GATA6 Is a Regulator of Sinus Node Development and Heart Rhythm

Total Page:16

File Type:pdf, Size:1020Kb

Load more

GATA6 is a regulator of sinus node development and heart rhythm Lara Gharibeha, Abir Yamaka,b,1, Jamieson Whitcomba,1, Aizhu Luc, Mathieu Joyala, Hiba Komatia, Wenbin Liangc, Céline Fisetd,e, and Mona Nemera,2 aMolecular Genetics and Cardiac Regeneration Laboratory, Department of Biochemistry, Microbiology, and Immunology, University of Ottawa, Ottawa, ON, Canada K1H 8M5; bCardiovascular Research Center, Harvard Medical School, Boston, MA 02115; cCardiovascular Electrophysiology Laboratory, University of Ottawa Heart Institute, University of Ottawa, Ottawa, ON, Canada K1Y 4W7; dResearch Center, Montreal Heart Institute, Montreal, QC, Canada H1T 1C8; and eFaculty of Pharmacy, Université de Montréal, Montréal, QC, Canada H3T 1J4 Edited by Christine E. Seidman, Howard Hughes Medical Institute, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, and approved October 19, 2020 (received for review April 16, 2020) The sinus node (SAN) is the primary pacemaker of the human heart, reported in several cases of familial AF (8, 9). The mutations and abnormalities in its structure or function cause sick sinus frequently lead to loss of function, but gain of function mutations syndrome, the most common reason for electronic pacemaker have also been found. Analysis of mice lacking a Tbx5 or an implantation. Here we report that transcription factor GATA6, whose Nkx2.5 allele confirmed that decreased levels of these TFs is mutations in humans are linked to arrhythmia, is highly expressed in sufficient to produce conduction abnormalities, including AV the SAN and its haploinsufficiency in mice results in hypoplastic SANs block (10). Decreased levels of another T-box family member, and rhythm abnormalities. Cell-specific deletion reveals a require- TBX3 in different regions of the developing heart, also leads to ment for GATA6 in various SAN lineages. Mechanistically, GATA6 lethal arrythmias (11). TBX5 and NKX2.5 cooperatively activate directly activates key regulators of the SAN genetic program in con- transcription of several genes important for cardiac conduction, duction and nonconduction cells, such as TBX3 and EDN1, respec- including connexin 40 (Cx40) and the DNA-binding protein in- tively. The data identify GATA6 as an important regulator of the hibitor Id2 (10, 12). In cardiomyocytes, TBX5 and NKX2.5 also SAN and provide a molecular basis for understanding the conduction interact with GATA4 (13, 14); mutations in GATA4 are found in abnormalities associated with GATA6 mutations in humans. They association with human AF, and GATA4 was shown to regulate also suggest that GATA6 may be a potential modifier of the conduction genes such as Cx40 and Cx30.2 (15). DEVELOPMENTAL BIOLOGY cardiac pacemaker. A role for GATA6 in CCS regulation was first suggested by the finding that an enhancer region upstream of the Gata6 pro- GATA proteins | sinus node | cardiac conduction system | TBX3 | moter is specifically active in the AV conduction system (16). The heart development presence of GATA6 in the ventricular CCS was subsequently confirmed, and its contribution to AV development and function he cardiac conduction system (CCS) consists of muscle cells was inferred from analysis of mice with myocardial-specific dele- Tand conducting fibers that ensure the initiation of the im- tion of its carboxyl zinc finger domain using Mlc2v-cre (17). In this pulse and its propagation throughout the heart. The CCS is com- model, a truncated GATA6 protein containing the N-terminal posed of the sinus node (SAN), known as the pacemaker of the activation domain and the first zinc finger can still be produced heart since it generates the electrical impulse, and the atrioven- and retains the ability to bind GATA sites and interact with known tricular node (AVN), the His or atrioventricular bundle (AV GATA cofactors. Of note, the mutant protein was restricted to bundle), and the Purkinje fibers, which propagate the signal to the MLC2V-expressing myocytes, while intact GATA6 is expressed in ventricular myocytes (1). Despite remarkable progress in the past atrial cells and in other cell types that may contribute to the decade, the cellular origins of the CCS components remain in- proximal CCS. completely elucidated. The SAN is thought to be composed mainly of secondary heart field cells derived from ISL1- and TBX18- Significance expressing cells (2), while the AVN and His bundle are thought to segregate from precursors of the working myocardium and are – GATA6 is a key regulator of sinus node (SAN) development. positive for transcription factors TBX2 and NKX2.5 (3 5). Loss of one Gata6 allele disrupts patterning and size of the Abnormalities affecting the generation or propagation of the SAN. GATA6 plays cell autonomous as well as