US010882885B2

( 12 ) United States Patent ( 10 ) Patent No .: US 10,882,885 B2 Wallace et al . (45 ) Date of Patent : Jan. 5 , 2021

( 54 ) PEPTIDE - BASED SYNTHETIC MOLECULES OTHER PUBLICATIONS AND SILICA NANOSTRUCTURES Lechner et al. ( “ Exploring the effect of native and artificial peptide modifications on silaffin induced silica precipitation, ” Chem . Sci . , ( 71 ) Applicant: Massachusetts Institute of 2012 , 3 , 3500 ) ( Year: 2012 ) . * Technology , Cambridge, MA (US ) Seker et al . “ Engineered Peptides for Nanohybrid Assemblies , " Langmuir 2014 , 30 , 2137-2143 ( Year: 2014 ) . * (72 ) Inventors: Andrea Kimi Wallace, Cambridge , MA Pender et al . “ Peptide - Mediated Formation of Single -Wall Carbon ( US ) ; Maiko Furubayashi , Cambridge , Nanotube Composites , ” Nano Letters 2006 , 6 , 40-44 ( Year: 2006 ) . * Coyle et al . “ A Cleavable Silica -Binding Affinity Tag for Rapid and MA ( US ) ; Christopher A. Voigt, Inexpensive Protein Purification ,” Biotechnol . Bioeng . 2014 ; 111 : Belmont, MA (US ) 2019-2026 ( Year: 2014 ) . * Nguyen et al. A protein -protein interaction in magnetosomes : TPR ( 73 ) Assignee : Massachusetts Institute of protein MamA interacts with an Mms6 protein , Biochem Biophys Technology , Cambridge, MA (US ) Rep . 2016 ; 7 : 39-44 ( Year: 2016 ) . * Uniprot entry for concentrative nucleoside transporter 1 , down loaded May 5 , 2020 ( Year: 2020 ) . * ( * ) Notice : Subject to any disclaimer , the term of this Uniprot entry for sodium / nucleoside contransporter , downloaded patent is extended or adjusted under 35 May 5 , 2020 ( Year: 2020 ) . * U.S.C. 154 ( b ) by 0 days. [ No Author Listed ] , THAOC_24272 . UniProt. Nov. 28 , 2012. 5 pages . Retrieved from : http://www.uniprot.org/uniprot/KORQ67. [ No Author Listed ] , THAOC_37500 . UniProt . Nov. 28 , 2012. 5 ( 21 ) Appl. No .: 15 /897,257 pages. Retrieved from : http://www.uniprot.org/uniprot/KOQYB9. Adams et al . , Genetically Engineered Peptides for Inorganics: Study ( 22 ) Filed : Feb. 15 , 2018 of an Unconstrained Bacterial Display Technology and Bulk Alu minum Alloy. Adv Mater. Sep. 6 , 2013 ; 25 ( 33 ) : 4530-91 . Ahmad et al . , Rapid Bioenabled Formation of Ferroelectric BaTiO3 ( 65 ) Prior Publication Data at Room Temperature from an Aqueous Salt Solution at Near US 2018/0244725 A1 Aug. 30 , 2018 Neutral pH . J Am Chem Soc . Jan. 9 , 2008 ; 130 ( 1 ) : 4-5 . Epub Dec. 8 , 2007 . Amemiya et al . , Controlled formation of magnetite crystal by partial oxidation of ferrous hydroxide in the presence of recombinant Related U.S. Application Data magnetotactic bacterial protein Mms6 . Biomaterials . Dec. 2007 ; 28 ( 35 ) : 5381-9 . Epub Aug. 27 , 2007 . ( 60 ) Provisional application No. 62 / 459,251 , filed on Feb. Banerjee et al . , Cu nanocrystal growth on peptide nanotubes by 15 , 2017 biomineralization : Size control of Cu nanocrystals by tuning peptide conformation . Proc Natl Acad Sci USA . Dec. 9 , 2003 ; 100 ( 25 ) : 14678 82. Epub Nov. 25 , 2003 . ( 51 ) Int . Cl . Bassindale et al . , An improved phage display methodology for CO7K 7/08 ( 2006.01 ) inorganic nanoparticle fabrication . Chem Commun . Jul . 28 , 2007: 2956 C08K 336 ( 2006.01 ) 8. doi : 10.1039 /b702650a . COIB 33/12 ( 2006.01 ) Borg et al . , Generation of Multishell Magnetic Hybrid Nanoparticles COIB 33/157 ( 2006.01 ) by Encapsulation of Genetically Engineered and Fluorescent Bac C08L 77/04 terial Magnetosomes with ZnO and SiO 2. Small . Sep. 2 , ( 2006.01 ) 2015 ; 11 ( 33 ) : 4209-17 . doi : 10.1002 / smll.201500028 . Epub Jun . 8 , B82Y 30/00 ( 2011.01 ) 2015 . ( 52 ) U.S. CI . Brutchey et al . , Biocatalytic Synthesis of a Nanostructured and CPC CO7K 7/08 ( 2013.01 ) ; COIB 33/122 Crystalline Bimetallic Perovskite -like Barium Oxofluorotitanate at Low Temperature . J Am Chem Soc . Aug. 9 , 2006 ; 128 (31 ) : 10288 ( 2013.01 ) ; COIB 33/157 ( 2013.01 ) ; C08K 3/36 94 . ( 2013.01 ) ; C08L 77/04 ( 2013.01 ) ; B82Y 30/00 Buckley et al . , The sol - gel preparation of silica gels . J Chem Ed . Jul . ( 2013.01 ) ; C08K 2201/011 ( 2013.01 ) 1 , 1994 ; 71 ( 7 ) : 599-602 . ( 58 ) Field of Classification Search Castro et al . , A primer to scaffold DNA origami. Nat Methods. Mar. None 2011 ; 8 ( 3 ) :221-9 . doi : 10.1038 / nmeth.1570 . See application file for complete search history . Cha et al . , Silicatein filaments and subunits from a marine sponge direct the polymerization of silica and silicones in vitro . Proc Natl Acad Sci USA . Jan. 19 , 1999 ; 96 ( 2 ) : 361-5 . ( 56 ) References Cited (Continued ) U.S. PATENT DOCUMENTS Primary Examiner Christina Bradley ( 74 ) Attorney, Agent, or Firm Wolf, Greenfield & 4,703,020 A 10/1987 Nakano et al . 2007/0238808 Al 10/2007 Goldberg et al . Sacks, P.C. 2008/0293919 A1 * 11/2008 Kaplan CO7K 14/43518 ( 57 ) ABSTRACT 530/356 Described herein are novel synthetic molecules , polymers , 2010/0173367 A1 * 7/2010 Marner, II A61B 5/0084 and compositions comprising silica - binding peptides, and 435/106 their methods of production. Also described herein are 2016/0096868 A1 4/2016 Cha et al . methods of synthesizing structurally and chemically com plex silica - based materials using the synthetic molecules , FOREIGN PATENT DOCUMENTS polymers, and compositions. EP 1817257 A1 8/2007 EP 2762488 A2 8/2014 20 Claims , 11 Drawing Sheets WO WO 2006/043285 A1 4/2006 Specification includes a Sequence Listing . US 10,882,885 B2 Page 2

( 56 ) References Cited Naik et al ., Peptide Templates for Nanoparticle Synthesis Derived from Polymerase Chain Reaction - Driven Phage Display. Adv Funct Mater. 2004 ; 14 ( 1 ) : 25-30 . OTHER PUBLICATIONS Naik et al . , Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. Nov. 2002 ; 1 ( 3 ) : 169-72 . Chen et al ., The synthesis of hydroxyapatite with different crystal Nam et al . , Virus - Enabled Synthesis and Assembly of Nanowires for Lithium Ion Battery Electrodes. Science. May 12 , 2006 ;312 (5775 ) : 885 linities by controlling the concentration of recombinant CEMP1 for 8. Epub Apr. 6 , 2006 . biological application . Mater Sci Eng C Mater Biot Appl. Feb. Okochi et al . , Screening of peptide with a high affinity for ZnO 2016 ; 59 : 384-389 . doi : 10.1016 /j.msec.2015.10.029 . Epub Oct. 22 , using spot -synthesized peptide arrays and computational analysis . 2015 . Acta Biomater. Jun . 2010 ; 6 ( 6 ) : 2301-6 . doi: 10.1016 / j.actbio.2009. 12.025 . Epub Dec. 16 , 2009 . Clark et al ., Engineering the Microfabrication of Layer -by -Layer Pappalardo et al . , Copper( ii) and nickel( ii ) binding modes in a Thin Films . Adv Mater. Dec. 1998 ; 10 ( 8 ) : 1515-9 . histidine -containing model dodecapeptide. New J Chem . May Della - Cioppa et al . , Melanin Production in Escherichia coli from a 2002 ; 26 ( 5 ) : 593-600 . doi : 10.1039 /b110655d . Cloned Tyrosinase Gene . Biotechnology ( NY ) . Jul. 1980 ; 8 ( 7 ) : 634 Perry et al . , From biomineral to biomaterials : the role if biomolecule 8 . mineral interactions. Biochem Soc Trans. Aug. 2009 ; 37 : 687-91 . Dickerson et al ., Identification and Design of Peptides for the Rapid , Prince et al . , Construction , Cloning , and Expression of Synthetic High - Yield Formation of Nanoparticulate TiO2 from Aqueous Solu Genes Encoding Spider Dragline Silk . Biochemistry. Aug. 29 , tions at Room Temperature. Chem Mater . May 25 , 2008; 20 (4 ) : 1578 1995 ; 34 ( 34 ) : 10879-85 . 84 . Roy et al ., Identification of a Highly Specific Hydroxyapatite Dickerson et al . , Identification of peptides that promote the rapid binding Peptide using Phage Display. Adv Mater. May 19 , precipitation of germania nanoparticle networks via use of a peptide 2008 ; 20 ( 10 ) : 1830-6 . display library . Chem Commun ( Camb ). Aug. 7 , 2004 ; ( 15 ) : 1776-7 . Schweitzer et al ., Melanin - covered nanoparticles for protection of Epub Jun . 30 , 2004 . bone marrow during radiation therapy of cancer. Int J Radiat Oncol Ding et al . , Biomimetic Production of Silk - Like Recombinant Squid Biol Phys. Dec. 1 , 2010 ; 78 ( 5 ) : 1494-502 . doi: 10.1016 /j.ijrobp.2010 . Sucker Ring Teeth Proteins . Biomacromolecules . Sep. 8 , 02.020 . Epub Apr. 24 , 2010 . 2014 ; 15 ( 9 ) : 3278-89 . doi : 10.1021 / bm500670r . Epub Aug. 5 , 2014 . Staniland et al., Crystallizing the function of the magnetosome Djalali et al . , Au Nanocrystal Growth on Nanotubes Controlled by membrane mineralization protein Mms6 . Biochem Soc Trans . Jun . Conformations and Charges of Sequenced Peptide Templates. J Am 15 , 2019 ; 44 ( 3 ) : 883-90 . doi : 10.1042 / BST20160057 . Epub Jun . 9 , Chem Soc . May 14 , 2003 ; 125 ( 19 ) : 5873-9 . 2019 . Filin et al . , Some Aspects of Precious Opal Synthesis. Aus Gem Sumerel et al ., Biocatalytically Templated Synthesis of Titanium mologist . 2002. 5 pages . Dioxide. Chem Mater. Dec. 1 , 2003 ; 15 ( 25 ) : 4804-9 . Epub Nov. 15 , Flynn et al . , Synthesis and organization of nanoscale II - VI semi 2003 . conductor materials using evolved peptide specificity and viral Thai et al . , Identification and characterization of Cu20- and ZnO capsid assembly . J Mater Chem . 2003 ; 13 ( 10 ) : 2414-21 . binding polypeptides by Escherichia coli cell surface display: Golec et al ., Novel ZnO - binding peptides obtained by the screening toward an understanding ofmetal oxide binding . Biotechnol Bioeng . of a phage display peptide library. J Nanopart Res . Nov. Jul. 20 , 2004 ; 87 ( 2 ) : 129-37 . 2012 ; 14 ( 11 ) : 1218 , 6 pages . Epub Oct. 4 , 2012 . Tsiveriotis et al ., Studies on the interaction of histidyl containing Guerette et al. , Nanoconfined B - Sheets Mechanically Reinforce the peptides with palladium ( II) and platinum ( II ) complex ions . Coord Supra -Biomolecular Network of Robust Squid Sucker Ring Teeth . Chem Rev. 1999 : 171-84 . ACS Nano . Jul. 22 , 2014 ; 8 ( 7 ) : 7170-9 . Umetsu et al . , Bioassisted Room - Temperature Immobilization and Gungormus et al . , Regulation of in vitro Calcium Phosphate Min Mineralization of Zinc Oxide — The Structural Ordering of ZnO eralization by Combinatorially Selected Hydroxyapatite - Binding Nanoparticles into a Flower - Type Morphology. Adv Mater. Nov. Peptides. Biomacromolecules . Mar. 2008 ; 9 ( 3 ) : 966-73 . doi: 10.1021 / 2005 ; 17 ( 21 ) : 2571-5 . bm701037x . Epub Feb. 14 , 2008 . Wallace et al . , Applying Synthetic Biology to Synthesize Functional Kang et al ., Microbial Synthesis of CdS Nanocrystals in Genetically Materials. AICHE Sites . 2017.2 pages . Retrieved from : https : //www . Engineered E. coli. Angew Chem Int Ed Engl . 2008 ; 47 ( 28 ) : 5186-9 . aiche.org/sbe/conferences/synthetic-biology-engineering-evolution doi : 10.1002 / anie.200705806 . design - seed / 2017/ proceeding /paper /applying - synthetic -biology Kroger et al. , Polycationic Peptides from Diatom Biosilica That synthesize - functional -materials . Direct Silica Nanosphere Formation . Science . Nov. 5 , Zafar et al . , Functional Material Feature of Bombyx mori Silk Light 1999 ; 286 ( 5442 ) : 1129-32 . vs. Heavy Chain Proteins. Biomacromolecules. Feb. 9 , 2015 ; 16 (2 ): 606 Kroger et al . , Self - Assembly of Highly Phosphorylated Silaffins and 14. doi : 10.1021 / bm501667 ). Epub Jan. 20 , 2015 . Their Function in Biosilica Morphogenesis . Sci . Oct. 18 , Zhang et al . , Tuning the autophagy -inducing activity of lanthanide 2002; 298( 5593 ): 584-6 . doi: 10.1126 / science.1076221 . Epub Nov. based nanocrystals through specific surface - coating peptides . Nat 2002 . Mater. Sep. 2012 ; 11 ( 9 ) : 817-26 . doi : 10.1038 / nmat3363 . Epub Jul. Lechner et al . , Silaffins in Silica Biomineralization and Biomimetic 15 , 2012 Silica Precipitation . Mar Drugs. Aug. 19 , 2015 ; 13 ( 8 ) : 5297-333 . doi : Zuo et al . , Aluminum- and mild steel - binding peptides from phage 10.3390 /md13085297 . display. Appl Microbiol Biotechnol . Sep. 2005 ; 68 ( 4 ) : 505-9 . Epub Li et al . , Selective in Vitro Effect of Peptides on Calcium Carbonate Oct. 26 , 2005 . Crystallization . Cryst Growth Des . 2002 ; 2 ( 5 ) : 387-93 . doi : 10.1021 / cg0255467 . * cited by examiner U.S. Patent Jan. 5 , 2021 Sheet 1 of 11 US 10,882,885 B2

.. MS/FragmentationAlignment GSY

GMSKSGSYSK:94SEQIDNO GSKKSMSSNO:94QSEQID GMSNO94:SEQID

FIG.IB

** U.S. Patent Jan. 5 , 2021 Sheet 2 of 11 US 10,882,885 B2

FIG . 2A Negative Control SET7 / 9 Y305F

209

90

*** *** VO *** : **** 20 U.S. Patent Jan. 5 , 2021 Sheet 3 of 11 US 10,882,885 B2

FIG . JA Negative Control

2

*****

*

6 MA ***** U.S. Patent Jan. 5 , 2021 Sheet 4 of 11 US 10,882,885 B2

FIG . 3C Specific Methylated Lysine Residues Over Time

FIG . 4A Negative Control

w U.S. Patent Jan. 5 , 2021 Sheet 5 of 11 US 10,882,885 B2

x www ** 3 VO ***

30

FIG . 6B

75 pepide substrate 100 U /mL Tyrosinase

Tyrosinase , Tyrosirase UTYROSINE map het momento normalen MELANING in water

* Tyrosinase U.S. Patent Jan. 5 , 2021 Sheet 6 of 11 US 10,882,885 B2

0.4 Control-R5 75Tyrosinase Tyrosinase Wavelength ( nm )

****** 20

****** 50 00 3.2 370

Wavelength (nm )

go

2 U.S. Patent Jan. 5. 2021 Sheet 7 of 11 US 10,882,885 B2

RS 4. 2 Hypusine ( 2374 Da )

Time ( hours )

Tyrosinase in H20 Tyrosinase in H20

25 in water

R5 in water

1 A5 + Tyrosinase

zum U.S. Patent Jan. 5 , 2021 Sheet 8 of 11 US 10,882,885 B2

FIG . 10A No protein

FIG . 10B U.S. Patent Jan. 5 , 2021 Sheet 9 of 11 US 10,882,885 B2

Ludox . R5Magnetosomes* RSMagnetosomes FIG.11D

silicano silicano

Ludox

silicano proteins coat * U.S. Patent Jan. 5 , 2021 Sheet 10 of 11 US 10,882,885 B2

FIG . 12 DNA ONA + R5 no silica

R5 - mamC magnetosomes & silica preciptiation U.S. Patent Jan. 5 , 2021 Sheet 11 of 11 US 10,882,885 B2

