Preclinical Exploration of Novel Small Molecules As Anticancer Agents in Triple-Negative and HER2/Neu-Positive Breast Cancers DISSERTATION

Preclinical exploration of novel small molecules as anticancer agents in triple-negative and HER2/neu-positive breast cancers DISSERTATION

Presented in Partial Fulfillment of the requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

By Shu-Chuan Weng, B.V.M., M.S. ***** The Ohio State University 2008

Approved by Dissertation Committee: Professor Ching-Shih Chen, Advisor Professor Robert W. Brueggemeier Adviser Professor Pui-Kai (Tom) Li Graduate Program in Professor Mike Xi Zhu Pharmacy

Breast cancer is the second leading cause of cancer death among women in the

United States and will result in an estimated 40,480 deaths in 2008, according to the

National Cancer Institute (NCI’s SEER Cancer Statistics Review). Three major subtypes of breast cancer (basal-like, HER2+/ER-, and luminal) that have contrary prognosis have been identified by gene expression studies. Comparing two hormone receptor–negative subtypes (basal-like and HER2+/ER-) with the hormone receptor– high luminal group, these two subtypes of breast cancer patients are associated with aggressive disease progression and poor clinical outcome. Thus, we are interested in developing new regimens against hormone receptor-negative breast cancers with the intention of extending survival of patients.

The efficacy and mechanism of two novel small molecules (OSU-03012 and

OSU-HDAC42) in against triple-negative and HER2/neu-positive breast cancers were investigated in this thesis. First, we demonstrated that PDK-1/Akt signaling represents a therapeutically relevant target to sensitize ER-negative breast cancer to tamoxifen by lowering the threshold for tamoxifen’s ER-independent pro-apoptotic effect both in vitro and in vivo . Thus, this experimental regimen could benefit the triple-negative patients who have limited choices in treatment. Second, we identified that HER degradation effect of celecoxib derivatives is through autophagy pathway evidenced by MDC staining and LAMP-2 staining. The role for drug-induced autophagic down-regulation of HER2 in mediating the antiproliferative effects of these compounds in cancer cells was supported by the attenuation of anti-proliferation

ii effect in autophagy inhibitor co-treated cells. Since the mechanistic study suggests that hsp90 is the main target for OSU-03012-induced HER2 down-regulation, a fluorescent polarization assay was established to find more potent compounds from existing OSU-03012 library. Both biochemical assays and computer simulation support T1A-10 and T3-1 as better candidates for developing new generation hsp90 inhibitors. Third, we investigated the effects of various HDAC inhibitors toward the regulation of HER2 and ER α expression and cell viability in different types of breast cancer cells. Our data show that OSU-HDAC42, a novel phenylbutyrate-derived

HDAC inhibitor, exerts a more potent suppressive effect on the expression levels of

Hsp90 client proteins (HER2, ER α and Akt) than suberoylanilide hydroxamic acid

(SAHA; vorinostat) and MS-275, as well as anti-proliferation activity in various cell line.

iii

Dedicated to all the cancer fighters, especially to my father

iv ACKNOWLEDGEMENT

Just like Dr. Chen has always said, the relationship by fate, it has brought me here to United State to join this big Chen family. I have completed this voyage with a lot of gratitude that I would like to express. It was Dr. Chen who offered me this great opportunity to fulfill my dream while I was in the intersection of my life.

During these four years, he has not only helped me to develop my independency on research with fully support, but also with his wife, Dr. Shieh together have always make us feel that homes are not thousands of miles away. The inspiration that Dr.

Geen-Dong Chang gave me helped me across the hindered of my research. Dr.

Samuel Kulp, thank you for the guidance on research execution and writing. Also, I thank Dr. Pui-Kai Li, Mike Xi Zhu and Robert W. Brueggemeier for the precious options and helps that they have provided. Dr. Alan Bakaletz from microscope lab in

Davis heart and lung center, I really appreciate his instructions on image process, which plays an important role in my research. I would like to thank Dr. Yoko Kashida and Eric Wu for all the efforts they have made for data I have shown in this thesis.

I am very luck to work with Dr. Wang, Aaron, Chen-Hsun and Jack in room

346. Besides the helps they offered academically, they have created a joyful and peaceful working environment for these pass four years. Also, all the lab mates in room 323, Jessie, Joseph, Hany, Jack Lee and Jay, I can’t say enough to thank you guys for the tremendous jobs that you have done to keep the main lab running. All the previous members, Yating, Ping-Hui, Jui-Wen, Chung-Wai, and Arthur, thanks for helping me to settle down and letting me never feel lonely during my first year. My

v BFF, Sharon, I still remember how you helped me to move the mattress, and all the fun times we had. My another BFF Lin Yen back in Taiwan, thank you for always cheering me up in each step of my life.

My deeply appreciation goes to the woman who brought me into this world, raised me and has always believed in me. She has always taught me to be independent, get education and seek for my career; whereas, I can’t remember how many times people said to me that woman should just get marry and be a trophy wife.

It was not easy for my mom giving birth for three girls with no boy at that era in

Taiwan, and I hope that my little achievement has made her proud. I also would like to thank my sisters, who share my responsibility as a daughter to take care our ill father, allowing me to continue my study with less worry. Finally, to my beloved husband, thank you for accepting who I am, respecting what I want to be, and supporting me regardless any circumstance. I just want to let you know “I have always known how luck I am”.

vi VITA

1989-1995 Bachelor of Veterinary Medicine National Chaiyi University, Chaiyi, Taiwan

1996-1997 Veterinarian for companion animals Beiping companion animal hospital, Kaohsiung, Taiwan

1997-1999 Master of Science Department of Veterinary Medicine, National Taiwan University, Taipei, Taiwan

1999-2004 Assistant Investigator Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan

2004-current Graduate student, Research Associate Division of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, The Ohio State University, USA

PUBLICATIONS

1. Weng SC , Kashida Yoko, Kulp SK, Wang DS, Brueggemeier RW, Shapiro CL, Chen CS: Sensitizing Estrogen Receptor-Negative Breast Cancer Cells to Tamoxifen with OSU-03012, a Novel Celecoxib-Derived Phosphoinositide- Dependent Protein Kinase-1/Akt Signaling Inhibitor. Mol Cancer Ther, 7(4): 800-7, 2008.

2. Tseng PH, Wang, YC, Weng SC, Weng JR, Chen CS, Brueggemeier RW, Shapiro CL, Chen CY, Dunn SE, Pollak M, Chen CS. Overcoming Trastuzumab Resistance in Breast Cancer Cells by Using a Novel Celecoxib- Derived PDK-1 Inhibitor. Mol Pharmacol, 70(5): 1534-41, 2006.

3. Chen CS, Weng SC , Tseng PH, Lin HP, Chen CS. Histone acetylation-independent effect of histone deacetylase inhibitors on Akt through the reshuffling of protein phosphatase 1 complexes. J Biol Chem. 280(46): 38879-87, 2005

4. Hung KS, Hong CY, Lee J, Lin SK, Huang SC, Wang TM, Tse V, Sliverberg GD, Weng SC , Hsiao M. Expression of p16(INK4A) induces dominant suppression of glioblastoma growth in situ through necrosis and cell cycle arrest. Biochem Biophys Res Commun. 269(3):718-25, 2000

vii 5. Weng SC , Lin WH, Chang YF, Chang CF. Identification of a virulence-associated protein homolog gene and ISRa1 in a plasmid of Riemerella anatipestifer . FEMS Microbiology Letters. 179(1):11-19, 1999

FIELDS OF STUDY Major Field: Pharmacy

viii TABLE OF CONTENTS Abstract…………………………………………………………………………...…...ii Acknowledgement…………………………………………………………………….v Vita…………………………………………………………………………………...vii Table of content…………………………………………………………………... ….ix List of tables………………………………………………………………………….xii List of Figures…………………………………………………………………….....xiii

Chapter 1: Introduction…………………………………………...... …………...1 1.1 Molecular subtypes and prognostic outcomes of breast cancer ……………….....1 1.2 The mechanisms of tamoxifen induced apoptosis through ER independent pathways…………………………………………………………………………...1 1.3 Actived ERBB receptors/PI3K/PDK-1/AKTpathway in cancer progression……………………………………………………………………...…2 1.4 Potential cancer therapeutic strategies of autophagy……………………………...3 1.5 Heat shock protein (Hsp) 90 inhibition in multiple signaling transduction pathways of tumor growth ………………………………………………………...4

Chapter 2: Sensitizing Estrogen Receptor-Negative Breast Cancer Cells to Tamoxifen with OSU-03012, a Novel Celecoxib-Derived Phosphoinositide- Dependent Protein Kinase-1/Akt Signaling Inhibitor……………………11 2.1 Introduction………………………………………………………………………13 2.2 Materials and Methods…………………………………………………………...15 2.2.1 Cells and reagents…………………………………………………………..15 2.2.2 Cell Culture………………………………………………………………...15 2.2.3 Cell Viability Analysis……………………………………………………...16 2.2.4 ER-Dependent Cell Proliferation Assay……………………………………16 2.2.5 Immunoblotting…………………………………………………………….17 2.2.6 Transfection and Detection of FOXO3a-GFP ……………………………..17 2.2.7 Flow Cytometric Analysis for Apoptosis…………………………………..18 2.2.8 In vivo studies………………………………………………………………18 2.2.9 Immunohistochemistry……………………………………………………..19 2.3 Results……………………………………………………………………………20 2.3.1 OSU-03012 Enhances the Antiproliferative Effect of Tamoxifen and 4- Hydroxytamoxifen in MCF-7 and MDA-MB-231 Cells…………………..20 2.3.2 OSU-03012 Sensitizes MCF-7 and MDA-MB-231 Cells to the Apoptotic Effects………………………………………………………………………22 2.3.3 Functional Role of Akt Inhibition in OSU-03012-Mediated Sensitization of Breast Cancer Cells to Tamoxifen………………………………………….23 2.3.4 In Vivo Efficacy of the Combination of Tamoxifen and OSU-03012 in a MDA-MB-231 Tumor Xenograft Model…………………………………..24 2.4 Discussion………………………………………………………………………..26

ix Chapter3: Autophagic Degradation of Human Epidermal Growth Factor Receptor 2 (HER2/ neu ) Induced by Celecoxib and its Derivative OSU-03012 through Hsp90- Mediated Mechanism………………………………………………………………...39 3.1 Introduction………………………………………………………………………41 3.2 Methods and Materials…………………………………………………………...43 3.2.1 Cells and reagents…………………………………………………………..43 3.2.2 Immunocytochemistry……………………………………………………...43 3.2.3 Biotin labeling assay………………………………………………….……44 3.2.3 Immunoblotting…………………………………………………………….45 3.2.4 Noninvasive ectodomain HER2 quantity assay……………………………45 3.2.5 Co-immunoprecipitation…………………………………………………...46 3.2.6 MDC staining………………………………………………………………46 3.2.7 PtdIns(3)P staining…………………………………………………………47 3.2.8 Inhibition of PDK-1 and Akt gene expression by siRNA………………….48 3.2.9 HSP90 ATP-binding assay…………………………………………………48 3.2.10 Computer Modeling………………………………………………………48 3.2.11 Cell lysate preparation for Fluorescence polarization assay……………...49 3.2.12 Ligand and binding buffer preparation……………………………………49 3.2.13 FP assay development and optimization………………………………….50 3.2.14 Competition FP assays……………………………………………………50 3.3 Results……………………………………………………………………………52 3.3.1 HER2/neu is internalized by celecoxib and OSU-03012 through PI3K/PDK- 1/Akt related pathway, COX-independently……………………………….52 3.3.2 Autophagy activation is essential for PI3K/PDK-1/Akt regulated ligand- independent HER2/neu endocytosis sorting to degradation pathway……..54 3.3.3 Celecoxib and OSU-03012 induce HER2 degradation and anti-proliferation through lysosome/autophagy pathway……………………………………..55 3.3.4 Hsp90 inhibition is required for HER2 degradation by celecoxib and OSU- 03012……………………………………………………………………….58 3.3.5 Development of new generation of Hsp90 inhibitors from existing OSU- 03012 library……………………………………………………………….59 3.3.6 Verification of the hsp90 FP assay hits……………………………………..60 3.4 Discussion..………………………………………………………………………62

Chapter4: Antitumor effects of histone deacetylase inhibitor, HDAC42 partly through Hsp90-mediated HER2 repression…………………………………………………...85 4.1 Introduction………………………………………………………………………86 4.2 Methods and Materials…………………………………………………………...88 4.2.1 Cells culture and reagents…………………………………………………..88 4.2.2 Cell Viability Analysis……………………………………………………...88 4.2.3 Immunoblotting…………………………………………………………….89 4.2.4 Immunoprecipitation……………………………………………………….89 4.3 Results……………………………………………………………………………91 4.3.1 OSU-HDAC42 inhibited cell proliferation of various breast cancer cell lines x with highest potency in HER2-overexpressed cells……………………….91 4.3.2 OSU-HDAC42 induced apoptosis in various breast cancer cell lines …….92 4.3.3 Treatment with HDAC inhibitors attenuated the expression levels of HER2 …………………………..…………………………………………………92 4.3.4 HDAC inhibitors induce hsp90 acetylation in HER2-overexpressed cell line………………………………………………………………………….93

Bibliography………………………………………………………………………...103

xi LIST OF TABLES

Table 3.1 The activity of OSU-derived hsp90 inhibitors in inhibiting the binding of GM-cy3B to tumor hsp90. The competitive effect was presented as percentage of control and was caculated by dividing the each specific binding mP (reducing free GM-cy3-B) value of inhibitor’s wells by the average mP from control; bars, ±SD ( n = 2-4)…………………………...80

xii LIST OF FIGURES

Figure Page

1.1 The molecular profiling and progronisis of breast cancer subtypes. A, the dendogram represent five subtypes of IDC clustered from 115 breast cancer tumors B, the clinical outcomes for each subtype of IDC are shown as overall survival………………………………………………………...……………....6

1.2 Tamoxifen-induced apoptosis through multiple modulations ……………..7

1.3 Tyrosine kinase receptor regulated PI3K/PDK-1/Akt pathway in cancer progression. ……………………………………………………………...….. 8

1.4 Small molecules that affect autophagy ...... 9

1.5 Hsp90’s client proteins are involved in multiple cancer progression pathways. A , Hsp90 clients associated with oncogenesis. B, Hsp90 clients involved in the six hallmarks of cancer. C, chemical structures of ATP- competitive hsp90 inhibitors…………………………………………..……..10

2.1 Sensitization of MCF-7 and MDA-MB-231 breast cancer cells to tamoxifen by OSU-03012 via an ER-independent mechanism. A, Upper panels, left , dose-dependent antiproliferative effects of OSU-03012 (OSU), tamoxifen (Tam), and 4-hydroxytamoxifen (4OH-T) on cell viability in MCF- 7 cells; ●, OSU; ♦, Tam; ■, 4OH-T; Center , dose-dependent effect of OSU- 03012 on the sensitivity of MCF-7 cells to the antiproliferative activity of tamoxifen; OSU-03012 doses (µM): ■, 0; ♦, 1; ▲, 2.5; ●, 5; Right , effect of OSU-03012 on the response of MCF-7 cells to the pure ER antagonist ICI 182780; OSU-03012 doses (µM): ■, 0; ▲, 5. Lower panels , same sets of experiments were carried out in MDA-MB-231 cells in lieu of MCF-7 cells. Cell viability was determined by the MTS assay as described in the Materials and Methods. Points , mean; bars , SD (n = 5). B, estradiol (E2) has no effect on OSU-03012-mediated sensitization of MCF-7 cells to the antiproliferative effect of tamoxifen (Tam). After 5 days of culture in the presence of 10% charcoal-stripped FBS, MCF-7 cells were seeded into 24-well culture plates (4 x 10 4 cells/well), treated as indicated in 5% charcoal-stripped FBS-containing medium for 72 h, and then harvested for counting of cell numbers as described in the Materials and Methods. Columns , mean; bar , SD (n = 3). C, Effect of OSU-03012, alone and in combination with tamoxifen, on ER α expression in MCF-7 cells. Cells were treated as indicated for 24 h. Immunoblotting was performed as described in the Materials and Methods……………...………..30

xiii 2.2 Annexin V flow cytometric analysis of apoptosis in MCF-7 and MDA- MB-231 cells receiving tamoxifen, OSU-03012, or the tamoxifen/OSU- 03012 combination. A, MCF-7 and MDA-MB-231 cells were treated tamoxifen or OSU-03012 individually or in combination at the indicated concentrations in 5% FBS-containing DMEM/F12 medium for 24 h, followed by Annexin V/propidium iodide staining as described in the Materials and Methods. Results are representative of two independent experiments. B, bar graphs representing the flow cytometry data presented in A above. Each bar represents the mean ± SD of two independent analyses. FL2-H, propidium iodide; FLH-1, annexin V……………………………………………..……..32

