DOCSLIB.ORG

Corneal Transduction to Inhibit Angiogenesis and Graft Failure

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Corneal Transduction to Inhibit Angiogenesis and Graft Failure Corneal Transduction to Inhibit Angiogenesis and Graft Failure Raghu C. Murthy,1,2 Trevor J. McFarland,1,2 Jon Yoken,1 Sandy Chen,1 Chris Barone,1 Dorthea Burke,1 Yi Zhang,1 Binoy Appukuttan,1 and J. Timothy Stout1 PURPOSE. To test whether lentivirus-mediated expression of an a significant number of corneal transplantations end in rejec- endostatin::kringle-5 (E::K-5) fusion gene has an inhibitory ef- tion and graft failure every year. The need for regrafting a failed fect on neovascularization and failure of corneal transplants. transplant is one of the top two indications for corneal trans- ETHODS A lentiviral vector containing a fusion transgene plantation in many centers in the United States, competing M . 2 comprising the human endostatin gene and the kringle-5 do- with pseudophakic bullous keratopathy in frequency. The main of the human plasminogen gene (E::K-5) was used for major risk factors for rejection are prior corneal transplanta- 3 transduction of corneal buttons ex vivo. The corneal buttons tion, glaucoma, and preoperative corneal vascularization. Pre- were transplanted after overnight incubation in media contain- vention of corneal neovascularization would be a pivotal step ing either lentivirus or PBS. Sixteen rabbits underwent allo- toward inhibiting graft failure and rejection. genic penetrating keratoplasty in one eye. The area of neovas- Endothelial cell migration, proliferation, and modification of cularization from the limbus to within the graft was the extracellular matrix are all involved in angiogenesis. Mole- documented after surgery. RT-PCR was performed to demon- cules that stimulate or inhibit vessel growth modulate angio- 4 strate the presence of transgene mRNA within the graft. His- genesis. A variety of pathologic states can result from a de- topathology was used to analyze neovascularization, inflamma- creased production of inhibitors or an increased production of 4 tion, and rejection morphology. stimulators. For example, an elevated level of vascular endo- thelial growth factor (VEGF) is associated with the abnormal RESULTS. Less neovascularization was observed in corneas neovascularization in diabetic retinopathy.5 The development treated with the lentivirus E::K-5 fusion vector. Early onset and of a biological agent to combat proangiogenic stimulation profound neovascularization was observed in control eyes. would be a useful tool. Prior attempts to inhibit rejection have E::K-5–treated animals did not have graft failure, whereas five included ex vivo gene therapy in a sheep corneal transplanta- of the six control animals had graft failure, as classified by 6 opacification of the graft. All E::K-5 transduced corneas tested tion model. Donor grafts were transduced with an adenovirus- were positive by RT-PCR for the unique fusion gene sequence. mediated delivery system with a gene encoding IL-10, which Histopathology corroborated a significant increase of blood downregulates some of the steps in the cascade of cell-medi- vessel presence and inflammatory reaction in control com- ated immunity. These animals showed prolonged corneal allo- pared with treated eyes. graft survival. Endostatin, a 20-kDa C-terminal fragment of collagen XVIII CONCLUSIONS. Corneas transduced with a lentivirus containing (Fig. 1) has been shown to be an endogenous inhibitor of an endostatin::kringle-5 fusion gene demonstrated an inhibi- angiogenesis and tumor growth in a hemangioendothelioma tion of neovascularization and graft failure. E::K-5 gene trans- model in rats.7 Endostatin impedes proliferation and migration duction through a lentiviral vector system may be a useful by downregulating the expression of genes involved in cell adjunct to prevent graft neovascularization and