R5 -mamc magnetosomes silicate precipitation Natural magnetosomes US 10,882,885 B2 1 2 PEPTIDE - BASED SYNTHETIC MOLECULES (both from diatoms and other organisms) . Importantly, AND SILICA NANOSTRUCTURES PTMs to silica - binding peptides can be used to control the morphology of precipitated silica , which can allow for the RELATED APPLICATION tunable control of silica structures required for various 5 applications. This application claims priority under 35 U.S.C. § 119 ( e ) In some aspects the disclosure relates to synthetic mol to U.S. provisional application No. 62 /459,251 , filed Feb. ecules . In some embodiments, a synthetic molecule com 15 , 2017 , which is incorporated herein by reference in its prises or consists essentially of the amino acid sequence of entirety. a silica - binding peptide , wherein at least one amino acid of 10 the silica - binding peptide contains at least one non - native GOVERNMENT SUPPORT post -translational modification . In some embodiments, the amino acid sequence of the silica - binding peptide comprises This invention was made with Government support under or consists essentially of the amino acid sequence of SEQ ID Grant No. HR0011-15-2-0033 awarded by the Defense 15 NO : 1 , SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ Advanced Research Projects Agency, Grant No. N00014 ID NO : 5 , SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , 15-1-0034 awarded by the Office of Naval Research , and SEQ ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 11 , SEQ ID Grant No. W911NF - 09 - D - 0001 awarded by the Army NO : 12 , SEQ ID NO : 13 , SEQ ID NO : 14 , SEQ ID NO : 15 , Research Office . The Government has certain rights in the SEQ ID NO : 16 , SEQ ID NO : 17 , SEQ ID NO : 18 , SEQ ID invention . 20 NO : 19 , SEQ ID NO : 20 , SEQ ID NO : 21 , SEQ ID NO : 22 , FIELD SEQ ID NO : 23 , SEQ ID NO : 24 , SEQ ID NO : 25 , SEQ ID NO : 26 , SEQ ID NO : 27 , SEQ ID NO : 28 , SEQ ID NO : 29 , Described herein are novel synthetic molecules , poly SEQ ID NO : 30 , SEQ ID NO : 31 , SEQ ID NO : 32 , SEQ ID mers , and compositions comprising silica - binding peptides , NO : 33 , SEQ ID NO : 34 , or a functional variant thereof. and their methods of production . Also described herein are 25 In some embodiments , at least one of the at least one methods of synthesizing structurally and chemically com non - native post - translational modifications is selected from the group consisting of oxidation , phosphorylation , methyl plex silica - based materials using the synthetic molecules , propylamination , myristoylation , hypusination, polymers, and compositions. hydroxylation , adenylylation , biotinylation , lipidation , BACKGROUND 30 acetylation , glycosylation , propylamination , and sulfona tion . Advanced functional materials with highly organized In some embodiments, the amino acid sequence of the nano- and microstructures are of increasing demand across silica -binding peptide consists essentially of SEQ ID NO : 1 , the medical , optical , energy, and mechanical fields. Silica- wherein at least one amino acid of SEQ ID NO : 1 contains based nano- and microstructures have potential use in a 35 at least one non - native post -translational modification . broad spectrum of applications; however, current methods of In some embodiments, at least one of the at least one generated silica - based nano- and microstructures are lim- non - native post -translational modifications is oxidation . In ited. For example , previous attempts at encapsulating mag- some embodiments, the oxidation occurs at Tyr10 of SEQ netosomes with silicate were performed by the sol - gel ID NO : 1 . method in ~ 43 % ethanol solvent, which is a harsh condition 40 In some embodiments , at least one of the at least one for the magnetosome membrane and proteins ( Borg S. , et al . , non - native post - translational modifications is phosphory Small, 2015 Sep. 2 ; 11 ( 33 ): 4209-17 ) . Other applications are lation . In some embodiments, the phosphorylation occurs at limited by time and / or energy constraints . For example, Ser1, Ser2, Ser5 , Ser7, Ser9, Ser11 and / or Ser14 of SEQ ID typical methods of synthesizing synthetic opals can take up NO : 1 . to a year and require high temperatures ( Filin S. V., et al . , 45 In some embodiments, at least one of the at least one Australian Gemmologist, 2002 January ; 21 : 278-282 ; U.S. non - native post -translational modifications is methylation. Pat . No. 4,703,020 ; P.C.T. App . No. PCT / IN2005 / 000033 ) . In some embodiments, the methylation occurs at Lys3 , Lys4 , Likewise , previous methods of combining silica and mela- Lys12, and / or Lys15 of SEQ ID NO : 1. In some embodi nin begin with pre - formed silica nanoparticles and require ments , Lys3 , Lys4, Lys12 , and / or Lys15 of SEQ ID NO : 1 overnight reactions to coat the surfaces with melanin 50 is methylated more than once . ( Schweitzer A. D. , et al . , Int. J. Radiat. Oncol . Biol . Phys ., In some embodiments, at least one of the at least one 2010 Dec. 1 ; 78 ( 5 ) : 1494-1502 ) . non - native post - translational modifications is propylamina tion . In some embodiments , the propylamination is the SUMMARY addition of spermine, spermidine, putrescine, and / or ther 55 mospermine to at least one amino acid of SEQ ID NO : 1 . Advanced functional materials with highly organized In some embodiments, at least one of the at least one nano- and microstructures are of increasing demand . The R5 non - native post - translational modifications is myristoy peptide from the diatom Cylindrotheca fusiformis was pre- lation . viously shown to precipitate 500 nm diameter silica spheres In some embodiments , at least one of the at least one in vitro ( Kröger N. , et al . , Science , 1999 Nov. 5 ; 286 ( 5442 ) : 60 non -native post - translational modifications is hypusination. 1129-32 ) . However, the potential of the R5 peptide and other In some embodiments , at least two amino acids of the silica - binding peptides for generating highly organized silica - binding peptide contain at least one non - native post nano- and microstructures has largely remained unexplored . translational modification . In some embodiments , at least As demonstrated herein , synthetic molecules comprising two of the at least two amino acids that have at least one silica - binding peptides, including R5 peptide, can be modi- 65 non - native post - translational modification have the same fied with post- translational modifications ( PTMs ) in vitro non - native post- translational modification . In some embodi using modifying enzymes isolated from various organisms ments , at least two of the at least two amino acids that have US 10,882,885 B2 3 4 at least one non - native post -translational modification have modification . In some embodiments , at least two of the at a different non - native post - translational modification . least two amino acids that have at least one post -transla In some embodiments , the synthetic molecule comprises tional modification have the same post -translational modi the amino acid sequence of a silica - binding peptide and at fication . In some embodiments, at least two of the at least least one terminal fusion molecule , wherein each of the at 5 two amino acids that have at least one post - translational least one terminal fusion molecules is fused to at least one terminal end of the amino acid sequence comprising the tionmodification . have a different post -translational modifica amino acid sequence of the silica - binding peptide . In some embodiments , at least one of the at least one In some embodiments, a synthetic molecule comprises the terminal fusion molecules is a biomolecule . In some 10 amino acid sequence of a silica - binding peptide, wherein the embodiments , the biomolecule is a polypeptide. In some amino acid sequence of the silica - binding peptide comprises embodiments, the polypeptide is selected from the group the amino acid sequence of SEQ ID NO : 14 , SEQ ID NO : consisting of Mms6 , MamC, CNT1 , and CNT2 . In some 15 , SEQ ID NO : 16 , SEQ ID NO : 17 , SEQ ID NO : 18 , SEQ embodiments , at least one of the at least one terminal fusion ID NO : 19 , SEQ ID NO : 20 , SEQ ID NO : 21 , SEQ ID NO : molecules is not a biomolecule . 15 22 , SEQ ID NO : 23 , SEQ ID NO : 24 , SEQ ID NO : 25 , SEQ In some embodiments, the amino acid sequence of the ID NO : 26 , SEQ ID NO : 27 , SEQ ID NO : 28 , SEQ ID NO : silica - binding peptide comprises the amino acid sequence of 29 , SEQ ID NO : 30 , SEQ ID NO : 31 , SEQ ID NO : 32 , SEQ SEQ ID NO : 1 , SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : ID NO : 33 , SEQ ID NO : 34 , or a functional variant thereof. 4 , SEQ ID NO : 5 , SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID In some aspects the disclosure relates to polymers. In NO : 8 , SEQ ID NO : 9 , SEQ ID NO : 10, SEQ ID NO : 11 , 20 some embodiments, the polymer comprises a fusion of at SEQ ID NO : 12 , or SEQ ID NO : 13 , SEQ ID NO : 14 , SEQ least two synthetic molecules , wherein each of the at least ID NO : 15 , SEQ ID NO : 16 , SEQ ID NO : 17 , SEQ ID NO : two synthetic molecules is as described above. In some 18 , SEQ ID NO : 19 , SEQ ID NO : 20 , SEQ ID NO : 21 , SEQ embodiments , at least two of the at least two synthetic ID NO : 22 , SEQ ID NO : 23 , SEQ ID NO : 24 , SEQ ID NO : molecules are chemically unique . 25 , SEQ ID NO : 26 , SEQ ID NO : 27 , SEQ ID NO : 28 , SEQ 25 In some embodiments, the at least two synthetic mol ID NO : 29 , SEQ ID NO : 30 , SEQ ID NO : 31 , SEQ ID NO : ecules are fused through an interaction between at least one 32 , SEQ ID NO : 33 , or SEQ ID NO : 34 , and / or a functional terminal end of each synthetic molecule . In some embodi variant, thereof . ments , the at least two synthetic molecules are fused through In some embodiments, the at least one amino acid of the an interaction between at least one amino acid side chain of silica binding peptide contains at least one post- translational 30 each synthetic molecule . In some embodiments, the polymer modification . In some embodiments , at least one of the at comprises R5 -melanin . least one post -translational modifications is selected from In some aspects the disclosure relates to compositions. In the group consisting of oxidation , phosphorylation , methyl- some embodiments , a composition comprises at least one ation , propylamination , myristoylation , hypusination , synthetic molecule , wherein each of the at least one syn hydroxylation , adenylylation , biotinylation , lipidation , 35 thetic molecules is as described above . In some embodi acetylation , glycosylation , propylamination, and sulfona- ments , the composition comprises two or more types of tion . synthetic molecules , wherein the two or more types of In some embodiments , the amino acid sequence of the synthetic molecules are chemically unique. silica - binding peptide comprises an the amino acid sequence In some embodiments , a composition comprises at least of SEQ ID NO : 1 , wherein at least one amino acid of SEQ 40 one polymer, wherein each of the at least one polymer is as ID NO : 1 contains at least one post - translational modifica- described above . In some embodiments, the composition tion . comprises two or more types of polymers , wherein the two In some embodiments , at least one of the at least one or more types of polymers are chemically unique. post- translational modifications is oxidation . In some In some aspects the disclosure relates to methods of embodiments, the oxidation occurs at Tyr10 of SEQ ID NO : 45 synthesizing a silica structure . In some embodiments, the 1 . method comprises contacting a synthetic molecule with a In some embodiments , at least one of the at least one solution comprising dissolved silica , wherein the synthetic post- translational modifications is phosphorylation . In some molecule is as described above . embodiments, the phosphorylation occurs at Ser1, Ser2 , In some embodiments, the synthetic molecule and the Ser5 , Ser7 , Ser9 , Ser11 and / or Ser14 of SEQ ID NO : 1 . 50 solution comprising dissolved silica are contacted at ambient In some embodiments, at least one of the at least one temperature . post - translational modifications is methylation . In some In some embodiments, the dissolved silica is aqueous embodiments, the methylation occurs at Lys3 , Lys4 , Lys12 , silicic acid . In some embodiments, the dissolved silica is and / or Lys15 of SEQ ID NO : 1. In some embodiments, colloidal silica . Lys3 , Lys4 , Lys12 , and / or Lys15 of SEQ ID NO : 1 is 55 In some embodiments, the method also comprises con methylated more than once . tacting the synthetic molecule and the solution comprising In some embodiments , at least one of the at least one dissolved silica with at least one metal nanoparticle. In some post - translational modifications is propylamination . In some embodiments , at least one of the at least one metal nanopar embodiments, the propylamination is the addition of sper- ticles is selected from the group consisting of an iron oxide mine, spermidine, putrescine, and / or thermospermine to at 60 nanoparticle, a zinc oxide nanoparticle, tantalum oxide least one amino acid of SEQ ID NO : 1 . nanoparticles, a hafnium oxide nanoparticle , a titanium In some embodiments , at least one of the at least one oxide nanoparticle , a cadmium sulfide nanoparticle , a ger post- translational modifications is myristoylation. manium oxide nanoparticle, an indium phosphide, and a In some embodiments, at least one of the at least one cadmium selenide nanoparticle . post - translational modifications is hypusination . 65 In some embodiments, the method also comprises con In some embodiments , at least two amino acids of the tacting the synthetic molecule and the solution comprising silica -binding peptide contain at least one post -translational dissolved silica with magnetosomes . US 10,882,885 B2 5 6 In some embodiments, the method also comprises con- embodiments presented herein . It is to be understood that the tacting the synthetic molecule and the solution comprising data illustrated in the drawings in no way limit the scope of dissolved silica with a biomolecule . In some embodiments, the disclosure . the biomolecule is DNA . FIGS . 1A - 1C . Phosphorylation of R5 by Protein Kinase In some aspects , the disclosure relates to a melanin 5 A. FIG . 1A . The relative percentages of each R5 species embedded silica structure generated by the method as ( unmodified R5 and R5 modified with phosphate ) over time . described above . FIG . 1B . Increasing the ratio of PKA to R5 increases the In some aspects , the disclosure relates to an R5 -Mms6 proportion of phosphorylated R5 ( ratios that converted up to iron oxide nanoparticle silica structure as generated by the 66 % of R5 were tested ) . FIG . 1C . Manually assembled method as described above . 10 MS / MS fragmentation alignments . Targeted MS / MS analy In some aspects , the disclosure relates to an R5 -mamC magnetosome silica structure generated by the method as sis was performed on an Agilent QQQ , and data were described above . interpreted manually . Each graph represents the fragments In some aspects , the disclosure relates to a carbon that were identified by specifically targeting the known mass nanotube - binding magnetosome silica structure generated 15 of R5 with zero , one , or two phosphates added and detecting by the method as described above . all product ions . Fragments were aligned to the region of R5 In some aspects , the disclosure relates to a silica coated that the product ion mass corresponds to . Regions with DNA - nanostructure generated by the method as described increased height represent more fragment coverage. Frag above . ments containing no phosphate mass shift are shown in dark In some aspects , the disclosure relates to an opal silica 20 shade, a mass shift corresponding to the presence of one structure generated by the method as described above . phosphate are shown in medium shade , and with two phos In some aspects , the disclosure relates to silica structures phates are shown in light shade. Data indicated that the comprising precipitated silica and at least one synthetic primary phosphorylation site was at Ser11 , with very low molecule , wherein each of the at least one synthetic mol- levels of phosphorylation at Ser4 , Ser7, and Ser16 . ecule is as described above . 25 FIGS . 2A - 2C . Methylation of R5 by Lysine Methyltrans In some embodiments, the silica structure also comprises ferase SETD7 . FIG . 2A . A heatmap showing the relative iron oxide nanoparticles, wherein at least one of the at least percentages of each R5 species ( containing zero through 16 one synthetic molecules is R5 - Mms6 . methyl groups) over time for wild -type SET7 / 9 and SET7 / 9 In some embodiments, the silica structure also comprises Y305F . FIGS . 2B - 2C . Profile traces for zero through four magnetosomes . In some embodiments, at least one of the at 30 methyl groups added to R5 over time for wild - type SET7 / 9 least one synthetic molecules is R5 - MamC . In some ( FIG . 2B ) and SET7 / 9 Y305F ( FIG . 2C ) . embodiments, at least one of the at least one synthetic FIGS . 3A - 3C . Methylation of R5 by diatom protein molecules is R5 - CNT. In some embodiments, the R5 - CNT THAOC_24272 . FIG . 3A . A heatmap showing the relative is R5 - CNT1 . In some embodiments, the R5 - CNT is percentages of each R5 species ( containing zero through 16 R5 - CNT2 . 35 methyl groups) over time . FIG . 3B . Profile traces for zero In some embodiments , the silica structure also comprises through five methyl groups added to R5 over time . FIG . 3C . a biomolecule . In some embodiments , the biomolecule is A schematic indicating which lysine residues are methylated DNA . over time. MS / MS analysis was performed on an Agilent In some aspects , the disclosure relates to silica structures QQQ and data were interpreted manually. Solid lines rep comprising precipitated silica and at least one polymer, 40 resent potential immediate connections between methylated wherein each of the at least on polymer is as described states over time , while dashed lines represent potential above . connections that skip one or more intermediate states . Fur In some embodiments, at least one of the at least one ther MS / MS analysis on a Thermo Orbitrap was performed polymers comprises R5 - melanin . and data were analyzed computationally using MASCOT . In some aspects, the disclosure relates to a silica coated 45 All data indicated that methylation occurs on all four lysines DNA - nanostructure comprising precipitated silica , R5 pep- with no discernable preference or pattern . tide , and DNA . FIGS . 4A - 4B . Methylation of R5 by diatom protein In some aspects , the disclosure relates to a methods of THAOC_37500 . FIG . 4A . A heatmap showing the relative synthesizing a silica coated DNA - nanostructure. In some percentages of each R5 species ( containing zero through 16 embodiments, the method comprises contacting DNA with 50 methyl groups) over time . FIG . 4B . Profile traces for zero R5 peptide and subsequently contacting the DNA and R5 through four methyl groups added to R5 over time . peptide with a solution comprising dissolved silica . In some FIG . 5. Propylamination of R5 by Thermospermine Syn embodiments, the DNA and the R5 are contacted with the thase ACL5 . A time course graph showing the relative solution comprising dissolved silica at ambient temperature. percentages of each R5 species ( unmodified and with one In some embodiments, the dissolved silica is aqueous silicic 55 thermospermine attached ), as well as the synthesis of free acid . In some embodiments , the dissolved silica is colloidal thermospermine. silica . FIGS . 6A - 6D . R5 - melanin formation by Tyrosinase . FIG . These and other aspects of the invention are further 6A . Enzymatic oxidation of tyrosine by Tyrosinase leads to described below . spontaneous formation of melanins. FIG . 6B . Within one 60 hour a color change is observed . FIG . 6C . Spectroscopy BRIEF DESCRIPTION OF THE DRAWINGS indicates formation of melanin over time ( peak at 350 nm ). FIG . 6D . SDS - PAGE and Coomassie stain indicated polym The following drawings form part of the present specifi- erization of R5 peptides in the presence of Tyrosinase . cation and are included to further demonstrate certain FIG . 7. Myristoylation by N -Myristoyltransferase 1. A aspects of the present disclosure , which can be better under- 65 time course graph showing the relative percentages of each stood by reference to one or more of these drawings in R5 species ( unmodified and with one myristoyl group combination with the detailed description of specific attached ). US 10,882,885 B2 7 8 FIG . 8. Hypusination by DHPS and DOHH . A time course structures required for various applications. The generation graph showing the relative percentages of each R5 species of nano- and microstructures using these silica - binding ( unmodified and with two hypusine groups attached ) in the peptides has various advantages over previously described presence of deoxyhypysine synthase ( DHPS ) and deoxyhy- methodologies . pusine hydroxylase ( DOHH ) . No intermediates or presence 5 For example, previous attempts at encapsulating magne of one hypusine residue were detected . tosomes with silicate were performed by the sol - gel method FIG . 9. R5 - melanin silica precipitation . Unmodified R5 in ~ 43 % ethanol solvent, which is a harsh condition for the peptides precipitated highly uniform silica spheres that magnetosome membrane and proteins ( Borg S. , et al . , Small , appeared white ( R5 in water ). R5 - melanin precipitated 2015 Sep. 2 ; 11 ( 33 ) : 4209-17 ) . In contrast, the methods brown , porous silica . 10 described herein facilitate the precipitation of silica in FIGS . 10A - 10B . In vitro synthesis of silica - coated iron aqueous solvents . oxide nanoparticles using R5 - Mms6 . FIG . 10A . Iron oxide Other applications are limited by time and / or energy nanoparticles were synthesized in vitro by the partial oxi- constraints . The methods of synthesizing silica described dation method using R5 -Mms6 ( della - Cioppa G. , et al . , herein are greater than 90 % faster than traditional hydro Biotechnology , 1990 July ; 8 ( 7 ) : 634-38 ) . FIG . 10B . Iron 15 thermal synthesis or sol - gel methods and occur at ambient oxide nanoparticles were visualized by scanning electron temperatures ( 25º C. versus greater than 60 ° C. ) in aqueous microscopy ( SEM ) and transmission electron microscopy conditions (Buckley A. M. and Greenblatt, M. J. , J. Chem . ( TEM ) . Energy - dispersive X - ray spectroscopy ( EDS ) Educ ., 1994 July ; 71 ( 7 ) : 599 ) . Previous examples of com showed that all nanoparticles ( first column) were composed bining silica and melanin start with pre - formed silica nan of iron oxide ( Fe2O4 ), and with the addition of TMOS , 20 oparticles and require overnight reactions to coat the sur R5 -Mms6 - iron oxide nanoparticles (middle row , second faces with melanin ( Schweitzer A. D. , et al . , Int. J. Radiat. column ) were 87.4 % Fe3O4 and 5.8 % silica ( SiO2 ) . Oncol . Biol . Phys ., 2010 Dec. 1 ; 78 ( 5 ) : 1494-1502 ) . The FIGS . 11A - 11D . In vitro synthesis of silica - coated mag- methodologies described herein , allow one to physically netosomes using R5 - Mam? . Genetically engineered M. embed melanin molecules in the silica in less than two magneticum produce magnetosomes displaying R5 on the 25 hours . surface . Magnetosomes were coated with silica through the Likewise, typical methods to synthesize synthetic opals addition of silicic acid ( either TMOS or Ludox HS - 30 as the can take up to a year ( usually requiring seven months ) and silica source ). FIGS . 11A - 11B . In the presence of TMOS and require high temperatures ( 800-1150 ° C. ) ( Filin S. V., et al . , Ludox silicic acids , both wild - type magnetosomes ( FIG . Australian Gemmologist, 2002 January ; 21 : 278-282 ; U.S. 11A ) and R5 -displaying magnetosomes ( FIG . 11B ) contain- 30 Pat . No. 4,703,020 ; P.C.T. App . No. PCT / IN2005 / 000033 ) . ing all coat proteins showed no statistical difference in their The methodologies described herein facilitate the synthesis ability to precipitate layers of silica , even when additional of opals at room temperature and over the course of days or R5 was doped into the reaction . FIGS . 