non-cell auton- electrical impulses lead to conduction defects ranging from be- omous functions in several cell types required for proper SAN nign to fatal arrhythmias. Impaired impulse generation in the development and function. Haploinsufficiency of Gata6 in mice SAN causes sick sinus syndrome (SSS), manifesting as sinus leads to electrophysiological alterations and increases suscep- pause/arrest or bradycardia. Blockage of the impulse conduction tibility to develop arrhythmias. GATA6 is critical for pacemaker to the AVN or Purkinje fibers results in atrioventricular block. In cell differentiation and cardiac conduction. humans, atrial fibrillation (AF), a condition involving a rapid and irregular cardiac rhythm, is the most common type of arrhyth- Author contributions: L.G. and M.N. designed research; L.G., A.Y., J.W., A.L., and M.J. mia, affecting 2.7 million individuals in the United States alone performed research; W.L. and C.F. contributed new reagents/analytic tools; L.G., A.Y., (6). Its frequency increases with aging, and it occurs in isolation J.W., A.L., M.J., H.K., W.L., C.F., and M.N. analyzed data and interpreted results; L.G. or in association with other complications such as dementia, and M.N. wrote the paper. stroke, and heart failure (7). Atrial fibrillation can be triggered The authors declare no competing interest. by alterations in atrial electrophysiology or calcium handling, This article is a PNAS Direct Submission. genetic factors, and contractile and structural remodeling in the This open access article is distributed under Creative Commons Attribution-NonCommercial- heart that increase with aging. Human genetic studies as well as NoDerivatives License 4.0 (CC BY-NC-ND). analysis of genetically modified mouse models have identified 1A.Y. and J.W. contributed equally to this work. several genes encoding critical cardiac transcription factors (TFs) 2To whom correspondence may be addressed. Email: [email protected]. that contribute to rhythm regulation disturbances. For example, This article contains supporting information online at https://www.pnas.org/lookup/suppl/ mutations in the GATA family of TFs (GATA4/5/6), the T-box doi:10.1073/pnas.2007322118/-/DCSupplemental. factor TBX5, and the homeodomain protein NKX2.5 have been Published December 28, 2020. PNAS 2021 Vol. 118 No. 1 e2007322118 https://doi.org/10.1073/pnas.2007322118 | 1of11 Downloaded by guest on October 2, 2021 To determine the contribution of GATA6 to the CCS, we such as atrial dilation and impaired ventricular function are analyzed CCS structure and function in mice haploinsufficient common in patients with chronic AF (19). We previously reported for Gata6. We found that loss of one Gata6 allele leads to that adult mice with 50% reduction in GATA6 have reduced left electrophysiological alterations and increased susceptibility to ventricular function as assessed by echocardiography, and several arrhythmias. Furthermore, hypocellularity and reduction in display a dilated right atrium (RA) and right ventricle (20). As +/− HCN4+/TBX3+ conduction cells marked the SAN of Gata6 shown in Fig. 2 A and B, these structural defects are evident at mice. Cell-specific deletion of Gata6 revealed its requirement birth. Further examination of Masson trichrome–stained sections +/− in different cell types that contribute to SAN development and revealed a hypoplastic SAN with fewer myocytes in all Gata6 CCS function, namely, conduction, second heart field (SHF), neonates compared to control littermates (Fig. 2C). To determine and endothelial cells. The results support a key function for whether this phenotype is associated with differentiation defects, GATA6 in pacemaker cell differentiation and in cardiac con- expression of key atrial and CCS markers and regulators, including duction. They also suggest that GATA6 may be an arrhythmia- NKX2.5, TBX5, ANP, and HCN4, was examined. Maintenance of causing or -modifying gene. the SAN and atrial identities involves transcriptional repression of atrial and SAN genes, respectively. For example, TBX3 represses Results the ANP gene in the SAN, while in the adjacent atrial myocar- Loss of One Allele of Gata6 in Mice Results in Electrocardiogram dium, NKX2.5 activates ANP and represses HCN4 and TBX3, as Alterations and Hypoplastic SAN. A surface electrocardiogram evidenced by ectopic expression of TBX3 and HCN4 in the em- +/− +/− (ECG) was performed on Gata6 and control littermates to bryonic myocardium of Nkx2.5 null mice (1). In Gata6 mice, assess whether these mice display any electrophysiological ab- NKX2.5 and TBX5 were up-regulated in the SAN relative to normalities. The ECG profiling showed significant increases in control littermates (Fig. 2 D, Top and Bottom). Interestingly, ANP +/− both PR segment and QT
Recommended publications
  • Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells

    Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells

    The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells.
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By

    UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By

    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
  • Contribution of Enhancer-Driven and Master-Regulator Genes to Autoimmune Disease Revealed Using Functionally Informed SNP-To-Gene Linking Strategies Kushal K

    Contribution of Enhancer-Driven and Master-Regulator Genes to Autoimmune Disease Revealed Using Functionally Informed SNP-To-Gene Linking Strategies Kushal K

    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.02.279059; this version posted March 31, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Contribution of enhancer-driven and master-regulator genes to autoimmune disease revealed using functionally informed SNP-to-gene linking strategies Kushal K. Dey1, Steven Gazal1, Bryce van de Geijn 1,3, Samuel Sungil Kim 1,4, Joseph Nasser5, Jesse M. Engreitz5, Alkes L. Price 1,2,5 1 Department of Epidemiology, Harvard T. H. Chan School of Public Health, Boston, MA, USA 2 Department of Biostatistics, Harvard T.H. Chan School of Public Health, Boston, MA 3 Genentech, South San Francisco, CA 4 Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA 5 Broad Institute of MIT and Harvard, Cambridge, MA, USA Abstract Gene regulation is known to play a fundamental role in human disease, but mechanisms of regulation vary greatly across genes. Here, we explore the con- tributions to disease of two types of genes: genes whose regulation is driven by enhancer regions as opposed to promoter regions (Enhancer-driven) and genes that regulate many other genes in trans (Master-regulator). We link these genes to SNPs using a comprehensive set of SNP-to-gene (S2G) strategies and apply stratified LD score regression to the resulting SNP annotations to draw three main conclusions about 11 autoimmune diseases and blood cell traits (average Ncase=13K across 6 autoimmune diseases, average N=443K across 5 blood cell traits).
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
  • Accompanies CD8 T Cell Effector Function Global DNA Methylation

    Accompanies CD8 T Cell Effector Function Global DNA Methylation

    Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
  • Negative Regulators of Colonic Peripheral Regulatory T Cell Development Teresa Lei Ai Washington University in St

    Negative Regulators of Colonic Peripheral Regulatory T Cell Development Teresa Lei Ai Washington University in St

    Washington University in St. Louis Washington University Open Scholarship Arts & Sciences Electronic Theses and Dissertations Arts & Sciences Spring 5-15-2018 Negative Regulators of Colonic Peripheral Regulatory T Cell Development Teresa Lei Ai Washington University in St. Louis Follow this and additional works at: https://openscholarship.wustl.edu/art_sci_etds Part of the Allergy and Immunology Commons, Immunology and Infectious Disease Commons, and the Medical Immunology Commons Recommended Citation Ai, Teresa Lei, "Negative Regulators of Colonic Peripheral Regulatory T Cell Development" (2018). Arts & Sciences Electronic Theses and Dissertations. 1509. https://openscholarship.wustl.edu/art_sci_etds/1509 This Dissertation is brought to you for free and open access by the Arts & Sciences at Washington University Open Scholarship. It has been accepted for inclusion in Arts & Sciences Electronic Theses and Dissertations by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected]. WASHINGTON UNIVERSITY IN ST. LOUIS Division of Biology and Biomedical Sciences Immunology Dissertation Examination Committee: Chyi-Song Hsieh, Chair Paul M. Allen Kenneth M. Murphy Gwendalyn J. Randolph Wayne M. Yokoyama Negative Regulators of Colonic Peripheral Regulatory T Cell Development By Teresa Lei Ai A dissertation presented to The Graduate School of Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy May 2018 St. Louis, Missouri
  • Evolutionarily Conserved Tbx5–Wnt2/2B Pathway Orchestrates Cardiopulmonary Development

    Evolutionarily Conserved Tbx5–Wnt2/2B Pathway Orchestrates Cardiopulmonary Development