corneal graft growth, antiapoptosis, and angiogenesis, specifically within rejection in high-risk corneal transplants with antecedent re- endothelial cells.8 Endostatin has also been reported to inhibit jection or neovascularization. (Invest Ophthalmol Vis Sci. cell matrix adhesion in endothelial cells and to promote a G1 2003;44:1837–1842) DOI:10.1167/iovs.02-0853 arrest through inhibition of cyclin D1.9,10 Angiostatin, a pro- tein derived from proteolytic cleavage of an internal fragment ore than 30,000 corneal transplantations are performed of plasminogen (Fig. 1), containing up to four kringle domains, Meach year in the United States—more than all heart, inhibits angiogenesis-dependent tumor growth.11,12 Kringle-5 kidney, and liver transplantations.1 Corneal transplantation (or of plasminogen shares 46% to 57% amino acid identity to each penetrating keratoplasty, PK) is one of the most successful of of the four kringle domains of angiostatin and is a more potent such operations in humans, with success exceeding 90%. Still, inhibitor of basic fibroblast growth factor (bFGF)–stimulated angiogenesis than is angiostatin alone.13 Kringle-5 acts specif- ically on endothelial cells by inhibiting cell migration, although 14 1 the exact mechanism has not been fully elucidated. Reports From the Clayton Gene Therapy Laboratory, Casey Eye Institute, have implied that interactions between angiostatin and integrin Oregon Health Sciences University, Portland, Oregon. ␣ ␤ 2Contributed equally to the work and therefore should be consid- v 3 (an integrin common to immature, newly synthesized ered equivalent senior authors. vessels), and caveolin-1 may be essential components in this 15,16 Supported by the Clayton Foundation for Research, Research to process. The angiostatic fusion protein consisting of Prevent Blindness, and the Heed Ophthalmic Foundation. mouse endostatin and mouse angiostatin has been shown to Submitted for publication August 20, 2002; revised October 1, have a more potent biological effect than either gene product 2002; accepted November 7, 2002. alone in an in vitro cancer model.17 In the current study, the Disclosure: R.C. Murthy, None; T.J. McFarland, None; J. Yo- biologically active domains of human endostatin 18 and human ken, None; S. Chen, None; C. Barone, None; D. Burke, None; Y. kringle-5 were linked to make the fusion protein E::K-5 for the Zhang, None; B. Appukuttan, None; J.T. Stout, None purpose of producing a protein able to inhibit both endothelial The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertise- cell proliferation and migration. ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Lentiviral vectors are efficient at transducing a number of Corresponding author: J. Timothy Stout, Casey Eye Institute, 3375 target cells, have a large transgene-carrying capacity, and ex- SW Terwilliger Boulevard, Portland, OR 97201; [email protected]. hibit early-onset expression. As a result of proviral integration Investigative Ophthalmology & Visual Science, May 2003, Vol. 44, No. 5 Copyright © Association for Research in Vision and Ophthalmology 1837 Downloaded from tvst.arvojournals.org on 09/29/2021 1838 Murthy et al. IOVS, May 2003, Vol. 44, No. 5 BamHI site and the reverse primer (5ЈCAATGTATCGGATCCTGTC- GAGCTAGC3Ј) containing a BamHI site. This fusion gene encodes 20 amino acids from the human IL-2 secretion signal, amino acids Ala1333 to Lys1516 from the human collagen XVIII gene (endostatin), an 8-ami- no-acid elastin linker motif VPGVGTAS, and amino acids Pro466 to Asp566 from the human plasminogen gene. The PCR fragment was digested with BamHI and ligated into the lentiviral vector pHRЈ, under the transcriptional control of the cytomegalovirus (CMV) promoter (Fig. 2). Construction of the E::Kr5 fusion gene was confirmed by direct sequencing of the transgene insert. Replication-deficient E::Kr5 lentivirus particles were prepared as previously described.19 