11C - 11D . However, less . when the MamA coat protein is removed with a solvent Synthetic Molecules and Compositions Comprising the Syn wash , R5 - displaying magnetosomes showed an increased 35 thetic Molecules silica coating thickness when TMOS is the silica source and In some aspects the disclosure relates to synthetic mol additional R5 is doped into the reaction . In the presence of ecules . As used herein , the term “ synthetic molecule ” refers Ludox silicic acid , wild -type magnetosomes without the to any non -naturally occurring compound that arises from MamA coat protein did not form silica coatings ( FIG . 11C ) , human engineering. In some embodiments , the synthetic while R5 - displaying magnetosomes without MamA contin- 40 molecule is produced in vitro. In other embodiments , the ued to show high propensity for becoming coated ( FIG . synthetic molecule is produced in vivo ( i.e. , in a living 11D ) . organism ). In some embodiments, the synthetic molecule is FIG . 12. Silica - coated DNA nanostructures using R5 . A produced in vivo and is subsequently isolated and purified . six - helix bundle DNA nanostructure ( 6 nm diameter, 80 nm In some embodiments , the synthetic molecule comprises length ) was coated with a layer of silica when in the 45 an amino acid sequence ( i.e. , a peptide component ). In some presence of R5 . embodiments, the amino acid sequence comprises the amino FIG . 13. SEM analysis of R5 - MamC magnetosomes silica acid sequence of a silica -binding peptide . precipitation The amino acid sequence of various silica- binding pep FIG . 14. TEM analysis of R5 - MamC magnetosomes silica tides are known to those having skill in the art, including the precipitation . 50 amino acid sequences of R5 (N - SSKKSGSYSGSKGSKR RIL - C , SEQ ID NO : 1 ) , R1 (N -SSKKSGSYYSYGTKKSG DETAILED DESCRIPTION SYSGYSTKKSASRRIL - C , SEQ ID NO : 2 ) , Si3-3 ( N - APPGHHHWHIHH - C , SEQ ID NO : 3 ) , Si3-4 Advanced functional materials with highly organized ( N -MSASSYASFSWS - C , SEQ ID NO : 4 ) , Si3-8 (N -KP nano- and microstructures are of increasing demand across 55 SHHHHHTGAN - C , SEQ ID NO : 5 ) , Si4-1 ( N -MSPHPH the medical , optical , energy , and mechanical fields. Silica- PRHHHT - C , SEQ ID NO : 6 ), Si4-3 based nano- and microstructures have potential use in a ( N -MSPHHMHHSHGH - C , SEQ ID NO : 7 ) , Si4-7 broad spectrum of applications; however, current technolo- ( N - LPHHHHLHTKLP - C , SEQ ID NO : 8 ) , Si4-8 gies for generated silica - based nano- and microstructures are ( N -APHHHHPHHLSR - C , SEQ ID NO : 9 ) , Si4-10 limited . 60 ( N - RGRRRRLSCRLL - C , SEQ ID NO : 10 ) , and Ge4-1 As demonstrated herein , silica - binding peptides , includ- ( N - TVASNSGLRPAS - C , SEQ ID NO : 11 ) (Kroger N. , et ing R5 peptide, can be modified with post -translational al . , J. Biol . Chem . 2001 Jul . 13 ; 276 ( 28 ) : 26066-70 ; Perry C. modifications ( PTMs ) in vitro using modifying enzymes C. , et al . , Biochem . Soc . Trans. 2009 August; 37 ( Pt 4 ) : isolated from various organisms (both from diatoms and 687-91 ; Baeuerlein E. , Wiley - VCH , March 2006 ; Ch . 1 : other organisms) . Importantly, PTMs to silica - binding pep- 65 ISBN : 978-3-527-60461-6 ) . Other previously disclosed tides can be used to control the morphology of precipitated R5 - like sequences include N - SSKKSGSYSGSKGSKRR ( I / silica , which can allow for the tunable control of silica N ) L - C ( SEQ ID NO : 12 ) and N -SSKKSGSYSGSKG US 10,882,885 B2 9 10 SKRRNL - C ( SEQ ID NO : 13 ) , wherein “N- ” and “ C- ” group of the amino acid sequence comprising the amino acid signify the N - terminus and C -terminus , respectively, of each sequence of the silica - binding peptide . peptide. In some embodiments , at least one of the at least one As disclosed herein , the amino acid sequences of addi- terminal fusion molecules comprises a biomolecule . As used tional, non - natural silica -binding peptides include 5 herein , the term “ biomolecule ” refers to large molecules N - GMSSKKSGSKGSKRRIL - C ( SEQ ID NO : 14 ) , generated by an organisms or produced synthetically. In N - SSEESGSYSGSEGSKRRIL - C ( SEQ ID NO : 15 ) , some embodiments, the biomolecule is a macromolecule . N - SSDDSGSYSGSDGSKRRIL - C ( SEQ ID NO : 16 ) , Examples of macromolecules include, but are not limited to , N - SSKESGSYSGSEGSKRRIL - C ( SEQ ID NO : 17 ) , proteins ( i.e. , polypeptides ) , carbohydrates, lipids , nucleic N - SSKKSGSYSGSEGSKRRIL - C ( SEQ ID NO : 18) , 10 acids ( i.e. , polynucleic acids ) , and combinations thereof. In N - SSKESGSYSGSKGSKRRIL - C ( SEQ ID NO : 19 ) , some embodiments, the biomolecule is a small molecule N - SSKKSGSLSGSKGSKRRIL - C ( SEQ ID NO : 20 ) , such as a metabolite , secondary metabolite , or a natural N - CCKKCGCYCGCKGCKRRIL - C ( SEQ ID NO : 21 ) , product. Examples of small molecule biomolecules are N -AAKKAGAYAGAKGAKRRIL - C ( SEQ ID NO : 22 ) , 15 known to those having ordinary skill in the art . N - SSKKAGAYAGAKGAKRRIL - C ( SEQ ID NO : 23 ) , In some embodiments , at least one of the at least one N - IIKKIGIIIGIKGIKRRIL - C ( SEQ ID NO : 24 ) , terminal fusion molecules is a polypeptide that is fused to N - PPKKPGPPPGPKGPKRRIL - C ( SEQ ID NO : 25 ) , the at least one terminal end of the amino acid sequence N - DDKKDGDYDGDKGDKRRIL - C ( SEQ ID NO : 26 ) , comprising the amino acid sequence of the silica - binding N - NNEENGNYNGNEGNKRRIL - C (SEQ ID NO : 27 ) , 20 peptide. N -NNEKNGNYNGNEGNKRRIL - C ( SEQ ID NO : 28 ) , In some embodiments, the polypeptide terminal fusion N - HHKKHGHYHGHKGHKRRIL - C ( SEQ ID NO : 29 ) , molecule is Mms6 ( including Mms6 orthologs and func N -KKKKKGKYKGKKGKKRRIL - C (SEQ ID NO : 30 ) , tional variants , thereof) . In some embodiments, the poly N - EEKKEGEYEGEKGEKRRIL - C ( SEQ ID NO : 31 ) , peptide terminal fusion molecule is MamC ( including N - AAEEAGAYAGAEGAKRRIL - C ( SEQ ID NO : 32 ) , 25 MamC orthologs and functional variants, thereof) . In some N -AAEKAGAYAGAEGAKRRIL - C ( SEQ ID NO : 33 ) , and embodiments, the polypeptide terminal fusion molecule is a N - SSHHSGSYSGSHGSKRRIL - C ( SEQ ID NO : 34 ) , carbon -nanotube - binding peptide. In some embodiments , wherein “ N- ” and “ C-” signify the N -terminus and C - ter- the carbon - nanotube - binding peptide is CNT1 ( including minus , respectively, of each peptide . CNT1 orthologs and functional variants, thereof) or CNT2 In some embodiments, a synthetic molecule comprises the 30 ( including CNT1 orthologs and functional variants , thereof) . amino acid sequence of a silica - binding peptide comprising In some embodiments, the polypeptide terminal fusion the amino acid sequence of SEQ ID NO : 1 , SEQ ID NO : 2 , molecule is Cementum Protein 1 ( CEMP1 ) ( Chen X. , et al . , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 5 , SEQ ID NO : Mater. Sci . Eng . C. Mater. Biol . Appl. 2016 February ; 59 : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID 384-89 ) . In some embodiments, the polypeptide terminal NO : 10 , SEQ ID NO : 11 , SEQ ID NO : 12 , SEQ ID NO : 13 , 35 molecule is a silicatein protein ( see Cha J. N. , et al . , Proc . SEQ ID NO : 14 , SEQ ID NO : 15 , SEQ ID NO : 16 , SEQ ID Natl . Acad . Sci . U.S.A. , 1999 Jan. 19 ; 96 ( 2 ) : 361-65 ; NO : 17 , SEQ ID NO : 18 , SEQ ID NO : 19 , SEQ ID NO : 20 , Brutchey R. L. , et al . , J. Am . Chem . Soc . 2006 Aug. 9 ; SEQ ID NO : 21 , SEQ ID NO : 22 , SEQ ID NO : 23 , SEQ ID 128 ( 31 ) : 10288-94 ; Sumerel J. L. , et al . , Chem . Mater. 2003 ; NO : 24 , SEQ ID NO : 25 , SEQ ID NO : 26 , SEQ ID NO : 27 , 15 ( 25 ) : 4804-9 , the entirety of which are incorporated SEQ ID NO : 28 , SEQ ID NO : 29 , SEQ ID NO : 30 , SEQ ID 40 herein ). NO : 31 , SEQ ID NO : 32 , SEQ ID NO : 33 , SEQ ID NO : 34 , In some embodiments , the polypeptide terminal fusion and / or a functional variant, thereof. molecule is a spider silk protein . In some embodiments , the In some embodiments , the synthetic molecule comprises spider silk protein is Major Amullate Spindroin 1 ( MaSpl ) an amino acid sequence comprising the amino acid sequence (SGRGGLGGQGAGMAAAAAMGGAGQGGYGGLG of a silica - binding peptide and at least one terminal fusion 45 SQGT, SEQ ID NO : 80 ) ( see Prince J. T. , et al . , Biochem molecule , wherein the at least one terminal fusion molecule istry. 1995 Aug. 29 ; 34 : 10879-85 , the entirety of which is is fused to at least one terminal end of the amino acid incorporated herein ). In some embodiments , the spider silk sequence comprising the amino acid sequence of the silica- protein is fibroin heavy chain (GAGAGSGAAGSG binding peptide . In the context of a terminal fusion mol- AGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGA ecule , the term “ fused ” refers to a covalent attachment 50 GSGAGAGS GAGAGY, SEQ ID NO : 81 ) or fibroin light formed between the terminal fusion molecule and the N - ter- chain ( see Zafar M. S. , et al . , Biomacromolecules . 2015 ; minal amine or C - terminal carboxyl group of the amino acid 16 ( 2 ) : 606-14 , the entirety of which is incorporated herein ). sequence comprising the amino acid sequence of the silica- In some embodiments, the polypeptide terminal fusion binding peptide . In some embodiments , a fusion molecule is molecule is PC Synthase from S. pompe ( SpPCS ) ( see Kang fused to the N - terminal amine group of the amino acid 55 S. H. , et al . , Angew . Chem . Int. Ed . Engl. 2008 ; 47 ( 28 ) : sequence comprising the amino acid sequence of the silica- 5186-89 , the entirety of which is incorporated herein ). binding peptide . In some embodiments, a fusion molecule is In some embodiments, the polypeptide terminal fusion fused to the C - terminal carboxyl group of the amino acid molecule is a suckerin protein . In some embodiments, the sequence comprising the amino acid sequence of the silica- suckerin protein is Suckerin -39 ( see Ding D. , et al . , Biomac binding peptide . In some embodiments, a fusion molecule is 60 romolecules . 2014 ; 15 : 3278-89 , the entirety of which is fused to both the N - terminal amine group and the C - terminal incorporated herein ). In some embodiments the suckerin carboxyl group of the amino acid sequence comprising the protein is Suckerin - 12 ( see Guerette P. A. , et al . , ACS Nano . amino acid sequence of the silica -binding peptide . In some 2014 Jul. 22 ; 8 ( 7 ) : 7170-79 , the entirety of which is incor embodiments a fusion molecule is fused to the N - terminal porated herein ). In some embodiments, the suckerin protein amine group of the amino acid sequence comprising the 65 is the M1 region or M2 region of a suckerin protein . For amino acid sequence of the silica - binding peptide , and a example, in some embodiments , the suckerin protein is an separate fusion molecule is fused to the C - terminal carboxyl M1 region amino acid sequence: US 10,882,885 B2 11 12. sequence by about 5 amino acids , by about 10 amino acids , AATSVSRTTH , ( SEQ ID NO : 82 ) by about 15 amino acids , by about 20 amino acids , by about 30 amino acids , by about 40 amino acids , by about 50 amino ATTAVSHTTHHA , ( SEQ ID NO : 83 ) acids , by about 75 amino acids , by about 100 amino acids or AATVSHTTHHA , ( SEQ ID NO : 84 ) 5 more , and which retain functionality . In the context of a silica - binding peptide ( and functional AAAVSHTTHHA , ( SEQ ID NO : 85 ) variants thereof ), the term “ retain functionality ” refers to the AAVSHTTHHA , ( SEQ ID NO : 86 ) variant silica - binding peptide's ability to precipitate silica at AAATVSHTTHHA , ( SEQ ID NO : 87 ) 10 least 10 % , 20 % , 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % , or 100 % , or more than 100 % as efficiently as the non - variant silica -binding peptide . Methods of measuring and compar AVSHTTHHA . ( SEQ ID NO : 88 ) ing levels of silica precipitation are known to those skilled in the art . In the context of Mms6 or MamC ( and their moleculeIn some is DBADIembodiments (SEQ , IDthe NO polypeptide : 35 ), A1 - S1terminal ( SEQ ID fusion NO : 15 orthologs) , the term “ retain functionality ” refers to the 36 ) , A1 - S2 ( SEQ ID NO : 37 ) , BT1 ( SEQ ID NO : 38 ) , BT2 protein's ability to bind metal at least 10 % , 20 % , 30 % , 40 % , ( SEQ ID NO : 39 ) , A7 ( SEQ ID NO : 40 ) , Z8 ( SEQ ID NO : 50 % , 60 % , 70 % , 80 % , 90 % , 100 % , or more than 100 % as 41 ) , J182 ( SEQ ID NO : 42 ) , J140 ( SEQ ID NO : 43 ) , 5R39 efficiently as wild - type Mms6 or MamC , respectively . Meth ( SEQ ID NO : 44 ) , 4R12 ( SEQ ID NO : 45 ) , AG - 4 ( SEQ ID ods of measuring and comparing levels of magnetosome NO : 46 ) , AG - P35 ( SEQ ID NO : 47 ) , Col - P10 ( SEQ ID NO : 20 binding are known to those skilled in the art. In the context 48 ) , CN225 ( SEQ ID NO : 49 ) , CN44 ( SEQ ID NO : 50 ) , of CNT1 or CNT2 ( and their orthologs ), the term “ retain CN179 ( SEQ ID NO : 51 ) , CN146 ( SEQ ID NO : 52 ) , HG12 functionality ” refers to the protein's ability to bind carbon ( SEQ ID NO : 53 ) , HG6 ( SEQ ID NO : 54 ) , Ge8 ( SEQ ID nanotubes at least 10 % , 20 % , 30 % , 40 % , 50 % , 60 % , 70 % , NO : 55 ) , Ge34 ( SEQ ID NO : 56 ) , Gold - binding peptide a 80 % , 90 % , 100 % , or more than 100 % as efficiently as ( SEQ ID NO : 57 ) , Gold - binding peptide b ( SEQ ID NO : 58 ) , 25 wild - type CNT1 or CNT2 , respectively. Methods of mea MS - S1 ( SEQ ID NO : 59 ) , RE - 1 ( SEQ ID NO : 60 ) , Ag - 22 suring and comparing levels of carbon -nanotube - binding are ( SEQ ID NO : 61 ) , Ag - 28 ( SEQ ID NO : 62 ) , Pt - 41 ( SEQ ID known to those skilled in the art. NO : 63 ) , Pt - 14 ( SEQ ID NO : 64 ) , Pt - 1.2 ( SEQ ID NO : 65 ) , In some embodiments, a synthetic molecule consists HPGAH ( SEQ ID NO : 66 ) , AG3 ( SEQ ID NO : 67 ) , AG4 essentially of the amino acid sequence of a silica -binding ( SEQ ID NO : 68 ) , dTi - 1 ( RKK ) ( SEQ ID NO : 69 ) , Ti - 1 30 peptide comprising the amino acid sequence of SEQ ID NO : ( SEQ ID NO : 70 ) , PG - 7 ( SEQ ID NO : 71 ) , ZnO - la ( SEQ ID 1 , SEQ ID NO : 2 , SEQ ID NO : 3 , SEQ ID NO : 4 , SEQ ID NO : 72 ) , Zno - lb ( SEQ ID NO : 73 ) , ZnO - 2 ( SEQ ID NO : NO : 5 , SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ 74 ) , ZnO - 3 ( SEQ ID NO : 75 ) , ZnO - 4 ( SEQ ID NO : 76 ) , HA ID NO : 9 , SEQ ID NO : 10 , SEQ ID NO : 11 , SEQ ID NO : 6-1 ( SEQ ID NO : 77 ) , HABP1 ( SEQ ID NO : 78 ) , or HABP2 12 , SEQ ID NO : 13 , SEQ ID NO : 14 , SEQ ID NO : 15 , SEQ ( SEQ ID NO : 79 ) ( TABLE 3 ) . 35 ID NO : 16 , SEQ ID NO : 17 , SEQ ID NO : 18 , SEQ ID NO : In some embodiments, the polypeptide terminal fusion 19 , SEQ ID NO : 20 , SEQ ID NO : 21 , SEQ ID NO : 22 , SEQ molecule is a peptide tag . Examples of peptide tags are ID NO : 23 , SEQ ID NO : 24 , SEQ ID NO : 25 , SEQ ID NO : known to those having skill in the art and include, but are not 26 , SEQ ID NO : 27 , SEQ ID NO : 28 , SEQ ID NO : 29 , SEQ limited to , AviTagTM , Calmodulin - tag , polyglutamate tag , ID NO : 30 , SEQ ID NO : 31 , SEQ ID NO : 32 , SEQ ID NO : E - tag , FLAG - tag , HA - tag , His - tag , Myc -tag , NE - tag , S - tag , 40 33 , SEQ ID NO : 34 , and / or a functional variant thereof. As SBP - tag , Softag 1 , Softag 3 , Strep - tag, TC tag , Ty tag , V5 used herein , the term “ consists essentially of” refers to tag , VSV - tag , Xpress tag , Isopeptag , SpyTag , SnoopTag , situations in which the amino acid sequence is identical to BCCP, Glutatione - S -transferase - tag, Green fluorescent pro- the indicated amino acid sequence , except to the extent that tein - tag , Hallo tag , Maltose binding protein - tag, Nus - tag , one or more of the amino acids of the amino acid sequence Thioredoxin -tag , and Fc - tag . In some embodiments, the 45 contains a post - translational modification . peptide tag comprise the AviTagTM amino acid sequence In some embodiments, the synthetic molecule comprises (GLNDIFEAQKIEWHE , SEQ ID NO : 89 ) . the amino acid sequence of a silica - binding peptide and at In some embodiments , at least one of the at least one least one post- translational modification to at least one terminal fusion molecules is a small molecule that is fused amino acid of the silica -binding peptide. The term “ post to the at least one terminal end of the amino acid sequence 50 translational modification , " as used herein , refers to any comprising the amino acid sequence of the silica - binding covalent modification to the R - group of an amino acid of a peptide. In some embodiments, the small molecule is biotin . synthetic molecule , wherein the covalent modification gen In some embodiments , the small molecule facilitates click erates a modified amino acid . As used herein , the term reactions ; for example, in some embodiments, the small “ modified amino acid ” refers to any amino acid that is not molecule comprises at least one alkyne or aliphatic azide 55 chemically equivalent or identical to any one of the follow functional group . ing amino acids : alanine , arginine, asparagine, aspartic acid , In some embodiments , at least one of the at least one cysteine, glutamine , glutamic acid , glycine, histidine, iso terminal fusion molecules does not comprise a biomolecule . leucine, leucine , lysine, methionine, phenylalanine, proline , As used herein , the term “ functional variant ” includes serine, tryptophan, tyrosine , and valine . In some embodi amino acid sequences which are about 70 % identical, at least 60 ments, a post - translational modification is made to the about 80 % identical, at least about 90 % identical, at least R - group of an amino acid of a synthetic molecule prior to the about 95 % identical, at least about 98 % identical, at least amino acid's incorporation into the synthetic molecule ( i.e. , about 99 % identical, at least about 99.5 % identical, or at the amino acid molecule is modified prior to peptide - bond least about 99.9 % identical to a protein's non -variant amino formation ). In other embodiments, a post -translational acid sequence and which retain functionality. The term 65 modification is made to the R - group of an amino acid of a “ functional variant " also includes polypeptides which are synthetic molecule after translation or synthesis of a poly shorter or longer than a protein's non - variant amino acid peptide component of the synthetic molecule ( i.e. , the R US 10,882,885 B2 13 14 group of an amino acid of a synthetic molecule is modified sequence ). For example, in some embodiments, the syn after it is incorporated into the synthetic molecule ) . thetic molecule consists essentially of the amino acid Various post- translational modifications are known to sequence of R5 ( SEQ ID NO : 1 ) , wherein the amino acid those having skill in the art, including , but not limited to , sequence comprises at least one non - native post -transla acylation ( e.g. , O - acylation , N - acylation , S - acylation ), 5 tional modification of the amino acid sequence of R5 . R5 acetylation , adenylylation , alkylation ( e.g. , methylation ), represents the amino acid sequence of silaffin - 1A , which is amidation , arginylation , biotinylation , butyrylation , car- encoded by the sill gene of the diatom C. fusiformis . The bamylation , carbonylation, carboxylation ( e.g. , gamma- car- amino acid sequence of silaffin - 1A , is post -translationally boxylation ), farnesylation, formylation , geranylgera- modified , in at least some contexts, by C. fusiformis in nylation , glycation , glycosylation ( e.g. , polysialyation ), 10 nature . For example, previous studies have demonstrated glutathionylation , glypiation , hypusination, hydryoxylation , that the R5 amino acid sequence is modified in nature by iodination , isoprenylation , lipoylation, malonylation , myris- phosphorylation occurring at each serine residue ), methyl toylation , nirtosylation , oxidation, palmitoylation , pegy- ation ( on Lys4 and Lys12 ), and propylamination ( on Lys3 lation , phosphopantetheinylation , phosphorylation , polyglu- and Lys15 ). However, some post - translational modifications tamylation , polyglycylation , propionylation , 15 to the R5 amino acid sequence ( or combinations of post propylamination ( e.g. , the addition of spermine , spermidine, translational modifications to the R5 amino acid sequence ) thermospermine, putrescine, and other long chain do not occur in nature ( i.e. , are non - native post -translational polyamines ), pyroglutamination, ribosylation, succi- modifications ). For example , methylation can be introduced nylation , sulfation , sulfenylation , sulfinylation , sulfonation , on one or more Lys residues of the R5 amino acid sequence and sulfonylation . 20 that are not methylated by C. fusiformis. Moreover, the Lys In some embodiments , at least one of the at least one residues of the R5 amino acid sequence that are methylated non - native post - translational modifications is selected from by C. fusiformis can be methylated to a non -native extent the group consisting of acylation ( e.g. , O - acylation , N -acy- ( e.g. , through the introduction of mono- , di- or tri -methyl lation, S - acylation ), acetylation, adenylylation , alkylation ation ). ( e.g. , methylation ), amidation , arginylation , biotinylation , 25 In summary , in the context of a synthetic molecule butyrylation , carbamylation , carbonylation , carboxylation consisting essentially of a naturally - occurring amino acid ( e.g. , gamma - carboxylation ), farnesylation , formylation , sequence and at least one non - native post - translational geranylgeranylation , glycation , glycosylation ( e.g. , poly- modification to the naturally -occurring amino acid sialyation ) , glutathionylation , glypiation , hypusination , sequence , the term “ non - native post- translational modifica hydryoxylation , iodination , isoprenylation , lipoylation , 30 tion " encompasses any covalent modification to the R - group malonylation , myristoylation , nirtosylation , oxidation , of any amino acid of the naturally occurring amino acid palmitoylation , pegylation , phosphopantetheinylation , phos- sequence ( or any combination of covalent modifications to phorylation , polyglutamylation , polyglycylation , propio- the R - group of more than one amino acid of the naturally nylation , propylamination , pyroglutamination , ribosylation , occurring amino acid sequence) that does not occur in any succinylation, sulfation , sulfenylation , sulfinylation , 35 organism that produces the naturally occurring amino acid sulfonation , and sulfonylation . sequence in nature . In some embodiments , the synthetic molecule comprises In some aspects , the disclosure relates to compositions a single post- translational modification . In other embodi- comprising at least one synthetic molecule as described ments , the synthetic molecule comprises more than one above . As used herein , the term " composition ” refers to any post -translational modification . In other embodiments, the 40 mixture of compounds, wherein the compounds are not synthetic molecule comprises more than one post- transla- covalently connected . In addition to the at least one synthetic tional modification , wherein none of the post -translational molecules described herein , a composition may also com modifications are equivalent ( i.e. , no amino acid has the prise salts , solvents, buffers, stabilizing agents, and / or pro same post - translation modification ). In other embodiments, tease inhibitors . The compositions can take the form of at least two of the amino acids of the synthetic molecule 45 solutions, suspensions , emulsion , powders , solids and the have the same post - translational modification . In some like . In some embodiments, the composition comprises two embodiments, at least two of the amino acids of the synthetic or more types of synthetic molecules , wherein the two or molecule have a different post - translational modification . more types of synthetic molecules are chemically unique . In some embodiments, the synthetic molecule comprises Polymers and Compositions Comprising the Polymers the amino acid sequence of a silica -binding peptide and at 50 In some aspects , the disclosure relates to a polymer least one non - native post - translational modification to at comprising a fusion of at least two synthetic molecules , least one amino acid of the silica - binding peptide . The term wherein the synthetic molecules are as described above in “ non - native post -translational modification ,” as used herein , “ Synthetic Molecules and Compositions Comprising the refers to a post- translational modification to a synthetic Synthetic Molecules .” In the context of a polymer compris molecule ( or a combination of post - translational modifica- 55 ing the fusion of at least two synthetic molecules , the terms tions to a synthetic molecule ) , wherein the post - translational " fusion ” and “ fused ” refer to a covalent bond formed modification of the synthetic molecule ( or the combination between : 1 ) at least one amino acid side chain of at least two of post - translational modifications to the synthetic mol- of the at least two synthetic molecules of the polymer ; 2 ) at ecule ) does not occur in nature. For example , in some least one terminal end of each of at least two of the at least embodiments, the synthetic molecule comprises an amino 60 two synthetic molecules ; and / or 3 ) at least one terminal end acid sequence that is not found in nature . In these instances, of at least one of the at least two synthetic molecules and at the term " non -native post -translational modification ” least one amino acid side chain of at least one of the at least encompasses any post- translational modification to the syn- two synthetic molecules . thetic molecule . In some embodiments, a polymer comprises at least two , In other embodiments, the synthetic molecule consists 65 three, four, five , six , seven , or eight synthetic molecules that essentially of the amino acid sequence of a peptide that are fused through an interaction between at least one amino occurs in nature ( i.e. , a naturally occurring amino acid acid side chain of each of the at least two , three, four, five , US 10,882,885 B2 15 16 six , seven , or eight synthetic molecules of the polymer. In embodiments, the composition comprises two or more types some embodiments, a polymer comprises at least two syn- of polymers , wherein the two or more types of polymers are thetic molecules that are fused through an interaction chemically unique. between at least one amino acid side chain of each of the at Methods of Generating Synthetic Molecules and Polymers least two synthetic molecules . 