2.3 Effect of OSU-03012 on the intracellular localization of FOXO3a and expression levels of other FOXO proteins in MCF-7 and MDA-MB-231 cells. A, immunocytochemical analysis of the effect of OSU-03012 on the intracellular localization of GFP-tagged FOXO3a in MCF-7 and MDA-MB- 231 cells. Cells were treated with 5 µM OSU-03012 in 5% FBS-containing DMEM/F-12 medium for 8 h. The percentage of cells with GFP-positive nuclei was determined by fluorescence microscopy. Columns , mean; bar , SD (n = 3). B, Effect of OSU-03012, alone and in combination with tamoxifen, on the expression and phosphorylation status of FOXO protein family members in MCF-7 and MDA-MB-231 cells. Cells were treated as indicated for 24 h. Immunoblotting was performed as described in the Materials and Methods………………………………………………………………………34

2.4 Effect of tamoxifen, OSU-03012, and the tamoxifen/OSU-03012 combination on the phosphorylation status of Akt and its downstream effectors GSK3 α/β and p27 in MCF-7 and MDA-MB-231 cells. A, transient upregulation of Akt phosphorylation in MCF-7 and MDA-MB-231 cells treated with tamoxifen. Cells were exposed to tamoxifen at 2.5, 5, or 7.5 µM for the indicated times. Immunoblotting for p-Ser473-Akt and total Akt was performed as described in the Materials and Methods. B, dose-dependent effect of tamoxifen alone or in combination with 5 µM OSU-03012 on the phosphorylation status of Akt and its substrates GSK3 α/β and p27, and on PARP cleavage in MDA-MB-231 cells. The MAP kinase p38 was used as a negative control to demonstrate the specificity of Akt inhibition. MDA-MB- 231 cells were exposed to individual treatments for 8 h. Immunoblotting was performed as described in the Materials and Methods……………………….36

2.5 Effects of daily oral treatment with tamoxifen (60 mg/kg), OSU-03012 (100 mg/kg), and the tamoxifen/OSU-03012 combination (60 and 100 mg/kg, respectively) on the growth of established subcutaneous MDA- MB-231 tumors in ovariectomized female athymic nude mice. MDA-MB- 231 tumors were established in each mouse by subcutaneous injection of 5 × 10 5 MDA-MB-231 cells in a total volume of 0.1 mL of cold serum-free xiv medium containing 50% Matrigel. Mice with established tumors (starting mean tumor volume, 59 + 5 mm 3) were randomly assigned to four groups (n = 10-12) that received the indicated treatments once daily by oral gavage for the duration of the study as described in the Materials and Methods. A, mean tumor volumes for each treatment group as a function of day of treatment. Points , mean tumor volume; bars , SEM (n = 10-12). B, immunohistochemical evaluation of intratumoral proliferation in MDA-MB-231 xenograft tumors. Immunostaining for Ki67 in formalin-fixed, paraffin-embedded tumor tissues was performed, and proliferation indices were calculated as described in Materials and Methods. Left panel , Immunohistochemistry showing Ki67 expression (brown intranuclear staining) in MDA-MB-231 tumors from each treatment group. Tissues were counterstained with hematoxylin. Right panel , Proliferation indices in MDA-MB-231 tumors from each treatment group. Each bar represents the mean of five 400X fields ± SD. Tam, tamoxifen…………………………………………………………………….38

3.1 Celecoxib, OSU-03012 and LY294002 induce HER2 endocytosis. A, immunocytochemistry data showed that all three compounds have the ability to induce HER2 [21] internalization. Nucleuses were stained by DAPI (blue). Representative images represented cells at 24 hr after treatments and were captured by confocal microscope (upper panel). Biotin-labeling assay was conducted to measure the consequences of cell-surface HER2 after drugs treatment. The strepavidin pulled-down HER2 indicate the fate of cell surface HER2 after cell treated with indicated concentrations of various treatments. All the protein lysates were collected 6 hours after different treatments as indicated. The level of HER2 and phospho-Akt in total cell lysates was detected. The human β-actin was used as a loading control for western blot (bottom panel). B, total HER2, phospho-HER2 and phospho-Akt protein level were concomitantly down-regulated by celecoxib or OSU-03012 dose- dependently at 12 hours or 24 hours. As shown here, 2.5 µM OSU-03012 induced a greater decrease in HER-2 protein than 50µM celecoxib. C, flow cytometry ananlysis of ectodomain HER2. The intensity of surface HER-2 level is decreased by celecoxib and OSU-03012 dose-dependently at 12 hours. The plots are represented as percentage over control in the top-right panel. The numbers on each histogram represent the percentage of total cells with negative extracelluar HER-2 staining (M1) or positive staining (M2). D, celecoxib analogs accelerate HER2 endocytosis. Compounds treated cell were stained with HER2 (red) and transferrin receptor (green), antibodies. Bar: 10 µM. E, celecoxib or OSU-3012 induced HER2 ubiquitionation and adaptor protein association. Co-immunoprecipitation data showed that OSU-03012 caused HER-2 ubiquitination and increased its association with endocytic adaptor proteins (AP50/ µ2). All experiments were repeated two times…...... 68

xv 3.2 Autophgagy is crucial for PI3K/PDK-1/Akt regulated ligand-independent HER2/neu endocytosis sorting to degradation pathway. A, identification of early endosome (GST-2XFYVE) and late endosome (Rab7) synthesis. PI3P (labeled with GST-2XFYVE) and Rab7 (labeled with specific antibody) were used as markers of early and late endosomes, respectively. B, autophagosome staining. SKBR3 cells were seeded on cover slides overnight, and then treated with 50 µM-celecoxib, 5 µM-OSU-03012 and 20 µM-LY294002 for 1 hour in serum free medium following by monodensycardaverine (MDC) staining. C, the effect of autophagy inhibition on HER2 inhibitors. In presence of 5% serum, autophagy inhibitors, 3-methyladenine (10mM), wortmannin (100nM), vinblastine (1.5 µM), anisomycin (0.5 µg/ml) and cyclohexamide (50 µg/ml) were added 30 min before cells treated with 50 µM-celecoxib or 5 µM-OSU- 03012 for 6 hours prior to preparation of cell lysates and immunoblotting of HER2 and β-actin. All experiments were repeated three times…………..…70

3.3 Celecoxib and OSU-03012 induce drastic HER-2 endocytosis followed by LAMP2-lysosome degradation. A, lysosme associated membrane protein 1 (LAMP1) lysosomes staining. Compounds treated cell were stained with HER2 and LAMP1 (green) antibodies. B, lysosme associated membrane protein 2 (LAMP2) lysosomes staining. Compounds treated cell were stained with HER2 and LAMP2 (green) antibodies. All the images were captured under confoccal microscope (Zesis). Bar: 10 µM ……………………………72

3.4 Celecoxib and OSU-03012 induce HER2 degradation and antiproliferative effects via lysosome/autophagy pathway. A, inhibition of lysosomes formation prevents HER degradation by OSU-03012 and celecoxib. All autophagy/lysosome inhibitors, bafilomycin (Ba, 100 nanomol/L), folimycin (Fo, 1µg/ml) and chloroquine (Ch, 50 µmol/LM) were added 30 min before SKBR3 cells treated celecoxib or OSU-03012 for 12 hours prior to preparation of cell lysates and immunoblotting with HER2 antibody. The accumulation of 47 kDa pro-enzyme form of cathepsin D was assessed to confirm the efficacy of all lysosome inhibitors (middle panel). The human β- actin was used as a loading control for western blot. B, vacuoles formation under inverted microscope (Nikon). Many small vacuoles in cytoplsma were observed under daylight after cells treated with lysosme inhibitor, bafilomycin (upper). The formation of large and perinucleus located vacuoles in SKBR-3 cells were caused by OSU-03012 and celecoxib (middle). As a result of bafilomycin and OSU-03012 combination treatment, cells contain both populations of vacuoles (bottom). C, the fusion of HER2 compartments and LAMP2-positive lysosomes is blocking by bafilomycin was confirmed by immunofluorescent staining. Red signals represent HER2 receptors and green showed LAMP2-lysosomes. D, the effects of proteasome and calpain inhibition on HER2 degradation. The proteasome inhibitor, MG-132 (MG,

xvi 1µM), PSI (100 µM), or calpain I inhibitor, ALLN (10 µM) were added 30 min before SKBR3 cells treated celecoxib or OSU-03012 for 6 or 12 hours E, cell proliferation by MTT assay. Chloroquine (10 µM) was added 30 min before SKBR3 cells treated with celecoxib or OSU-03012 with indicated dosages for 24, and then cell proliferation was determined by MTT assay. Columns, mean; bars, ±SE (n=6, p<0.05)……………………………………………………...74

3.5 Hsp90 inhibition is essential for PI3K/PDK-1-mediated HER2 degradation. A, after 48 hours of PDK-1 siRNA transfection, sample of SKBR3 cells were collected and analyzed by immunoblotting (left panel) and immunocytochemiestry (right panel). B, SKBR3 cells treated with tumicamycin as indicated concentrations for 24 hours after cells transfected with PDK-1 siRNA for 48 hours. C, celcoxib or OSU-03102 inhibited cellular hsp90 activity. Left panel , the amount of ATP bond-hsp90 was decreased in celecoxib or OSU-03012-teated cells lysates compared to that of vehicle. 17- AAG here served as a positive control in inhibiting the ATP binding activity of hsp90. ATP-binding protein were pulled down by ATP-sepharose beads and detected by western blot. Total lysate and affinity-purified proteins (pulldown) were blotted for HSP90 α/β, HSP70, and β-actin. Right panel , the density of protein level in left panel was analyzed by gel-pro image software, then plotted by bar chart as percentage over control; Columns, mean; bars, ±SD ( n = 2-4). D, after 48 hours of PDK-1, hsp90 or hsp90+PDK-1 siRNA transfection, protein lysates of SKBR3 cells were collected and analyzed by immunoblotting using PDK-1 and hsp90 antibodies. β-actin severed as protein quantity control in every blot………………………………………………...76

3.6 High-throughput screening fluorescence polarization (FP) assay for tumor-specific Hsp90 inhibitors from OSU-03012 library. A, Upper panel , fluorescence tracer (GM-cy3B) was serially diluted in 384-well plate to generate 50 µL solutions in binding buffer. Total fluorescence intensity values of each ligand concentration were recorded and compared to that of buffer- only. Bottom panel , the polarization signal was recorded and average values plotted against ligand concentration. B, Dose-response curve for the binding of 50nM GM-cy3B to Hsp90 in SKBR3 cell or recombinant Hsp90. Upper panel , values collected at equilibrium (22 hours) was plotted against the amount of added SKBR3 cell lysate protein (0-10 µg). Bottom panel , data was generated against the amount of added Hsp90 recombinant protein. Scatchard and Hill plots were constructed according to each data. C, increasing concentrations of 17-AAG were added to the reaction buffer containing 50nM GM-cy3B and 0.75 µg SKBR3 cell lysate at a final volume of 50 µL in each well of 384-wells plate……………………………………………………….78

3.7 Effects of OSU-03012 derivatives on hsp90 inhibition and down-

xvii regulation of hsp90 client proteins. A, OSU-03102 derivatives inhibited hsp90 ATP-binding activity. Total lysate and affinity-purified proteins (ATP- sepharose pull-down) were analyzed by hsp90 α/β, HER2 and β-actin antibodies. B, interactions between potential hsp90 inhibitors and hsp90 α chaperone. The predicted docking of T1A-10 or T3-1 into the N-terminal of hsp90 α is demonstrated. The important amino acid residues interacted with compounds labeled with name and number in upper and middle panel. The N- terminal domain of hsp90 α structure (2VCI) is shown in ribbon form in bottom panel. The T1A-10 (upper panel), T3-1 (middle panel) and superimpose of T1A-10 and T3-1 (bottom panel) are presented as stick-and- ball structures, colored by atom types. Hydrogen bonds and distances for the interactions are indicated in green and dot lines. In the structures of T1A-10 and T3-1, gray is carbon; light blue is hydrogen; blue is nitrogen; red is oxygen; green is fluorine; and yellow represents sulfonamide (data provided by M.S. Su-Lin Lee)………………………………………………………….82

3.8 Target-selectivity of OSU-03012-derived hsp90 inhibitors. A, effects of OSU-03012 , T1A-10, T3-1 and 17-AAG on expression level of HER2, PDK- 1, ER α and Akt in breast cancer cells as determined by western blot. Cells were dosed with different compounds for 12 h (SKBR3) or 24 h (MCF-7) at various concentrations. β-actin was used as a loading control. The relative protein amount was normalized by dividing the ratio of HER2 versus β-actin or ER α versus β-actin in each sample against that of vehicle-control and presented underneath each lane. B , Upper panel , the effect of OSU-03012- derived hsp90 inhibitors on cell growth inhibition in different breast cancer cell lines. 2000 cells per 96-well were plated the day before treatments. After 120 hours, MTT assay was performed and cell viability charts were plotted as percentage of control and was calculated by dividing the absorbance values of inhibitors’ wells by the average absorbance from control. Points, mean; bars, ±SE ( n = 6). Bottom panel , IC50 of hsp90 inhibitors in various breast cancer cell lines was calculated and shown in table. C, CI values for cell death were determined in relation to the fraction affected using the medium dose analysis. CI values less than 1 are considered as a synergistic interaction. The combination concentrations of 17-AAG or OSU-derived hsp90 inhibitors are indicated above the points. The line indicates the CI value as 1……………..84

4.1 Antiproliferation effects of OSU-HDAC42, SAHA and MS-275 in four different breast cancer cell lines. A, chemical structures of OSU-HDAC42, SAHA and MS275. B, time- and dose-depepndent effects of OSU-HDAC42, SAHA and MS275 on cell viability in SKBR3, BT474, MDA-MB-231 and MCF-7 cells. Cells were exposed to OSU-HDAC42, SAHA or MS-275 at the indicated concentrations in 10% FBS-supplemented RPMI 1640 in 96-well plates for 24, 48, or 72 hours, and cell viability was assessed by MTT assay.

xviii Points, mean; bars, ±SE ( n = 6). C, effect of OSU-HDAC42 on the viability of HER2 over-expression cell line, SKBR3 in comparison to BT474, MCF-7 and MDA-MB-231. D, HER2, ER α, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7 and HDAC8 status of four human breast cancer cell lines: SKBR3 (HER2+, ER α-), BT474 (HER2+, ER α+), MCF-7 (HER-, ER α+) and MDA-MB-231 (HER2-, ER α-)………………………………….96

4.2 E ffects of OSU-HDAC42 versus SAHA or MS-275 on the different biomarkers associated with HDAC inhibition or apoptosis in different breast cancer cell lines. The cells were exposed to indicated concentrations of OSU-HDAC42, SAHA or MS275 in 10%-FBS containing DMEM/F12 medium for 24 hours. A, representative immunoblots of HER2 overexpression cell lines, SKBR3 and BT474. B, signals of p21, Acetyl-H3 and Acetyl-tubulin were quantitated by image analysis software and normalized against that of β-actin. Top panel , SKBR3. bottom panel , BT474. The data was extracted from A. C, representative immunoblots of HER2 negative cell lines, MCF-7 and MDA-MB-231……………………………...98

4.3 Effects of OSU-HDAC42 versus SAHA or MS-275 on protein expression levels of HER2, Akt1/2 and ER ααα in different breast cancer cell lines. The cells were exposed to indicated concentrations of OSU-HDAC42, SAHA or MS275 in 10%-FBS containing DMEM/F12 medium for 24 hours. A, representative immunoblots of HER2, Akt1/2 or ER α expression level in various breast cancer cell lines. B, signals of HER2, Akt1/2 or ER α were quantitated by image analysis software and normalized against that of β- actin..………………………………………………………………………..100

4.4 Effects of OSU-HDAC42 versus SAHA or MS-275 on hsp90 regulation. A, Cells were exposed to indicated concentrations of OSU-HDAC42, SAHA or MS275 in 10%-FBS containing DMEM/F12 medium for 24 hours. The hsp90 protein in cell lysate was pull-down and then level of acetyl-lysine or hsp90 was detected by immunoblotting. The representative immunoblots show the acetylation level of hsp90 and endogenous level of hsp90 in various breast cancer cell lines. B, dose-dependent effect of OSU-HDAC42 on hsp70 expression level. C, effect of proteasome (ALLN) or lysosome (Choloroquine) inhibitor on HER2 degradation causing by OSU-HDAC42. D, effect of ALLN on OSU-HDAC42 inducing ER α degradation……………………………...102

xix CHAPTER 1:

INTRODUCTION

1.1 Molecular subtypes and prognostic outcomes of breast cancer

Breast cancer is a heterogeneous disease that has diverse histopathologies, genetic and genomic variations resulting different outcomes. The gene expression profiling study showed that there are at least five subtypes of invasive ductal carcinoma (IDC) composed about 80% of all breast cancers. These include luminal

A, luminal B, HER2 positive, basal and normal breast-like subtype. The HER2- positive (ie. HER2+/ER-) and basal subtypes (ie. Triple negative; PR-/ER/-HER-) present the worst prognosis among these five subtypes, whereas luminal subtype

(ER+) shows the most favourable outcome (fig.1.1)[1, 2].