Virus particles were resuspended in a minimal volume of PBS and stored at Ϫ80°C. FIGURE 1. Diagram of the proteins plasminogen and collagen XVIII. The fusion protein E::K-5 was derived from the kringle 5 domain of plasminogen and the cleaved product endostatin 18 of collagen Viral Assay XVIII. The presence of virus particles was confirmed with a quantitative HIV-1 p24 antigen ELISA kit (ZeptoMetrix, Buffalo, NY), according to into the host genome, sustained long-term expression is 18,19 the manufacturer’s instructions. To ensure the infectivity of the lenti- achieved in many tissue types, including nondividing cells. viral reagent, 10, 50, and 100 ␮L of virus was placed into a six-well In a previous study, we confirmed that a lentivirus containing plate of human dermal microvascular endothelial cells (HDMECs) for a reporter gene transduces all cornea cell types efficiently, and 20 minutes at 37°C. Medium 131 (Cascade Biologicals, Portland, OR) expression is persistent in corneal cultures maintained up to 60 20 was then added, and cells were incubated at 37°C5%CO2 for 5 days, days. To study the neovascularization and rejection of cor- with medium changes every other day. On day 5, RNA was isolated neal transplants, we used a rabbit model of allogenic corneal with extraction reagent (TRIzol; Gibco-BRL, Grand Island, NY), and transplantation. standard RT-PCR reactions and analyses were performed. The forward Prior studies have documented a high rate of transplant primer (5ЈTCTGAGGGTCCGCTGAAGCCCGGGG3Ј) and reverse rejection in rabbits with retained graft– host sutures after Ј Ј 21 primer (5 CAAATGAAGGGGCCGCAC3 ) flanked the elastin linker re- PK. In this study we investigated the ability of a lentiviral gion and thus amplified only the fusion transcript. vector to deliver a potentially antiangiogenic
Load more

Recommended publications
  • Endostatin: a Novel Inhibitor of Androgen Receptor Function in Prostate Cancer
    Endostatin: A novel inhibitor of androgen receptor function in prostate cancer Joo Hyoung Leea, Tatyana Isayevaa, Matthew R. Larsonb, Anandi Sawanta, Ha-Ram Chaa, Diptiman Chandaa, Igor N. Chesnokovc, and Selvarangan Ponnazhagana,1 Departments of aPathology and cBiochemistry and Molecular Genetics, University of Alabama, Birmingham, AL 35294; and bDepartment of Biological Chemistry, University of Michigan Medical Center, Ann Arbor, MI 48109 Edited* by Louise T. Chow, University of Alabama at Birmingham, Birmingham, AL, and approved December 29, 2014 (received for review September 12, 2014) Acquired resistance to androgen receptor (AR)-targeted therapies a C-terminal LBD. Like other nuclear receptors (NRs), AR is a compels the development of novel treatment strategies for castra- transcription factor regulating target-gene expression in a ligand- tion-resistant prostate cancer (CRPC). Here, we report a profound dependent manner (2, 16). Cognate ligand binding induces effect of endostatin on prostate cancer cells by efficient intracellular conformational changes predominantly in helix 12 of AR trafficking, direct interaction with AR, reduction of nuclear AR level, LBD, which enhances transcriptional activity by forming a ligand- and down-regulation of AR-target gene transcription. Structural dependent AF-2 binding interface for coactivators (17). Wilson modeling followed by functional analyses further revealed that and colleagues demonstrated that the interdomain interaction phenylalanine-rich α1-helix in endostatin—which shares struc- between AF-1 in NTD and AF-2 in LBD (N/C interaction) leads tural similarity with noncanonical nuclear receptor box in AR— to AR stabilization and slower ligand dissociation (18, 19). antagonizes AR transcriptional activity by occupying the activation Functional activity of AR largely depends on AF-2 that function (AF)-2 binding interface for coactivators and N-terminal accommodates the binding of various AR coactivators by rec- AR AF-1.