5 In some aspects , the disclosure relates to the methods of In some embodiments, a polymer comprises at least two, generating synthetic molecules as described above in “ Syn three , four, five, six , seven , or eight synthetic molecules that thetic Molecules and Compositions Comprising the Syn are fused through an interaction between at least one termi- thetic Molecules .” In some embodiments , the method com nal end of each of the at least two , three, four, five , six , prises sequentially contacting an amino acid with another seven , or eight synthetic molecules . In some embodiments , 10 amino acid under conditions that facilitate the generation of a polymer comprises at least two synthetic molecules that peptide bonds between the amino acids ( i.e. , the generation are fused through an interaction between at least one termi- of a peptide ). In some embodiments, at least one of the nal end of each of the at least two synthetic molecules . amino acids is a modified amino acid . Methods of generating In some embodiments, a polymer comprises at least two , 15 peptides in vitro and in vivo are known to those having skill three , four, five , six , seven , or eight synthetic molecules that in the art. are fused through at least one terminal end of at least one of In some embodiments, the generated peptide is a silica the at least two , three , four, five, six , seven , or eight synthetic binding peptide. molecule and at least one amino acid side chain of at least In some embodiments , the method further comprises one of the at least two , three, four, five, six , seven , or eight 20 contacting the silica - binding peptide with a modifying synthetic molecules . In some embodiments, a polymer com- enzyme, wherein the modifying enzyme introduces post prises at least two synthetic molecules that are fused through translational modifications to the R - group of at least one at least one terminal end of at least one of the at least two amino acid of the silica -binding peptide. synthetic molecule and at least one amino acid side chain of In some embodiments the modifying enzyme is capable of at least one of the at least two synthetic molecules . 25 phosphorylating the R - group of at least one amino acid of In some embodiments , a polymer is a linear polymer. In the silica -binding peptide. Examples of known and putative some embodiments, a polymer is an alternating polymer modifying enzymes that are capable of phosphorylating an ( e.g. , A - B - A - B - A - B ) . In some embodiments, a polymer is a amino acid R - group of a peptide have been identified by periodic polymer ( e.g. , ( A - B - A - A - B ) ). In some embodi- those having skill in the art and include , but are not limited ments , the polymer is a statistical polymer. In some embodi- 30 to , BRSK2 , THAPSDRAFT_34059 , THAPS_35643 , ments, the polymer is a block polymer ( e.g. , a diblock or THAPSDRAFT_33728 , Ca2 + / calmodulin dependent pro triblock polymer ). In some embodiments, a polymer is a tein kinase II , DAP Kinase , GSK3a , GSK33 , PKA ( protein branched polymer. In some embodiments , the polymer is a kinase A ) , and LKB1 ( liver kinase B1 ) . star, brush , or comb polymer . In some embodiments the modifying enzyme is capable of In some embodiments , a polymer comprises at least two 35 methylating the R - group of at least one amino acid of the synthetic molecules that are fused through a single covalent silica -binding peptide . Examples of known and putative bond . In other embodiments, a polymer comprises compris- modifying enzymes that are capable of methylating an ing at least two synthetic molecules that are fused through at amino acid R - group of a peptide have been identified by least two covalent bonds . 40 those having skill in the art and include , but are not limited In some embodiments, a polymer comprises a fusion of at to , SET7 / 9 gi_71042599 , gi_512853798 , gi_16754879 , least two synthetic molecules , and each of the at least two THAPSDRAFT_20746 , THAPSDRAFT_32876 , THAPS synthetic molecules are identical. In other embodiments, at DRAFT_21274 , THAPSDRAFT_11244 , THAPS least two of the at least two synthetic molecules are chemi- DRAFT_24355, THAPSDRAFT_30620 , THAPS cally unique ( i.e. , are not made up of the same atoms ) . 45 DRAFT_263816 , THAPS_41291, THAPSDRAFT_23288, In some embodiments, a polymer comprises a fusion of at cffcpA - 2, SIT4A , SIT2 , DSK1 , MAP2, RPC25 , THAPS least two synthetic molecules , wherein at least two of the DRAFT_35182, THAPSDRAFT_268872 , THAPS synthetic molecules comprise the amino acid sequence of a DRAFT_22056 , THAPSDRAFT_3607, THAPS silica -binding peptide . In some embodiments, the polymer DRAFT_bd1835 , THAPSDRAFT_11154 , THAPSDRAFT_ comprises R5 -melanin . 50 11069 , THAPSDRAFT_268872, THAPSDRAFT_23212 , In some embodiments, a polymer comprises a fusion of at THAPSDRAFT_5135 , THAPSDRAFT_23725 , MET, least two synthetic molecules , wherein at least two of the rbcMT, PHATRDRAFT_55013 , PHATRDRAFT_51541 , synthetic molecules comprise the amino acid sequence of a PHATRDRAFT_46484 , PHATRDRAFT_47888 , PHAT silica - binding peptide and wherein at least one of the silica DRAFT_45376 , PHATRDRAFT_6698 , PHATRDRAFT_ binding peptides comprises the amino acid sequence of R5 55 42601 , LCYB . THAPSDRAFT_21409, THAPS and the amino acid sequence of an M1 or M2 region of a DRAFT_8998 , THAOC_37500 , and THAOC_24272 . suckerin protein , e.g. , to make di - block or tri- block copo- In some embodiments the modifying enzyme is capable of lymers . propylaminating the R - group of at least one amino acid of In some aspects , the disclosure relates to a composition the silica -binding peptide. Examples of known and putative comprising at least one polymer as described above . As used 60 modifying enzymes that are capable of propylaminating an herein , the term " composition ” refers to any mixture of amino acid R - group of a peptide have been identified by compounds, wherein the compounds are not covalently those having skill in the art and include , but are not limited connected . In addition to the at least one synthetic molecules to , ACL5 , THAPSDRAFT_17140, THAPSDRAFT_23207, described herein , a composition may also comprise salts , THAPSDRAFT_24273 , THAPSDRAFT_24769, THAPS solvents , buffers, stabilizing agents, and / or protease inhibi- 65 DRAFT_261161, THAPSDRAFT_262580 , THAPS tors . The compositions can take the form of solutions , DRAFT_264237 , THAPSDRAFT_264730, THAPS suspensions, emulsion , powders , solids and the like . In some DRAFT_267946 , TPS_41289 , TPS_108361 , SPDS , SPMS , US 10,882,885 B2 17 18 tSPMS , PMT, SpeD , THAPSDRAFT_21371 , THAPS- TPST1 ( Protein - tyrosine sulfotransferase 1 ) and TPST2 DRAFT_269901, and THAPSDRAFT_30691. ( Protein - tyrosine sulfotransferase 2 ) . In some embodiments the modifying enzyme is capable of In some embodiments, the method further comprises hypusinating the R - group of at least one amino acid of the contacting the silica -binding peptide with a terminal fusion silica - binding peptide . Examples of known and putative 5 molecule under such conditions that facilitate the generation modifying enzymes that are capable of hypusinating an of at least one covalent bond between the N - terminal amino amino acid R - group of a peptide have been identified by and / or C - terminal carboxyl group of the silica -binding pep those having skill in the art and include , but are not limited tide and the terminal fusion protein . to , DHPS and DOHH . In some embodiments , at least one of the at least one In some embodiments the modifying enzyme is capable of 10 terminal fusion molecules comprises a biomolecule . In some hydroxylating the R - group of at least one amino acid of the embodiments , at least one of the at least one terminal fusion silica - binding peptide . Examples of known and putative molecules is a polypeptide that is fused to at least one modifying enzymes that are capable of hydroxylating an terminal end of the amino acid sequence comprising the amino acid R - group of a peptide have been identified by amino acid sequence of the silica - binding peptide . In some those having skill in the art and include , but are not limited 15 embodiments , the polypeptide that is fused to the at least to , JMJD6 , JMJD6 , THAOC_04424 , THAOC_27572, terminal end of the silica - binding peptide as the polypeptide PHATRDRAFT_3251, PHATRDRAFT_49314 , THAPS- is synthesized . For example , in some embodiments, the DRAFT_8036 , THAPSDRAFT_7775, Lysyl Hydroxylase 3 silica - binding peptide is synthesized and then the terminal ( LH3 ) , Lysyl Hydroxylase 2 ( LH2 ) , Lysyl Hydroxylase 1 fusion polypeptide is synthesized on the C - terminal end of ( LH1 ) , and Procollagen - lysine, 2 - oxoglutarate 5 - dioxy- 20 the amino acid sequence comprising the amino acid genase 1 (PLODI ) . sequence of the silica - binding protein . In other embodi In some embodiments the modifying enzyme is capable of ments , the terminal fusion polypeptide is synthesized and adenylylating the R -group of at least one amino acid of the then the silica - binding peptide is synthesized on the C - ter silica - binding peptide. Examples of known and putative minal end of the terminal fusion polypeptide . modifying enzymes that are capable of adenylylating an 25 In some embodiments, the polypeptide terminal fusion amino acid R - group of a peptide have been identified by molecule comprises the amino acid sequence of Mms6 those having skill in the art and include , but are not limited ( including Mms6 orthologs and functional variants, thereof) . to , vops . In some embodiments , the polypeptide terminal fusion mol In some embodiments the modifying enzyme is capable of ecule comprises the amino acid sequence of MamC ( includ biotinylating the R - group of at least one amino acid of the 30 ing MamC orthologs and functional variants , thereof ). In silica - binding peptide . Examples of known and putative some embodiments , the polypeptide terminal fusion mol modifying enzymes that are capable of biotinylating an ecule comprises the sequence of a carbon -nanotube - binding amino acid R - group of a peptide have been identified by peptide. In some embodiments , the carbon -nanotube -bind those having skill in the art and include , but are not limited ing peptide is CNT1 ( including CNT1 orthologs and func to , BirA . 35 tional variants, thereof) or CNT2 ( including CNT1 orthologs In some embodiments the modifying enzyme is capable of and functional variants thereof ). glycosylating the R - group of at least one amino acid of the In some embodiments, the polypeptide terminal fusion silica - binding peptide . Examples of known and putative molecule is Cementum Protein 1 ( CEMP1 ) ( Chen X. , et al . , modifying enzymes that are capable of glycosylating an Mater. Sci . Eng . C. Mater . Biol . Appl. 2016 February ; 59 : amino acid R - group of a peptide have been identified by 40 384-89 ) . In some embodiments, the polypeptide terminal those having skill in the art and include , but are not limited molecule is a silicatein protein ( see Cha J. N. , et al . , Proc . to , GALNTI, OGT, POMT1 , THAPSDRAFT_3500 , Natl . Acad . Sci . U.S.A. , 1999 Jan. 19 ; 96 ( 2 ) : 361-65 ; POFUT1 (GDP - frucose protein O - fucosyltransferase 1 ) , Brutchey R. L. , et al . , J. Am . Chem . Soc . 2006 Aug. 9 ; POFUT2 ( GDP - frucose protein O - fucosyltransferase 2 ) , and 128 ( 31 ) : 10288-94 ; Sumerel J. L. , et al . , Chem . Mater . 2003 ; POMT1 ( Protein O -mannosyl -transferase 1 ) . 45 15 ( 25 ) : 4804-9 , the entirety of which is incorporated herein ). In some embodiments the modifying enzyme is capable of In some embodiments , the polypeptide terminal fusion lapidating the R - group of at least one amino acid of the molecule is a spider silk protein . In some embodiments , the silica -binding peptide. Examples of known and putative spider silk protein is Major Amullate Spindroin 1 ( MaSpl ) modifying enzymes that are capable of lapidating an amino (SGRGGLGGQGAGMAAAAAMGGAGQGGYGGLGS acid R - group of a peptide have been identified by those 50 QGT, SEQ ID NO : 80 ) ( see Prince J. T. , et al . , Biochemistry . having skill in the art and include , but are not limited to , 1995 Aug. 29 ; 34 : 10879-85 , the entirety of which is LpA , LipB , LIPT1, NMT2 , and NMT1 . incorporated herein ). In some embodiments , the spider silk In some embodiments the modifying enzyme is capable of protein is fibroin heavy chain (GAGAGSGAAGSGA acetylating the R - group of at least one amino acid of the GAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAG silica - binding peptide . Examples of known and putative 55 SGAGAGS GAGAGY, SEQ ID NO : 81 ) or fibroin light modifying enzymes that are capable of acetylating an amino chain ( see Zafar M. S. , et al . , Biomacromolecules. 2015 ; acid R -group of a peptide have been identified by those 16 ( 2 ) : 606-14 , the entirety of which is incorporated herein ). having skill in the art and include , but are not limited to , In some embodiments, the polypeptide terminal fusion LAT2 , THAPSDRAFT_2540 , ELP3 , HATI , GCN5 , molecule is PC Synthase from S. pompe ( SpPCS ) ( see Kang KAT2A , p300 ( EIA - associated protein 300 kDa ) , MOZ , 60 S. H. , et al . , Angew . Chem . Int. Ed . Engl. 2008 ; 47 ( 28 ) : YBF2 / Sas3 , Sas2 , Tip60 , Morf, and Crebbp . 5186-89 , the entirety of which is incorporated herein ). In some embodiments the modifying enzyme is capable of In some embodiments, the polypeptide terminal fusion sulfonating the R - group of at least one amino acid of the molecule is a suckerin protein . In some embodiments, the silica - binding peptide . Examples of known and putative suckerin protein is Suckerin - 39 ( see Ding D. , et al . , Biomac modifying enzymes that are capable of sulfonating an amino 65 romolecules. 2014 ; 15 : 3278-89 , the entirety of which is acid R - group of a peptide have been identified by those incorporated herein ). In some embodiments the suckerin having skill in the art and include , but are not limited to , protein is Suckerin - 12 ( see Guerette P. A. , et al . , ACS Nano . US 10,882,885 B2 19 20 2014 Jul. 22 ; 8 ( 7 ) : 7170-79 , the entirety of which is incor- ments , the method comprises, contacting at least two syn porated herein ). In some embodiments, the suckerin protein thetic molecules under conditions that facilitate the genera is the M1 region or M2 region of a suckerin protein . For tion of at least one covalent bond between the at least two example, in some embodiments, the suckerin protein is an synthetic molecules . In some embodiments, at least one of M1 region amino acid sequence : 5 the at least one covalent bonds is formed between at least one amino acid side chain of each of the synthetic molecules of the polymer. In some embodiments, at least one of the at AATSVSRTTH , ( SEQ ID NO : 82 ) least one covalent bonds is formed between at least one ATTAVSHTTHHA , ( SEQ ID NO : 83 ) terminal end of each synthetic molecule . In some embodi 10 ments , at least one of the at least one covalent bonds is AATVSHTTHHA , ( SEQ ID NO : 84 ) formed between at least one terminal end of at least one AAAVSHTTHHA , ( SEQ ID NO : 85 ) synthetic molecule and at least one amino acid side chain of another synthetic molecule . AAVSHTTHHA , ( SEQ ID NO : 86 ) 15 Silica Structures AAATVSHTTHHA , ( SEQ ID NO : 87 ) In some aspects , the disclosure relates to a silica structures or comprising precipitated silica and at least one synthetic molecule , wherein the at least one synthetic molecule is as AVSHT THHA . ( SEQ ID NO : 88 ) described above in “ Synthetic Molecules and Compositions In some embodiments , the polypeptide terminal fusion 20 Comprising the Synthetic Molecules .” In some embodi molecule is DBAD1 ( SEQ ID NO : 35 ) , A1 - S1 ( SEQ ID NO : ments, the silica structure further comprises at least one 36 ) , A1 - S2 ( SEQ ID NO : 37 ) , BT1 ( SEQ ID NO : 38 ) , BT2 metal nanoparticle. In some embodiments, at least one of the ( SEQ ID NO : 39 ) , A7 ( SEQ ID NO : 40 ) , Z8 ( SEQ ID NO : at least one metal nanoparticles is selected from the group 41 ) , J182 ( SEQ ID NO : 42 ) , J140 ( SEQ ID NO : 43 ) , 5R39 consisting of an iron oxide nanoparticle, a zinc oxide nan ( SEQ ID NO : 44 ) , 4R12 ( SEQ ID NO : 45 ) , AG - 4 ( SEQ ID 25 oparticle, tantalum oxide nanoparticles, a hafnium oxide NO : 46 ) , AG - P35 ( SEQ ID NO : 47 ) , Col - P10 ( SEQ ID NO : nanoparticle , a titanium oxide nanoparticle, a cadmium 48 ) , CN225 ( SEQ ID NO : 49 ) , CN44 ( SEQ ID NO : 50 ) , sulfide nanoparticle, a germanium oxide nanoparticle , an CN179 ( SEQ ID NO : 51 ) , CN146 ( SEQ ID NO : 52 ) , HG12 indium phosphide, and a cadmium selenide nanoparticle. In ( SEQ ID NO : 53 ) , HG6 ( SEQ ID NO : 54 ) , Ge8 ( SEQ ID some embodiments, the silica structure further comprises at NO : 55 ) , Ge34 ( SEQ ID NO : 56 ) , Gold - binding peptide a 30 least one magnetosome. In some embodiments , the silica ( SEQ ID NO : 57 ) , Gold - binding peptide b ( SEQ ID NO : 58 ) , structure further comprises a biomolecule . In some embodi MS - SI ( SEQ ID NO : 59 ) , RE - 1 ( SEQ ID NO : 60 ) , Ag - 22 ments, the biomolecule is DNA . ( SEQ ID NO : 61 ) , Ag - 28 ( SEQ ID NO : 62 ) , Pt - 41 ( SEQ ID In some embod ts , at least one of the at least one NO : 63 ) , Pt - 14 ( SEQ ID NO : 64 ) , Pt - 1.2 ( SEQ ID NO : 65 ) , synthetic molecules is R5 - Mms6 as described in Example HPGAH ( SEQ ID NO : 66 ) , AG3 ( SEQ ID NO : 67 ) , AG4 35 10. In some embodiments , at least one of the at least one ( SEQ ID NO : 68 ) , dTi - 1 ( RKK ) ( SEQ ID NO : 69 ) , Ti - 1 synthetic molecules is R5 -MamC as described in Example ( SEQ ID NO : 70 ) , PG - 7 ( SEQ ID NO : 71 ) , ZnO - la ( SEQ ID 11. In some embodiments, at least one of the at least one NO : 72 ) , ZnO - 1b ( SEQ ID NO : 73 ) , ZnO - 2 ( SEQ ID NO : synthetic molecules is R5 - CNT . In some embodiments, the 74 ) , ZnO - 3 ( SEQ ID NO : 75 ) , ZnO - 4 ( SEQ ID NO : 76 ) , HA R5 - CNT is R5 - CNT1 as described in Example 12. In some 6-1 ( SEQ ID NO : 77 ) , HABP1 ( SEQ ID NO : 78 ) , or HABP2 40 embodiments , the R5 - CNT is R5 - CNT2 as described in ( SEQ ID NO : 79 ) ( TABLE 3 ) . Example 12 . In some embodiments, the polypeptide terminal fusion In some aspects , the disclosure relates to a silica structure molecule is a peptide tag . Examples of peptide tags are comprising precipitated silica and at least one polymer, known to those having skill in the art and include, but are not wherein the at least one polymer is as described above in limited to , AviTagTM , Calmodulin -tag , polyglutamate tag , 45 “ Polymers and Compositions Comprising the Polymers .” In E - tag , FLAG - tag , HA - tag , His - tag , Myc - tag, NE - tag , S - tag , some embodiments , at least one of the at least one polymers SBP - tag , Softag 1 , Softag 3 , Strep - tag , TC tag , Ty tag , V5 comprises R5 - melanin as described in Example 9 . tag, VSV -tag , Xpress tag , Isopeptag, SpyTag, SnoopTag , In some aspects , the disclosure relates to a silica coated BCCP , Glutatione - S -transferase - tag, Green fluorescent pro- DNA - nanostructure comprising precipitated silica , R5 pep tein - tag , Hallo tag , Maltose binding protein - tag, Nus - tag , 50 tide , and DNA ; for example, as described in Example 13 . Thioredoxin - tag, and Fc - tag . In some embodiments , the Methods of Synthesizing Silica Structures and Resulting peptide tag comprise the AviTagTM amino acid sequence Silica Structures (GLNDIFEAQKIEWHE , SEQ ID NO : 89 ) In some aspects , the disclosure relates to methods of In some embodiments , at least one of the at least one synthesizing silica structures . In some embodiments, the terminal fusion molecules is a small molecule that is fused 55 method comprises: contacting at least one synthetic mol to the at least one terminal end of the amino acid sequence ecule ( as described above in “ Synthetic Molecules and comprising the amino acid sequence of the silica -binding Compositions Comprising the Synthetic Molecules " ) with a peptide. In some embodiments, the small molecule is biotin . solution comprising dissolved silica . In some embodiments, In some embodiments, the small molecule facilitates click the at least one synthetic molecule and the solution com reactions , for example , in some embodiments, the small 60 prising dissolved silica are contacted at ambient temperature molecule comprises at least one alkyne or aliphatic azide ( as used herein , the term “ ambient temperature ” refers to functional group . temperatures range of about 18 ° C. to about 30 ° C. In some In some embodiments , at least one of the at least one embodiments, the at least one synthetic molecule and the terminal fusion molecules is not a biomolecule . solution comprising dissolved silica are contacted at chilled In some aspects , the disclosure relates to methods of 65 temperatures. As used herein , the term " chilled tempera generating polymers as described above in “ Polymers and tures ” refers to temperatures range of about 0 ° C. to about Compositions Comprising the Polymers .” In some embodi- 4 ° C. US 10,882,885 B2 21 22 In some embodiments, the dissolved silica is aqueous polymerized R5 peptides indicates that PTMs to R5 can be silicic acid . In some embodiments, the dissolved silica is used to control the morphology of precipitated silica , which colloidal silica . will allow for the tunable control of silica structures required In some embodiments , the method further comprises for various applications. contacting the at least one synthetic molecule and the 5 solution comprising dissolved silica with at least one metal Example 2 : Generation of Phosphorylated R5 nanoparticle . In some embodiments, at least one of the at Peptide least one metal nanoparticles is selected from the group consisting of an iron oxide nanoparticle, a zinc oxide nan- Protein Kinase A (PKA ) (NEB P6000S ) was incubated oparticle, tantalum oxide nanoparticles, a hafnium oxide 10 with kinase buffer (NEB B6022S ) , 2 UM R5 , and 1 mM ATP nanoparticle, a titanium oxide nanoparticle, a cadmium at 30 ° C. for 30 minutes to 16 hours , followed by heat sulfide nanoparticle, a germanium oxide nanoparticle, an inactivation at 65 ° C. for 20 minutes. A time course showing indium phosphide , and a cadmium selenide nanoparticle . the incorporation of one phosphate into R5 was determined In some embodiments, the method further comprises by LC - MS ( FIG . 1A ) . Varying the ratio of PKA to R5 ( up to contacting the synthetic molecule and the solution compris- 15 1000U : 2 UM was tested ) could increase the proportion of ing dissolved silica with magnetosomes. phosphorylated R5 to 66 % of the total R5 population ( FIG . In some embodiments , the method further comprises 1B ) . LC - MS / MS was performed using an Agilent QQQ and contacting the synthetic molecule and the solution compris- indicated primary phosphorylation at Serll , with very low ing dissolved silica with a biomolecule . In some embodi- levels of phosphorylation at Ser4, Ser7 , and Ser16 ( FIG . ments , the biomolecule is DNA . 