1.2 The mechanisms of tamoxifen induced apoptosis through ER independent

pathways.

Tamoxifen has been used to treat hormone response breast cancer patients for three decades with tolerable toxicity. It is well recognized that low concentration

(nanomolar) of tamoxifen causes cell growth arrest by decreasing growth-promoting genes transcription as a result of ER α inhibition. Whereas, tamoxifen also acts as an apoptosis inducer at high dosage (micromolar) through ER-independent mechanisms.

For instance, tamoxifen is able activate Protein Kinase C (PKC) by translocating PKC to membrane or mitochondria through activation of phospholipase C (PLC) and D. 1 The activated-PKC turns on its down-stream effector, pro-apoptotic mitogen- activated protein kinases (MAPK) family member JNK1 and then the action of tamoxifen on PKC leads cells go to apoptosis. The multiple non-ER mediating pathways, including, PKC, TGF-β, camodulin, c-myc, ceramide, MAP kinase, oxidative stress, mitochondrial permeability transition (MPT), and ceramide generation lead to apoptosis according to current reports are summarized in figure1.2

[3].

1.3 Actived ERBB receptors/PI3K/PDK-1/AKTpathway in cancer progression

. The abnormal activated ERBB receptor or epidermal growth factor receptor

(EGFR) is found in wide range of human tumors; therefore, they are suitable candidates for selective anticancer therapies. Activated ERBB receptors stimulate

PI3K/PDK-1/AKT pathway by recruiting class IA phosphatidylinositol 3-kinases

(PI3Ks) to phosphorylated tyrosine residues via the SRC-homology 2 (SH2) domains of p85 regulatory subunit , or the adaptor proteins IRS1 and IRS2. This action brings

PI3K in close proximity to its substrate at the plasma membrane and reverses the inhibitory action of p85 on the p110 catalytic subunit, which then is be able to convert phosphatidylinositol 4, 5-bisphosphate into phosphatidylinositol 3, 4, 5-trisphosphate in order to gather PDK-1 and AKT with pleckstrin homology regions. The contact of

AKT with PDK-1 triggers its activation as a result of phosphorylation at threonine308 and serine473 site, subsequently. This model of action can be reversed by several phosphatases, including phosphatase and tensin homologue deleted on chromosome ten (PTEN), SH2 domain-containing phosphatase (SHIP1/2) and protein phosphatase

2A (PP2A) by dephosphorylating PIP2 or PIP3.

The regulation of AKT on cell apoptosis and proliferation is mediated by 2 phosphorylating its down-stream effectors. For instance, forkhead family of transcription factors (FKHR), nuclear transcription factors that arouse the transcription of apoptotic proteins, such as Fas ligand, were negatively regulated by

AKT in order to prevent cells undergoing apoptosis via retaining FKHR in cytoplasm with 14-3-3 proteins. Besides transcriptional driven apoptosis, Akt also can phosphorylate apoptotic protein BAD and refurbish the anti-apoptotic function of Bcl-

2 and Bcl-xL on account of dissociation between BAD and Bcl-2/Bcl-xL. Glycogen synthase kinase 3(GSK3), p27 and mTOR regulate cell progression under the control of AKT. For example, AKT stabilizes cyclin D1 protein levels through down- regulation of GSK3 β that controls cyclin D1 degradation by ubiquitin-proteosomal degradation system. The contributions of all the down stream effectors in PI3K/PDK-

1/AKT to cancer cell progression make this pathway a perfect target for anti-cancer therapy. A brief summary of this pathway was shown in figure 1.3 [4].

1.4 Potential cancer therapeutic strategies of autophagy

Many lines of evidences sustain the susceptibility of cancers to autophagy induction. For example, Beclin 1, an autophagy induction gene is monoallelically deleted in 40–75% of sporadic human breast cancers and ovarian cancers [5]. Study has shown that Beclin 1 controls cellular proliferation of breast cancer cells, as well as clonigenicity and tumorigenesis in nude mice. Moreover, Beclin 1 has higher expression level in human normal breast versus breast carcinoma tissue [6]. On the other hand, autophagy induction might also serves as a cell defense mechanism when cancer cells encounter chemotherapeutic agents and thus autophagy blockers might be beneficial to certain chemotherapies.

Although the role of autophagy in cancer development is still controversial, some 3 autophagy-inducing agents are currently be used in clinical or clinical trails, such as rapamycin or tamoxifen. Conversely, the efficacy of chemo-combination therapy with chemotherapeutic agents and autophagy inhibitors is also under investigation.

These autophagy inhibitors are mainly block autophay by blocking autophagosome or autolysosome formation. The autolysosome inhibitors include vacuolar (V)-type

ATPase inhibitor such as bafilomycin A and lysomesome trapped agent, chloroquine.

They both result elevated lysosomal pH to prevent autophagosome fusion with lysosome. PI3K inhibitors, 3-methyladenine and wortmannin block autophagosome formation on account of lacking new Ptdlns(3)-phosphate synthesis. The small molecules that affect autophagy at different stages are shown in figure 1.4[7].

1.5 Heat shock protein (Hsp) 90 inhibition in multiple signaling transduction pathways of tumor growth

Hsp90 Heat shock protein (Hsp) 90 is a chaperone protein sustained the malignant transformation by keeping the appropriately folded and functionally active conformation of several oncoproteins. A number of reports have indicated that oncogenic kinases, such as HER2/neu, IGFR and Akt, as well as transcription factors, p53, steroid receptors (AR, ER) and Stat3 all need Hsp90 to maintain their stability and maturation (Fig.1.5A). In this regard, Hsp90 regulates tumor progression signaling transduction pathways including, apoptosis, growth signals invasion, metastasis and limitless replication through different oncogenic protein regulation

(Fig. 1.5B) [8].

The Hsp90 targeting therapy has been intensively investigated for several reasons. For instance, Hsp90 has lower dynamic in normal cell evidenced by its higher binding affinity with its co-chaperones, p23 and Hop in breast or colon tumor 4 tissue than that in normal tissue. Also, the IC 50 of binding affinity with 17-AAG was

6170 nM for normal breast versus 29 nM for breast carcinoma, explaining the selective of hsp90 inhibitors between normal and malignant cells [9]. To date, there are four main classes of ATP-competitive Hsp90 inhibitors including natural products; derivatives of geldanamycin and radicicol, synthesis small-molecules such as

BBII021 and NVP-AUY92217-AAG (Fig. 1.5C). Utilization of hsp90 inhibitor alone or in combination with other anti-cancer agents in both solid and hemotologic cancers treatment are undertaking in several clinical trails. Moreover, some HDAC inhibitors, such as LAQ824 or SAHA inhibits Hsp90 through hyperacetylation have been reported as the other way to control Hsp90 by epigenetic regulation [10, 11].

Fig. 1.1 The molecular profiling and progronisis of breast cancer subtypes. A, the dendogram represent five subtypes of IDC clustered from 115 breast cancer tumors B, the clinical outcomes for each subtype of IDC are shown as overall survival[12].

Fig. 1.2 Tamoxifen-induced apoptosis through multiple modulations[3].

(Nature Publishing Group Copyright)

Fig. 1.3 Tyrosine kinase receptor regulated PI3K/PDK-1/Akt pathway in cancer progression[4].

(Nature Publishing Group Copyright)

Fig. 1.4 Small molecules that affect autophagy[7].

9 Fig. 1.5 Hsp90’s client proteins are involved in multiple cancer progression pathways. A , Hsp90 clients associated with oncogenesis. B, Hsp90 clients involved in the six hallmarks of cancer. C, chemical structures of ATP-competitive hsp90 inhibitors.

CHAPTER2:

SENSITIZING ESTROGEN RECEPTOR-NEGATIVE BREAST CANCER

CELLS TO TAMOXIFEN WITH OSU-03012, A NOVEL CELECOXIB-

DERIVED PHOSPHOINOSITIDE-DEPENDENT PROTEIN KINASE-1/AKT

SIGNALING INHIBITOR

ABSTRACT

Tamoxifen is a mainstay in the treatment of estrogen receptor (ER)-positive breast cancer patients. While tamoxifen’s efficacy has been attributed to induction of tumor cell growth arrest and apoptosis by inhibition of ER signaling, recent evidence indicates that tamoxifen possesses ER-independent antitumor activities. Here, we use

OSU-03012, a small-molecule inhibitor of phosphoinositide-dependent protein kinase-1 (PDK-1) to address the hypothesis that PDK-1/Akt signaling represents a therapeutically relevant target to sensitize ER-negative breast cancer to tamoxifen.

OSU-03012 sensitized both ER-positive MCF-7 and ER-negative MDA-MB-231 cells to the antiproliferative effects of tamoxifen in an ER-independent manner. Flow cytometric analysis of phosphatidylserine externalization revealed that this augmented suppression of cell viability was attributable to a marked enhancement of tamoxifen- induced apoptosis by OSU-03012. Mechanistically, this OSU-03012-mediated sensitization was associated with suppression of a transient tamoxifen-induced elevation of Akt phosphorylation, and enhanced modulation of the functional status of multiple Akt downstream effectors, including FOXO3a, GSK3 α/β, and p27. The 11 growth of established MDA-MB-231 tumor xenografts was suppressed by 50% after oral treatment with the combination of tamoxifen (60 mg/kg) and OSU-03012 (100 mg/kg), whereas OSU-03012 and tamoxifen alone suppressed growth by 30% and

0%, respectively. These findings indicate that the inhibition of PDK-1/Akt signaling to sensitize ER-negative breast cancer cells to the ER-independent antitumor activities of tamoxifen represents a feasible approach to extending the use of tamoxifen to a broader population of breast cancer patients. Considering the urgent need for novel therapeutic strategies for ER-negative breast cancer patients, this combinatorial approach is worthy of continued investigation.

12 2.1 Introduction

Tamoxifen has been used extensively in the treatment of both advanced and early-stage estrogen receptor (ER)-positive breast cancers, and was recently approved as a chemopreventive agent for women at high-risk for breast cancer [13, 14] The observed clinical efficacy of tamoxifen has been associated with its ability to induce growth arrest and apoptosis in breast cancer cells through the inhibition of estrogen binding to the ER. Nonetheless, tamoxifen at high concentrations ( ≥ 10 µM) also has been shown to mediate apoptosis in ER-negative cancer cells [15], which might be attributable to its ability to modulate the activation and/or expression status of a series of signaling targets in an ER-independent manner. Protein kinase C (PKC), transforming growth factor-β (TGF β), calmodulin, the transcription factor c-Myc, and the mitogen-activated protein (MAP) kinases p38 and JNK (c-Jun N-terminal kinase) are among the putative targets implicated in this ER-independent pro-apoptotic activity of tamoxifen [3]. From a clinical perspective, these ER-independent antiproliferative effects of tamoxifen could possibly be exploited for the treatment of estrogen-unresponsive tumors, including ER-negative breast cancer, provided the concentrations of tamoxifen needed to modulate these apoptotic regulators could be attained therapeutically. This premise prompted our investigation of the combinatorial use of OSU-03012, a celecoxib-derived phosphoinositide-dependent protein kinase-1 (PDK-1)/Akt signaling inhibitor [16], with tamoxifen in ER-negative breast cancer cells. We hypothesized that PDK-1/Akt signaling represents a therapeutically relevant target to sensitize ER-negative breast cancer to tamoxifen by lowering the threshold for tamoxifen’s ER-independent pro-apoptotic effects.

Extending the use of tamoxifen to the treatment of metastatic, hormone-insensitive breast cancer patients addresses an urgent need for the development of novel effective 13 therapeutic approaches against ER-negative breast tumors.

Because PDK-1 is a proximal mediator of PI3K signals, PDK-1 inhibitors influence a large portion of the PI3K/Akt pathway. OSU-03012 has been demonstrated to induce apoptosis at low micromolar concentrations in various types of solid tumor cells, including those of prostate [16], breast [17, 18], colon [19], lung

[20], pancreas [21], and brain [22], chronic myelogenous leukemia cells [23], and chronic lymphocytic leukemia cells [24]. It is noteworthy that, in a panel of breast cancer cells, OSU-03012 induced anti-proliferative effects irrespective of differences in the functional and/or expression status of ER, HER2, and IGF-IR [17, 18]. In this study, we demonstrate that OSU-03012 interacted with tamoxifen to enhance cell killing in both ER-positive (ER α+) MCF-7 and ER-negative (ER α-) MDA-MB-231 breast cancer cells.

14 2.2 Materials and Methods

2.2.1 Cells and reagents

Tamoxifen, 4-hydroxytamoxifen, 17 β-estradiol, and gentamicin were purchased from Sigma-Aldrich (St Louis, MO). ICI-182780 was obtained from Tocris

Bioscience (Ellisville, MO). The PDK-1 inhibitor OSU-03012 was synthesized as described [16]. For in vitro studies, stock solutions of test agents were prepared in

DMSO and diluted in the indicated culture medium for treatment of cells (final concentration of DMSO, <0.1%). For in vivo studies, OSU-03012 and tamoxifen were prepared as suspensions in vehicle (0.5% methylcellulose w/v, 0.1% Tween 80 v/v, in sterile water) for oral administration to tumor xenograft-bearing immunocompromised mice. Antibodies against poly (ADP-ribose) polymerase

(PARP), phospho-p27 (Thr 157 ), phospho-p38 (Thr 180 /Tyr 182 ), GSK3ß, phospho-

GSK α/ß (Ser 21/9 ), total-Akt, phospho-Akt (Ser 473 ), FOXO1, phospho-FOXO1 (Ser 256 ),

FOXO3a, phospho-FOXO3a (Ser 318/321 ), FOXO4 and phospho-FOXO4(Ser 262 ) were purchased from Cell Signaling Technology Inc. (Beverly, MA). Antibodies against

ER α and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and ICN Biomedicals Inc. (Costa Mesa, CA), respectively.

2.2.2 Cell Culture

ER-positive MCF-7 and ER-negative MDA-MB-231 cells were obtained from

American Type Culture Collection (Manassas, VA) and maintained in Dulbecco's minimal essential medium/Ham's F12 (DMEM/F12; 1:1) supplemented with 10%

FBS and 10 µg/mL gentamicin (Sigma-Aldrich) at 37ºC in a humidified incubator containing 5% CO 2.

15 2.2.3 Cell Viability Analysis

The viability of breast cancer cells was analyzed by the 3-(4,5-dimethylthiazol-2- yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay

(Promega, Madison, WI) in five replicates. Cells were seeded at 7,000 cells/well in

96-well, flat-bottomed plates in 10% FBS-supplemented DMEM/F12 medium. After

24 h, the medium was replaced with that containing the indicated concentrations of individual agents or combinations of drugs and 5% FBS. Control cells were treated with DMSO vehicle at a concentration equal to that in drug-treated cells ( ≤0.1%, final concentration). After 24- or 72-h treatment, 20 µL of MTS reagent was added to each well and cells were incubated for up to 3 additional h at 37°C. The absorbances were read on a plate reader at a single wavelength of 490 nm. The concentrations of agents that inhibited viability by 50% (IC 50 ) were calculated for single agents and combinations by the median-effect method of Chou and Talalay [25] using CalcuSyn software (Biosoft, Ferguson, MO).

2.2.4 ER-Dependent Cell Proliferation Assay

MCF-7 cells were maintained in culture in DMEM/F12 medium containing 10% charcoal-stripped FBS (Hyclone, Logan, UT) for 5 days, after which cells were seeded at 4 x 10 4/well into 24-well culture plates in the same medium. Twenty-four hours later, the medium was replaced with that containing the indicated concentrations of individual agents or combinations of drugs and 5% charcoal- stripped FBS. For the estradiol-treated groups, estradiol was added 30 min prior to the drug treatment. After treatments, cells were harvested and cell number in each well was counted using a Coulter Counter (Beckman Coulter, Fullerton, CA).

16 2.2.5 Immunoblotting

Treated cells were washed with PBS, collected by scraping into RIPA lysis buffer

[50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS and a mixture of protease inhibitors] (Calbiochem;

La Jolla, CA), and then sonicated for 5 s. After brief centrifugation at 12,000 rpm, equivalent amounts of total protein from the soluble fractions of the cell lysates (20 –

50 µg) were resolved in SDS-polyacrylamide gels and transferred to a nitrocellulose membrane. After blocking with TBS containing 0.05% Tween 20 (TBST) and 5% nonfat milk for 1 h, the membrane was incubated with the appropriate primary antibody at 1:1000 dilution in TBST/1% nonfat milk at 4 oC overnight, and then washed three times with TBST. The membrane was probed with horseradish peroxidase-conjugated secondary antibodies at 1:2000 for 1 h at room temperature, and washed with TBST three times. The immunoblots were visualized by enhanced chemiluminescence.