    [Show full text]
  • The Procollagen N-Proteinases ADAMTS2, 3 and 14 in Pathophysiology
    Review The procollagen N-proteinases ADAMTS2, 3 and 14 in pathophysiology Mourad Bekhouche and Alain Colige Laboratory of Connective Tissues Biology, GIGA-R, University of Liège, B-4000 Sart Tilman, Belgium Correspondence to Alain Colige: Laboratory of Connective Tissues Biology, University of Liège, GIGA-Research, Tour de Pathologie B23/3, Avenue de l'Hôpital, 3, B-4000 Sart Tilman, Belgium. [email protected] http://dx.doi.org/10.1016/j.matbio.2015.04.001 Edited by W.C. Parks and S. Apte Abstract Collagen fibers are the main components of most of the extracellular matrices where they provide a structural support to cells, tissues and organs. Fibril-forming procollagens are synthetized as individual chains that associate to form homo- or hetero-trimers. They are characterized by the presence of a central triple helical domain flanked by amino and carboxy propeptides. Although there are some exceptions, these two propeptides have to be proteolytically removed to allow the almost spontaneous assembly of the trimers into collagen fibrils and fibers. While the carboxy-propeptide is mainly cleaved by proteinases from the tolloid family, the amino-propeptide is usually processed by procollagen N-proteinases: ADAMTS2, 3 and 14. This review summarizes the current knowledge concerning this subfamily of ADAMTS enzymes and discusses their potential involvement in physiopathological processes that are not directly linked to fibrillar procollagen processing. © 2015 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Introduction determine the cause of dermatosparaxis, a rare genetic disease that appeared in Belgian cattle herds during an Fibrillar collagens are the most abundant proteins inbreeding program [2,3].
    [Show full text]
  • Increased Endostatin/Collagen XVIII Expression Correlates with Elevated VEGF Level and Poor Prognosis in Hepatocellular Carcinoma
    Modern Pathology (2005) 18, 663–672 & 2005 USCAP, Inc All rights reserved 0893-3952/05 $30.00 www.modernpathology.org Increased endostatin/collagen XVIII expression correlates with elevated VEGF level and poor prognosis in hepatocellular carcinoma Tsung-Hui Hu1,*, Chao-Cheng Huang2,*, Chia-Ling Wu3, Pey-Ru Lin4, Shang-Yun Liu2, Jui-Wei Lin2, Jiin-Haur Chuang3 and Ming Hong Tai4,5 1Division of Hepatology, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan; 2Division of Pathology, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan; 3Department of Surgery, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan; 4Department of Medical Education and Research, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan and 5Department of Biological Sciences, National Sun Yat-Sen University, Kaohsiung, Taiwan Liver is the primary source for collagen XVIII, the precursor of angiogenesis inhibitor, endostatin. However, the role of endostatin/collagen XVIII expression during liver carcinogenesis remains elusive. Therefore, we studied its expression in five hepatoma cell lines and 105 hepatocellular carcinoma specimens. The poorly differentiated hepatoma cell lines exhibited increased endostatin/collagen XVIII levels compared with the well-differentiated ones. In hepatoma tissues, endostatin/collagen XVIII expression was detected in various types of liver cells and was significantly stronger in adjacent nontumor tissues than that in tumors (Po0.001). Endostatin/collagen XVIII expression in nontumor tissues correlated with tumor stages (P ¼ 0.014) and expression of vascular endothelial growth factor (P ¼ 0.007), but not the stages of hepatic fibrosis (P40.05). Kaplan–Meier analysis showed that patients with higher endostatin/collagen XVIII expression had significantly shorter overall survival (P ¼ 0.011) and disease-free survival (P ¼ 0.0034).
    [Show full text]
  • Binding and Endothelial Tube Formation
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 7275–7280, June 1998 Biochemistry Defining the domains of type I collagen involved in heparin- binding and endothelial tube formation SHAWN M. SWEENEY†,CYNTHIA A. GUY‡,GREGG B. FIELDS§, AND JAMES D. SAN ANTONIO†¶ †Department of Medicine and the Cardeza Foundation for Hematologic Research, Jefferson Medical College of Thomas Jefferson University, Philadelphia, PA 19107; ‡Department of Laboratory Medicine and Pathology, University of Minnesota, Minneapolis, MN 55455; and §Department of Chemistry and Biochemistry, and the Center for Molecular Biology and Biotechnology, Florida Atlantic University, Boca Raton, FL 33431 Edited by Darwin J. Prockop, MCP-Hahnemann Medical School, Philadelphia, PA, and approved April 14, 1998 (received for review January 12, 1998) ABSTRACT Cell surface heparan sulfate proteoglycan To localize more precisely the heparin-binding regions on type (HSPG) interactions with type I collagen may be a ubiquitous I collagen, we studied complexes between collagen monomers cell adhesion mechanism. However, the HSPG binding sites on and heparin–albumin–gold particles by electron microscopy type I collagen are unknown. Previously we mapped heparin (6), and we observed heparin binding primarily to a region on binding to the vicinity of the type I collagen N terminus by the triple helix near the procollagen N terminus. In collagen electron microscopy. The present study has identified type I fibrils, heparin–gold bound to the a bands region within each collagen sequences used for heparin binding and endothelial D-period, which is consistent with an N-terminal heparin- cell–collagen interactions. Using affinity coelectrophoresis, binding site on its monomers. The resolution of the mapping we found heparin to bind as follows: to type I collagen with technique was insufficient to assign heparin-binding function high affinity (Kd ' 150 nM); triple-helical peptides (THPs) to any particular protein sequence.