20 1C) . In some aspects , the disclosure relates to a melanin embedded silica structure generated by a method as Example 3 : Generation of Methylated R5 Peptide described above ; see for example, Example 9 . In some aspects , the disclosure relates to an R5 -Mms6 SET7 / 9 was recombinantly expressed in E. coli (Add iron oxide nanoparticle silica structure as generated by a 25 gene, plasmid # 24082) and purified by affinity chromatog method as described above ; see for example, Example 10 . raphy. Purified lysine methyltransferase SETD7 ( SET7 / 9 ) In some aspects , the disclosure relates to an R5 -MamC was incubated with methylation buffer ( 50 mM Tris - HCl, pH magnetosome silica structure generated by a method as 9.0 , 5 mM MgCl2 , 4 mM DTT ) , 2 uM R5 , and 16 ?M SAM described above ; see for example, Example 11 . at 37 ° C. for 30 minutes to 18 hours , followed by heat In some aspects , the disclosure relates to a carbon- 30 inactivation at 65 ° C. for 20 minutes. A time course showing nanotube - binding magnetosome silica structure generated the incorporation of zero to 16 methyl groups into R5 ( FIG . by a method as described above ; see for example, Example 2A ) and profile traces for zero through four methyl groups 12 . ( FIG . 2B ) were determined by LC - MS . In some aspects , the disclosure relates to an opal silica The Y305F mutation was introduced into SET7 / 9 ( Add structure generated by the method a method as described 35 gene , plasmid # 24082 ) by site - directed mutagenesis. above ; see for example , Example 14 . SET7 / 9 Y305F was recombinantly expressed in E. coli and In some aspects , the disclosure relates to methods of purified by affinity chromatography . Purified SET7 / 9 Y305F synthesizing silica - coated DNA - nanostructures; see for was incubated with methylation buffer ( 50 mM Tris - HCl, pH example , Example 13. In some embodiments , the method 9.0 , 5 mM MgCl2 , 4 mM DTT ) , 2 UM R5 , and 16 UM SAM comprises contacting DNA with R5 peptide and subse- 40 at 37 ° C. for 30 minutes to 18 hours, followed by heat quently contacting the DNA and R5 peptide with a solution inactivation at 65 ° C. for 20 minutes . A time course showing comprising dissolved silica . In some embodiments , the the incorporation of zero to 16 methyl groups into R5 ( FIG . DNA and the R5 are contacted with the solution comprising 2A ) and profile traces for zero through four methyl groups dissolved silica at ambient temperature . In some embodi- ( FIG . 2C ) were determined by LC - MS . ments, the dissolved silica is aqueous silicic acid . In some 45 THAOC_24272 is a previously uncharacterized hypo thetical protein from the diatom Thalassiosira oceanica embodiments, the dissolved silica is colloidal silica . ( THAOC_24272-uniprot.org/uniprot/KORQ67 ). The gene EXAMPLES was identified as containing a Rubisco large subunit meth yltransferase ( LSMT ) binding site via BLAST . The gene Example 1 : Post - Translational Modification of the 50 was optimized for expression in E. coli , synthesized , trans R5 Peptide formed into E. coli , expressed , and purified by affinity chromatography. Purified THAOC_24272 was incubated The R5 peptide ( N - SSKKSGSYSGSKGSKRRIL - C ) with methylation buffer ( 50 mM Tris -HCl , pH 9.0 , 5 mM ( SEQ ID NO : 1 ) from the diatom Cylindrotheca fusiformis MgCl2 , 4 mM DTT ) , 2 uM R5 , and 16 UM SAM at 37 ° C. was previously shown to precipitate 500 nm diameter silica 55 for 30 minutes to 18 hours, followed by heat inactivation at spheres in vitro (Kröger N. , et al . , Science, 1999 Nov. 5 ; 65 ° C. for 20 minutes. A time course showing the incorpo 286 ( 5442 ) : 1129-32 ) . For the experiments described below , ration of zero to 16 methyl groups into R5 ( FIG . 3A ) and R5 was recombinantly expressed in Escherichia coli ( E. profile traces for zero through five methyl groups ( FIG . 3B ) coli ) and R5 peptide was purified by affinity and size were determined by LC - MS . LC - MS / MS were performed exclusion chromatography. The purified peptide was lyo- 60 using Agilent QQQ and Thermo Orbitrap instruments and philized and then resuspended to a concentration of 5 mM in indicated the methylation occurs on all four lysine with no water . discernable preference or pattern ( FIG . 3C ) . As demonstrated herein , the R5 peptide can be modified THAOC_37500 is a previously uncharacterized hypo with non - native post - translational modifications ( PTMs ) in thetical protein from the diatom Thalassiosira oceanica vitro using modifying enzymes isolated from various organ- 65 ( THAOC_37500 uniprot.org/uniprot/KOQYB9 ) . The isms ( both from diatoms and other organisms) or recombi- gene was identified as containing a Rubisco large subunit nantly expressed in E. coli . The data described below using methyltransferase ( LSMT ) binding site via BLAST . The US 10,882,885 B2 23 24 gene was optimized for expression in E. coli , synthesized , purified by affinity chromatography. Purified N - myrisotyl transformed into E. coli , expressed , and purified by affinity transferase 1 ( NMT1 ) was incubated with myristoyltrans chromatography. Purified THAOC_37500 was incubated ferase buffer ( 30 mM Tris - HCl, pH 7.5 , 0.5 mM EDTA , 0.5 with methylation buffer ( 50 mM Tris -HCl , pH 9.0 , 5 mM mM EGTA , 1.0 % Triton X - 100 , 4.5 mM 2 -mercaptoetha MgCl2 , 4 mM DTT ) , 2 ?M R5 , and 16 UM SAM at 37 ° C. 5 nol ) , 200 um myristoyl -CoA , and 200 uM R5 at 25 ° C. for for 30 minutes to 18 hours , followed by heat inactivation at one to six hours, followed by heat inactivation at 95 ° C. for 65 ° C. for 20 minutes . A time course showing the incorpo- 5 minutes. A time course showing the incorporation of one ration of zero to 16 methyl groups into R5 ( FIG . 4A ) and myristoyl group was determined by LC - MS ( FIG . 7 ) . profile traces for zero through four methyl groups ( FIG . 4B ) 10 were determined by LC - MS . Example 7 : Generation of Hypusine -Modified R5 Example 4 : Generation of Peptide Thermospermine -Modified R5 Peptide The human DHPS gene was optimized for expression in Thermospermine synthase ACL5 from Arabidopsis thali- 15 E. coli , synthesized , transformed into E. coli , expressed , and ana catalyzes the formation of free thermospermine from purified by affinity chromatography . Purified deoxyhypusine S - adenosyl- 3- (methylthiopropylamine (decarboxylated synthase ( DHPS ) was incubated with hypusination buffer SAM ) and spermidine . Subsequently, ACL5 can covalently ( 200 mM glycine, pH 9.4 , 1 mM DTT, 0.5 mM NAD + , 375 attach thermospermine to R5 . The, synthesized ACL5 gene , transformed was opti 20 UM BSA ), 20 mM spermidine, 200 uM R5 at 37 ° C. for one mizedinto E. forcoli expression , expressed in , and E. purified coli by affinity chromatog to 6 hours, followed by heat inactivation at 95 ° C. for 5 raphy. Purified ACL5 was incubated with 100 mM Tris - HCl, minutes. A time course showing the conversion of two lysine pH 7.5 , 32 uM SAM , 63 mM spermidine, and 20 uM R5 at to hypusine residues was determined by LC - MS ( FIG . 8 ) . 32 ° C. for one to 16 hours , followed by heat inactivation at No intermediates or presence of one hypsine residue were 95 ° C. for 5 minutes. A time course showing the production 25 detected . of free thermospermine and the incorporation of one ther- The human DOHH gene was optimized for expression in mospermine molecule into R5 ( FIG . 5 ) was determined by E. coli , synthesized , transformed into E. coli , expressed , and LC - MS . purified by affinity chromatography. Purified deoxyhypusine hydroxulase ( DOHH ) was incubated with hypusination buf Example 5 : Generation of Melanin -Modified R5 30 fer ( 200 mM glycine , pH 9.4 , 1 mM DTT, 0.5 mM NAD + , Peptide 375 ?M BSA ) , 20 mM spermidine, 200 uM R5 at 37 ° C. for one to 6 hours , followed by heat inactivation at 95 ° C. for 5 Tyrosinase is an enzyme responsible for melanin synthe minutes. A time course showing the conversion of two lysine fromsis via mushrooms the oxidation (Sigma of free T3824 tyrosine ) was (reconstituted FIG . 6A ) . Tyrosinase in water 35 to hypusine residues was determined by LC - MS (FIG . 8 ) . at varying concentrations ( 0-1,000 U /mL ) and incubated No intermediates or presence of one hypsine residue were with R5 at room temperature for 16 hours . The R5 peptide detected . was recombinantly expressed in Escherichia coli ( E. coli ) and purifying the peptide by affinity and size exclusion Example 8 : Other Modifications of R5 Peptide chromatography. The purified peptide was lyophilized and 40 then resuspended in water at known concentrations ( 50 uM - 3 mm ). Additional enzymes were tested for enzymatic activity A time course was generated showing the production of against R5 but showed no resulting modifications ( TABLE oxidized R5 ( FIGS . 6B - 6C ) and the subsequent spontaneous 1 ) . Additional potential modifying enzymes are listed in formation of R5 polymers, or a version of melanin made 45 TABLE 2 . from R5 ( FIG . 6D ) . Formation of melanin was verified by spectroscopy ( FIGS . 6B -6C )—an observed increase in TABLE 1 absorbance at 350 nm ( characteristic wavelength of mela List of modifying enzymes that were tested against nin ) and by SDS - PAGE analysis and Coomassie staining R5 but resulted in no modifications . ( FIG . 6D ) , These results demonstrate the polymerization of 50 the R5 peptides . Additional characterization by QTOF con Modification firmed the mixed presence of R5 monomers and polymers , Enzyme Name Organism Type but could not determine the relative ratios or the size of the BRSK2 Homo sapiens Phosphorylation polymers . JMJD6 Auxenochlorella protothecoides Hydroxylation Additionally, a three plasmid system was constructed to 55 JMJD6 Nannochloropsos gaditana Hydroxylation THAOC 04424 Thalassi osira oceanica Hydroxylation co - express R5 and two Tyrosinase enzymes (melA and THAOC 27572 Thalassiosira oceanica Hydroxylation melci ) from Streptomyces antibioticus in E. coli ( della vops Vibrio parahaemolyticus Adenylylation Cioppa G. , et al . , Biotechnology , 1990 July ; 8 ( 7 ) : 634-38 ) . serotype 03 : K6 This system facilitates the induction of R5 polymerization in BirA Escherichia coli Biotinylation vivo and the subsequent purification of R5 polymers from E. 60 GALNT1 Homo sapiens Glycosylation coli . OGT Homo sapiens Glycosylation POMT1 Homo sapiens Glycosylation LplA Escherichia coli Lipidation Example 6 : Generation of Myristoylated R5 LipB Escherichia coli Lipidation Peptide LIPT1 Escherichia coli Lipidation 65 NMT2 Homo sapiens Lipidation The human NMT1 gene was optimized for expression in E. coli , synthesized , transformed into E. coli , expressed , and US 10,882,885 B2 25 26 TABLE 2 TABLE 2 - continued List of potential R5 modifying enzymes . List of potential R5 modifying enzymes . Enzyme Name Organism Enzyme Name Organism Modification Type Modification Type 5 gi_71042599 Eukaryotic Methyltransferase PHATRDRAFT_49314 P. tricornutum hypothetical protein gi_512853798 Eukaryotic Methyltransferase ( lysyl hydroxylase ) gi_16754879 Eukaryotic Methyltransferase THAPSDRAFT_8036 T. pseudonana hypothetical protein THAPSDRAFT 20746 T. pseudonana hypothetical protein ( lysyl hydroxylase ) (methyltransferase ) THAPSDRAFT_7775 T. pseudonana hypothetical protein THAPSDRAFT 32876 T. pseudonana hypothetical protein 10 ( lysyl hydroxylase ) (methyltransferase ) THAOC_27572 ?. oceanica hypothetical protein THAPSDRAFT_21274 T. pseudonana hypothetical protein ( lysyl hydroxylase ) (methyltransferase ) THAOC 04424 ?. oceanica hypothetical protein THAPSDRAFT 11244 T. pseudonana hypothetical protein ( lysyl hydroxylase ) (methyltransferase ) THAPSDRAFT 34059 T. pseudonana Kinase THAPSDRAFT_24355 T. pseudonana hypothetical protein 15 THAPS_35643 T. pseudonana Kinase (methyltransferase ) LCYB P. tricornutum lycopene beta cyclase THAPSDRAFT_30620 T. pseudonana hypothetical protein (methyltranserase ? ) ( methyltransferase ) THAPSDRAFT 270357 T. pseudonana hypothetical protein THAPSDRAFT_263816 T. pseudonana hypothetical protein THAPSDRAFT 13556 T. pseudonana hypothetical protein (methyltransferase ) LAT2 T. pseudonana Acetyltransferase THAPS_41291 T. pseudonana CAM1 - calmodulin THAPSDRAFT_2538 T. pseudonana Phosphatase (methyltransferase ) 20 THAPSDRAFT_2540 T. pseudonana hypothetical protein THAPSDRAFT 23288 T. pseudonana hypothetical protein ( acetyltransferase ) (methyltransferase ) THAPSDRAFT_21409 T. pseudonana hypothetical protein cffcpA - 2 C. fusiformis chlorophyll related ( methyltransferase ) ( methyltransferase ) THAPSDRAFT_2711 T. pseudonana hypothetical protein SIT4A C. fusiformis silicon transporter THAPSDRAFT_3500 T. pseudonana hypothetical protein (methyltransferase ) 25 ( glycosyl transferase ) SIT2 C. fusiformis silicon transporter THAPSDRAFT_33728 T. pseudonana hypothetical protein (methyltransferase ) ( kinase ) DSK1 C. fusiformis spindle kinesin 1 THAPSDRAFT 22506 T. pseudonana hypothetical protein (methyltransferase ) THAPSDRAFT_8998 T. pseudonana hypothetical protein C. fusiformis nitrate reductase (methyltransferase ) (methyltransferase ) 30 THAPSDRAFT_17140 T. pseudonana hypothetical protein MAP2 7. pseudonana methionine ( propylamination ) aminopeptidase 2 THAPSDRAFT_21371 T. pseudonana Spermidine synthase (methyltransferase ) THAPSDRAFT_23207 T. pseudonana hypothetical protein RPC25 T. pseudonana RNA pol III (propylamination ) (methyltransferase ) THAPSDRAFT_24273 T. pseudonana hypothetical protein THAPSDRAFT_35182 T. pseudonana set domain 35 ( propylamination ) containing protein THAPSDRAFT_24769 T. pseudonana hypothetical protein (methyltransferase ) ( propylamination ) THAPSDRAFT 268872 T. pseudonana set -domain THAPSDRAFT 261161 T. pseudonana hypothetical protein containing protein (propylamination ) (methyltransferase ) THAPSDRAFT_262580 T. pseudonana hypothetical protein THAPSDRAFT_22056 T. pseudonana hypothetical protein (propylamination ) (methyltransferase ) 40 THAPSDRAFT_264237 T. pseudonana hypothetical protein THAPSDRAFT_3607 T. pseudonana hypothetical protein (propylamination ) (methyltransferase ) THAPSDRAFT_264730 T. pseudonana hypothetical protein THAPSDRAFT_bd1835 T. pseudonana hypothetical protein ( propylamination ) (methyltransferase ) THAPSDRAFT_267946 T. pseudonana hypothetical protein THAPSDRAFT 11154 T. pseudonana hypothetical protein ( propylamination ) (methyltransferase ) 45 THAPSDRAFT 269901 T. pseudonana Thermospermine synthase THAPSDRAFT 11069 T. pseudonana hypothetical protein THAPSDRAFT_30691 T. pseudonana Spermine synthase (methyltransferase ) ACL5 A. thaliana Thermospermine synthase THAPSDRAFT_268872 T. pseudonana hypothetical protein TPS 41289 T. pseudonana Thermospermine synthase ? (methyltransferase ) POFUT1 (GDP - frucose Homo sapiens Glycosylation THAPSDRAFT_23212 T. pseudonana hypothetical protein protein O (methyltransferase ) 50 fucosyltransferase 1 ) THAPSDRAFT_5135 T. pseudonana hypothetical protein POFUT2 ( GDP - frucose Homo sapiens Glycosylation (methyltransferase ) protein O THAPSDRAFT 23725 T. pseudonana hypothetical protein fucosyltransferase 2 ) (methyltransferase ) POMT1 (Protein Homo sapiens Glycosylation MET T. pseudonana Methyltransferase O -mannosyl rbcMT P. tricornutum Methyltransferase 55 transferase 1 ) PHATRDRAFT_55013 P. tricornutum Methyltransferase PLOD1 (Procollagen Homo sapiens Glycosylation PHATRDRAFT_51541 P. tricornutum Methyltransferase lysine , 2 PHATRDRAFT 46484 P. tricornutum hypothetical protein oxoglutarate (methyltransferase ) 5 -dioxygenase 1 ) PHATRDRAFT_47888 P. tricornutum hypothetical protein TPST1 (Protein Homo sapiens Sulfonation (methyltransferase ) tyrosine PHATDRAFT_45376 P. tricornutum hypothetical protein 60 sulfotransferase 1 ) (methyltransferase ) TPST2 ( Protein Homo sapiens Sulfonation PHATRDRAFT__6698 P. tricornutum hypothetical protein tyrosine ( methyltransferase ) sulfotransferase 2 ) PHATRDRAFT_42601 P. tricornutum hypothetical protein ELP3 Saccharomyces Acetylation (methyltransferase ) cerevisiae PHATRDRAFT_3251 P. tricornutum hypothetical protein 65 HAT1 Saccharomyces Acetylation ( lysyl hydroxylase ) cerevisiae US 10,882,885 B2 27 28 TABLE 2 - continued subsequently lyophilized . R5 - Mms6 then was used to pre cipitate iron oxide nanoparticles in vitro by the partial List of potential R5 modifying enzymes . oxidation method ( FIG . 10A ) (Amemiya Y., et al . , Bioma Enzyme Name Organism Modification Type terials, 2007 December ; 28 ( 35 ) : 5381-89 ) . 5 Silica coating of the R5 - Mms6 synthesized iron nanopar GCN5 Homo sapiens Acetylation KAT2A Homo sapiens Acetylation ticles was performed by first hydrolyzing TMOS in hydro p300 ( E1A Acetylation chloric acid to produce silicic acid . The nanoparticles were associated protein then incubated with 100 mM silicic acid in a phosphate 300 kDa ) MOZ , YBF2 / Sas3 , Acetylation 10 buffered solution ( FIG . 10B ) . In some samples, an additional Sas2 , Tip60 = 1 mM R5 peptide was added in the reaction ( FIG . 10B ) . By MYST family energy - dispersive X - ray spectroscopy ( EDS ) we determined Morf Acetylation Crebbp Acetylation that the nanoparticles were composed of iron oxide ( Fe3O4 ) . Lysyl Hydroxylase Hydroxylation The addition of TMOS and R5 resulted in approximately 5 % 3 ( LH3 ) silicon dioxide . Lysyl Hydroxylase Hydroxylation 15 2 ( LH2 ) Lysyl Hydroxylase Hydroxylation Example 11 : R5 - MamC for Combination In Vivo / In 1 (LH1 ) Vitro Silica - Coated Magnetosome ( Magnetic Ca2 + / calmodulin Phosphorylation Nanoparticle ) Synthesis dependent protein kinase II 20 DAP Kinase Phosphorylation A DNA fragment encoding for R5 peptide (5 '- TCCTC GSK3a Homo sapiens Phosphorylation CAAAAAATCTGGTTCATATTCCGGCTCTAAAGG CA GSK3B Homo sapiens Phosphorylation TPS_41289 Thalassiosira Propylamination GTAAACGTCGTATCTTA - 3 ') ( SEQ ID NO : 91 ) was fused psuedonana to the C - terminal of the mamC gene , which is a magneto TPS_108361 Thalassiosira Propylamination 25 some surface protein . The mamC -R5 gene was cloned into psuedonana a pMGA plasmid vector, and conjugated into Magnetospiril SPDS Propylamination SPMS Propylamination lum magneticum , and cultured in liquid media . The R5 -dis tSPMS Propylamination playing magnetosomes were purified from the recombinant PMT Propylamination M. magneticum by French Press and bar -magnet , washed Sped Propylamination 30 with HEPES - EDTA and 2M NaCl , and finally resuspended in deionized water or HEPES ( pH7.4 ) buffer . The R5 - displaying magnetosomes were resuspended in a Example 9 : Altered Silica Morphology Using phosphate buffered solution and mixed with silicic acid at R5 -Melanin room temperature. Silica precipitation was analyzed after 30 35 minutes . The dried material appeared black to the naked eye. R5 melanin- (polymerized R5 ) was used to precipitate By TEM , magnetosome chains coated in a layer of silica amorphous silicon dioxide ( silica ) . First , R5 polymers were were observed ( FIG . 11 and FIG . 13 ) . By energy - dispersive enriched for from the mixed monomer / polymer sample by X - ray spectroscopy ( EDS ) it was determined that the size exclusion chromatography. The silica precipitation samples contain approximately 50-80 % iron oxide ( Fe , 04 ) reaction was performed as previously published ( Kröger N. , 40 and 5-10 % silicon dioxide . By TEM , silicate coating on the et al . , Science , 1999 Nov. 5 ; 286 ( 5442 ) : 1129-32 ) , while surface of magnetosomes was observed ( FIG . 14 ) . using R5 - melanin in place of unmodified R5 peptides . Briefly , silicic acid was created by hydrolyzing tetramethyl Example 12 : CNT- Binding Magnetosomes orthosilicate ( TMOS ) in hydrochloric acid . Silicic acid was 45 DNA fragments encoding for carbon -nanotube - binding then added to R5 - melanin in a phosphate buffered solution peptides ( CNT1 , 5 ' - CACTCCTCCTACTGGTA CGCCTT at a 1:10 ratio . Silica precipitation occurred spontaneously at CAACAACAAGACC - 3 ' ( SEQ ID NO : 92 ) or CNT2 , room temperature . After 10 minutes the particles were 5 - GACTCCCCGCACACCGAGCTGCCG - 3 ') ( SEQ ID pelleted and washed with water and dried . The dried silica NO : 93 ) were fused to the C - terminal of the mamC gene . was visibly brown to the naked eye , indicating that the 50 MamC - CNT and MamC -CNT2 genes were cloned into melanin was embedded in the silica . When analyzed by pMGA plasmid vector, conjugated into M. magneticum and scanning electron microscope ( SEM ) the silica morphology cultured in liquid media . The magnetosomes were purified appeared porous ( FIG . 9 ) . This melanin - embedded silica can from each recombinant M. magneticum by French Press and be generated in less than two hours . bar -magnet , washed with HEPES -EDTA and 2M NaCl , and 55 finally resuspended in deionized water . Example 10 : R5 -Mms6 for In Vitro Silica - Coated Iron Oxide Nanoparticle Synthesis TABLE 3 A DNA fragment encoding for the R5 peptide (5' Metal Binding Peptides to Combine / Fuse with R5 . ATGTCCTCCAAAAAATCTGGTTCATATTCCGGCTCT 60 Pep SEQ AAAGGCAGTAAACGTCGTATCTTA - 3 ') ( SEQ ID NO : tide ID 90 ) was fused to the N -terminal of the mms6 gene , which is Name Sequence NO Metal ( s ) Ref . an iron binding protein used to regulate magnetosome DBADISTEARATTL 35 Al Adams B. L. , et al . , crystal morphology. R5 -mms6 was cloned into a PMB1 TACDAY Adv . Mater . 2013 Sep 6 ; plasmid vector, and transformed into E. coli , and cultured in 65 25 (33 ) : 4530-91 . liquid media . Recombinant R5 -Mms6 was purified from E. coli by affinity and size exclusion chromatography and US 10,882,885 B2 29 30 TABLE 3 - continued TABLE 3- continued Metal Binding Peptides to combine / Fuse with R5 . Metal Binding Peptides to combine / Fuse with R5 . Pep SEO Pep SEQ tide ID 5 tide ID Name Sequence NO Metal ( s ) Ref . Name Sequence NO Metal ( s ) Ref . A1 VPSSGPQDT 36 Al Zuo R. , et al . , Appl . HG12 HGGGHGHG 53 Cu ( II ) , Banerjee I. A. , S1 RTT Microbiol . Biotechnol . GGHG Ni ( II ) et al . , Proc . 2005 Sep ; 68 ( 4 ) : 505-9 . Natl . Acad . Sci . 10 U.S.A. 2003 Dec 9 ; A1 YSPDPRPWS 37 Al Zuo R. , et al . , Appl . 100 ( 25 ) : 14678-82 . S2 SDY Microbiol . Biotechnol . 2005 Sep ; 68 ( 4 ) : 505-9 . HG6 HGGGHG 54 Cu ( II ) , Pappalardo G. , et al . , Ni ( II ) New J. Chem . 2002 ; BT1 HQPANDPS 38 BaTiO3 Ahmad G. , et al . , J. 26 ( 5 ) : 593-600 . WYTG Am . Chem . Soc . 2008 15 Jan 9 ; 130 ( 1 ) : 4-5 . Ge8 SLKMPHWP 55 Ge02 Dickerson M. B. , et HLLP al . , Chem . Commun , BT2 NTISGLRYA 39 BaTiO3 Ahmad G. , et al . , J. 2004 Aug 7 ; ( 15 ) : PHM Am . Chem . Soc . 2008 1776-77 . Jan 9 ; 130 ( 1 ) : 4-5 . Ge34 TGHQS PGA 56 GeO2 Dickerson M. B. , et A7 CNNPMHQN 40 Zns Flynn C. E. , et al . , 20 YAAH al . , Chem . Commun . C J. Mater . Chem . 2003 ; 2004 Aug 7 ; ( 15 ) : 13 ( 10 ) : 2414-21 . 1776-77 . Z8 LRRSSEAHN 41 Zns Flynn C. E. , et al . , Gold - LKAHLPPSR 57 Au Nam K. T. , et al . , SIV J. Mater . Chem . 2003 ; bind - LPS Science . 2006 13 ( 10 ) : 2414-21 . 25 ing May 12 ; 312 ( 5775 ) : pep 885-88 . J182 CTYSRLHLC 42 cas Flynn C. E. , et al . , tide J. Mater . Chem . 2003 ; a 13 ( 10 ) : 2414-21 . Gold - AHHAHAAD 58 Au Djalali R. , et al . , J. J140 SLTPLTTSH 43 Cas Flynn c . E. , et al . , 30 bind Am . Chem . Soc . 2003 LRS J. Mater . Chem . 2003 ; ing May 14 ; 125 ( 19 ) : 13 ( 10 ) : 2414-21 . pep 5873-79 . tide 5R39 GRVLAGSS 44 CaCo3 Li c . , et al . , Cryst . b AVSSRPS Growth Des . 2002 ; 2 ( 5 ) : 387-93 . 35 MS - ATIHDAFYS 59 Fe Zuo R. , et al . , Appl . S1 APE Microbiol . Biotechnol . 4R12 AYGSSGFYS 45 CaCO3 Li C. , et al . , Cryst . 2005 Sep ; 68 ( 4 ) : ASFTPR Growth Des . 2002 ; 505-9 . 2 ( 5 ) : 387-93 . RE ACTARSPWI 60 Lanthide Zhang Y. , et al . , AG - 4 NPSSLFRYL 46 Ag Naik R. R. , et al . , 40 1 CG oxides : Nat . Mater . 2012 PSD Adv . Funct . Mater . Y203 , Sep ; 11 ( 9 ) : 817-26 . 2004 ; 14 ( 1 ) : 25-30 . Ce02 , Yb203 , AG WSWRPTPH 47 Ag Naik R. R. , et al . , Nd203 , P35 VVT Adv . Funct . Mater . Er2031 2004 ; 14 ( 1 ) : 25-30 . 45 La203, Eu203 , Col- HYPTLPGSS 48 ?? Naik R. R. , et al . , Pr60111 P10 TT Adv . Funct . Mater . Tb4071 2004 ; 14 ( 1 ) : 25-30 . G0203 CN225RHTDGLRRI 49 Cu ( II ) Thai C. K. , et al . , 50 Ag TVPPKAPRS 61 Ag Bassindale A. R. , et AAR Biotechnol . Bioengin . 22 SDL al . , Chem . Commun . 2004 Jul 20 ; 87 ( 2 ) : 2007 Jul 28 ; ( 28 ) : 129-37 . 2956-58 . CN44 NTVWRLNS 50 Cu ( II ) Thai C. K. , et al . , Ag LTRPNHGNT 62 Ag Bassindale A. R. , et SCGM Biotechnol . Bioengin . 55 28 VDT al . , Chem . Commun . 2004 Jul 20 ; 87 ( 2 ) : 2007 Jul 28 ; ( 28 ) : 129-37 . 2956-58 .