2.2.6 Transfection and Detection of FOXO3a-GFP

Cells were cultured on cover glasses in 6-well culture plates and then transfected with the FOXO3a-GFP plasmid, which was kindly provided by Dr. Mickey C.-T. Hu

(MD Anderson Cancer Center, Houston, Texas)[16], using the Fugene 6 transfection reagent (Roche). Twenty-four h after transfection, cells were treated with OSU-03012 for 8 h and fixed in 4% formaldehyde. After washing with PBS, cells were mounted using Vectashield Mounting Medium with DAPI (Vector, Burlingame, CA), and GFP fluorescence was visualized by microscopy. The number of nuclei with GFP-positive signals were counted and expressed as a percentage of the total number of DAPI- positive nuclei. 17

2.2.7 Flow Cytometric Analysis for Apoptosis

For assessment of apoptosis, cells were treated for 24 h and then labeled with 5

µL Annexin V-FITC (Invitrogen, Carlsbad, CA) and 0.1 µg propidium iodide (Sigma-

Aldrich) in 100 µL binding buffer (10mM HEPES, 140 mM NaCl, and 2.5 mM CaCl 2, pH 7.4) containing 5 x 10 5 cells. Samples were mixed gently and incubated at room temperature in the dark for 15 min. Immediately before analysis by flow cytometry,

400  µL of binding buffer were added to each sample. Two-color analysis of apoptosis was performed using a BD FACSCalibur System (BD Biosciences, San

Jose, CA). Fluorescence compensation on the flow cytometer was adjusted to minimize overlap of the FITC and PI signals. A total of 1.2 × 10 4 cells were acquired for each sample and a maximum of 1 × 10 4 cells within the gated region were analyzed.

2.2.8 In vivo studies

Ovariectomized female NCr athymic nude mice (6-8 weeks of age) were obtained from the National Cancer Institute (Frederick, MD). The mice were group- housed in plastic shoebox cages with autoclaved bedding and filtered air (4-5 mice/cage) with ad libitum access to sterilized food and water. Animal rooms were maintained at 22ºC ± 2ºC with 12 h of fluorescent lighting per day. All experimental procedures using animals were performed in accordance with protocols approved by the Institutional Laboratory Animal Care and Use Committee of The Ohio State

University.

Each mouse was injected subcutaneously in the right flank with 5 × 10 5 MDA-

MB-231 cells in a total volume of 0.1 mL serum-free medium containing 50% 18 Matrigel (BD Biosciences, Bedford, MA). As tumors became established (mean starting volume, 59 ± 5 mm 3), mice were randomly assigned to treatment groups receiving (a) vehicle (0.5% methylcellulose/0.1% Tween 20 in water); (b) tamoxifen at 60 mg/kg, (c) OSU-03012 at 100 mg/kg, or (d) both tamoxifen and OSU-03012. All treatments were administered once per day by oral gavage (10 µl/g body weight) for the duration of the study. Tumors were measured weekly using calipers and their volumes calculated using a standard formula: (short axis) 2 x long axis x 0.52. Body weights were measured weekly.

2.2.9 Immunohistochemistry

At terminal sacrifice, tumors harvested from mice were fixed in formalin and embedded in paraffin by routine procedures. Tumor specimens were submitted to the

OSU Veterinary Biosciences Histology/Immunohistochemistry Core for immunohistochemical staining of Ki67 in representative 4-µm sections of tumor tissues. Proliferation indices were calculated as the number of immunopositive nuclei x 100% divided by the total number of cells per 400x field.

2.2.10 Statistical Analysis

All experiments were carried out at least two times on different occasions.

Values from in vitro experiments are presented as the mean + SD. The medium-effect method was used to analyze dose-response data for single or multiple drugs. For in vivo data, values are expressed as mean + SE. Comparison of variance and mean value were performed using F test followed by t -test (p<0.05).

19 2.3 Results

2.3.1 OSU-03012 Enhances the Antiproliferative Effect of Tamoxifen and 4-

Hydroxytamoxifen in MCF-7 and MDA-MB-231 Cells

The antitumor effects of OSU-03012, tamoxifen, and 4-hydroxytamoxifen, an active metabolite with at least 100-fold higher affinity for the ER, were assessed in

ER-positive MCF-7 and ER-negative MDA-MB-231 cells by the MTS assay at 72 h.

All three agents induced dose-dependent reductions in cell viability with IC 50 values as follows: MCF-7: OSU-03012, 6.8 + 0.2 µM; tamoxifen, 16.2 + 0.9 µM; 4- hydroxytamoxifen, 13.1 + 0.3 µM; MDA-MB-231: OSU-03012, 4.0 + 1.4 µM; tamoxifen, 13.0 + 0.2 µM; 4-hydroxytamoxifen, 11.8 + 0.2 µM (Fig. 2.1A, left). It is noteworthy that OSU-03012 exhibited biphasic inhibition of viability in MDA-MB-

231 cells, which was not noted in MCF-7 cells. This finding suggests that there existed distinct modes of mechanisms by which OSU-03012 mediated antiproliferative effects at concentrations below 1 µM and above 5 µM in MDA-MB-

231 cells, which warrants investigation. On the other hand, both cell lines were comparably susceptible to the antiproliferative effects of tamoxifen and 4- hydroxytamoxifen irrespective of differences in their ER binding affinity and the cellular ER status.

The ability of OSU-03012 to sensitize breast cancer cells to tamoxifen was demonstrated by the shift of the dose-response curve for tamoxifen to the left in response to increasing levels of OSU-03012 in MCF-7 cells and, more prominently, in

MDA-MB-231 cells (Fig. 2.1A, center). Three lines of evidence suggest that this

OSU-03012-induced sensitization was mediated through an ER-independent mechanism. First, as just described, prominent sensitization was observed in the ER- negative MDA-MB-231 cells. Second, this sensitization was specific to tamoxifen as 20 the responses of MCF-7 and MDA-MB-231 cells to the combination of OSU-03012

(5 µM) with the pure antiestrogen, ICI 182780, were nearly identical to their responses to OSU-03012 alone (Fig. 2.1A, right). Thus, this finding indicates that the approximately 25% reduction in viability of cells treated with the combination was attributable to the activity of OSU-03012, suggesting that the response to ICI 182780 was unaltered by the presence of OSU-03012. Lastly, MCF-7 cells (4 x 10 4 cells/well) were exposed to various treatments with or without 1 nM estradiol (E2) in medium containing charcoal-stripped serum, and cell numbers were counted after 6 days. As shown, while E2 significantly increased the number of vehicle-treated MCF-

7 cells, it could not diminish the suppressive effect of the combination therapy on cell proliferation (Fig. 2.1B).

To gain some insight into the effects of OSU-03012, both alone and in combination with tamoxifen, on ER α signaling, expression levels of ER α were determined by immunoblotting in treated MDA-MB-231 and MCF-7 cells (Fig.

2.1C). In the ER-negative MDA-MB-231 cells, none of the treatments resulted in an observable re-expression of ER α that could have potentially restored tamoxifen sensitivity, thereby providing further support for an ER-independent mechanism of

OSU-03012-induced tamoxifen sensitization in ER-negative cells. In contrast, OSU-

03012 noticeably reduced ER α expression in MCF-7 cells at 1, 2.5 and 5 µM to a level comparable to that observed after E2 treatment. Moreover, in combination with

5 µM tamoxifen, 5 µM OSU-03012 caused a substantially greater reduction in ER α levels in treated MCF-7 cells. This finding suggests that a role for suppressed ER signaling in OSU-03012-induced sensitization to tamoxifen cannot be entirely discounted in ER-positive MCF-7 cells.

21 2.3.2 OSU-03012 Sensitizes MCF-7 and MDA-MB-231 Cells to the Apoptotic

Effects of Tamoxifen .

As indicated by Annexin V analysis of phosphatidylserine externalization, OSU-

03012-mediated sensitization was, at least in part, attributable to the enhancement of tamoxifen-induced apoptosis (Fig. 2.2A). Relative to MCF-7 cells, MDA-MB-231 cells exhibit substantially higher susceptibility to the apoptotic and chemosensitizing effects of OSU-03012. As shown in Fig. 2.2B, normalization to the DMSO-treated controls revealed that OSU-03012 alone at 5 µM induced 4% and 28% apoptotic death in MCF-7 and MDA-MB-231 cells, respectively, while tamoxifen alone at 5 and 7.5 µM lacked apoptotic activity in either cell line. However, in combination with 5 µM OSU-03012, tamoxifen at 5 and 7.5 µM caused 19% and 30% apoptotic death, respectively, in MCF-7 cells vis-à-vis 41% and 55%, respectively, in MDA-

MB-231 cells. Moreover, our data indicate that the sensitizing effect of OSU-03012 on tamoxifen-induced apoptosis could not be diminished by the presence of E2 (data not shown), providing further support for the dissociation of this chemosensitization from ER signaling.

2.3.3 Functional Role of Akt Inhibition in OSU-03012-Mediated Sensitization of

Breast Cancer Cells to Tamoxifen .

Although MCF-7 and MDA-MB-231 cells exhibit low levels of Akt phosphorylation [17, 26, 27], we hypothesized that Akt signaling still represented a therapeutically relevant target for OSU-03012 to sensitize these cells to tamoxifen via two potential mechanisms. First, OSU-03012-mediated Akt inhibition would lead to the activation of a series of apoptosis regulators, which might interact synergistically with tamoxifen’s non-ER targets to facilitate apoptosis signaling. Second, OSU- 22 03012 could antagonize tamoxifen-induced Akt activation, thereby overcoming therapeutic resistance.

To test our hypothesis, we first examined the effect of OSU-03012 on the functional status of several Akt downstream effectors, the FOXO family of forkhead transcription factors [review: [28]], GSK3 α/β [29, 30] and p27 [31, 32], in MCF-7 and MDA-MB-231 cells. It is well understood that Akt plays an integral role in regulating the activity of FOXO proteins [review: [28]], by modulating their intracellular location through phosphorylation. Immunofluorescent labeling of

FOXO3a in MCF-7 and MDA-MB-231 cells indicated that OSU-03012 treatment resulted in a multifold increase in nucleus-associated FOXO3a, in comparison to its apparent cytoplasmic sequestration in DMSO vehicle-treated cells, suggesting nuclear translocation of FOXO3a in response to Akt inhibition (Fig. 2.3A). This alteration in

FOXO3a intracellular localization was associated with OSU-03012-induced reductions in the phosphorylation status of FOXO3a, as well as the Akt substrates,

GSK3 α/β and p27, at the Akt-specific phosphorylation sites, p-Ser 318/321 -FOXO3a

(Fig. 2.3B), p-Ser 21/9 -GSK3 α/β and p-Thr 157 -p27, respectively (Fig. 2.4B; see description below). In addition, the effect of tamoxifen and OSU-03012 on the Akt- sensitive phosphorylation status of other FOXO proteins, specifically FOXO1 and

FOXO4, was examined. As shown in Fig. 2.3B, the low endogenous level of p-

Ser 256 -FOXO1 in MDA-MB-231 cells was diminished by tamoxifen and OSU-03012, but without a detectable corresponding change in the expression of the unphosphorylated protein. Changes in the phosphorylation of Ser 262 -FOXO4 could not be detected in either cell line after treatment. These findings suggest that, among the FOXO proteins, FOXO3a may play the more prominent role in the effects of

OSU-03012 on the sensitivity of ER-negative breast cancer cells to tamoxifen. 23 Subsequently, we examined the effect of OSU-03012 on the phosphorylation status of Akt in tamoxifen-treated MCF-7 and MDA-MB-231 cells by Western blotting. As shown in Fig. 4A, tamoxifen treatment caused a transient increase in Akt phosphorylation in a time- and dose-dependent manner in MCF-7, and, to a substantially lesser extent, MDA-MB-231 cells. Tamoxifen-induced Akt phosphorylation peaked at 16 h after treatment in MCF-7 cells, and between 4 and 8 h in MDA-MB-231 cells. The ability of OSU-03012 to antagonize this tamoxifen- induced upregulation of phosphorylated Akt was clearly evident in MDA-MB-231 cells (Fig. 4B). Moreover, in addition to decreasing the level of p-Ser 473 -Akt in tamoxifen-treated cells, OSU-03012 also interacted with tamoxifen to reduce in a dose-dependent manner the phosphorylation levels of the two Akt substrates, Ser 21/9 -

GSK3 α/β and Thr 157 -p27. Similar results were also obtained in MCF-7 cells (not shown). In contrast, the level of phosphorylated Thr 180 /Tyr 182 -p38 MAP kinase remained unaltered in drug-treated cells, suggesting that this dephosphorylation effect of the drug combination was specific for components of the Akt pathway. Consistent with the flow cytometry data described previously (Fig. 2); these alterations in Akt signaling were associated with a dose-dependent increase in apoptosis as indicated by

PARP cleavage (Fig. 4B). Together, these in vitro findings support the existence of mechanistic interactions between OSU-03012-mediated Akt inhibition and the ER- independent actions of tamoxifen in facilitating apoptosis signaling in breast cancer cells.

2.3.4 In Vivo Efficacy of the Combination of Tamoxifen and OSU-03012 in a

MDA-MB-231 Tumor Xenograft Model .

To further evaluate the antitumor potential of the OSU-03012/tamoxifen 24 combination regimen in ER-negative breast cancer, ovariectomized female athymic nude mice bearing established subcutaneous MDA-MB-231 tumor xenografts

(starting mean tumor volume, 59 + 5 mm 3) were treated daily for 35 days by gavage with tamoxifen at 60 mg/kg, OSU-03012 at 100 mg/kg, the combination of both drugs at the same respective dose levels, or vehicle. All treatments were well-tolerated without overt signs of toxicity, and without significant change in body weights compared with the vehicle-treated group throughout the course of this study. As shown in Fig. 5A, treatment with tamoxifen alone had no appreciable effect on MDA-

MB-231 tumor growth, but both OSU-03012 alone and the combination regimen significantly inhibited MDA-MB-231 tumor growth by 30% and 50% ( P < 0.05), respectively, after 5 weeks of treatment. Immunohistochemical evaluation of Ki67 expression revealed diminished proliferation within tumors from all treatment groups with a significantly greater reduction in mice treated with the tamoxifen/OSU-03012 combination than in those treated with either agent alone ( P < 0.05)(Fig. 5B). These in vivo data are consistent with our in vitro findings regarding the effect of OSU-

03012 on sensitizing MDA-MB-231 cells to tamoxifen via an ER-independent mechanism.

25 2.4 Discussion

Tamoxifen, a selective ER modulator, mediates antiproliferative effects in ER- positive breast cancer cells with nM potency through the disruption of estrogen binding to the ER. Recent studies have indicated that tamoxifen is also effective against ER-negative tumor cells, including those of liver, ovary, pancreas, and breast

[3], though at therapeutically unattainable concentrations. Although the ER- independent mechanism by which tamoxifen facilitates apoptosis remains elusive, putative molecular targets include PKC, TGF-β, calmodulin, c-myc, ceramide and

MAP kinases. From a mechanistic perspective, these ER-independent proapoptotic mechanisms could be pharmacologically exploited by targeting PDK-1/Akt signaling to lower the apoptosis threshold in ER-negative breast cancer cells. This hypothesis is of clinical relevance in light of recent evidence that PDK-1/Akt signaling is frequently upregulated in breast cancers [17, 23, 33]. The findings presented here provide the proof-of-principle of this hypothesis by demonstrating the ability of the PDK-1/Akt signaling inhibitor OSU-03012 to sensitize MDA-MB-231 cells to the antiproliferative effects of tamoxifen.

The molecular basis for this OSU-03012-mediated sensitization may be threefold. First, as a possible compensatory mechanism, tamoxifen treatment, in the range of 2.5 – 7.5 µM, led to a transient increase in Akt phosphorylation in MCF-7 cells, and to a much lesser extent, in MDA-MD-231 cells. This finding is reminiscent of that in a recent report describing a transient increase in p-Akt in MCF-7 cells, but not in MDA-MB-231 cells, after treatment with tamoxifen at 40 – 80 nM [27]. The discrepancy between this reported data and our findings in MDA-MB-231 cells might be attributed to differences in the dose of tamoxifen used between these two studies.

Nevertheless, this transient tamoxifen-induced elevation of Akt phosphorylation may 26 serve a protective function, which is counteracted by OSU-03012 leading to increased cellular sensitivity to tamoxifen. Second, our data suggest that OSU-03012-mediated

Akt inhibition interacted cooperatively with the ER-independent actions of tamoxifen in modulating the functional status of multiple Akt downstream effectors, including

FOXO3a, GSK3 α/β, and p27. Third, OSU-03012-induced apoptosis in cancer cells has been associated with effects on pathways other than PDK-1/Akt signaling, including the disruption of mitochondrial membrane potential and activation of caspase 9 [34, 35], induction of endoplasmic reticulum stress responses [22], inhibition of p21-activated kinase (PAK1) activity [31], inhibition of Janus-activated kinase 2/signaling transducer activator of transcription 3 (JAK/STAT3) and MAP kinase pathways, and downregulation of cyclins A and B, and the inhibitor of apoptosis protein [32] members, XIAP and survivin [36]. Thus, these and perhaps other OSU-03012-induced apoptotic pathways may merge with those induced by tamoxifen to culminate in enhanced breast cancer cell death. Which of the putative

ER-independent targets of tamoxifen interact with these PDK-1-dependent or - independent OSU-03012-induced pathways in co-treated cells remains undefined.