    [Show full text]
  • Collagens, Modifying Enzymes and Their Mutations in Humans, Flies And
    Review TRENDS in Genetics Vol.20 No.1 January 2004 33 Collagens, modifying enzymes and their mutations in humans, flies and worms Johanna Myllyharju and Kari I. Kivirikko Collagen Research Unit, Biocenter Oulu and Department of Medical Biochemistry and Molecular Biology, University of Oulu, FIN-90014 Oulu, Finland Collagens and proteins with collagen-like domains form Collagens are the most abundant proteins in the human large superfamilies in various species, and the numbers body, constituting ,30% of its protein mass. The import- of known family members are increasing constantly. ant roles of these proteins have been clearly demonstrated Vertebrates have at least 27 collagen types with 42 dis- by the wide spectrum of diseases caused by a large number tinct polypeptide chains, >20 additional proteins with of mutations found in collagen genes. This article will collagen-like domains and ,20 isoenzymes of various review the collagen superfamilies and their mutations in collagen-modifying enzymes. Caenorhabditis elegans vertebrates, Drosophila melanogaster and the nematode has ,175 cuticle collagen polypeptides and two base- Caenorhabditis elegans. The genomes of these two model ment membrane collagens. Drosophila melanogaster invertebrate species have been fully sequenced, and it is has far fewer collagens than many other species but therefore possible to identify all of the collagen genes has ,20 polypeptides similar to the catalytic subunits present in these species. Because of the extensive of prolyl 4-hydroxylase, the key enzyme of collagen syn- literature in these fields, this review will focus primarily thesis. More than 1300 mutations have so far been on recent advances. More detailed accounts and more characterized in 23 of the 42 human collagen genes complete references can be found in previous reviews, for in various diseases, and many mouse models and example Refs [1–6].
    [Show full text]
  • Collagens—Structure, Function, and Biosynthesis
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of East Anglia digital repository Advanced Drug Delivery Reviews 55 (2003) 1531–1546 www.elsevier.com/locate/addr Collagens—structure, function, and biosynthesis K. Gelsea,E.Po¨schlb, T. Aignera,* a Cartilage Research, Department of Pathology, University of Erlangen-Nu¨rnberg, Krankenhausstr. 8-10, D-91054 Erlangen, Germany b Department of Experimental Medicine I, University of Erlangen-Nu¨rnberg, 91054 Erlangen, Germany Received 20 January 2003; accepted 26 August 2003 Abstract The extracellular matrix represents a complex alloy of variable members of diverse protein families defining structural integrity and various physiological functions. The most abundant family is the collagens with more than 20 different collagen types identified so far. Collagens are centrally involved in the formation of fibrillar and microfibrillar networks of the extracellular matrix, basement membranes as well as other structures of the extracellular matrix. This review focuses on the distribution and function of various collagen types in different tissues. It introduces their basic structural subunits and points out major steps in the biosynthesis and supramolecular processing of fibrillar collagens as prototypical members of this protein family. A final outlook indicates the importance of different collagen types not only for the understanding of collagen-related diseases, but also as a basis for the therapeutical use of members of this protein family discussed in other chapters of this issue. D 2003 Elsevier B.V. All rights reserved. Keywords: Collagen; Extracellular matrix; Fibrillogenesis; Connective tissue Contents 1. Collagens—general introduction ............................................. 1532 2. Collagens—the basic structural module.........................................