CN179RIGHGRQIR 51 Zno Thai C. K. , et al . , Pt SRL THSNYA 63 Pt Bassindale A. R. , et KPL Biotechnol . Bioengin . 41 TPT al . , Chem . Commun . 2004 Jul 20 ; 87 ( 2 ) : 60 2007 Jul 28 ; ( 28 ) : 129-37 . 2956-58 .

CN146MRHSSSGEP 52 Zno Thai C. K. , et al . , Pt EHTNPILSH 64 Pt Bassindale A. R. , et RLL Biotechnol . Bioengin . 14 ??? al . , Chem . Commun . 2004 Jul 20 ; 87 ( 2 ) : 2007 Jul 28 ; ( 28 ) : 129-37 . 65 2956-58 . US 10,882,885 B2 31 32 TABLE 3 - continued Using R5 to precipitate silica coatings may enable thinner coatings than alternative chemical methods and may allow Metal Binding Peptides to combine / Fuse with R5 . for DNA nanostructure morphologies to be retained even Pep SEO after the coatings , thereby allowing the DNA structure to tide ID 5 remain functional after being coated with silica . Other Name Sequence NO Metal ( s ) Ref . methods of generated these structures results in silica that Pt QSFSTNVLH 65 Pt Bassindale A. R. , et completely engulfs the nanostructure . 1.2 THH al . , Chem . Commun . A six - helix bundle DNA nanostructure was folded as 2007 Jul 28 ; ( 28 ) : previously published ( Castro C. E. , et al . , Nat . Methods, 2956-58 . 10 2011 March ; 8 ( 3 ) : 221-29 ) . The DNA nanostructure was HPGAHHPGAH 66 Pt Tsiveriotis P. and then incubated with R5 in a magnesium and phosphate Hadjiliadis N. , buffered solution for 30 minutes at room temperature . The Coord . Chem . Rev. silica precipitation reaction was initiated by adding 100 mm 1999 ; 171-84 . of hydrolyzed silicic acid ( TMOS or Ludox HS - 30 silica 15 AG3 AYSSGAPP 67 Ag Naik R. R. , et al . , sources ) to the solution . After 30 minutes the sample was MPPF Nat . Mater . 2002 prepared for TEM . TEM images indicated a layer of silica Nov ; 1 ( 3 ) : 169-72 . around the DNA structure ( FIG . 12 ) . AG4 NPSSLFRYL 68 Ag Naik R. R. , et al . , PSD Nat . Mater . 2002 Example 14 : Photonic Materials Using R5 20 Nov ; 1 ( 3 ) : 169-72 . Previously described methods of synthesizing synthetic dTi - 1RKKRKKRK 69 TiO2 Dickerson M. B. , et opals can take up to a year ( usually seven months) and ( RKK ) KRKKGGGW al . , Chem . Mater . require high temperatures ( 800-1150 ° C.) ( Filin S. V., et al . , 2008 ; 20 ( 4 ) : 1578-84 . Australian Gemmologist, 2002 January ; 21 : 278-282 ; U.S. Ti - 1 RKKRTKNP 70 TiO2 Dickerson M. B. , et 25 Pat . No. 4,703,020 ; P.C.T. App . No. PCT / IN2005 / 000033 ) . THKLFFFW al . , Chem . Mater . The methods described herein are capable of synthesizing 2008 ; 20 ( 4 ) : 1578-84 . opals at room temperature and over the course of days or PG - 7 TMGANLGL 71 Zno Golec P. , et al . , less . KWPV J. Nanopar . Res . Three methods are being explored to order the silica 2012. 14 ( 11 ) : 1218 . 30 particles produced by unmodified R5 into organized 2D or Zno- EAHVMHKV 72 Zno Umetsu M. , et al . , 3D layered materials to control the optical properties ( e.g. la APRP Adv . Mater . 2005 ; opalescence ) beyond the light absorption from the polym 17 ( 21 ) : 2571-75 . erized R5 . First , unmodified R5 can be used to precipitate Zno- HVNLHS 73 Zno Okochi M. , et al . , silica spheres in solution (per the standard process ). The 1b Acta . Biomater . 2010 35 template surface material ( e.g. silicon wafer) can then be Jun ;. 6 ( 6 ) : 2301-06 . dipped into the solution . Upon removing the template sur face from the solution , the silica spheres should self -orga Zno- RCARRY 74 Zno Okochi M. , et al . , nize into a layer on the surface . 2 Acta . Biomater . 2010 Second , layer -by - layer adsorption can be explored ( Clark Jun ;. 6 ( 6 ) : 2301-06 . 40 S. and Hammon P., Adv. Mater. , 1998 December; 10 ( 18 ) : Zno- HYQSNW 75 Zno Okochi M. , et al . , 1515-19 ) , where a layer of R5 peptide is absorbed onto a 3 Acta . Biomater . 2010 silicon wafer surface . The formation of silica spheres on the Jun ;. 6 ( 6 ) : 2301-06 . surface can be tested by submerging the R5 - coated layer into Zno- HWFHPR 76 Zno Okochi M. , et al . , a phosphate buffered silicic acid solution , as well as intro 4 Acta . Biomater . 2010 45 ducing additional free R5 peptide into the reaction . Samples Jun ;. 6 ( 6 ) : 2301-06 . can then be analyzed by profilometery to determine R5 layer HA SVSVGMKP 77 Hydroxy Roy M. D. , et al . , thickness, and SEM and TEM to visualize any surface 6-1 SPRP apatite Adv . Mater . 2008 ; morphologies. ( Cas 20 ( 10 ) : 1830-36 . Finally, a protein microarray can be used to immobilize ( PO4 ) 3 50 R5 on a surface. A similar process to the layer -by -layer ( OH ) approach can be used to form silica spheres on the surface . HABP1CMLPHHGA 78 Hydroxy- Gungormus M. , C apatite et al . , Example 15 : Additional Applications ( Cag Biomacromolecules . ( PO4 ) 3 2008 Mar ; 55 Post -translational modifications to R5 may be able alter ( OH ) 9 ( 3 ) : 966-73 . the silica morphology ( e.g. size, shape, porosity ) that is HABP2CNPGFAQA 79 Hydroxy Gungormus M. , produced in a controlled fashion . Combining multiple modi apatite et al . , fications on R5 may enable the synthesis of more complex ( Cag Biomacromolecules . silica structures . Potential applications for these materials ( PO4 ) 3 2008 Mar ; 60 include : customizable silica materials, biomedical applica ( OH ) 9 ( 3 ) : 966-73 . tions ( e.g. , drug delivery vehicles, biosensors, bioimaging ) , catalysis, thermal energy storage, optical fibers, microelec Example 13 : Silica - Coated DNA Nanostructures tronics, construction materials ( e.g. glass ) , and cosmetics (DNA Origami) Using R5 ( e.g. abrasive material for face scrubs ) 65 R5 -melanin and the R5 -melanin - silica may be able to Coating DNA nanostructures with silica to reduce bio absorb , transduce , and dissipate many forms of energy ( e.g. logical immune responses is an active area of research . radiation , UV ) , conduct electrons and ions , or manipulate US 10,882,885 B2 33 34 light. Magnetosomes, or magnetic nanoparticles, are able to 6. Borg S. , Rothenstein D. , Bill J. , and Schuler D. , Genera absorb electromagnetic wave , generate heat by applying tion of Multishell Magnetic Hybrid Nanoparticles by electromagnetic field . Potential applications for these mate- Encapsulation of Genetically Engineered and Fluorescent rials ( and combinations thereof) include : incorporating Bacterial Magnetosomes with ZnO and SiO 2. Small , R5 - melanin with other hydrogel polymers to 3D print mac- 5 2015 Sep. 2 ; 11 ( 33 ) : 4209-17 . roscale materials for the creation of optical and medical 7. Brutchey R. L. , Yoo E. S. , and Morse D. E. , Biocatalytic devices; incorporating R5 -melanin into bioplastics to yield Synthesis of a Nanostructured and Crystalline Bimetallic hard plastic materials with melanin properties; incorporating Perovskite - like Barium Oxofluorotitanate at Low Tem R5 - melanin into fuel cells , green batteries, sensors , or elec- perature. J. Am . Chem . Soc . 2006 Aug. 9 ; 128 ( 31 ) : tronics that require electrical conductivity or optical fea- 10 10288-94 . tures; using R5 -melanin - silica as substrates for catalytic 8. Buckley A. M. and Greenblatt, M. J. , The sol - gel prepa reactions that require transfer of electron or protons; using ration of silica gels . J. Chem . R5 - melanin - silica as a bio - inert, UV or radiation absorptive Educ ., 1994 July ; 71 ( 7 ) : 599 . material ( e.g. sunscreen additive , cancer treatment, etc. ); 9. Castro C. E. , Kilchherr F. , Kim D. N. , Shiao E. L. , Wauer using silica - coated or CNT - coated magnetic nanoparticles 15 T. , Wortmann P., Bathe M. , and Dietz H. , A primer to for microwave absorption or electromagnetic interference scaffolded DNA origami. Nat . Methods, 2011 March ; ( EMI ) shielding . Specific applications include as coatings on 8 (3 ) : 221-29 . military stealth aircrafts or vehicles and as MRI contrast 10. Cha J. N. , Shimizu K. , Zhou Y., Christiansen S. C. , agents. 20 Chmeka B. F. , Stucky G. D. , and Morse D. E. , Silicatein DNA nanostructures are currently being explored by filaments and subunits from a marine sponge direct the others for drug delivery and biosensing. Coating the nano- polymerization of silica and silicones in vitro . Proc . Natl . structures with a bio - inert material, like silica , can improve Acad . Sci . U.S.A. , 1999 Jan. 19 ; 96 ( 2 ) : 361-65 . the efficacy and reduce immune response . Additionally, 11. Chen X. , Liu Y., Yang J. , Wu W., Miao L. , Yu Y., Yang DNA nanostructures are a robust method for synthesizing 25 X. , and Sun W., The synthesis of hydroxyapatite with highly complex structures at the nanoscale . Coating these different crystallinities by controlling the concentration of structures with silica and removing the organic material can recombinant CEMP1 for biological application . Mater. serve as another route to synthesize complex silica structures Sci . Eng. C. Mater. Biol . Appl. 2016 February; 59 : at the nano- and micro - scales. Using R5 to precipitate silica 384-89 . coatings may enable thinner coatings than alternative chemi- 30 12. Clark S. and Hammon P., Engineering the Microfabri cal methods and may allow for DNA nanostructure mor- cation of Layer -by - Layer Thin Films . Adv . Mater. , 1998 phologies to be retained even after the coatings, thereby December; 10 ( 18 ) : 1515-19 . allowing the DNA structure to remain functional after being 13. della - Cioppa G. , Garger S. J. , Sverlow G. G. , Turpen T. coated with silica . (One common challenge with other H. , and Grill L. K. , Melanin Production in Escherichia methods is the silica completely engulfs the nanostructure .) 35 coli from a Cloned Tyrosinase Gene. Biotechnology , 1990 Applications for using R5 to synthesize ordered silica July ; 8 ( 7 ) : 634-38 . spheres on a surface include production of opals for use in 14. Dickerson M. B. , Jones S. E. , Cai Y., Ahmad G. , Naik R. jewelry and ornaments . R. , Kroger N. , and Sandhage K. H. , Identification and Design of Peptides for the Rapid , High - Yield Formation REFERENCES 40 of Nanoparticulate TiO2 from Aqueous Solutions at Room Temperature . Chem . Mater. 2008 ; 20 ( 4 ) : 1578-84 . 1. Adams B. L. , Finch A. S. , Hurley M. M. , Starkes D. A. and 15. Dickerson M. B. , Naik R. R. , Stone M. O. Cia Y., and Stratis - Cullum D. N. , Genetically Engineered Peptides for Sandhage K. H. , Identification of peptides that promote Inorganics: Study of an Unconstrained Bacterial Display the rapid precipitation of germania nanoparticle networks Technology and Bulk Aluminum Alloy, Adv. Mater . 2013 45 via use of a peptide display library. Chem . Commun . 2004 Sep. 6 ; 25 ( 33 ) : 4530-91 . Aug. 7 ; ( 15 ) : 1776-77 . 2. Ahmad G. , Dickerson M. B. , Cai Y., Jones S. E. , Ernst E. 16. Ding D. , Guerette P. A. , Hoon S. , Kong K. W., Cornvik M. , Vernon J. P., Haluska M. S. , Fang Y., Wang J. , T. , Nilsson M. , Kumar A. , Lescar J. , and Miserez A. , Subramanyam G. , Naik R. R. , and Sandhage K. H. , Rapid Biomimetic Production of Silk - Like Recombinant Squid Bioenabled Formation of Ferroelectric BaTiO3 at Room 50 Sucker Ring Teeth Proteins. Biomacromolecules . 2014 ; Temperature from an Aqueous Salt Solution at Near 15 : 3278-89 . Neutral pH . J. Am . Chem . Soc . 2008 Jan. 9 ; 130 ( 1 ) : 4-5 . 17. Djalali R. , Chen Y. F. , and Matsui H. , Au Nanocrystal 3. Amemiya Y., Arakaki A. , Staniland S. , Tanaka T. , and Growth on Nanotubes Controlled by Conformations and Matsunaga T. , Controlled formation of magnetite crystal Charges of Sequenced Peptide Templates. J. Am . by partial oxidation of ferrous hydroxide in the presence 55 Chem . Soc . 2003 May 14 ; 125 ( 19 ) : 5873-79 . of recombinant magnetotactic bacterial protein Mms6 . 18. Filin S. V., Puzynin A. I. , and Samoilov V. N. , Some Biomaterials , 2007 December; 28 ( 35 ) : 5381-89 . Aspects of Precious Opal Synthesis. Australian Gem 4. Banerjee I. A. , Yu L. , and Matsui H. , Cu nanocrystal mologist, 2002 January ; 21 : 278-282 . growth on peptide nanotubes by biomineralization : Size 19. Flynn C. E. , Chuanbin M. , Hayhurst A. , Williams J. L. , control of Cu nanocrystals by tuning peptide conforma- 60 Georgiou G. , Iverson B. , and Belcher A. M. , Synthesis tion . and organization of nanoscale II - VI semiconductor mate Proc . Natl . Acad . Sci . U.S.A. 2003 Dec. 9 ; 100 ( 25 ) : rials using evolved peptide specificity and viral capsid 14678-82 . assembly. J. Mater . Chem . 2003 ; 13 ( 10 ) : 2414-21 . 5. Bassindale A. R. , Codina - Barrios A. , Franscione N. , and 20. Golec P., Karczewska -Golec J. , Los M. , and Wegrzyn G. , Taylor P. G. , An improved phage display methodology for 65 Novel ZnO - binding peptides obtained by the screening of inorganic nanoparticle fabrication . Chem . Commun . 2007 a phage display peptide library. J. Nanopar. Res . 2012 . Jul. 28 ; ( 28 ) : 2956-58 . 14 ( 11 ) : 1218 . US 10,882,885 B2 35 36 21. Guerette P. A. , Hoon S. , Ding D. , Amini S. , Masic A. , cell surface display : toward an understanding of metal Ravi V., Venkatesh B. , Weaver J. C. , and Miserez A. , oxide binding . Biotechnol. Bioengin . 2004 Jul. 20 ; 87 ( 2 ) : Nanoconfined P - Sheets Mechanically Reinforce the 129-37 . Supra -Biomolecular Network of Robust Squid Sucker 36. Tsiveriotis P. and Hadjiliadis N. , Studies on the interac Ring Teeth . ACS Nano . 2014 Jul. 22 ; 8 ( 7 ) : 7170-79 . 5 tion of histidyl containing peptides with palladium ( II ) and 22. Gungormus M. , Fong H. , Kim I. W., Evans J. S. , platinum ( II ) complex ions . Coord . Chem . Rev. 1999 ; Tamerler C. , and Sarikaya M. , Regulation of in vitro 171-84 . Calcium Phosphate Mineralization by Combinatorially 37. Umetsu M. , Mizuta M. , Tsumoto K. , Ohara S. , Takami Selected Hydroxyapatite - Binding Peptides. Biomacro- S. , Watanabe H. , Kumagai I. , and Adschiri T. , Bioassisted 10 Room - Temperature Immobilization and Mineralization of molecules . 2008 March ; 9 ( 3 ) : 966-73 . Zinc Oxide The Structural Ordering of ZnO Nanoparticles 23. Kang S. H. , Bozhilov K. N. , Myung N. V., Mulchandani into a Flower - Type Morphology. Adv. Mater. 2005 ; A. , and Chen W., Microbial Synthesis of CdS Nanocrys 17 (21 ): 2571-75 . tals in Genetically Engineered E. coli . Angew . Chem . Int . 38. Zafar M. S. , Belton D. J. , Hanby B. , Kaplan D. L. , and Ed . Engl. 2008 ; 47 ( 28 ) : 5186-89 . 15 Perry C. C. , Functional Material Feature of Bombyx mori 24. Kröger N. , Deutzmann R. , and Sumper M. , Polycationic Silk Light vs. Heavy Chain Proteins . Biomacromolecules . Peptides from Diatom Biosilica That Direct Silica Nano 2015 ; 16 ( 2 ) : 606-14 . sphere Formation . Science , 1999 Nov. 5 ; 286 ( 5442 ) : 39. Zhang Y., Aheng F. , Yang T. , Zhou W., Liu Y., Man N. , 1129-32 . Zhang L. , Jin N. , Dou Q. , Zhang Y., Li Z. , and Wen L. P., 25. Li C. , Botsaris G. D , and Kaplan D. L. , Selective in Vitro 20 Tuning the autophagy - inducing activity of lanthanide Effect of Peptides on Calcium Carbonate Crystallization . based nanocrystals through specific surface - coating pep Cryst. Growth Des . 2002 ; 2 ( 5 ) : 387-93 . tides . Nat. Mater. 2012 September; 11 ( 9 ) : 817-26 . 26. Naik R. R. , Jones S. E. , urray C. J. , McAuliffe J. C. , 40. Zuo R. , D. Ornek , and T. K. Wood , Aluminum- and mild Vaia R. A. , and Stone M. O. , Peptide Templates for steel- binding peptides from phage display . Appl. Micro Nanoparticle Synthesis Derived from Polymerase Chain 25 biol . Biotechnol. 2005 September ; 68 ( 4 ) : 505-9 . Reaction -Driven Phage Display . Adv. Funct. Mater. 2004 ; 14 ( 1 ) : 25-30 . OTHER EMBODIMENTS 27. Naik R. R. , Stringer S. J. , Agarwal G. , Jones S. E. , and Stone M. O. , Biomimetic synthesis and patterning of All of the features disclosed in this specification may be silver nanoparticles . Nat . Mater . 2002 November; 1 ( 3 ) : 30 combined in any combination . Each feature disclosed in this 169-72 . specification may be replaced by an alternative feature 28. Nam K. T. , Kim D. W , Yoo P. J. , Chiang C. Y., Meethong serving the same, equivalent, or similar purpose . Thus, N. , Hammond P. T. Chiang Y. M. , and Blecher A. M. , unless expressly stated otherwise, each feature disclosed is Virus - Enabled Synthesis and Assembly of Nanowires for only an example of a generic series of equivalent or similar Lithium Ion Battery Electrodes. Science . 2006 May 12 ; 35 features . 312 ( 5775 ) : 885-88 . From the above description , one skilled in the art can 29. Okochi M. , Ogawa M. , Kaga C. , Sugita T. , Tomita Y., easily ascertain the essential characteristics of the present Kato R. , and Honda H. , Screening of peptide with a high disclosure, and without departing from the spirit and scope affinity for ZnO using spot- synthesized peptide arrays and 40 disclosurethereof, can to makeadapt variousit to various changes usages and and modifications conditions . ofThus the , computational analysis . Acta . Biomater. 2010 June ; 6 ( 6 ) : other embodiments are also within the claims . 2301-06 . 30. Pappalardo G. , Giuseppe I. , Raffaele P. B. , Tiziana C. , EQUIVALENTS Giulia G. and Saita M. G. , Copper ( ii) and nickel ( ii ) binding modes in a histidine - containing model dodeca- 45 While several inventive embodiments have been peptide . New J. Chem . 2002 ; 26 ( 5 ) : 593-600 . described and illustrated herein , those of ordinary skill in the 31. Prince J. T. , McGrath K. P., DiGirolamo C. M. , and art will readily envision a variety of other means and / or Kaplan D. L. , Construction , Cloning , and Expression of structures for performing the function and / or obtaining the Synthetic Genes Encoding Spider Dragline Silk . Bio- results and / or one or more of the advantages described chemistry. 1995 Aug. 29 ; 34 : 10879-85 . 50 herein , and each of such variations and /or modifications is 32. Roy M. D. , Scott K. S. , Amis E. J. , and Becker M. L. , deemed to be within the scope of the inventive embodiments Identification of a Highly Specific Hydroxyapatite -bind- described herein . More generally, those skilled in the art will ing Peptide using Phage Display. Adv . Mater. 2008 ; readily appreciate that all parameters, dimensions , materials, 20 ( 10 ) : 1830-36 . and configurations described herein are meant to be exem 33. Sumerel J. L. , Yang W., Kisailus D. , Weaver J. C. , Choi 55 plary and that the actual parameters, dimensions , materials, J. H. , and Morse D. E. , Biocatalytically Templated Syn- and / or configurations will depend upon the specific appli thesis of Titanium Dioxide . Chem . Mater. 2003 ; 15 ( 25 ) : cation or applications for which the inventive teachings 4804-9 . is / are used . Those skilled in the art will recognize , or be able 34. Schweitzer A. D. , Revskaya E. , Chu P., Pazo V., Fried- to ascertain using no more than routine experimentation , man M. , Nosanchuk J. D. , Cahill S. , Frases S. , Casadevall 60 many equivalents to the specific inventive embodiments A. , and Dadachova E. , Melanin - covered nanoparticles for described herein . It is , therefore, to be understood that the protection of bone marrow during radiation therapy of foregoing embodiments are presented by way of example cancer. Int. J. Radiat. Oncol . Biol . Phys ., 2010 Dec. 1 ; only and that, within the scope of the appended claims and 78 ( 5 ) : 1494-1502 . equivalents thereto , inventive embodiments may be prac 35. Thai C. K. , Dai H. , Sastry M. S. , Sarikaya M. , Schwartz 65 ticed otherwise than as specifically described and claimed . D. T. , and Baneyz F. , Identification and characterization of Inventive embodiments of thepresent disclosure are directed Cu20- and ZnO - binding polypeptides by Escherichia coli to each individual feature , system , article, material, kit , US 10,882,885 B2 37 38 and / or method described herein . In addition , any combina- “ Consisting essentially of , ” when used in the claims , shall tion of two or more such features, systems , articles, mate- have its ordinary meaning as used in the field of patent law . rials , kits , and / or methods, if such features, systems , articles, As used herein in the specification and in the claims , the materials, kits , and / or methods are not mutually inconsis phrase " at least one ,” in reference to a list of one or more tent, is included within the inventive scope of the present 5 selectedelements from , should any be one understood or more ofto meanthe elements at least onein the element list of disclosure . elements, but not necessarily including at least one of each All definitions , as defined and used herein , should be and every element specifically listed within the list of understood to control over dictionary definitions, definitions elements and not excluding any combinations of elements in in documents incorporated by reference , and / or ordinary the list of elements . This definition also allows that elements meanings of the defined terms. 10 may optionally be present other than the elements specifi All references, patents and patent applications disclosed cally identified within the list of elements to which the herein are incorporated by reference with respect to the phrase “ at least one ” refers, whether related or unrelated to subject matter for which each is cited , which in some cases those elements specifically identified . Thus, as a non -limit may encompass the entirety of the document . ing example , “ at least one of A and B ” ( or, equivalently, “ at The indefinite articles " a " and " an ,” as used herein in the 15 least one of A or B , ” or , equivalently “ at least one of A and / or specification and in the claims , unless clearly indicated to B ” ) can refer, in one embodiment, to at least one , optionally the contrary , should be understood to mean “ at least one. " including more than one , A , with no B present and option The phrase " and / or, ” as used herein in the specification ally including elements other than B ) ; in another embodi and in the claims , should be understood to mean “ either or ment, to at least one , optionally including more than one , B , both ” of the elements so conjoined , i.e. , elements that are 20 with no A present ( and optionally including elements other conjunctively present in some cases and disjunctively pres- than A ) ; in yet another embodiment, to at least one , option ent in other cases . Multiple elements listed with " and / or ” ally including more than one , A , and at least one , optionally should be construed in the same fashion , i.e. , “ one or more ” including more than one , ( and optionally including other of the elements so conjoined . Other elements may optionally elements ); etc. be present other than the elements specifically identified by 25 It should also be understood that, unless clearly indicated the “ and / or ” clause, whether related or unrelated to those to the contrary , in any methods claimed herein that include elements specifically identified . Thus, as a non - limiting more than one step or act , the order of the steps or acts of example , a reference to “ A and / or B ” , when used in con- the method is not necessarily limited to the order in which junction with open - ended language such as " comprising" the steps or acts of the method are recited . can refer, in one embodiment, to A only ( optionally includ- 30 In the claims , as well as in the specification above , all ing elements other than B ) ; in another embodiment, to B transitional phrases such as “ comprising , " “ including , " " car only ( optionally including elements other than A ) ; in yet rying, " “ having , " " containing , " " involving , " " holding , " another embodiment , to both A and B ( optionally including " composed of , ” and the like are to be understood to be other elements ); etc. open -ended , i.e. , to mean including but not limited to . Only As used herein in the specification and in the claims , “ or” 35 the transitional phrases " consisting of " and " consisting should be understood to have the same meaning as “ and / or ” essentially of” shall be closed or semi- closed transitional as defined above . For example , when separating items in a phrases, respectively, as set forth in the United States Patent list , “ or ” or “ and / or ” shall be interpreted as being inclusive , Office Manual of Patent Examining Procedures, Section i.e. , the inclusion of at least one , but also including more 2111.03 . It should be appreciated that embodiments than one , of a number or list of elements , and, optionally, 40 described in this document using an open - ended transitional additional unlisted items . Only terms clearly indicated to the phrase ( e.g. , " comprising " ) are also contemplated , in alter contrary, such as “ only one of ” or “ exactly one of , ” or, when native embodiments, as “ consisting of” and “ consisting used in the claims , “ consisting of, ” will refer to the inclusion essentially of the feature described by the open -ended of exactly one element of a number or list of elements . In transitional phrase . For example , if the disclosure describes general, the term “ or ” as used herein shall only be inter- 45 " a composition comprising A and B ” , the disclosure also preted as indicating exclusive alternatives ( i.e. “ one or the contemplates the alternative embodiments “ a composition other but not both ” ) when preceded by terms of exclusivity, consisting of A and B ” and “ a composition consisting such as “ either ,” “ one of, ” “ only one of , ” or “ exactly one of . ” essentially of A and B ” .