    Evolutionarily conserved Tbx5–Wnt2/2b pathway orchestrates cardiopulmonary development Jeffrey D. Steimlea,b,c, Scott A. Rankind,e,f,g, Christopher E. Slagleh,i,j,k, Jenna Bekenya,b,c, Ariel B. Rydeena,b,c, Sunny Sun-Kin Chanl,m, Junghun Kweona,b,c, Xinan H. Yanga,b,c, Kohta Ikegamia,b,c, Rangarajan D. Nadadura,b,c, Megan Rowtona,b,c, Andrew D. Hoffmanna,b,c, Sonja Lazarevica,b,c, William Thomasn,o, Erin A. T. Boyle Andersonp, Marko E. Horbn,o, Luis Luna-Zuritaq,r, Robert K. Hom, Michael Kybal,m, Bjarke Jensens, Aaron M. Zornd,e,f,g, Frank L. Conlonh,i,j,k, and Ivan P. Moskowitza,b,c,1 aDepartment of Pediatrics, University of Chicago, Chicago, IL 60637; bDepartment of Pathology, University of Chicago, Chicago, IL 60637; cDepartment of Human Genetics, University of Chicago, Chicago, IL 60637; dCenter for Stem Cell and Organoid Medicine, Cincinnati Children’s Research Foundation, Cincinnati, OH 45229; eDepartment of Pediatrics, College of Medicine, University of Cincinnati, Cincinnati, OH 45229; fDivision of Developmental Biology, Perinatal Institute, Cincinnati Children’s Research Foundation, Cincinnati Children’s Hospital Medical Center, University of Cincinnati, Cincinnati, OH 45229; gDepartment of Pediatrics, College of Medicine, University of Cincinnati, Cincinnati, OH 45229; hDepartment of Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599; iDepartment of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599; jIntegrative Program for Biological and Genome Sciences, University of North
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • The Role of Tbx5 in Sinoatrial Node Differentiation in Mouse Embryonic Stem Cell Derived Cardiomyocytes Yunkai Dai Clemson University, Yunkaidai@Gmail.Com

    The Role of Tbx5 in Sinoatrial Node Differentiation in Mouse Embryonic Stem Cell Derived Cardiomyocytes Yunkai Dai Clemson University, [email protected]

    Clemson University TigerPrints All Dissertations Dissertations May 2019 The Role of Tbx5 in Sinoatrial Node Differentiation in Mouse Embryonic Stem Cell Derived Cardiomyocytes Yunkai Dai Clemson University, [email protected] Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Recommended Citation Dai, Yunkai, "The Role of Tbx5 in Sinoatrial Node Differentiation in Mouse Embryonic Stem Cell Derived Cardiomyocytes" (2019). All Dissertations. 2377. https://tigerprints.clemson.edu/all_dissertations/2377 This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected]. THE ROLE OF TBX5 IN SINOATRIAL NODE DIFFERENTIATION IN MOUSE EMBRYONIC STEM CELL DERIVED CARDIOMYOCYTES A Dissertation Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Bioengineering by Yunkai Dai May 2019 Accepted by: Dr Ann Foley, Committee Chair Dr Agneta Simionescu Dr Robin C. Muise-Helmericks Dr Ying Mei ABSTRACT The sinoatrial node of the mouse embryo arises from the wall of the right atrium near the border of the sinus venosus. Early in development this region expresses the transcription factor Tbx5. Because of this, Tbx5 is thought to sit at the apex of a transcriptional cascade leading to sinoatrial node (SAN) differentiation. To test this we produced a mouse embryonic stem cell line B1 (pTripZ-mTbx5; αMHC::GFP) that conditionally overexpresses Tbx5, to determine if this would lead to enhanced SAN differentiation. We found that ES cells overexpressing Tbx5 showed enhanced overall cardiac differentiation and that cardiac cells showed increased beat rates as compared control embryos.
  • Construction of a Cerna Network Combining Transcription Factors in Eutopic Endometrial Tissue of Tubal Factor Infertility and Endometriosis-Related Infertility

    Construction of a Cerna Network Combining Transcription Factors in Eutopic Endometrial Tissue of Tubal Factor Infertility and Endometriosis-Related Infertility

    Construction of a ceRNA network combining transcription factors in eutopic endometrial tissue of tubal factor infertility and endometriosis-related infertility Junzui Li ( [email protected] ) Xiamen University https://orcid.org/0000-0002-6640-8215 Lulu Ren Xiamen University Medical College Cui Yang Xiamen University Medical College Rongfeng Wu Xiamen University Medical College Zhixiong Huang Xiamen University School of Life Sciences Qionghua Chen Xiamen University Medical College Research article Keywords: TFI, endometriosis-related infertility, DEGs, ceRNA network, TFs Posted Date: December 19th, 2019 DOI: https://doi.org/10.21203/rs.2.19312/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/27 Abstract Purpose Although tubal factor infertility (TFI) and endometriosis-related infertility all can result in female infertility, the pathogenesis of TFI and endometriosis-related infertility were different. The pathophysiologic mechanisms of TFI and endometriosis-related infertility have not been investigated thoroughly. Thus, the aim of the study is to identify the potential crucial genes, pathways, transcription factors (TFs) and long non-coding RNAs (lncRNAs) associated with TFI and endometriosis-related infertility, and further analyze the molecular mechanism implicated in genes. Methods 3 patients with TFI and 3 patients with endometriosis-related infertility were recruited, and microarray hybridization of the eutopic endometrial tissue during the window of implantation (WOI) was performed to examine the expression of mRNAs and lncRNAs. First, differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) were screened out based on P < 0.05 and fold change (FC) ≧ 2. Second, gene ontology, pathway and TFs enrichment analyses and PPI network construction of DEGs were performed.
  • A Sox2 Distal Enhancer Cluster Regulates Embryonic Stem Cell Differentiation Potential