    [Show full text]
  • Endostatin Review
    Dose-Response, 9:369-376, 2011 Formerly Nonlinearity in Biology, Toxicology, and Medicine Copyright © 2011 University of Massachusetts ISSN: 1559-3258 DOI: 10.2203/dose-response.10-020.Javaherian TWO ENDOGENOUS ANTIANGIOGENIC INHIBITORS, ENDOSTATIN AND ANGIOSTATIN, DEMONSTRATE BIPHASIC CURVES IN THEIR ANTITUMOR PROFILES Kashi Javaherian ᮀ Center of Cancer Systems Biology, Department of Medicine, St. Elizabeth’s Medical Center, School of Medicine, Tufts University, Boston, MA, USA Tong-Young Lee, Robert M. Tjin Tham Sjin ᮀ Vascular Biology Program, Department of Surgery, Children’s Hospital Boston and Harvard Medical School, Boston, MA, USA George E. Parris, Lynn Hlatky ᮀ Center of Cancer Systems Biology, Department of Medicine, St. Elizabeth’s Medical Center, School of Medicine, Tufts University, Boston, MA, USA ᮀ Angiogenesis refers to growth of blood vessels from pre-existing ones. In 1971, Folkman proposed that by choking off the blood supply to tumors, they are starved, lead- ing to their demise. A few years ago, the monoclonal antibody Avastin became the first antiangiogenic biological approved by FDA, for treatment of cancer patients. Two other antiangiogenic endogenous protein fragments were isolated in Folkman’s laboratory more than a decade ago. Here, we present a short review of data demonstrating that angio- statin and endostatin display a biphasic antitumor dose-response. This behavior is com- mon among a large number of antiangiogenic agents and the reduced effectiveness of antiangiogenic agents at high dose rates may be due to suppression of growth of new ves- sels carrying the agent into the critical region around the tumor. Keywords: Angiogenesis, Angiostatin, Endostatin, Biphasic INTRODUCTION In 1990, it was reported that thromspondin, an extracellular matrix protein, displayed antiangiogenic properties (Good et al.
    [Show full text]
  • Anti-Angiogenic Activity of Human Endostatin Is HIF-1- Independent in Vitro and Sensitive to Timing of Treatment in a Human Saphenous Vein Assay
    Molecular Cancer Therapeutics 845 Anti-angiogenic activity of human endostatin is HIF-1- independent in vitro and sensitive to timing of treatment in a human saphenous vein assay Gordon R. Macpherson,1 Sylvia S.W. Ng,1 sections with human endostatin from Calbiochem resulted Siiri L. Forbes,1 Giovanni Melillo,4 in a dose-dependent inhibition of microvessel outgrowth. Tatiana Karpova,2 James McNally,2 Importantly, inhibition of vessel outgrowth by Calbiochem Thomas P. Conrads,5 Timothy D. Veenstra,5 endostatin in a human saphenous vein angiogenesis assay Alfredo Martinez,3 Frank Cuttitta,3 required early treatment. In view of this in vitro data, we Douglas K. Price,1 and William D. Figg1 suggest that clinical trials involving endostatin treatment of late-stage disease may not adequately represent the 1Molecular Pharmacology Laboratory, 2Laboratory of Receptor Biology efficacy of this drug in early-stage cancer. (Mol Cancer 3 and Gene Expression, and Cell and Cancer Biology Branch and Vascular Ther. 2003;2:845–854) Biology Faculty, National Cancer Institute, Bethesda, MD, and 4DTP— Tumor Hypoxia Laboratory and 5SAIC-Frederick, Inc., National Cancer Institute at Frederick, Frederick, MD Introduction Endostatin is a cleavage product from the COOH-terminal, Abstract non-helical portion of the collagen XVIII NC1 domain (1). It was first identified in a murine hemangioendothelioma cell Endostatin is a 20-kDa endogenous angiogenesis inhibitor line and subsequently shown to be a powerful anti- that has recently been shown to inhibit the expression of angiogenic peptide and inhibitor of endothelial cell vascular endothelial growth factor (VEGF), an angiogenic proliferation (1). Endostatin had dramatic anti-tumor growth factor that is up-regulated by hypoxia via the HIF-1 activity in mice treated s.c.
