 NMP6V70862 a NMP6V70862 Pseudotrapelus sinaitus sinaitus Jordan 31.8614 36.0059 KU097435 KU169155 - - 9 T3754 - Pseudotrapelus sinaitus sinaitus Jordan 29.5607 35.4115 KU097433 KU169156 - - 10 T3755 a, b - Pseudotrapelus sinaitus sinaitus Jordan 29.6903 35.358 KU097434 KU169157 KU097643 KU097526 8 MHNG27339 a MHNG27339 Pseudotrapelus sinaitus sinaitus Jordan 29.3194 36.0086 KU097432 KU169159 - - 7 MCCI-R1574 a MCCI-R1574 Pseudotrapelus sinaitus sinaitus (Type locality) Egypt (Sinai) 28.5564 33.9565 KU097419 KU169171 - KU097518 13 MCCI-R597 a MCCI-R597 Pseudotrapelus sinaitus sinaitus Jordan 30.3241 35.4481 KU097416 KU169153 - - 11 MCCI-R610 a MCCI-R610 Pseudotrapelus sinaitus sinaitus Jordan 29.8935 35.3122 KU097417 KU169154 - KU097516 12 MCCI-R611 a MCCI-R611 Pseudotrapelus sinaitus sinaitus Jordan 30.3307 35.4401 KU097418 KU169158 - KU097517 17 NMP6V70859-1 NMP6V70859-1 Pseudotrapelus sinaitus werneri (paratype) Jordan 32.0298 36.9754 KU097427 KU169163 KU097642 KU097523 18 NMP6V70859-2 NMP6V70859-2 Pseudotrapelus sinaitus werneri (paratype) Jordan 32.0298 36.9754 KU097428 KU169164 - KU097524 19 NMP6V70859-3 NMP6V70859-3 Pseudotrapelus sinaitus werneri (paratype) Jordan 32.0298 36.9754 KU097429 KU169165 - KU097525 15 NMP6V70860 a NMP6V70860 Pseudotrapelus sinaitus werneri (paratype) Jordan 31.1879 36.6605 KU097422 KU169169 - KU097519 20 T3930 a - Pseudotrapelus sinaitus werneri Jordan 32.2287 37.2196 KU097430 KU169167 KU097644 KU097527 21 MHNG27337 MHNG27337 Pseudotrapelus sinaitus werneri Jordan 32.3425 36.9920 KU097420 KU169160 - - 22 MHNG27338 a MHNG27338 Pseudotrapelus sinaitus werneri Jordan 32.3015 37.1596 KU097421 KU169166 - - 23 NMP6V70449-1 a NMP6V70449-1 Pseudotrapelus sinaitus werneri (paratype) Syria 32.7994 37.0835 KU097424 KU169168 - KU097520 24 NMP6V70449-3 NMP6V70449-3 Pseudotrapelus sinaitus werneri (paratype) Syria 32.7994 37.0835 KU097425 KU169161 - KU097521 25 NMP6V70449-4 a NMP6V70449-4 Pseudotrapelus sinaitus werneri (paratype) Syria 32.7994 37.0835 KU097426 KU169162 KU097641 KU097522 26 NMP6V70449-5 a NMP6V70449-5 Pseudotrapelus sinaitus werneri (paratype) Syria 32.7994 37.0835 KU097431 - - - IBES10359 IBES10359 Acanthocercus adramitanus Saudi Arabia 20.7031 40.9892 KU097508 KU169223 - KU097582 AO156 - Acanthocercus adramitanus Oman 17.1163 54.5486 KU097507 KU169222 KU097645 - CAS227508 CAS227508 Acanthocercus annectens Somalia 11.0261 49.193 JX668128 JX857621 - JX838886 MVZ242740 MVZ242740 Acanthocercus annectens Somalia 11.0261 49.193 JX668129 JX857561 - JX838887 CAS201727 CAS201727 Acanthocercus atricollis Uganda -0.9249 29.6936 JX668130 JX857596 - JX838888 MVZ265804 MVZ265804 Acanthocercus atricollis Mozambique -22.415 30.0552 JX668133 JX857555 - JX838891 Location Specimen code Voucher code* Species Country Latitude Longitude 16S ND4-tRNA MC1R c-mos MVZ257904 MVZ257904 Acanthocercus cyanogaster Ethiopia 13.49 39.47 JX668135 JX857609 - JX838892 MVZ257924 MVZ257924 Acanthocercus cyanogaster Ethiopia 13.47 39.5 JX668136 JX857562 - JX838893 MVZ236454 MVZ236454 Acanthocercus yemensis Yemen 15.4351 44.1225 JX668140 JX857608 - JX838897 MVZ236455 MVZ236455 Acanthocercus yemensis Yemen 15.4351 44.1225 JX668141 JX857559 - JX838898 IBES10270 IBES10270 Acanthocercus yemensis Saudi Arabia 18.2904 42.3605 KU097509 KU169224 KU097646 KU097581 ZFMK84370 ZFMK84370 Xenagama batillifera Somalia - - JX668224 JX857572 - JX838990 MVZ241356 MVZ241356 Xenagama taylori Somalia 9.67 44.2075 GU128466 GU128502 - JX838993 MVZ241361 MVZ241361 Xenagama taylori Somalia 9.5755 44.0317 JX668227 JX857578 - JX838994 AMNH105545 AMNH105545 Xenagama zonura Somalia 7.035 39.158 JX668225 JX857585 - JX838991 AMNH105546 AMNH105546 Xenagama zonura Somalia 9.67 44.2075 JX668226 JX857576 - JX838992 MNHN II MNHN II Trapelus boehmei Mauritania 20.9322 -17.0255 JX668221 JX857619 - JX838989 BEV7755 BEV7755 Trapelus boehmei Morocco - - KU097510 KU169225 KU097647 KU097583 ZFMK 64395 ZFMK 64395 Trapelus mutabilis Egypt - - HQ901114 GU128501 - -
Table S2. Information on the gene fragments used in this study, including their lengths and the primers used, with their orientation, sequences, references and PCR conditions.