Our finding that the phosphorylation status of p38 was not altered by OSU-03012 or tamoxifen suggests that its upstream regulators, such as the putative tamoxifen targets, PKC, calmodulin, c-myc, ceramide and MAP kinase, are not involved.

The therapeutic potential of this combination regimen was demonstrated in its superior activity in suppressing established MDA-MB-231 xenograft tumor growth in comparison to that of individual agents (Fig. 5). This in vivo finding provides a proof-of-principle that Akt signaling represents a clinically relevant target to sensitize

ER-negative breast cancer cells to the ER-independent proapoptotic actions of tamoxifen. This strategy is distinct from that underlying the use of demethylating 27 agents and histone deacetylase inhibitors to restore tamoxifen sensitivity in MDA-

MB-231 cells by reactivating the expression of ER mRNA and functional protein

[37]. Other approaches reported to enhance tamoxifen sensitivity in ER-negative breast cancer cells include those aimed at triggering apoptotic pathways, such as the induction of ceramide synthesis with persin, a plant toxin [38], and co-treatment with tumor necrosis factor-related apoptosis-inducing ligand [39], both of which modulate tamoxifen responsiveness independent of ER status. Strategies that suppress survival pathways associated with tamoxifen resistance have also been reported, such as inhibition of the cytoprotective protein, clusterin, by immunoneutralization or anti- sense therapy to counteract its induction in response to tamoxifen treatment in ER- positive cells [40], and inhibition of phosphatidylinositol-3-kinase in chronically estrogen-deprived, aromatase-transfected, ER-positive breast tumor xenografts [41].

In addition, the small-molecule zinc finger inhibitor disulfide benzamide effectively restored tamoxifen sensitivity in resistant ER-positive breast cancer cell lines through targeted disruption of ER DNA binding domain, subsequent modulation of co-factor recruitment, and inhibition of ERE transactivation [21]. These and other research efforts addressing tamoxifen sensitivity underscore the major challenge that acquired and de novo resistance to antiestrogens poses to the clinical management of breast cancer. Considering the urgent need for novel strategies for the treatment of ER- negative breast cancers, the pharmacological exploitation of both ER-dependent and – independent antitumor activities of tamoxifen with combinatorial approaches represents a paradigm shift in endocrine therapy for breast cancer that is worthy of further investigation.

28 Fig. 2.1 Sensitization of MCF-7 and MDA-MB-231 breast cancer cells to tamoxifen by OSU-03012 via an ER-independent mechanism. A, Upper panels, left , dose-dependent antiproliferative effects of OSU-03012 (OSU), tamoxifen (Tam), and 4-hydroxytamoxifen (4OH-T) on cell viability in MCF-7 cells; ●, OSU; ♦, Tam;

■, 4OH-T; Center , dose-dependent effect of OSU-03012 on the sensitivity of MCF-7 cells to the antiproliferative activity of tamoxifen; OSU-03012 doses (µM): ■, 0; ♦, 1;

▲, 2.5; ●, 5; Right , effect of OSU-03012 on the response of MCF-7 cells to the pure

ER antagonist ICI 182780; OSU-03012 doses (µM): ■, 0; ▲, 5. Lower panels , same sets of experiments were carried out in MDA-MB-231 cells in lieu of MCF-7 cells.

Cell viability was determined by the MTS assay as described in the Materials and

Methods. Points , mean; bars , SD (n = 5). B, estradiol (E2) has no effect on OSU-

03012-mediated sensitization of MCF-7 cells to the antiproliferative effect of tamoxifen (Tam). After 5 days of culture in the presence of 10% charcoal-stripped

FBS, MCF-7 cells were seeded into 24-well culture plates (4 x 10 4 cells/well), treated as indicated in 5% charcoal-stripped FBS-containing medium for 72 h, and then harvested for counting of cell numbers as described in the Materials and Methods.

Columns , mean; bar , SD (n = 3). C, Effect of OSU-03012, alone and in combination with tamoxifen, on ER α expression in MCF-7 cells. Cells were treated as indicated for 24 h. Immunoblotting was performed as described in the Materials and Methods.

Fig. 2.1

30 Fig. 2.2 Annexin V flow cytometric analysis of apoptosis in MCF-7 and

MDA-MB-231 cells receiving tamoxifen, OSU-03012, or the tamoxifen/OSU-

03012 combination. A, MCF-7 and MDA-MB-231 cells were treated tamoxifen or

OSU-03012 individually or in combination at the indicated concentrations in 5%

FBS-containing DMEM/F12 medium for 24 h, followed by Annexin V/propidium iodide staining as described in the Materials and Methods. Results are representative of two independent experiments. B, bar graphs representing the flow cytometry data presented in A above. Each bar represents the mean ± SD of two independent analyses. FL2-H, propidium iodide; FLH-1, annexin V.

Fig. 2.2

32 Fig. 2.3 Effect of OSU-03012 on the intracellular localization of FOXO3a and expression levels of other FOXO proteins in MCF-7 and MDA-MB-231 cells.

A, immunocytochemical analysis of the effect of OSU-03012 on the intracellular localization of GFP-tagged FOXO3a in MCF-7 and MDA-MB-231 cells. Cells were treated with 5 µM OSU-03012 in 5% FBS-containing DMEM/F-12 medium for 8 h.

The percentage of cells with GFP-positive nuclei was determined by fluorescence microscopy. Columns , mean; bar , SD (n = 3). B, Effect of OSU-03012, alone and in combination with tamoxifen, on the expression and phosphorylation status of FOXO protein family members in MCF-7 and MDA-MB-231 cells. Cells were treated as indicated for 24 h. Immunoblotting was performed as described in the Materials and

Methods.

Fig. 2.3

34 Fig. 2.4 Effect of tamoxifen, OSU-03012, and the tamoxifen/OSU-03012 combination on the phosphorylation status of Akt and its downstream effectors

GSK3 α/β and p27 in MCF-7 and MDA-MB-231 cells. A, transient upregulation of

Akt phosphorylation in MCF-7 and MDA-MB-231 cells treated with tamoxifen.

Cells were exposed to tamoxifen at 2.5, 5, or 7.5 µM for the indicated times.

Immunoblotting for p-Ser473-Akt and total Akt was performed as described in the

Materials and Methods. B, dose-dependent effect of tamoxifen alone or in combination with 5 µM OSU-03012 on the phosphorylation status of Akt and its substrates GSK3 α/β and p27, and on PARP cleavage in MDA-MB-231 cells. The

MAP kinase p38 was used as a negative control to demonstrate the specificity of Akt inhibition. MDA-MB-231 cells were exposed to individual treatments for 8 h.

Immunoblotting was performed as described in the Materials and Methods.

Fig. 2.4

36 Fig. 2.5 Effects of daily oral treatment with tamoxifen (60 mg/kg), OSU-

03012 (100 mg/kg), and the tamoxifen/OSU-03012 combination (60 and 100 mg/kg, respectively) on the growth of established subcutaneous MDA-MB-231 tumors in ovariectomized female athymic nude mice. MDA-MB-231 tumors were established in each mouse by subcutaneous injection of 5 × 10 5 MDA-MB-231 cells in a total volume of 0.1 mL of cold serum-free medium containing 50% Matrigel.

Mice with established tumors (starting mean tumor volume, 59 + 5 mm 3) were randomly assigned to four groups (n = 10-12) that received the indicated treatments once daily by oral gavage for the duration of the study as described in the Materials and Methods. A, mean tumor volumes for each treatment group as a function of day of treatment. Points , mean tumor volume; bars , SEM (n = 10-12). B, immunohistochemical evaluation of intratumoral proliferation in MDA-MB-231 xenograft tumors. Immunostaining for Ki67 in formalin-fixed, paraffin-embedded tumor tissues was performed, and proliferation indices were calculated as described in

Materials and Methods. Left panel , Immunohistochemistry showing Ki67 expression

(brown intranuclear staining) in MDA-MB-231 tumors from each treatment group.

Tissues were counterstained with hematoxylin. Right panel , Proliferation indices in

MDA-MB-231 tumors from each treatment group. Each bar represents the mean of five 400X fields ± SD. Tam, tamoxifen.

Fig. 2.5

38 CHAPTER3:

AUTOPHAGIC DEGRADATION OF HUMAN EPIDERMAL

GROWTH FACTOR RECEPTOR 2 (HER2/ NEU ) INDUCED BY

CELECOXIB AND ITS DERIVATIVE OSU-03012 THROUGH

HSP90-MEDIATED MECHANISM

Abstract

Amplification or overexpression of the human epidermal growth factor receptor 2 (HER2), present in 20 - 30% of human breast cancer, is associated with poor prognosis, frequent disease recurrence, and resistance to hormonal, cytotoxic, and radiation therapies. Consequently, targeting HER2 represents an important strategy for breast cancer therapy. We show here that 2.5 µmol/L OSU-03012 exhibited a similar potency as celecoxib at 50 µmol/L concentration in HER2 down- regulation, providing therapeutically attainable concentration of celecoxib analogs in anti HER2-tumors therapy. HER2-overexpressing SKBR3 human breast cancer cells were used in all assays. Drug effects on the expression level and/or subcellular location of HER2 and biomarkers of endosomes and lysosomes were analyzed by

Western blotting, flow cytometry, and immunocytochemistry. To analyze the consequence of membrane HER2 after drugs’ treatment, cell surface-HER2 was biotinylated before cells were exposed to agents, followed by streptavidin extraction.

Intracellular phosphatidylinostiol 3-phosphates (PI3P) synthesis was detected by immunocytochemistry using the GST-2xFYVE fusion protein.

39 Immunocytochemical evaluations showed that celecoxib, OSU-03012 and

LY294002 (a PI3 kinase inhibitor) induced HER2 endocytosis. Co- immunoprecipitation data indicated that interaction between HER2 and the AP2 adaptor protein; AP50/ µ2 was increased by celecoxib analogs. Evidences that OSU-

03012-induced HER2 down-regulation involves autophagy include the co-localization of internalized HER2 with LAMP-2 positive autolysosomes and MDC positive vacuoles in celecoxib or OSU-03012-treated cells, as well as the attenuation of HER2 down-regulation by the autophagy inhibitors, bafilomycin, folimycin and chloroquine.

Moreover, OSU-03012- and celecoxib-induced reductions in cell viability, as determined by MTT assay, was also attenuated by chloroquine, suggesting a role for drug-induced autophagic down-regulation of HER2 in mediating the antiproliferative effects of these compounds in cancer cells.

The mechanistic study shows that celecoxib and OSU-03012 induce ligand- independent HER2 endocytosis and autophagic degradation through a mechanism that involves PDK-1 and hsp90. Several lines of biological evidences support that celecoxib derivatives possess the inhibition effect on hsp90. First, down-regulation of hsp90 clients, which include HER2, PDK-1, Akt and ER α. Second, celecoxib derivatives decreased binding activity of hsp90 with ATP, as an indication of hsp90 inactivation. Third, the sensitivity to celecoxib derivatives of different breast cancer cell lines is correspondent to HER2 expression level of those. Fourth, these compounds competed with geldanamycin for hsp90 binding evidenced by fluorescence polarization assay. In conclusion, our study not only provides a new insight regarding therapeutic benefit of celecoxib analogs against HER2 positive breast cancer therapy, but also linked drug-inducing autophagy with regulation of

HER2 receptor and proliferation of breast cancer cells. 40 3.1 Introduction:

Human epithelial growth factor receptor (HER) family of receptor tyrosine kinase (RTKs)-mediated signaling represented a critical pathway in tumor growth and progression. Among the four HER family members, which include HER1 (ErbB1),

HER2 (ErbB2, neu), HER3 and HER4, HER2 is the most effective oncoprotein [42].

Overexpression of HER2, occurs in about 20-30% of human breast cancers, suggesting a molecular subtype of breast cancer associated with aggressive disease and poor clinical outcome [43, 44]. Despite the success of humanized monoclonal antibody, trastuzumab (Herceptin) [45] directed against HER2 in treating early stage high risk and metastatic HER positive disease, clinical results indicate that only one- third of patients response to trastuzumab [44, 46].

While the need of novel class of anti-HER2 therapy is demanded, a group of hsp90 inhibitors have been developed by inhibiting hsp90 as a therapeutic target due to the unique role of hsp90 in stabilizing oncogenic proteins. These include natural products such as benzoquinone ansamycins [47], radicicol [48] and their derivatives, synthetic compounds, such as purine-based small molecule inhibitors [49]. 17-AGG

[35], a member of benzoquinone ansamycin family, had a promising anti-HER2 tumor activity in preclinical studies and became the first molecule in the class entering clinical trails despite its limited bioavailbility and hepatoxicity.

In our previous study, we have found that OSU-03012, a COX-2-inactive

PDK-1 inhibitor [16] derived from celecoxib showed a similar effect as hsp90 inhibitors on HER2 receptor in terms of receptor internalization and down-regulation in breast cancer cell lines (SKBR-3 and BT474) accompanied by dephosphorylation of Akt, p27(kip1), and p70(S6K) as well as apoptosis induction with a concentration of 3-4 µM in a panel of breast cancer cells [18]. The results inspired the possibility of 41 exploiting OSU-03012 in against HER2 positive cancers due to two clinical perspectives. First, celecoxib, a lead compound of OSU-03012, has shown a promising chemopreventive activity in HER2 animal models [43, 50] and it is currently being evaluated in clinical trials for the prevention of breast cancer development or recurrence. Second, OSU-03012, which is currently undergoing preclinical testing under the Rapid Access to Intervention Development program at the National Cancer Institute, has shown good oral-bioavailbility 1 and promising antitumor effects in prostate, breast as well as lung cancers animal models [51].

Here, we provide evidences that celecoxib analogs accelerate HER2 receptor endocytosis and mediate degradation through PDK-1/Akt inhibition and autophagy pathways, charactering by the fusion of HER2 compartment with LAMP2-specific- lysosomes and the sensitivity to autolysosome inhibitors. Also, we have explored the question of how celecoxib analogs induce HER2 endocytosis and demonstrated that hsp90-mdeiated autolysosome formation is essential for HER2 regulation by small molecules. Moreover, to optimize celecoxib into a new generation of hsp90 inhibitor, the fluorescence polarization assay was established as a platform for compound screening from existing library. The subsequent work validated that 1-[4-(5-

Phenanthren-2-yl-3-trifluoromethyl-pyrazol-1-yl)-phenyl]-piperazine, namely T3-1 possess most potent hsp90 inhibition activity with sub-mcrimolar EC 50 in causing

HER2 and ER α degradation.

1Compound summary, Feburary 4, 2008, NCI RAID Initiative for NSC D728209, contract no. N01-CM-52205.

42 3.2 Methods and Materials:

3.2.1 Cells and reagents

SKBR3, MDA-MB-231, MCF-7 and BT474 cells obtained from American

Type Culture Collection (Manassas, VA) were maintained in Dulbecco's minimal essential medium/Ham's F12 (DMEM/F12; 1:1) supplemented with 10% FBS and 10

µg/ml gentamycin (Sigma-Aldrich) at 37ºC in a humidified incubator containing 5%

CO 2. LY294002, 3-methyladenine (3-MA), wortmannin, vinblastine, anisomycin, chloroquine, bafilomycin, tunicamycin, MG132, E-64d and pepstatin A were purchased from Sigma-Aldrich (St Louis, MO). Foliomycin, N-acetyl-leucinyl-L- leucinyl-L-norleucinal (ALLN), proteasome inhibitor (PSI) and cyclohexamide were purchased from Calbiochem (San Diego, CA). The PDK-1 inhibitor, OSU-03012 was synthesized as described (Zhu et al., 2004). Antibodies against phospho-Akt (Ser 308 ),

C-terminus of neu (C-18), extracellular domain of neu (9G6), phospho-HER-2

(Tyr 1248 ), HSP90 α/β (F-8), Rab7 (H-50), HSC70 (B-6) and cathepsinD (C-20) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Anti-ubiqutin was purchased from Pierce Biotechnology Inc. (Rockford, IL). Anti-human transferring receptor was purchased from Invitrogen (Carlsbad, CA). Anti-actin was purchased from ICN Biomedicals Inc. (Costa Mesa, CA). Anti-AP-2, µ2 (AP50) was purchased

TM from BD Transducton Laboratories (San Jose, CA). LAMP1 and LAMP2 antibody was purchased from Development studies Hybridoma Bank (Iowa City, IA).