    [Show full text]
  • Endostatin in the Regulation of Endothelial Cell – Matrix Interactions and Pericellular Proteolysis
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Helsingin yliopiston digitaalinen arkisto Helsinki University Biomedical Dissertations No. 51 ENDOSTATIN IN THE REGULATION OF ENDOTHELIAL CELL – MATRIX INTERACTIONS AND PERICELLULAR PROTEOLYSIS Sara A. Wickström Departments of Pathology and Virology, Haartman Institute, Helsinki University Hospital and Biomedicum Helsinki University of Helsinki Finland Academic Dissertation To be presented, with the permission of the Faculty of Medicine, University of Helsinki, for public criticism, in the Lecture Hall 3 of the Biomedicum Helsinki, Haartmaninkatu 8, Helsinki, on March 26th, 2004, at 12 o’clock noon Helsinki 2004 Supervised by: Professor Jorma Keski-Oja Departments of Pathology and Virology Biomedicum and Haartman Institute University of Helsinki Helsinki, Finland Reviewed by: Professor Ismo Virtanen Department of Biomedicine and Anatomy Biomedicum Helsinki University of Helsinki Helsinki, Finland and Docent Raija Soininen Department of Biochemistry Biocenter Oulu University of Oulu Oulu, Finland Opponent: Professor Lena Claesson-Welsh Department of Genetics and Pathology Rudbeck Laboratory University of Uppsala Uppsala, Sweden ISSN 147-8433 ISBN 952-10-1723-6 (nid.) ISBN 952-10-1724-4 (PDF) http://ethesis.helsinki.fi Yliopistopaino Helsinki 2004 4 Contents Original publications ............................................................................................ 7 Abbreviations........................................................................................................
    [Show full text]
  • Insights Into the Structure and Dynamics of Lysyl Oxidase
    www.nature.com/scientificreports OPEN Insights into the structure and dynamics of lysyl oxidase propeptide, a fexible protein Received: 8 April 2018 Accepted: 20 July 2018 with numerous partners Published: xx xx xxxx Sylvain D. Vallet1, Adriana E. Miele 1, Urszula Uciechowska-Kaczmarzyk2, Adam Liwo2, Bertrand Duclos1, Sergey A. Samsonov2 & Sylvie Ricard-Blum1 Lysyl oxidase (LOX) catalyzes the oxidative deamination of lysine and hydroxylysine residues in collagens and elastin, which is the frst step of the cross-linking of these extracellular matrix proteins. It is secreted as a proenzyme activated by bone morphogenetic protein-1, which releases the LOX catalytic domain and its bioactive N-terminal propeptide. We characterized the recombinant human propeptide by circular dichroism, dynamic light scattering, and small-angle X-ray scattering (SAXS), and showed that it is elongated, monomeric, disordered and fexible (Dmax: 11.7 nm, Rg: 3.7 nm). We generated 3D models of the propeptide by coarse-grained molecular dynamics simulations restrained by SAXS data, which were used for docking experiments. Furthermore, we have identifed 17 new binding partners of the propeptide by label-free assays. They include four glycosaminoglycans (hyaluronan, chondroitin, dermatan and heparan sulfate), collagen I, cross-linking and proteolytic enzymes (lysyl oxidase-like 2, transglutaminase-2, matrix metalloproteinase-2), a proteoglycan (fbromodulin), one growth factor (Epidermal Growth Factor, EGF), and one membrane protein (tumor endothelial marker-8). This suggests new roles for the propeptide in EGF signaling pathway. Lysyl oxidase (LOX), a copper amine oxidase, catalyzes the oxidative deamination of lysine and hydroxylysine residues in collagens and elastin, which is the frst step of the covalent cross-linking of these extracellular matrix (ECM) proteins1.