Gene Length (bp) Primer Sequence (5’-3’) Reference PCR Conditions 16Sa F: CGCCTGTTTATCAAAAACAT 16S ~492 Palumbi et al. (1991) 94°C (5’), [94°C (30’’), 48°C (45’’), 72°C (1’)] x35, 72°C (5’) 16Sb R: CCGGTCTGAACTCAGATCACGT ND4 F: CACCTATGACTACCAAAAGCTCATGTAGAAGC ND4+tRNA 681 Arévalo et al. (1994) 94°C (5’), [94°C (30’’), 52°C (45’’), 72°C (45,60,80,90’’)] x35, 72°C (5’) Leu R: CATTACTTTTACTTGGATTTGCACCA MC1RF F: AGGCNGCCATYGTCAAGAACCGGAACC MC1R 663 Pinho et al. (2009) 94°C (5’), [94°C (30’’), 56°C (45’’), 72°C (80’’)] x35, 72°C (5’) MC1RR R: CTCCGRAAGGCRTAAATGATGGGGTCCAC G73 F: GCGGTAAAGCAGGTGAAGAAA c-mos 372 Saint et al. (1998) 94°C (5’), [94°C (45’’), 52°C (45’’), 72°C (80’’)] x40, 72°C (5’) G74 R: TGAGCATCCAAAGTCTCCAAT
References Arevalo, E., Davis, S.K., Sites, J.W., 1994. Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus Grammicus complex (Phrynosomatidae) in Central Mexico. Syst. Biol., 43, 387–418. Palumbi, S.R., Martin, A., Romano, S., McMillan, W.S., Stice, S., Grabowski, G., 1991. The Simple Fool’s Guide to PCR. University of Hawaii Press, Honolulu. Pinho, C., Rocha, S., Carvalho, B.M., Lopes, S., Mourao, S., Vallinoto, M., Brunes, T.O., Haddad, C.F.B., Goncalves, H., Sequeira, F., Ferrand, N., 2009. New primers for the amplification and sequencing of nuclear loci in a taxonomically wide set of reptiles and amphibians. Conserv. Genet. Resour., 2(S1), 181–185. Saint, K.M., Austin, C.C., Donnellan, S.C., Hutchinson, M.N., 1998. C-mos, a nuclear marker useful for squamate phylogenetic analysis. Mol. Phylogenet. Evol., 10, 259–263. Table S3. Information on the phylogenetic and calibration analyses, partitions, models and parameters (different partition approaches; Gene/PartitionFinder [PF]; C=codon).
Partition Other Analysis Dataset Partition Length Model Clock model Rate Tree model Runs approach Priors/Parameters 16S 492 Gene ND4 681 mtDNA tRNA 152 (Outgroups 16S, ND4 (C1), tRNA included) PF ND4 (C2) 1325 ND4 (C3) 16S 492 Phylogenetic trees ND4 681 Gene tRNA 152 Replicates x100, GTR+G Maximum MC1R 663 Bootstrap x1000 Likelihood c-mos 429 Concatenated 16S, ND4 (C1), tRNA (Outgroups ND4 (C2), c-mos (C3) included) ND4 (C3) PF MC1R (C1) 2360 MC1R (C2) MC1R (C3) c-mos (C1, C2) 16S 492 GTR+G Gene ND4 681 TrN+I+G mtDNA tRNA 153 TPM1uf+I
16S HKY+I (Outgroups excluded ND4 (C1), tRNA HKY+G PF 1326 ND4 (C2) HKY+G ND4 (C3) TrN+G Phylogenetic 16S 492 GTR+G 7 trees ND4 681 TrN+I+G Strict clock Coalescent Alpha Uniform (0, 10) 3 runs, 5x10 generations, Unlink clock Rate fixed to 1 Random starting tree Base substitution 5x103 sampling frequency, Bayesian Gene tRNA 153 TPM1uf+I Link trees Uniform (0, 100) 10% burning Inference MC1R 663 TrN+I Concatenated c-mos 429 JC
16S HKY+G (Outgroups excluded) ND4 (C1), tRNA HKY+G c-mos (C3), MC1R (C2), ND4 (C2) HKY+I PF 2361 ND4 (C3) TrN+G MC1R (C1), c-mos (C1, C2) K80+I MC1R (C3) HKY+I+G Partition Other Analysis Dataset Partition Length Model Clock model Rate Tree model Runs approach Priors/Parameters 16S 492 GTR+G Gene ND4 681 TrN+I+G Phylogenetic mtDNA TPM1uf+I trees Haplotypes tRNA 153 Coalescent Alpha Uniform (0, 10) 3 runs, 5x107 generations, Strict clock 16S HKY+I Rate fixed to 1 Random starting