SEQUENCE LISTING

< 160 > NUMBER OF SEQ ID NOS : 94 < 210 > SEQ ID NO 1 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 1 Ser Ser Lys Lys Ser Gly Ser Tyr Ser Gly Ser Lys Gly Ser Lys Arg 1 5 10 15 Arg Ile Leu US 10,882,885 B2 39 40 - continued

< 210 > SEQ ID NO 2 < 211 > LENGTH : 33 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 2 Ser Ser Lys Lys Ser Gly Ser Tyr Tyr Ser Tyr Gly Thr Lys Lys Ser 1 5 10 15 Gly Ser Tyr Ser Gly Tyr Ser Thr Lys Lys Ser Ala Ser Arg Arg Ile 20 25 30

Leu

< 210 > SEQ ID NO 3 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 3 Ala Pro Pro Gly His His His Trp His Ile His His 1 5 10

< 210 > SEQ ID NO 4 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 4 Met Ser Ala Ser Ser Tyr Ala Ser Phe Ser Trp Ser 1 5 10

< 210 > SEQ ID NO 5 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : lica - Binding Peptide < 400 > SEQUENCE : 5 Lys Pro Ser His His His His His Thr Gly Ala Asn 1 5 10

< 210 > SEQ ID NO 6 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 6 Met Ser Pro His Pro His Pro Arg His His His Thr 1 5 10

< 210 > SEQ ID NO 7 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 7 US 10,882,885 B2 41 42 - continued

Met Ser Pro His His Met His His Ser His Gly His 1 5 10

< 210 > SEQ ID NO 8 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 8 Leu Pro His His His His Leu His Thr Lys Leu Pro 1 5 10

< 210 > SEQ ID NO 9 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 9 Ala Pro His His His His Pro His His Leu Ser Arg 1 5 10

< 210 > SEQ ID NO 10 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 10 Arg Gly Arg Arg Arg Arg Leu Ser Cys Arg Leu Leu 1 5 10

< 210 > SEQ ID NO 11 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 11 Thr Val Ala Ser Asn Ser Gly Leu Arg Pro Ala Ser 1 5 10

< 210 > SEQ ID NO 12 < 211 > LENGTH : 20 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 12 Ser Ser Lys Lys Ser Gly Ser Tyr Ser Gly Ser Lys Gly Ser Lys Arg 1 5 10 15 Arg Ile Asn Leu 20

< 210 > SEQ ID NO 13 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide US 10,882,885 B2 43 44 - continued

< 400 > SEQUENCE : 13 Ser Ser Lys Lys Ser Gly Ser Tyr Ser Gly Ser Lys Gly Ser Lys Arg 1 5 10 15 Arg Asn Leu

< 210 > SEQ ID NO 14 < 211 > LENGTH : 17 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 14 Gly Met Ser Ser Lys Lys Ser Gly Ser Lys Gly Ser Lys Arg Arg Ile 1 5 10 15 Leu

< 210 > SEQ ID NO 15 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 15 Ser Ser Glu Glu Ser Gly Ser Tyr Ser Gly Ser Glu Gly Ser Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 16 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 16 Ser Ser Asp Asp Ser Gly Ser Tyr Ser Gly Ser Asp Gly Ser Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 17 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 17 Ser Ser Lys Glu Ser Gly Ser Tyr Ser Gly Ser Glu Gly Ser Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 18 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 18 Ser Ser Lys Lys Ser Gly Ser Tyr Ser Gly Ser Glu Gly Ser Lys Arg US 10,882,885 B2 45 46 - continued