    [Show full text]
  • Matrix Proteoglycans As Effector Molecules for Epithelial Cell Function
    Eur Respir Rev 2005; 14: 97, 137–144 DOI: 10.1183/09059180.05.00009703 CopyrightßERSJ Ltd 2005 Matrix proteoglycans as effector molecules for epithelial cell function C.W. Frevert* and P.L. Sannes# ABSTRACT: Matrix proteoglycans are complex molecules composed of a core protein and AFFILIATIONS glycosaminoglycan side chains. Once thought to be the molecular glue providing structural *Pulmonary and Molecular Pathology Research Laboratories at the Seattle, support and imparting biomechanical properties to lung tissue, it is now apparent that Dept of Veterans Affairs Medical proteoglycans are important biological modifiers which regulate processes such as lung Center, and the Division of development, homeostasis, inflammation and wound healing. The diverse roles of Pulmonary/Critical Care Medicine, proteoglycans in the extracellular matrix suggest that these molecules play a critical role in Dept of Medicine, University of Washington School of Medicine, normal and diseased lungs. This short article will discuss the role extracellular matrix Seattle, WA, and proteoglycans play in regulating epithelial cell function in the lungs. #Dept of Molecular Biomedical Sciences, College of Veterinary KEYWORDS: Chondrotin sulphate, epithelial cell, heparan sulphate, perlecan, proteoglycans, Medicine, North Carolina State University, Raleigh, NC, USA. versican CORRESPONDENCE C.W. Frevert he primary function of the lungs is to proteoglycans. The goal of this article is to Seattle VAMC Pulmonary Research allow for the diffusion of oxygen and discuss the role of extracellular matrix proteogly- Group T carbon dioxide into and out of the blood. cans in regulating epithelial cell function in Seattle VA Medical Center Therefore, the preservation of normal lung normal and diseased lungs. 151L function is critical.
    [Show full text]
  • Endostatin Lowers Blood Pressure Via Nitric Oxide and Prevents Hypertension Associated with VEGF Inhibition
    Endostatin lowers blood pressure via nitric oxide and prevents hypertension associated with VEGF inhibition Sarah B. Sunshinea,1, Susan M. Dallabridaa, Ellen Duranda, Nesreen S. Ismaila, Lauren Bazineta, Amy E. Birsnera, Regina Sohnb, Sadakatsu Ikedac, William T. Puc, Matthew H. Kulked, Kashi Javaheriana, David Zurakowskie,f, Judah M. Folkmana,2, and Maria Rupnicka,b Divisions of aVascular Biology and cCardiology and Departments of eAnesthesia and fSurgery, Children’s Hospital Boston, Harvard Medical School, Boston, MA 02115; bDivision of Cardiovascular Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and dDepartment of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215 Edited by Robert Langer, Massachusetts Institute of Technology, Cambridge, MA, and approved May 28, 2012 (received for review April 2, 2012) Antiangiogenesis therapy has become a vital part of the arma- control. VEGF stimulates endothelial NO synthase (eNOS), mentarium against cancer. Hypertension is a dose-limiting toxicity resulting in NO production and lower BP (21, 22). Inhibiting for VEGF inhibitors. Thus, there is a pressing need to address the VEGF in animal studies reduces eNOS expression, leading to associated adverse events so these agents can be better used. The vasoconstriction and hypertension (23). In patients, VEGF in- hypertension may be mediated by reduced NO bioavailability fusion causes rapid NO release and hypotension (24). resulting from VEGF inhibition. We proposed that the hyperten- Endostatin (ES), a fragment of collagen XVIII on chromosome sion may be prevented by coadministration with endostatin (ES), 21, is an endogenous angiogenesis inhibitor (25, 26). This 183- an endogenous angiogenesis inhibitor with antitumor effects amino acid fragment causes tumor regression in a number of shown to increase endothelial NO production in vitro.
    [Show full text]