tree Base substitution 5x103 sampling frequency, Unlink clock Bayesian (Outgroups ND4 (C1), tRNA HKY+G Link trees Uniform (0, 100) 10% burning Inference excluded) PF 1325 ND4 (C2) HKY+G ND4 (C3) TrN+G Yule Concatenated 16S+ND4+ tRNA 1326 GTR+I+G Relaxed Uncorrelated Lognormal Alpha Uniform (0, 10) 3 runs, 2x108 generations, Random starting tree *BEAST (Outgroups Gene MC1R (phased) 663 TrN+I+G Strict clock Rate fixed to 1 Base substitution 2x104 sampling frequency, Unlink mt/nDNA excluded) Uniform (0, 100) 10% burning c-mos (phased) 372 K80+I Strict clock trees nDNA MC1R (phased) 663 2 runs each, 5x105 BP&P Gene 1) θ≈G(1,10); τ≈G(1,10); 2) θ≈G(2,2000); τ≈G(2,2000); 3) θ≈G(1,10); τ≈G(2,2000); 4) θ≈G(2,2000); τ≈G(1,10) (Outgroups generations, 10% burning excluded) c-mos (phased) 372 16S 492 GTR+I+G Relaxed Uncorrelated Lognormal 0.0073-0.0132 Estimation of Concatenated Yule Alpha Uniform (0, 10) 3 runs, 5x107 generations, divergence times ND4+tRNA 818 GTR+I+G Relaxed Uncorrelated Lognormal 0.0113-0.0204 Gene Random starting tree Base substitution 5x103 sampling frequency, (Outgroups MC1R 663 GTR+G Strict clock 0-0.0204 Link trees Uniform (0, 100) 10% burning Pang et al. (2003) included) c-mos 372 HKY+G Strict clock 0-0.0204 16S 492 GTR+I+G Relaxed Uncorrelated Lognormal Estimation of Concatenated Yule Alpha Uniform (0, 10) 3 runs, 5x107 generations, divergence times ND4+tRNA 818 GTR+I+G Relaxed Uncorrelated Lognormal Uniform Gene Random starting tree Base substitution 5x103 sampling frequency, (Outgroups 0-1 MC1R 663 GTR+G Strict clock Link trees Uniform (0, 100) 10% burning Leaché et al. (2014) included) c-mos 372 HKY+G Strict clock 16S 492 GTR+I+G Relaxed Uncorrelated Lognormal 0.0073-0.0132 *BEAST Concatenated Yule Alpha Uniform (0, 10) 3 runs, 2x108 generations, Dated ND4+tRNA 818 GTR+I+G Relaxed Uncorrelated Lognormal 0.0113-0.0204 Random starting tree Gene Base substitution 2x104 sampling frequency, (Outgroups Unlink mt/nDNA MC1R 663 GTR+G Strict clock 0-0.0204 Uniform (0, 100) 10% burning Pang et al. (2003) excluded) trees c-mos 372 HKY+G Strict clock 0-0.0204 16S 492 GTR+I+G Relaxed Uncorrelated Lognormal 0.0073-0.0132 Concatenated ND4+tRNA 818 GTR+I+G Relaxed Uncorrelated Lognormal 0.0113-0.0204 Alpha Uniform (0, 10) Yule 3 runs, 108 generations, 104 Ancestral area Base substitution Gene MC1R 663 GTR+G Strict clock 0-0.0204 Random starting tree sampling frequency, 10% reconstruction (Outgroups Uniform (0, 100) Link trees burning included) c-mos 372 HKY+G Strict clock 0-0.0204 Loocation Symmetric discrete Strict clock Exponential
Table S4. Pairwise uncorrected genetic divergence (p-distance) between the Pseudotrapelus taxa, derived from the mitochondrial genes 16S (below the diagonal) and ND4 (above the diagonal), and within each taxa (16S/ND4). Taxon names correspond to changes proposed in this paper.
P. chlodnickii P. sinaitus P. jensvindumi P. dhofarensis P. aqabensis P. neumanni P. chlodnickii 0.3/0.7 14.1 19.6 19.9 19 19 P. sinaitus 5 0.1/0.3 18.2 17.8 18.6 16.5 P. jensvindumi 7.6 6.9 0/0.8 14.9 15.2 15.7 P. dhofarensis 6.6 6.4 3.9 0.1/2.7 11.8 12.9 P. aqabensis 7.1 6.9 4 2.2 0.9/2.8 11.2 P. neumanni 7.1 7 3.7 2.2 2.3 1.1/7.4