    A Sox2 Distal Enhancer Cluster Regulates Embryonic Stem Cell Differentiation Potential

    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press A Sox2 distal enhancer cluster regulates embryonic stem cell differentiation potential Harry Y. Zhou,1,3 Yulia Katsman,1,3 Navroop K. Dhaliwal,1 Scott Davidson,1 Neil N. Macpherson,1 Moorthy Sakthidevi,1 Felicia Collura,1 and Jennifer A. Mitchell1,2 1Department of Cell and Systems Biology, University of Toronto, Toronto, Ontario M5S 3G5, Canada; 2Center for the Analysis of Genome Evolution and Function, University of Toronto, Toronto, Ontario M5S 3G5, Canada The Sox2 transcription factor must be robustly transcribed in embryonic stem (ES) cells to maintain pluripotency. Two gene-proximal enhancers, Sox2 regulatory region 1 (SRR1) and SRR2, display activity in reporter assays, but deleting SRR1 has no effect on pluripotency. We identified and functionally validated the sequences required for Sox2 transcription based on a computational model that predicted transcriptional enhancer elements within 130 kb of Sox2. Our reporter assays revealed three novel enhancers—SRR18, SRR107, and SRR111—that, through the formation of chromatin loops, form a chromatin complex with the Sox2 promoter in ES cells. Using the CRISPR/ Cas9 system and F1 ES cells (Mus musculus129 3 Mus castaneus), we generated heterozygous deletions of each enhancer region, revealing that only the distal cluster containing SRR107 and SRR111, located >100 kb downstream from Sox2, is required for cis-regulation of Sox2 in ES cells. Furthermore, homozygous deletion of this distal Sox2 control region (SCR) caused significant reduction in Sox2 mRNA and protein levels, loss of ES cell colony morphology, genome-wide changes in gene expression, and impaired neuroectodermal formation upon spontaneous differentiation to embryoid bodies.
  • In Situ Detection of Tbx5 Expression in Developing Chick Embryonic Heart

    In Situ Detection of Tbx5 Expression in Developing Chick Embryonic Heart

    San Jose State University SJSU ScholarWorks Master's Theses Master's Theses and Graduate Research Fall 2010 In Situ Detection Of Tbx5 Expression In Developing Chick Embryonic Heart Vaishali Agarwal San Jose State University Follow this and additional works at: https://scholarworks.sjsu.edu/etd_theses Recommended Citation Agarwal, Vaishali, "In Situ Detection Of Tbx5 Expression In Developing Chick Embryonic Heart" (2010). Master's Theses. 3901. DOI: https://doi.org/10.31979/etd.84mn-c4vy https://scholarworks.sjsu.edu/etd_theses/3901 This Thesis is brought to you for free and open access by the Master's Theses and Graduate Research at SJSU ScholarWorks. It has been accepted for inclusion in Master's Theses by an authorized administrator of SJSU ScholarWorks. For more information, please contact [email protected]. IN SITU DETECTION OF Tbx 5 EXPRESSION IN DEVELOPING EMBRYONIC CHICK HEART A Thesis Presented to The Faculty of the Department of Biological Sciences San Jose State University In Partial Fulfillment of the Requirements for the Degree Master of Science by Vaishali Agarwal December 2010 © 2010 Vaishali Agarwal ALL RIGHTS RESERVED The Designated Thesis Committee Approves the Thesis Titled IN SITU DETECTION OF Tbx 5 EXPRESSION IN DEVELOPING EMBRYONIC CHICK HEART by Vaishali Agarwal APPROVED FOR THE DEPARTMENT OF BIOLOGICAL SCIENCES SAN JOSE STATE UNIVERSITY December 2010 Dr. Steven White Department of Biological Sciences Dr. Michael Sneary Department of Biological Sciences Dr. Bob Fowler Department of Biological Sciences ABSTRACT IN SITU DETECTION OF Tbx 5 EXPRESSION IN DEVELOPING EMBRYONIC CHICK HEART by Vaishali Agarwal The Tbx 5 gene codes for a highly conserved transcription factor containing a DNA-binding motif called the T box (or T-domain).