1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 19 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 19 Ser Ser Lys Glu Ser Gly Ser Tyr Ser Gly Ser Lys Gly Ser Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 20 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 20 Ser Ser Lys Lys Ser Gly Ser Leu Ser Gly Ser Lys Gly Ser Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 21 5211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 21 Cys Cys Lys Lys Cys Gly Cys Tyr Cys Gly Cys Lys Gly Cys Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 22 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 22 Ala Ala Lys Lys Ala Gly Ala Tyr Ala Gly Ala Lys Gly Ala Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 23 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 23 Ser Ser Lys Lys Ala Gly Ala Tyr Ala Gly Ala Lys Gly Ala Lys Arg 1 5 10 15 Arg Ile Leu US 10,882,885 B2 47 48 - continued

< 210 > SEQ ID NO 24 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 24 Ile Ile Lys Lys Ile Gly Ile Ile Ile Gly Ile Lys Gly Ile Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 25 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 25 Pro Pro Lys Lys Pro Gly Pro Pro Pro Gly Pro Lys Gly Pro Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 26 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 26 Asp Asp Lys Lys Asp Gly Asp Tyr Asp Gly Asp Lys Gly Asp Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 27 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 27 Asn Asn Glu Glu Asn Gly Asn Tyr Asn Gly Asn Glu Gly Asn Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 28 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 28 Asn Asn Glu Lys Asn Gly Asn Tyr Asn Gly Asn Glu Gly Asn Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 29 < 211 > LENGTH : 19 < 212 > TYPE : PRT US 10,882,885 B2 49 50 - continued < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 29 His His Lys Lys His Gly His Tyr His Gly His Lys Gly His Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 30 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 30 Lys Lys Lys Lys Lys Gly Lys Tyr Lys Gly Lys Lys Gly Lys Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 31 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Bindingn Peptide < 400 > SEQUENCE : 31 Glu Glu Lys Lys Glu Gly Glu Tyr Glu Gly Glu Lys Gly Glu Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 32 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 32 Ala Ala Glu Glu Ala Gly Ala Tyr Ala Gly Ala Glu Gly Ala Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 33 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide < 400 > SEQUENCE : 33 Ala Ala Glu Lys Ala Gly Ala Tyr Ala Gly Ala Glu Gly Ala Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 34 < 211 > LENGTH : 19 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Silica - Binding Peptide US 10,882,885 B2 51 52 - continued < 400 > SEQUENCE : 34 Ser Ser His His Ser Gly Ser Tyr Ser Gly Ser His Gly Ser Lys Arg 1 5 10 15 Arg Ile Leu

< 210 > SEQ ID NO 35 < 211 > LENGTH : 15 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : DBAD1 < 400 > SEQUENCE : 35 Ser Thr Glu Ala Arg Ala Thr Thr Leu Thr Ala Cys Asp Ala Tyr 1 5 10 15

< 210 > SEQ ID NO 36 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Al - S1 < 400 > SEQUENCE : 36 Val Pro Ser Ser Gly Pro Gin Asp Thr Arg Thr Thr 1 5 10

< 210 > SEQ ID NO 37 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Al - S2 < 400 > SEQUENCE : 37 Tyr Ser Pro Asp Pro Arg Pro Trp Ser Ser Asp Tyr 1 5 10

< 210 > SEQ ID NO 38 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : BT1 < 400 > SEQUENCE : 38 His Gin Pro Ala Asn Asp Pro Ser Trp Tyr Thr Gly 1 5 10

< 210 > SEQ ID NO 39 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : BT2 < 400 > SEQUENCE : 39 Asn Thr Ile Ser Gly Leu Arg Tyr Ala Pro His Met 1 5 10

< 210 > SEQ ID NO 40 < 211 > LENGTH : 9 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : AZ US 10,882,885 B2 53 54 - continued

< 400 > SEQUENCE : 40 Cys Asn Asn Pro Met His Gin Asn Cys 1 5

< 210 > SEQ ID NO 41 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : 28 < 400 > SEQUENCE : 41 Leu Arg Arg Ser Ser Glu Ala His Asn Ser Ile Val 1 5 10

< 210 > SEQ ID NO 42 < 211 > LENGTH : 9 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : J182 < 400 > SEQUENCE : 42 Cys Thr Tyr Ser Arg Leu His Leu Cys 1 5

< 210 > SEQ ID NO 43 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : J140 < 400 > SEQUENCE : 43 Ser Leu Thr Pro Leu Thr Thr Ser His Leu Arg Ser 1 5 10

< 210 > SEQ ID NO 44 < 211 > LENGTH : 15 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : 5R39 < 400 > SEQUENCE : 44 Gly Arg Val Leu Ala Gly Ser Ser Ala Val Ser Ser Arg Pro Ser 1 5 10 15

< 210 > SEQ ID NO 45 < 211 > LENGTH : 15 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : 4R12 < 400 > SEQUENCE : 45 Ala Tyr Gly Ser Ser Gly Phe Tyr Ser Ala Ser Phe Thr Pro Arg 1 5 10 15

< 210 > SEQ ID NO 46 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : AG - 4 US 10,882,885 B2 55 56 - continued < 400 > SEQUENCE : 46 Asn Pro Ser Ser Leu Phe Arg Tyr Leu Pro Ser Asp 1 5 10

< 210 > SEQ ID NO 47 < 211 > LENGTH : 11 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : AG - P35 < 400 > SEQUENCE : 47 Trp Ser Trp Arg Pro Thr Pro His Val Val Thr 1 5 10

< 210 > SEQ ID NO 48 < 211 > LENGTH : 11 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Co1 - P10 < 400 > SEQUENCE : 48 His Tyr Pro Thr Leu Pro Gly Ser Ser Thr Thr 1 5 10

< 210 > SEQ ID NO 49 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : CN225 < 400 > SEQUENCE : 49 Arg His Thr Asp Gly Leu Arg Arg Ile Ala Ala Arg 1 5 10

< 210 > SEQ ID NO 50 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : CN44 < 400 > SEQUENCE : 50 Asn Thr Val Trp Arg Leu Asn Ser Ser Cys Gly Met 1 5 10

< 210 > SEQ ID NO 51 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : CN179 < 400 > SEQUENCE : 51 Arg Ile Gly His Gly Arg Gin Ile Arg Lys Pro Leu 1 5 10

< 210 > SEQ ID NO 52 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : CN146 < 400 > SEQUENCE : 52 US 10,882,885 B2 57 58 - continued

Met Arg His Ser Ser Ser Gly Glu Pro Arg Leu Leu 1 5 10

< 210 > SEQ ID NO 53 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : HG12 < 400 > SEQUENCE : 53 His Gly Gly Gly His Gly His Gly Gly Gly His Gly 1 5 10

< 210 > SEQ ID NO 54 < 211 > LENGTH : 6 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : HG6 < 400 > SEQUENCE : 54 His Gly Gly Gly His Gly 1 5

< 210 > SEQ ID NO 55 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Ge8 < 400 > SEQUENCE : 55 Ser Leu Lys Met Pro His Trp Pro His Leu Leu Pro 1 5 10

< 210 > SEQ ID NO 56 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Ge34 < 400 > SEQUENCE : 56 Thr Gly His Gin Ser Pro Gly Ala Tyr Ala Ala His 1 5 10

< 210 > SEQ ID NO 57 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Gold - binding peptide < 400 > SEQUENCE : 57 Leu Lys Ala His Leu Pro Pro Ser Arg Leu Pro Ser 1 5 10

< 210 > SEQ ID NO 58 < 211 > LENGTH : 8 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Gold - binding peptide < 400 > SEQUENCE : 58 US 10,882,885 B2 59 60 - continued Ala His His Ala His Ala Ala Asp 1 5

< 210 > SEQ ID NO 59 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : MS - S1 < 400 > SEQUENCE : 59 Ala Thr Ile His Asp Ala Phe Tyr Ser Ala Pro Glu 1 5 10

< 210 > SEQ ID NO 60 < 211 > LENGTH : 11 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : RE - 1 < 400 > SEQUENCE : 60 Ala Cys Thr Ala Arg Ser Pro Trp Ile Cys Gly 1 5 10

< 210 > SEQ ID NO 61 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Ag - 22 < 400 > SEQUENCE : 61 Thr Val Pro Pro Lys Ala Pro Arg Ser Ser Asp Leu 1 5 10

< 210 > SEQ ID NO 62 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Ag - 28 < 400 > SEQUENCE : 62 Leu Thr Arg Pro Asn His Gly Asn Thr Val Asp Thr 1 5 10

< 210 > SEQ ID NO 63 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Pt - 41 < 400 > SEQUENCE : 63 Ser Arg Leu Thr His Ser Asn Tyr Ala Thr Pro Thr 1 5 10

< 210 > SEQ ID NO 64 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Pt - 14 < 400 > SEQUENCE : 64 Glu His Thr Asn Pro Ile Leu Ser His Thr His Asn US 10,882,885 B2 61 62 - continued

1 5 10

< 210 > SEQ ID NO 65 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Pt - 1.2 < 400 > SEQUENCE : 65 Gln Ser Phe Ser Thr Asn Val Leu His Thr His His 1 5 10

< 210 > SEQ ID NO 66 < 211 > LENGTH : 5 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : HPGAH < 400 > SEQUENCE : 66 His Pro Gly Ala His 1 5

< 210 > SEQ ID NO 67 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : AG3 < 400 > SEQUENCE : 67 Ala Tyr Ser Ser Gly Ala Pro Pro Met Pro Pro Phe 1 5 10

< 210 > SEQ ID NO 68 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : AG4 < 400 > SEQUENCE : 68 Asn Pro Ser Ser Leu Phe Arg Tyr Leu Pro Ser Asp 1 5 10

< 210 > SEQ ID NO 69 < 211 > LENGTH : 16 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : dri - 1 ( RKK ) < 400 > SEQUENCE : 69 Arg Lys Lys Arg Lys Lys Arg Lys Lys Arg Lys Lys Gly Gly Gly Trp 1 5 10 15

< 210 > SEQ ID NO 70 < 211 > LENGTH : 16 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Ti - 1 < 400 > SEQUENCE : 70 Arg Lys Lys Arg Thr Lys Asn Pro Thr His Lys Leu Phe Phe Phe Trp 1 5 10 15 US 10,882,885 B2 63 64 - continued

< 210 > SEQ ID NO 71 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : PG - 7 < 400 > SEQUENCE : 71 Thr Met Gly Ala Asn Leu Gly Leu Lys Trp Pro Val 1 5 10

< 210 > SEQ ID NO 72 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Zno - 1 < 400 > SEQUENCE : 72 Glu Ala His Val Met His Lys Val Ala Pro Arg Pro 1 5 10

< 210 > SEQ ID NO 73 < 211 > LENGTH : 6 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Zno - 1 < 400 > SEQUENCE : 73 His Val Asn Leu His Ser 1 5

< 210 > SEQ ID NO 74 < 211 > LENGTH : 6 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Zno - 2 < 400 > SEQUENCE : 74 Arg Cys Ala Arg Arg Tyr 1 5

< 210 > SEQ ID NO 75 < 211 > LENGTH : 6 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Zno - 3 < 400 > SEQUENCE : 75 His Tyr Gln Ser Asn Trp 1 5

< 210 > SEQ ID NO 76 < 211 > LENGTH : 6 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Zno - 4

< 400 > SEQUENCE : 76 His Trp Phe His Pro Arg 1 5 US 10,882,885 B2 65 66 - continued

< 210 > SEQ ID NO 77 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : HA 6-1 < 400 > SEQUENCE : 77 Ser Val Ser Val Gly Met Lys Pro Ser Pro Arg Pro 1 5 10

< 210 > SEQ ID NO 78 < 211 > LENGTH : 9 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : HABP1 < 400 > SEQUENCE : 78 Cys Met Leu Pro His His Gly Ala Cys 1 5

< 210 > SEQ ID NO 79 < 211 > LENGTH : 9 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : HABP2 < 400 > SEQUENCE : 79 Cys Asn Pro Gly Phe Ala Gin Ala Cys 1 5

< 210 > SEQ ID NO 80 < 211 > LENGTH : 35 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : MaSpi Monomer < 400 > SEQUENCE : 80 Ser Gly Arg Gly Gly Leu Gly Gly Gin Gly Ala Gly Met Ala Ala Ala 1 5 10 15 Ala Ala Met Gly Gly Ala Gly Gin Gly Gly Tyr Gly Gly Leu Gly Ser 20 25 30 Gln Gly Thr 35

< 210 > SEQ ID NO 81 < 211 > LENGTH : 59 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Fibroin Heavy Monomer < 400 > SEQUENCE : 81 Gly Ala Gly Ala Gly Ser Gly Ala Ala Gly Ser Gly Ala Gly Ala Gly 1 5 10 15 Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly 20 25 30 Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly 35 40 45 Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Tyr 50 55 US 10,882,885 B2 67 68 - continued

< 210 > SEQ ID NO 82 < 211 > LENGTH : 10 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Ml Region < 400 > SEQUENCE : 82 Ala Ala Thr Ser Val Ser Arg Thr Thr His 1 5 10

< 210 > SEQ ID NO 83 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : M1 Region < 400 > SEQUENCE : 83 Ala Thr Thr Ala Val Ser His Thr Thr His His Ala 1 5 10

< 210 > SEQ ID NO 84 < 211 > LENGTH : 11 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : M1 Region < 400 > SEQUENCE : 84 Ala Ala Thr Val Ser His Thr Thr His His Ala 1 5 10

< 210 > SEQ ID NO 85 < 211 > LENGTH : 11 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Mi Region < 400 > SEQUENCE : 85 Ala Ala Ala Val Ser Hi Thr Thr s s Ala 1 5 10

< 210 > SEQ ID NO 86 < 211 > LENGTH : 10 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Mi Region < 400 > SEQUENCE : 86 Ala Ala Val Ser His Thr Thr His His Ala 1 5 10

< 210 > SEQ ID NO 87 < 211 > LENGTH : 12 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : M1 Region < 400 > SEQUENCE : 87 Ala Ala Ala Thr Val Ser His Thr Thr His His Ala 1 5 10 US 10,882,885 B2 69 70 - continued

< 210 > SEQ ID NO 88 < 211 > LENGTH : 9 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : M1 Region < 400 > SEQUENCE : 88 Ala Val Ser His Thr Thr His His Ala 1 5

< 210 > SEQ ID NO 89 < 211 > LENGTH : 15 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : AviTag < 400 > SEQUENCE : 89 Gly Leu Asn Asp Ile Phe Glu Ala Gln Lys Ile Glu Trp His Glu 1 5 10 15

< 210 > SEQ ID NO 90 < 211 > LENGTH : 60 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic polynucleotide < 400 > SEQUENCE : 90 atgtcctcca aaaaatctgg ttcatattcc ggctctaaag gcagtaaacg togtatotta 60

< 210 > SEQ ID NO 91 < 211 > LENGTH : 57 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic polynucleotide < 400 > SEQUENCE : 91 tcctccaaaa aatctggttc atattccggc tctaaaggca gtaaacgtcg tatctta 57

< 210 > SEQ ID NO 92 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic polynucleotide < 400 > SEQUENCE : 92 cactcctcct actggtacgc cttcaacaac aagacc 36

< 210 > SEQ ID NO 93 < 211 > LENGTH : 24 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic polynucleotide < 400 > SEQUENCE : 93 gactccccgc acaccgagct gccg 24

< 210 > SEQ ID NO 94 < 211 > LENGTH : 21 < 212 > TYPE : PRT < 213 > ORGANISM : Artificial Sequence US 10,882,885 B2 71 72 - continued < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic polypeptide < 400 > SEQUENCE : 94 Gly Met Ser Ser Lys Lys Ser Gly Ser Tyr Ser Gly Ser Lys Gly Ser 1 5 10 15 Lys Arg Arg Ile Leu 20

What is claimed is : 11. The silica structure of claim 10 , further comprising: synthetic molecule comprising or consisting essen iron oxide nanoparticles tially of the amino acid sequence of SEQ ID NO : 1 , wherein 15 magnetosomes , optionally wherein at least one of the at least one synthetic molecules is R5 - MamC , R5 - CNT1 , at least one amino acid of SEQ ID NO : 1 contains a or R5 - CNT2 ; and / or non - native post - translational modification selected from the a biomolecule , optionally wherein the biomolecule is group consisting of oxidation , myristoylation , hypusination, DNA . and methylation , wherein the methylation occurs at Lys3, 20 12. The synthetic molecule of claim 1 , wherein Lys3 , Lys4 , and / or Lys15 of SEQ ID NO : 1 . Lys4 , and / or Lys15 of SEQ ID NO : 1 is methylated more 2. The synthetic molecule of claim 1 , wherein the oxida than once . tion occurs at Tyr10 of SEQ ID NO : 1 . 13. The synthetic molecule of claim 1 , wherein at least 3. A polymer comprising a fusion of at least two synthetic one amino acid of SEQ ID NO : 1 further contains a molecules of claim 1 . 25 post - translational modification selected from the group con 4. The polymer of claim 3 , wherein two or more of the sisting of: synthetic molecules contain an oxidized tyrosine. phosphorylation , optionally wherein the phosphorylation 5. A silica structure comprising precipitated silica and at occurs at Serl, Ser2 , Ser5 , Ser7 , Ser9, Ser11 , and / or least one polymer as claimed in claim 3 . Ser14 of SEQ ID NO : 1 ; 6. The polymer of claim 3 , wherein : 30 methylation , wherein the methylation occurs at Lys 12 of two or more of the at least two synthetic molecules are SEQ ID NO : 1 , and optionally wherein Lys12 of SEQ chemically unique; ID NO : 1 is methylated more than once ; and the at least two synthetic molecules are fused through an propylamination , optionally wherein the propylamination interaction between at least one terminal end of each is the addition of spermine, spermidine, putrescine, synthetic molecule ; and / or 35 and / or thermospermine to at least one amino acid of the at least two synthetic molecules are fused through an SEQ ID NO : 1 . interaction between at least one amino acid side chain 14. A synthetic molecule comprising : a silica binding of each synthetic molecule . protein comprising the amino acid sequence of SEQ ID NO : 7. A composition comprising at least one synthetic mol- 1 , wherein at least one amino acid of SEQ ID NO : 1 contains ecule as claimed in claim 1 and / or at least one polymer 40 a non - native post - translational modification selected from thereof. the group consisting of oxidation , myristoylation, hypusi 8. A method of synthesizing a silica structure comprising : nation , and methylation, wherein the methylation occurs at contacting a synthetic molecule as claimed in claim 1 with Lys3 , Lys4 , and / or Lys15 of SEQ ID NO : 1 ; and a terminal a solution comprising dissolved silica . fusion molecule , wherein the terminal fusion molecule is : 9. The method of claim 8 , wherein : 45 ( i ) a metal - binding polypeptide, a magnetosome surface the synthetic molecule and the solution comprising dis- polypeptide, or a carbon - nanotube -binding polypep solved silica are contacted at ambient temperature ; tide; and the dissolved silica is aqueous silicic acid or colloidal ( ii ) fused to at least one terminal end of the silica - binding silica ; peptide. the synthetic molecule and the solution comprising dis- 50 15. The synthetic molecule of claim 14 , wherein the solved silica are further contacted with at least one synthetic molecule comprises an additional terminal fusion metal nanoparticle, optionally wherein the at least one molecule , wherein the additional terminal fusion molecule is metal nanoparticle is selected from the group consisting not a biomolecule . of an iron oxide nanoparticle, a zinc oxide nanoparticle 16. The synthetic molecule of claim 14 , wherein at least tantalum oxide nanoparticles, a hafnium oxide nan- 55 one amino acid of the silica binding peptide contains a oparticle , a titanium oxide nanoparticle , a cadmium post - translational modification selected from the group con sulfide nanoparticle , a germanium oxide nanoparticle, sisting of propylamination , hydroxylation , adenylylation , an indium phosphide , and a cadmium selenide nan- biotinylation, lipidation, acetylation , glycosylation , propy oparticle ; lamination , and sulfonation . the synthetic molecule and the solution comprising dis- 60 17. The synthetic molecule of claim 14 , wherein the solved silica are further contacted with magnetosomes ; oxidation occurs at Tyr10 of SEQ ID NO : 1 . and / or 18. The synthetic molecule of claim 14 , wherein the the synthetic molecule and the solution comprising dis- terminal fusion molecule is a polypeptide selected from the solved silica are further contacted with a biomolecule , group consisting of Mms6 , MamC , CNT1 , and CNT2 . optionally wherein the biomolecule is DNA . 65 19. The synthetic molecule of claim 14 , wherein Lys3 , 10. A silica structure comprising precipitated silica and at Lys4 , and / or Lys15 of SEQ ID NO : 1 is methylated more least one synthetic molecule as claimed in claim 1 . than once. US 10,882,885 B2 73 74 20. The synthetic molecule of claim 14 , wherein at least one amino acid of SEQ ID NO : 1 contains a post - transla tional modification selected from the group consisting of: phosphorylation , optionally wherein the phosphorylation occurs at Serl , Ser2 , Ser5 , Ser7 , Ser9 , Ser11 , and / or 5 Ser14 of SEQ ID NO : 1 ; methylation , wherein the methylation occurs at Lys 12 of SEQ ID NO : 1 , and optionally, wherein Lys12 of SEQ ID NO : 1 is methylated more than once ; and propylamination , optionally wherein the propylamination 10 is the addition of spermine, spermidine , putrescine , and /or thermospermine to at least one amino acid of SEQ ID NO : 1 .