3.2.2 Immunocytochemistry

For detecting the locations of receptors and endocytosis related protein,

SKBR3 was treated with varied compounds at variant concentrations as indicated.

Then samples were collected and washed with Dulbecco's PBS, fixed in 4% 43 paraformaldehyde for 30 min at room temperature, and again washed with PBS before immunocytochemistry staining. Then the cells were permeabilized with 0.1% Triton

X-100 in PBS containing 1% fetal bovine serum and stained with diluted first antibody for 24 h at 4°C, washed with PBS. For visualization both protein under fluorescent microscope, Alexa Fluor 488 goat anti-mouse IgG, Alexa Fluor 647 goat anti-rabbit IgG and Alexa Fluor 647 donkey anti-goat IgG (Molecular Probe, Inc,

Carlsbad, CA) were used for conjugated different first antibodies, respectively. All the antibodies were diluted in dilution solution (0.1% Triton X-100, 0.2% bovine serum albumin in PBS) and the nuclear counter staining was performed by the mounting medium (Vector, CA) prior to examination. Images of immunocytochemically labeled samples were observed using a Zeiss microscope

(LSM510) with an Argon laser and a HeNe laser, appropriate filters (excitation wavelengths are 488 nm, 633nm and 543), and a 63×1.4 numerical aperture water immersion lens.

3.2.3 Biotin labeling assay

1 x10 6 cells were plated in 10cm 3 plate the day before treatment. The cells were rinsed twice with iced-cold PBS-CM for 10 minutes at 4 o C on a shaker. After

20 minutes, a fresh preparation 0.5 mg/ml sulfo-NHS-SS-biotin (Pierce

Biotechnology Inc., Rockford, IL) in 1X PBS was added to the cells and incubated for

20 minutes more at 4oC. The excess sulfo-NHS-SS-biotin was quenched and washed away using 100nM glycine in 1XPBS before drugs treatment. Control cells were incubated with 0.1%DMSO. Other cells were treated with celecoxib 50 µM, OSU-

03012 5 µM or LY294002 20 µM, respectively. All groups were incubated at 37 oC.

The cells were washed 3 times by PBS-CM, then collected by scraper following by 44 suspension in M-PER lysis buffer (Pierce Biotechnology Inc., Rockford, IL). After protein quantification by Bradford assay (Bio-Rad Laboratories, Hercules, CA), the same amount of protein was taken from each group, and then streptavidin-coated beads were used to purify biotin-labeling protein (Sigma-Aldrich). After four times wash in 1XPBS, the pellets were suspended in 2x SDS sample buffer, and then boiled at 95 oC before processing western blotting.

3.2.3 Immunoblotting

The general procedure for the Western blot analysis was performed as follows.

After the drug treatment in various time, cells were washed with PBS, scraped and collected using M-PER lysis buffer (Pierce Biotechnology Inc., Rockford, IL) and a mixture of protease inhibitors (Calbiochem; La Jolla, CA). Protein contents were analyzed by Bradford assay (Bio-Rad Laboratories, Hercules, CA). Twenty to fifty µg of total proteins were resolved in SDS-polyacrylamide gels, and transferred to a nitrocellulose membrane. After blocking with TBS containing 0.05% Tween 20

(TBST) and 5% nonfat milk for 1 hr, the membrane was incubated with the appropriate primary antibody at 1:1000 dilution in TBST/1% nonfat milk at 4 oC overnight, and washed three times with TBST. The membrane was probed with horseradish peroxidase-conjugated secondary antibodies at 1:2000 for 1 hr at room temperature, and washed with TBST three times. The immunoblots were visualized by enhanced chemiluminescence (GE healthcare, Piscataway, NJ).

3.2.4 Noninvasive ectodomain HER2 quantity assay

1 x10 6 cells were treated were plated in 10cm 3 plate the day before treatment.

Cells were treated with different concentrations of OSU-03012, celecoxib and 45 LY294002, respectively as indicated for 12 hours. Cells are rinsed once with 1X PBS, and then added approximately 5 ml of 0.2% EDTA (in PBS) to plate. After the cells round up, all the treated cells were collected and fixed in 1% paraformaldehyde for 30 minutes. In order to analyze the surface HER-2 only, permeabilization was not performed before staining. HER2 ectodomain mouse monoclonal antibody (1:100) was used as primary antibody, and then conjugated with Alexa Fluor 488 goat anti- mouse IgG. Single color analysis of ectomain neu was performed using a BD

FACSCalibur System (BD Biosciences, San Jose, CA).

3.2.5 Co-immunoprecipitation

SKBR3 was treated with various concentrations of OSU-03012 as indicated time points and lysed by the aforementioned Nonidet P-40 isotonic lysis buffer with a mixture of protease and phosphatase inhibitors. After centrifugation at 13000 xg for

15 min, the supernatants were collected and incubated with protein A/G-Sepharose beads (Santa Cruz Biotechnology Inc, Santa Cruz, CA) for 2 hr to eliminate nonspecific binding. The mixture was centrifuged at 1000 _ g for 5 min, and the supernatants were exposed to desired antibodies in the presence of protein A/G

Sepharose beads at 4 °C overnight. After a brief centrifugation, protein A/G-

Sepharose beads were collected and washed with 1XPBS four times, suspended in

2XSDS sample buffer, and subjected to western blot analysis with varied antibodies as indicated.

3.2.6 MDC staining

Monodansylcadaverine (MDC, Sigma-Aldrich) was applied to the cells at 50

µM for 30–45 min followed by 10 min incubation with 40mM NH4Cl in serum free 46 medium and one wash with phosphate-buffered saline (PBS) plus 10% FCS. The intracellular MDC-fluorescence (excitation 355 nm, emission 460, cutoff 550, well- scan) features were taken on an inverted fluorescence microscope (Nikon).

3.2.7 PtdIns(3)P staining

2XFYVE fragment of hrs was amplified from MCF7 cDNA library by using primer pairs (5’ aggatcc atggacgctgaggaatgccac 3’ and 5’ ctggccctgggatcc ctgctcgtagcagggctc 3’; 5' cagggatcc cagggccagggca gcgacgctgaggaatgccac 3' and 5' agagctc ctgctcgtagcagggctc 3'). The amplicon of each primer pair was digested with Eco RI/ Bam HI or Bam HI/ Xho I and then ligated into

Eco RI/ Xho I digested pGEX-6P-1 vector (Amersham Pharmacia). To generate the

GST-2XFYVE fusion protein, the constructed plasmid was transformed into E. coli

BL21(DE3) for expression, and then purified by using Glutathione conjugated beads

(Amersham Pharmacia). The fixation and permeabilization were performed as above, and followed by staining with GST-2XFYVE 2mg/ml in dilution solution overnight at

4°C. After staining, goat anti-GST antibody was used to conjugate GST protein, followed by labeling with Alexa Fluor 488 donkey anti-goat IgG (Molecular Probe,

Inc). Mounting medium (Vector, CA) was used to counter stain nucleus prior to examination. The nuclear counter staining was performed byImages of immunocytochemically labeled samples were observed using a Zeiss microscope

(LSM510) with an Argon laser and a HeNe laser, appropriate filters (excitation wavelengths are 488 nm, 633nm and 543), and a 63×1.4 numerical aperture water immersion lens.

47 3.2.8 Inhibition of PDK-1 and Akt gene expression by siRNA

SKBR3 cells were nucleofected following the manufacturer’s instructions using the Cell Line Nucleofector Kit C, program E-009 (Amaxa Biosystems, Cologne,

Germany) and transfected with either 0.2 nmol of the appropriate small interfering

RNA (siRNA) or a Non-targeting siRNA. PDK-1 and Akt1 siRNA were purchased from Dharmacon (Chicago, IL). The protein lysates of siRNA transfected cells was collected 48 hours after transfection.

3.2.9 HSP90 ATP-binding assay

The ATP-binding assay was performed as previous report [52]. SKBR3 cells were treated with celecoxib, OSU-03012, 17-AAG and LY294002 for 6 hours and then lysed in TNESV buffer (50mM Tris, 2mM EDTA, 100nM NaCl, 1mM activated sodium orthovanadate, 25 mM NaF, 1% TritonX-100 [PH 7.5]) for 30 min at 4°C.

Lysates were centrifuged for 15 min at 12000rpm at 4 °C. Protein (200 µg) was incubated with pre-equilibrated γ-phosphate-linked ATP sepharose (Jena Bioscience

GmbH, Jena, Germany) in incabation buffer (10mM Tris-HCl, 50 mM KCl, 5 mM

MgCl 2, 20mM Na 2MoO 4, 0.01% Nonidet P-40) overnight at 4°C, rotating. The sepharose was then washed four times with incubation buffer. Boiling with SDS sample buffer isolated bound proteins.

3.2.10 Computer Modeling

The three-dimensional structure of geldanamycin, celecoxib and OSU-03012 were generated by InsighII 2000.1 software (Accelrys, San Diego, CA). The crystal

48 structure of N-terminal domain of the Hsp90 chaperone in complex of radicicol- derived compound VER-52296 [43] (entry code 2VCJ) was retrieved from the

Research Collaboratory for Structural Bioinformatics Protein Data Bank [53]. The grid parameter file of 2VCJ was generated on the N-terminal domain of VER-49009 binding site, and the default parameters in AutoDock Tools were used. The docking parameter files of geldanamycin, celecoxib and OSU-03012 were defined with GA runs [100], population size [200], and evaluations [2.5X10 7] using the Lamarckian genetic algorithm. Other default parameters were used. Docking was performed with

AutoDock 4.0 [54] using the Pentium 4 Cluster at Ohio Supercomputer Center

(available at http://www.osc.edu ).

3.2.11 Cell lysate preparation for Fluorescence polarization assay

SKBR3 Cells were cultured in DMEM/Ham’s F12 medium supplemented with

15 mM HEPES, 1.2 g/L sodium bicarbonate, 10% fetal bovine serum, 2.3mM L- glutamine, 1% penicillin and streptomycin, 10 µg/L Gentamicin (Invitrogen,

Carlsbad, CA), pH 7.2. Cells were collected and frozen to rupture the membranes and then dissolved in binding buffer with added protease and phosphotase inhibitors to form the lysate. Lysates were stored at –20 °C before use. Total protein content was determined using the Bradford protein assay kit from Bio-Rad (Hercules, CA ) according to the manufacturer’s instructions.

3.2.12 Ligand and binding buffer preparation

Geldanamycin-cy3B was synthesized as previous reports and dissolved in

DMSO to form 1 µM solution. The binding buffer contained 20mM HEPES , pH 7.3,

50 mM KCl, 5 mM MgCl2, 20 mM Na2MoO4, and 0.01% NP40. Before each use, 49 0.1 mg/mL bovine gamma globulin (Sigma-Aldrich, St. Louis, MO) and 2 mM DTT

(Promega, Madison, WI) were freshly added.

3.2.13 FP assay development and optimization

The development of fluorescence polarization was established following the previous study [55]. The assay was performed in black 384-well microplates (Perkin

Elmer, Waltham, MA) in total volume of 50 µL in each well. The fluorescence intensity values were recorded using excitation filter at 540nM and emission filter at

590nM. FP measurements were executed by setting the integration time of 100ms, an excitation filter at 545nM and emission filter at 610nM. All data were express in millipolarization unit. The mP values were caculated using the equation mP= 1000 ×

[(I II -I⊥)/(I II+I ⊥)] I II : parallel emission intensity measurement, I ⊥: perpendicular emission intensity measurement. Saturation curves were recorded in which fluorescently labeled geldanamycin (Cy3B-GM) (50 nM) was treated with increasing amounts of SKBR3 lysates. The specific binding was defined as the contribution to signal of bound ligand and was caculated as mP=mP b- mP f , that mP b and mP f are the polarization value values of bound and free tracer, respectively; mP is the recorder polarization value for a specific protein lysate or recombination Hsp90

(Stressgene,) concentration.

3.2.14 Competition FP assays

OSU-03012 derivatives dissolved in DMSO were added at indicated concentrations to the reaction buffer containing both 50nM GM-cy3B and SKBR3 cell lysate (0.75 µg/well) in a final volume of 50 µL. Free GM-cy3B and bound GM- 50 cy3B with SKBR3 cell lysate (0.75 µg/well) were included as controls in each plate.

Plates were placed at room temperature, and polarization values were measured after

22 hours. The competitive efficiency of each OSU-03012 derivative was presented as a percentage of control as followed the equation % of inhibition= 100-[(mPa- mPf)/(mPb-mPf)]×100, that mPa is the recorded mP from testing agent wells, mPf is the average record mP from GM-cy3B-only wells, and mPb is the average from wells containing both GM-cy3B and SKBR3 lysate.

51 3.3 Results

3.3.1 HER2/neu is internalized by celecoxib and OSU-03012 through PI3K/PDK-

1/Akt related pathway, COX-independently.

Since celecoxib derivative, OSU-03012, a COX-2-inactive PDK-1 inhibitor, can down-regulated HER2 without COX-2 inhibitory effect in HER2 positive breast cancer cells [16, 18], we postulated that action of these two compounds is related to

PDK-1/Akt inhibition in this regard. To test this hypothesis, the HER2 regulation activities of celecoxib analogs (celecoxib and OSU-03012) and LY294002, an inhibitor of PI3 kinase [56] were assessed in HER positive breast cancer cell line,

SKBR3. The cells were exposed to individual agents over the dosages range of 2.5-

50 µmol/L and the HER2 regulation activities were determined by HER2 immunocytochemistry staining, biotin labeling assay, immunoblotting, as well as flow cytometry at 6, 12 or 24 hours. All three agents showed a dose-dependent reduction in total HER-2 and phospho-Akt levels at 6 hours (Fig. 3.1A, bottom panel). Also, they all induced HER2 internalization as shown here by HER2 immunocytochemistry at 24 hours after various compounds treatment at different concentrations as indicated

(Fig. 3.1A, upper panel). To analyze the consequence of membrane HER2 after drugs’ treatment, cell surface-HER2 was biotinylated before cells were exposed to agents. All three compounds caused membrane HER2 reduction accompanying by receptors’ fragmentation. It is noteworthy that PI3K or PDK-1 inhibition caused a major cleaved form of HER2 around size 135Kda formation (Fig. 3.1A, bottom panel).

Immunoblotting assay was performed to access the correlation between phospho-Akt and HER2 down-regualtion. According to the HER2 immunoblotting assay at 24 hours, the effect of OSU-03012 in decreasing total HER2 level was 20 52 times more than celecoxib accompany by dose-dependent reduction of phospho-Akt level. Although LY294002 cleaved membrane-HER2 and decreased total HER2 level after 6 hours of drug treatment, we found that decreasing amount of total-HER2 by

LY294002 was irrespective to the decrease of phospho-Akt level for longer exposure time (Fig. 3.1B). This result was further supported by extracellular domain HER2 flow cytometry analysis showing the difference between celecoxib analogs and

LY294002 in regulating membrane-located HER2 (Fig. 3.1C). The extracelullar

HER2 intensity was significantly diminished in the presence of 25 µM-, 50 µM- celecoxib, 2.5µM-, 5 µM-OSU-03012 by 23%, 33%, 37%, 70% (mean values from two determinations, p<0.05); 20 µM-LY294002, nevertheless, did not. However, when we analyzed the data by gating the cells with M1 region as ectodomain HER-2 negative population vis-à-vis M2 region as ectodomain HER-2 positive population, the decrease amount of HER-2 positive cells is 7%, 17%, 18%, 44% and 7% comparing to the control group in the presence of 25 µM-, 50 µM-celecoxib, 2.5µM-,

5µM-OSU-03012 and LY294002, respectively. This suggests that the slightly decreasing amount of HER2 by LY294002 may due to the effect of expression inhibition instead of endocytotic degradation; therefore, the fate of these internalized receptors might be determined at the post-endocytosis/receptor-sorting step.

Impaired internalization has suggested as the main reason of why down- regulated of HER2 is not efficient; thus, increasing receptors internalization could stimulate receptors down-regulated [57, 58]. The endosome and HER2 co-staining showed that celecoxib and OSU-03012 drastically induced large portion of internalized HER2 vesicles localized with endosome identified by transferrin receptor staining, supporting that accelerated endocytosis was induced as results of drugs

53 treatment (Fig. 3.1D). Moreover, celecoxib analogs notably elevated the association of HER2 with AP50/ µ2, an adaptor protein that acts as a binding partner of HER2 in plasma membrane clathrin-coated pits while receptors endocytosis [59], and ubiquitin revealed by HER2 immunopricipitation (Fig. 3.1E). Consequently, we suggest that celecoxib derivatives accelerate HER2 ubiquitination and endocytosis through

PI3K/PDK-1/Akt related pathway, COX-independently.

3.3.2 Autophagy activation is essential for PI3K/PDK-1/Akt regulated ligand- independent HER2/neu endocytosis sorting to degradation pathway.

Since PtdIns(3)P is a crucial phosphoinositide in the biology of endosomes

[60], we identified early endosome and late endosome formation by detecting

PtdIns(3)P containing compartments via GST-2XFYVE fusion protein (early endosome) and Rab7 antibody (late endosome) [61] with immunocytochemistry method. The drugs-treated groups had substantially increased GST-2XFYVE signals that were associated with a multitude of vesicles located at the peripheral as the result shown here (Fig. 3.2A). Moreover, both celecoxib and OSU-03012 caused appreciable formation of Rab7 conversion signals, a progression sign of autophagic pathway while early endosome converts to late endosome [62].

Because the actions of PI3K/PDK-1 inhibitors in HER2 proteolysis presents two characters, PtdIns(3)P requirement and Rab7-compartments formation according to our findings, it implies that the mechanism might related to autophagy activation

[63]. To verify this assumption, we used monodansylcadaverine (MDC) staining to detect the autophagosome formation [64]. SKBR3 cells were exposed to agents for 1 hour in serum free medium followed by MDC staining. The result showed that both celecoxib and OSU-03012 induced autophagosome formation in SKBR3 cells (Fig. 54 3.2B). To gather further support for the idea that autophagy activation is required for celecoxib analogs-induced HER2 degradation, we used different autophagy inhibitors

[65] to block autophagy events in order to delay drugs-induced HER2 degradation.

As shown in figure 3.2C, 3-MA, wortmannin, cyclohexamine, vinblastine and anisomycin all delayed the HER2 degradation caused by celecoxib analogs in different degrees. The HER2 degradation reverse effect was wortmannin>vinblastine>3-MA>anisomycin> cyclohexamine in celecoxib treated cells. That was wortmannin=cyclohexamine=anisomycin>3-MA>vinblastine in OSU-

03012 treated groups. As expected, only cycloheximide and anisomycin can vaguely dim the HER2 degradation effect of the chaperone-mediated autophagy inducer, 17-

AAG [65, 66]. Taken together, these data suggested that autophagy is essential for the stimulation of celecoxib analogs-mediated HER2 proteolysis and can be pharmacologically deferred by autophagy inhibitors.

3.3.3 Celecoxib and OSU-03012 induce HER2 degradation and anti-proliferation through lysosome/autophagy pathway.

To explore the celecoxib- and OSU-03012-regulated HER2 degradation mechanism, double immunocytochemistry staining was used to observe the cellular localization of HER2 under confocal microscope. In lysosomes and HER-2 co- staining, SKBR3 cells were seeded on the cover slide the night before cells exposure to both agents for 4 hours followed by fixation and staining with two different kinds of lysosome markers, including LAMP1 and LAMP2 [67]. Immunocytochemistry data showed that no significant co-locolization was found between LAMP1-positive- lysosomes with internalized HER2 in celecoxib and OSU-03012 treated cells.

Moreover, both compounds notably decreased the numbers of LAMP1-positive- 55 lysosomes (Fig. 3.3A). On the other hand, LAMP2, and HER-2 double-labeled vesicles were significantly increased by celecoxib and OSU-03012 concomitant with redistribution of LAMP2-positive lysosome from cytoplasm to perinucleus (Fig.

3.3B). Sum up this data and Rab7 staining result (Fig. 3.2A), it strongly supports our hypothesis that celecoxib- and OSU-03012-induced HER2 degradation is through autophagy/lysosome pathway, since LAMP2 and Rab7 have been identified as two conversion signals during autophagosome-lysosome fusion [62, 67].

To further support our findings in cell staining, the blocking agents of three major protein degradation systems (lysosomes, proteasomes and calpain) were used to validate the destined degradation organelles of celecoxib analogs-inducing- internalized HER2. Autophagy/lysosome inhibitors including; V-type H(+)-ATPase inhibitors, bafilomycin and folimycin; lysosomotropic agent, chloroquine, were added separately to the medium 30 minutes followed by cells exposed to either

50 µMcelecoxib or 5 µMOSU-03012 for 12 hours before protein lysates were collected. Bafilomycin and folimycin prominently attenuated HER2 down-regulation in response to celecoxib and OSU-03012 (Fig. 3.4A); however, chloroquine only attenuated the effect of OSU-03012, but not celecoxib. The retention of cathepsinD pro-enzyme served as an indication to prove that autophagy/lysosome inhibitors inhibited endosomes, lysosomes and secretory vesicles. Noteworthy, the activity of lysosme inhibitors seems to be compromised by celecoxib, since the retention amount of cathepsinD pro-enzyme was lesser in celecoxib and lysosome inhibitor co-treated groups than that of OSU-03012. This might explain why the celecoxib down- regulated HER-2 presented a less sensitive manner to autophagy/lysosome inhibitors comparing to that of OSU-03012. Also, we found that SKBR3 cells produce many small vacuoles evenly distributed in cytoplasm as a result of autophagy/lysosome 56 inhibitors treatment; in contrast, OSU-03012 or celecoxib induced large and perinucleus-located vacuoles. Both type of vacuoles co-existed separately in combination treated cells under daylight microscope (Fig. 3.4B). To further investigate this finding, we observed the locations of LAMP2-lysosomes and HER2 by immunocytochemistry method under confocal microscope followed by drug’s treatment. In concordance with the finding under daylight microscope, we found that

LAMP2-lysosomes in cells were dilated on account of bafilomycin treatment and bafilomycin was able to prevent the fusion of celecoxib analogs-induced intracellular

HER2 labeled vesicles with LAMP2-positive lysosomes in SKBR3 cells (Fig. 3.4C).

Several protease inhibitors were used to determine the involvement of proteases, our data indicated that OSU-03012 regulated HER-2 was more sensitive to

E64d, a membrane-permeable inhibitor of cathepsins B, H, and L than pepstatin A, an inhibitor of cathepsins D and E by reversing 10% HER-2 degradation. Whereas,

HER2 protein in celecoxib-treated cells was sensitive to both types of protease inhibitors (Fig. 3.4D, bottom panel). The proteasome inhibitors PSI and ALLN slight delayed the HER2 degradation event by OSU-03012 at 6 hours; oppositely, ALLN stimulated HER2 degradation in combination with OSU-03012 or alone at 12 hours post treatment (Fig. 3.4D, upper right panel). Celecoxib-induced HER-2 down- regulation was not response to either proteasome or calpain inhibitors, whereas, all agents accelerated the HER-2 degradation effect of celecoxib (Fig. 3.4D, upper left panel), suggesting the stimulation of HER2 proteolysis of celecoxib analogs was most likely due toautophagy/lysosomal pathway, less likely through proteasome pathway.

Given its attenuation of celecoxib- and OSU-03012-degraded-HER2, we next asked whether autophagy/lysosome inhibition also affects the cytotoxicity of OSU-

03012 and celecoxib. OSU-03012-induced reduction in cell viability, as determined 57 by MTT assay, was also attenuated by 10 µM chloroquine. The chart indicated that

17% and 44% of 1 µM and 2 µM OSU-03012 susceptible SKBR3 cells were rescued by 10 µM chloroquine, respectively after 24 hours of treatment. Less than 10% of the

10 µM and 20 µM celecoxib susceptible cells were rescued by 10 µM chloroquine

(p<0.05) (Fig. 3.4E). This result suggests a role for drug-induced autophagic/lysosomal down-regulation of HER2 in mediating the anti-proliferative effects of celecoxib and OSU-03012 in cancer cells.

58 3.3.4 Hsp90 inhibition is required for HER2 degradation by celecoxib and OSU-

03012.

Since celecoxib and OSU-03012 inhibit PDK-1 pathway function [16], we asked if these two compounds down regulate HER2 through PDK-1/Akt regulation.

We first tested whether silencing PDK-1 or Akt1 with siRNA could cause degradation of HER2 receptors. No significant HER2 reduction was found in either siRNA transfected cells, while PDK-1 siRNA caused notable amount of HER2 accumulation as determined by western blotting (Fig. 3.4A; left panel). This result was further confirmed by HER2 immunocytochemistry staining, which showed HER2 accumulation in cytoplasm by PDK-1 siRNA silencing (Fig. 3.4A; right panel).

Because ER stress as one of the drug action of OSU-03012 [22] has been implied to induce autophagy/lysosome ER-associated degradation [68], we next exam the effect of endoplasmic reticulum (ER) stress in HER2 protein regulation by using tunicamycin, an agent induces ER stress by interrupting glycosylation of receptors .

As shown in immunoblotting, tunicamycin shown dose-dependent effect on the formation of 150-kDa-deglycosylated-HER2, but didn’t show significant synergetic effect in the deduction of HER2 protein (Fig. 3.5B).

Since the activities of OSU-03012 in regulating hsp90-mediated autophagy have been implied in recent study [69, 70] and hsp90 is a well-known HER2 modulator in terms of attaining active conformations or enhancing stability [71], we assessed the effects of celecoxib and OSU-3012 on hap90 activity within cellular context via hsp90 ATP binding assay [72]. ATP binding activity was analyzed by

ATP-sepharose pull-down of hsp90 from cell lysates, followed by western blot-based quantification. We found that hsp90’s ATP binding activity was appreciable decreased in celecoxib and OSU-03012 treated cells concomitant with the degree of HER2 59 degradation level, and the decreased in ATP binding by hsp90 cannot be accounted for by changes in hsp90 level as shown in the chart (Fig. 3.5C). 17-AAG served as a positive control here. The hsp90 siRNA knockdown experiment further sustained the importance of hsp90 in HER2 protein degradation (Fig. 3.5D). In conclusion, we suggest that celecoxib analogs induce HER2 internalization through PDK-1 inhibition, and then internalized HER2 was degraded by lysosome/autophagy mechanism upon hsp90 inhibition.

3.3.5 Development of new generation of Hsp90 inhibitors from existing OSU-

03012 library .

Since we have indentified hsp90 as the target of OSU-03012-induced HER2 degradation, we further established a high through-put screening assay in order to develop more potent hsp90 inhibitors from existing library. The development of fluorescence polarization (FP) assay was executed by following previous study (Du et al, 2007) in order to find tumor-specific hsp90 inhibitors. In the following assays, the concentration of fluorescence ligand (GM-cy3B) at 50nM was used since the fluorescence intensity is significantly larger (2.4 folds) than that of background and results in a constant tracer signal approximately 221 millipolarization [73] as shown in fluorescence intensity and fluorescence polarization assays, respectively (Fig.

3.6A). The Hill and scatchard plot analysis of the experiment shown that low amount of SKBR3 cell lysate (0.73 µg) or recombination protein of hsp90 (2.26nM) was required to achieve saturation (Fig. 3.6B). The dose-dependent replacement effect by

17-AAG as shown in figure 6C indicated the specificity of this assay. To validate more potent hsp90 inhibitors, a test was performed on a subset of 17 compounds from existing OSU-03012 library. Compounds were prepared at a final concentration of 20 60 µM in binding buffer containing 50nM GM-cy3B and 0.75 µg SKBR3 cell lysate.

The competitive effect of each OSU-03012 derivatives was listed at the table 3.1. As shown here, compound T1A-10 and T3-1 both are more potent on replacing geldanamycin of the binding hsp90 among all derivatives. Two hits, T1A-10 (3-

Amino-N-{4-[3-trifluoromethyl-5-(4'-trifluoromethyl-biphenyl-4-yl)-pyrazol-1-yl]- phenyl}-propionamide) and T3-1 (1-[4-(5-Phenanthren-2-yl-3-trifluoromethyl- pyrazol-1-yl)-phenyl]-piperazine), which show significant competitive effect, will be further identified in the following study.

3.3.6 Verification of the hsp90 FP assay hits .

Indeed, these two compounds showed better effect on hsp90 inhibition evidenced by Hsp90 ATP binding assay and HER2 immunoblotting (Fig.3.7A). The docking results suggest a potential site for T1A-10 or T3-1 interactions with the geldanamycin binding site in N-terminal domain of hsp90 chaperone similar with the binding mode of radicicol [43]( (Fig. 3.7B). In this model, three hydrogen bindings are predicted between two amide groups or oxygen of T1A-10 with residue Gly108,

Gly135 or Ile110, respectively. Only one hydrogen binding was predicted between amine group of T3-1 with His154. Although T1A-10 and T3-1 have very different in chemical structure, the superimpose image indicate that these two compound share the same binding model with hsp90 with binding energy as -7.79 in T1A-10 and -8.96 in

T3-1.

To further validate the result from FP assay and computer modeling, we analyzed several client proteins status of hsp90 in drugs treated cells to evaluate the efficacy of different OSU-derived hsp90 inhibitors. As the results shown, all these three OSU-derived hsp90 inhibitors show significant HER2, PDK-1 and Akt down- 61 regulation. Among them, T3-1 exhibits the highest potency, followed by T1A-10 and

OSU-03012 with respective EC 50 values of 0.55 µM, 6.9 µM and 11 µM in HER2 down-regulation, while the strong positive control 17-AAG exhibited EC 50 values of

0.036 µM (Fig. 3.8A; upper panel). All these compounds required higher concentration on ER α down-regulation, and the EC 50 values are 23 µ M, 5.5 µM, 1.75

µM and 0.73 µ M in OSU-03012, T1A-10 and T3-1 and 17-AAG, correspondingly

(Fig. 3.8A; bottom panel). Consistent with cell line specificity of hsp90 inhibitors, both T1A-10 and T3-1 showed stronger cytotoxicity in HER2 positive (SKBR3,

IC 50 =1.56 µM in T1A-10, IC 50 =0.22 µM in T3-1; BT474, IC 50 =1.89 µM in T3-1,

IC 50 =0.12 µM in T3-1) compared to HER2 negative (MCF-7, IC 50 =3.14 µM in T1A-

10, IC 50 =0.42 µM in T3-1; MDA-MB-231, IC 50 =2.78 µM in T3-1, IC 50 =0.59 µM in T3-

1) breast cancer cell lines (Fig. 3.8B). The combination treatment with OSU-derived hsp90 inhibitors and 17-AAG showed significant synergistic effect between these two types of hsp90 inhibitors (Fig. 3.8C). In conclusion, the FP assay and computer modeling that we have established in this study provide the fundamental tools for the future OSU-03012-derived hsp90 inhibitors design and screening.

62 3.4 Discussion

Celecoxib has shown the potential anti-proliferation effect in HER2-positive breast cancer; however, the targets of celecoxib in this regards are still not comprehensive [43, 50]. In view of the fact that despite its highly selective COX-2 inhibition effect, non-COX-2 effects of celecoxib have been reported to suppress tumor growth [16, 74]. Our observations here present a new possible mechanism of non-COX anticancer effects of celecoxib, namely, down-regulating the oncoprotein,

HER2 through PDK-1 and HSP90-mediated pathway. Meanwhile, we found that autophagy plays an important role in celecoxib analogs-induced antitumor effects, since autophagy inhibitor attenuated both HER2 degradation and cell-killing effects of celecoxib analogs. To augment the hsp90 inhibition effect of celecoxib, a fluorescence polarization assay (FP) and computer modeling calculation was used to identify new generation hsp90 inhibitors from existing OSU-03012 library. We then validated the result of FP assay and computer modeling by demonstrating that celecoxib-derived T1-A10 and T3-1 compounds inhibit hsp90 function and destablize hsp90 clients including HER2, PDK-1, Akt and ER α in breast cancer cells.

Moreover, the synergistic effects in combination treatment with OSU-derived hsp90 inhibitors and 17-AAG indicated that celecoxib-derived hsp90 inhibitors possess other effect than just hsp90 inhibition and these could be the potential adjuvants for

17-AAG in clinical trails.

The formation of N-terminal 135-kDa HER2 has been reported as a result of geldanamycin, staurospore or curcumin inducing cleavage of the cytoplasmic part of

HER2, which stimulated receptor endocytic down-regulation [58, 75]. Here, we first report that PDK-1 (OSU-03012) and PI3Kinhibitors (LY294002) also cause the formation of N-terminal 135-kDa HER2. It implies that these HER2-modulators, 63 including geldanamycin, celecoxib, OSU-03012 and LY294002 might share similar mechanism in promoting HER2 endocytosis. Although the C-terminus sequence of

135-kDa HER2 is not clear, it is believed that this fragment contains ecto- and transmembrane domains plus a small part of the cytoplasmic domain of intact HER2

[76]. Since our data indicated that this 135-kDa HER2 at least contains the 1205 amino acid sequence of C-terminus HER2 according to the peptide mapping of antibody used in this study (from 1205-1255 amino acid), we highly suspect that the

135-kDa HER2 is a deglycosylated-C-terminal-cleaved HER2. The full length HER2 contains encoded 1257 amino acid, therefore, only 6 kDa molecular weight deduction of HER2 should be seen by immunoblotting asumming that cleavage site is at 1205 a.a.. As shown here, the molecular weighted of tunicymycin-induced deglycosylated-

HER2 is around 30-40 kDa lower than glycosylation-modified HER2 (p185), thereby supports the possibility of HER2 deglycosylation by HER2 inhibitors. It remains inconclusive whether 135-kDa HER2 is independent or correlated with endocytosis event. In a general concept, C-terminus cleavage of HER2 could promote endocytosis by releasing HER2 from a retention mechanism that normally sequesters the receptors at plasma membrane or by expose to an unknown crytic motif [58, 77]; however, the cleavage of the HER2 is not a requirement for internalization, since intact HER2 was still internalized by geldanamycin-stimulated HER2 endocytosis [78]. Since

LY294002 induced 135-kDa HER2 formation without internalization in serum free medium (data not shown here), our suggestion is concordant with Lerdrup and co- workers’ study, suggesting C-terminus cleavage only enhance the mobility of membrane HER2 [78].

It is well established that PtdIns(3)P signaling is important in receptor sorting to degradation pathway and transporting of newly synthesized lysosomal enzyme, 64 such as procathepsin D or the trans-Golgi network (TGN), but not endosome biogenesis[37, 79-81]. Consistent with those reports, our study provide a good model for dissect the mechanism of PI3K and PDK-1 in receptors endocytosis regulation, showing the PtdIns(3)P is pivotal in late endosome/autophagosome formation which processes receptors degradation. Nothworthy, since our data indicated that PI3K inhibitors induces C-terminus HER2 cleavage and HER2 endocytosis without hsp90 inhibition activity, it raises a possibility that 17-AAG might share similar drug action of PI3K/PDK-1 inhibitor. This hypothesis is supported by a study showing that PI3K activation abrogated the apoptosis and growth arrest induced by 17-AAG [82]. Since

17-AAG has been on clinical trails, additional studies regarding the possible link between PI3K/PDK-1 inhibition and 17-AAG-induced HER2 endocytosis is worth to be investigated.

Although celecoxib analogs and 17-AAG both inhibit Hsp90 activity and sequentially cause HER2 degradation, several characters are different between them.

First, celecoxib analogs down-regulated HER-2 is not reversed by proteasome inhibitor, MG132 and PSI, as well as proteasome/CalpainI inhibitor ALLN in longer drugs exposure time, while, 17-AAG is sensitive to all of them. We speculate this disparity is due to the drug action of 17-AAG not only inhibits Hsp90 activation, but also triggers the activation of Hsp70, an open form of Hsp70 in a triage model, which indicated a failure of the chaperones to perform protein folding or the refolding of damaged proteins leads to the recruitment of proteases or ubiquitylation enzymes to eliminate the potentially dangerous polypeptides through proteasome degradation [83,

84]. OSU-03012 presents the advantage on this point due to the rising evidences showing that hsp70 activation and overexpression confers resistance to the chemotherapies [73, 85]. Second, HER2 autophagic degradation of 17-AAG is 65 through chaperone-mediated autophagy pathways (CMA) vis-à-vis celecoxib analogs are through both macroautophagy (MA) and CMA pathways. The cross-talk among these two different forms of autophagy has been reported [63]; therefore, our study demonstrated that oncoprotein proteolysis can be regulated by both forms of autophagy. Although the consequences of autophagy are varied under different circumstances in cancer cells [86], our study indicated that oncoprotein degradation and cell death in response to autophagy inducers (celecoxib or OSU-03012) was attenuated by inhibiting autophagy in HER2 positive breast cancer cells. These results provide some value information regarding the role of autophagy in cancer therapy. In summary, celecoxib-stimulated down-regulation of HER2 is mediated through its PDK-1 and Hsp90 inhibitory effect and regulation mechanism was also demonstrated by its derivative, OSU-03012, which is more potent PDK-1 and Hsp90 inhibitor. The study not only provides important information of HER2 positive breast cancer therapy using celecoxib, but also advances our knowledge of the drug-induced autophagic down-regulation of HER2 in mediating the antiproliferative effects of these compounds in cancer cells.

Significantly, we have developed robust approaches for hsp90 inhibitors screening using FP, computer modeling and bio-assays in this study. As has been demonstrated by the correspondence of immunoblotting and ATP binding assays with both FP and computer modeling results; whereby, this platform constitutes a mechanistic basis for the structural optimization of celecoxib to generate more potent hsp90 inhibitors such as T1A-10 and T3-1. Although our work suggest that T1A-10 and T3-1 compounds act directly inside the N-terminal ATP-binding pocket of hsp90, it remains to be determined whether they can also act indirectly on hsp90. In sum, at the rising of evidences showing the values of hsp90 inhibition on anti-tumor 66 proliferation, thereby, T1A-10 and T3-1 compounds provide more choices for hsp90- targeting cancer therapy.

67 Fig. 3.1 Celecoxib, OSU-03012 and LY294002 induce HER2 endocytosis. A, immunocytochemistry data showed that all three compounds have the ability to induce HER2 [21] internalization. Nucleuses were stained by DAPI (blue).

Representative images represented cells at 24 hr after treatments and were captured by confocal microscope (upper panel). Biotin-labeling assay was conducted to measure the consequences of cell-surface HER2 after drugs treatment. The strepavidin pulled- down HER2 indicate the fate of cell surface HER2 after cell treated with indicated concentrations of various treatments. All the protein lysates were collected 6 hours after different treatments as indicated. The level of HER2 and phospho-Akt in total cell lysates was detected. The human β-actin was used as a loading control for western blot (bottom panel). B, total HER2, phospho-HER2 and phospho-Akt protein level were concomitantly down-regulated by celecoxib or OSU-03012 dose- dependently at 12 hours or 24 hours. As shown here, 2.5 µM OSU-03012 induced a greater decrease in HER-2 protein than 50 µM celecoxib. C, flow cytometry ananlysis of ectodomain HER2. The intensity of surface HER-2 level is decreased by celecoxib and OSU-03012 dose-dependently at 12 hours. The plots are represented as percentage over control in the top-right panel. The numbers on each histogram represent the percentage of total cells with negative extracelluar HER-2 staining (M1) or positive staining (M2). D, celecoxib analogs accelerate HER2 endocytosis.

Compounds treated cell were stained with HER2 (red) and transferrin receptor

(green), antibodies. Bar: 10 µM. E, celecoxib or OSU-3012 induced HER2 ubiquitionation and adaptor protein association. Co-immunoprecipitation data showed that OSU-03012 caused HER-2 ubiquitination and increased its association with endocytic adaptor proteins (AP50/ µ2). All experiments were repeated two times.

Fig. 3.1

69 Fig. 3.2 Autophgagy is crucial for PI3K/PDK-1/Akt regulated ligand- independent HER2/neu endocytosis sorting to degradation pathway. A, identification of early endosome (GST-2XFYVE) and late endosome (Rab7) synthesis. PI3P (labeled with GST-2XFYVE) and Rab7 (labeled with specific antibody) were used as markers of early and late endosomes, respectively. B, autophagosome staining. SKBR3 cells were seeded on cover slides overnight, and then treated with 50 µM-celecoxib, 5 µM-OSU-03012 and 20 µM-LY294002 for 1 hour in serum free medium following by monodensycardaverine (MDC) staining. C, the effect of autophagy inhibition on HER2 inhibitors. In presence of 5% serum, autophagy inhibitors, 3-methyladenine (10mM), wortmannin (100nM), vinblastine

(1.5 µM), anisomycin (0.5 µg/ml) and cyclohexamide (50 µg/ml) were added 30 min before cells treated with 50 µM-celecoxib or 5 µM-OSU-03012 for 6 hours prior to preparation of cell lysates and immunoblotting of HER2 and β-actin. All experiments were repeated three times.

Fig. 3.2

71 Fig. 3.3 Celecoxib and OSU-03012 induce drastic HER-2 endocytosis followed by

LAMP2-lysosome degradation. A, lysosme associated membrane protein 1

(LAMP1) lysosomes staining. Compounds treated cell were stained with HER2 and

LAMP1 (green) antibodies. B, lysosme associated membrane protein 2 (LAMP2) lysosomes staining. Compounds treated cell were stained with HER2 and LAMP2

(green) antibodies. All the images were captured under confoccal microscope (Zesis).

Bar: 10 µM

Fig. 3.3

73 Fig. 3.4 Celecoxib and OSU-03012 induce HER2 degradation and antiproliferative effects via lysosome/autophagy pathway. A, inhibition of lysosomes formation prevents HER degradation by OSU-03012 and celecoxib. All autophagy/lysosome inhibitors, bafilomycin (Ba, 100 nanomol/L), folimycin (Fo,

1µg/ml) and chloroquine (Ch, 50 µmol/LM) were added 30 min before SKBR3 cells treated celecoxib or OSU-03012 for 12 hours prior to preparation of cell lysates and immunoblotting with HER2 antibody. The accumulation of 47 kDa pro-enzyme form of cathepsin D was assessed to confirm the efficacy of all lysosome inhibitors (middle panel). The human β-actin was used as a loading control for western blot. B, vacuoles formation under inverted microscope (Nikon). Many small vacuoles in cytoplsma were observed under daylight after cells treated with lysosme inhibitor, bafilomycin

(upper). The formation of large and perinucleus located vacuoles in SKBR-3 cells were caused by OSU-03012 and celecoxib (middle). As a result of bafilomycin and

OSU-03012 combination treatment, cells contain both populations of vacuoles

(bottom). C, the fusion of HER2 compartments and LAMP2-positive lysosomes is blocking by bafilomycin was confirmed by immunofluorescent staining. Red signals represent HER2 receptors and green showed LAMP2-lysosomes. D, the effects of proteasome and calpain inhibition on HER2 degradation. The proteasome inhibitor,

MG-132 (MG, 1 µM), PSI (100 µM), or calpain I inhibitor, ALLN (10 µM) were added

30 min before SKBR3 cells treated celecoxib or OSU-03012 for 6 or 12 hours E, cell proliferation by MTT assay. Chloroquine (10 µM) was added 30 min before SKBR3 cells treated with celecoxib or OSU-03012 with indicated dosages for 24, and then cell proliferation was determined by MTT assay. Columns, mean; bars, ±SE (n=6, p<0.05).

Fig. 3.4

75 Fig. 3.5 Hsp90 inhibition is essential for PI3K/PDK-1-mediated HER2 degradation. A, after 48 hours of PDK-1 siRNA transfection, sample of SKBR3 cells were collected and analyzed by immunoblotting (left panel) and immunocytochemiestry (right panel). B, SKBR3 cells treated with tumicamycin as indicated concentrations for 24 hours after cells transfected with PDK-1 siRNA for 48 hours. C, celcoxib or OSU-03102 inhibited cellular hsp90 activity. Left panel , the amount of ATP bond-hsp90 was decreased in celecoxib or OSU-03012-teated cells lysates compared to that of vehicle. 17-AAG here served as a positive control in inhibiting the ATP binding activity of hsp90. ATP-binding protein were pulled down by ATP-sepharose beads and detected by western blot. Total lysate and affinity- purified proteins (pulldown) were blotted for HSP90α/β, HSP70, and β-actin. Right panel , the density of protein level in left panel was analyzed by gel-pro image software, then plotted by bar chart as percentage over control; Columns, mean; bars,

±SD ( n = 2-4). D, after 48 hours of PDK-1, hsp90 or hsp90+PDK-1 siRNA transfection, protein lysates of SKBR3 cells were collected and analyzed by immunoblotting using PDK-1 and hsp90 antibodies. β-actin severed as protein quantity control in every blot.

Fig. 3.5

77 Fig 3.6 High-throughput screening fluorescence polarization (FP) assay for tumor-specific Hsp90 inhibitors from OSU-03012 library. A, Upper panel , fluorescence tracer (GM-cy3B) was serially diluted in 384-well plate to generate

50 µL solutions in binding buffer. Total fluorescence intensity values of each ligand concentration were recorded and compared to that of buffer-only. Bottom panel , the polarization signal was recorded and average values plotted against ligand concentration. B, Dose-response curve for the binding of 50nM GM-cy3B to Hsp90 in SKBR3 cell or recombinant Hsp90. Upper panel , values collected at equilibrium

(22 hours) was plotted against the amount of added SKBR3 cell lysate protein (0-10

µg). Bottom panel , data was generated against the amount of added Hsp90 recombinant protein. Scatchard and Hill plots were constructed according to each data. C, increasing concentrations of 17-AAG were added to the reaction buffer containing 50nM GM-cy3B and 0.75 µg SKBR3 cell lysate at a final volume of 50 µL in each well of 384-wells plate .

Fig 3.6

79 Table 3.1 The activity of OSU-derived hsp90 inhibitors in inhibiting the binding of GM-cy3B to tumor hsp90. The competitive effect was presented as percentage of control and was caculated by dividing the each specific binding mP (reducing free

GM-cy3-B) value of inhibitor’s wells by the average mP from control; bars, ±SD ( n =

2-4).

Name Ar R Cy3B-GM F3C N N R binding (%) Ar OSU- NH2 H N 03012 2 O 86.7±7.9 T1A-2 NH2 70±24.9 H2N O T1A-5 NH2

SO2 108.9±15.7 H2N T1A-4 NH2 NH2 H2N 76.5±17 O

T3-1 H N NH 56.84±0.65 OSU-Gln NH2HCl H N NH 2 2 86.7±7.8 O O NH T1A-15 F C 2 3 NH 2 100.7±12 O T1A-16 O NH2 137.75±40 NH2 T1A-10 NH2 69.5±3.28 H2N O T1A-9 NH2 H N 2 O 119.19±34 T1A-12 NH2 NH2 H2N 79.28±18 O

H N NH 7 2 2 O 96.9±7.87

O T1B-1 NH2 H N 2 O 111.3±3.28 T1B-7 NH2 NH O 2 107.5±5.9 NH2 O H CO TM-b-Ala 3 NH2 H CO 102.95±29 3 HCl H2N O H3CO DM-b-Ala NH2 H3CO HCl H2N O 62±15 H3CO Table 3.1

81 Fig. 3.7 Effects of OSU-03012 derivatives on hsp90 inhibition and down- regulation of hsp90 client proteins. A, OSU-03102 derivatives inhibited hsp90 ATP- binding activity. Total lysate and affinity-purified proteins (ATP-sepharose pull- down) were analyzed by hsp90 α/β, HER2 and β-actin antibodies. B, interactions between potential hsp90 inhibitors and hsp90 α chaperone. The predicted docking of

T1A-10 or T3-1 into the N-terminal of hsp90 α is demonstrated. The important amino acid residues interacted with compounds labeled with name and number in upper and middle panel. The N-terminal domain of hsp90 α structure (2VCI) is shown in ribbon form in bottom panel. The T1A-10 (upper panel), T3-1 (middle panel) and superimpose of T1A-10 and T3-1 (bottom panel) are presented as stick-and-ball structures, colored by atom types. Hydrogen bonds and distances for the interactions are indicated in green and dot lines. In the structures of T1A-10 and T3-1, gray is carbon; light blue is hydrogen; blue is nitrogen; red is oxygen; green is fluorine; and yellow represents sulfonamide (data provided by M.S. Su-Lin Lee).

Fig. 3.7

83 Fig. 3.8 Target-selectivity of OSU-03012-derived hsp90 inhibitors. A, effects of

OSU-03012 , T1A-10, T3-1 and 17-AAG on expression level of HER2, PDK-1, ER α and Akt in breast cancer cells as determined by western blot. Cells were dosed with different compounds for 12 h (SKBR3) or 24 h (MCF-7) at various concentrations. β- actin was used as a loading control. The relative protein amount was normalized by dividing the ratio of HER2 versus β-actin or ER α versus β-actin in each sample against that of vehicle-control and presented underneath each lane. B , Upper panel , the effect of OSU-03012-derived hsp90 inhibitors on cell growth inhibition in different breast cancer cell lines. 2000 cells per 96-well were plated the day before treatments. After 120 hours, MTT assay was performed and cell viability charts were plotted as percentage of control and was calculated by dividing the absorbance values of inhibitors’ wells by the average absorbance from control. Points, mean; bars, ±SE

(n = 6). Bottom panel , IC50 of hsp90 inhibitors in various breast cancer cell lines was calculated and shown in table. C, CI values for cell death were determined in relation to the fraction affected using the medium dose analysis. CI values less than 1 are considered as a synergistic interaction. The combination concentrations of 17-AAG or

OSU-derived hsp90 inhibitors are indicated above the points. The line indicates the CI value as 1.

Fig. 3.8 85 CHAPTER4:

ANTITUMOR EFFECTS OF HISTONE DEACETYLASE

INHIBITOR, HDAC42 PARTLY THROUGH Hsp90-mediated

HER2 repression

Abstract

Histone deacetylase (HDAC) inhibitors, a newer class of antitumor drug, have exhibited the ability to down-regulate HER2 and ER α through transcriptional repression and hyperacetylation of heat shock protein (hsp)90, an important ATP- dependent chaperone that mediates the stability and maturation of a variety of important oncogenic proteins, including HER2, EGFR, Akt, and ER α. In the present study, we investigated the effects of various HDAC inhibitors toward the regulation of

HER2 and ER α expression and cell viability in different types of breast cancer cells.

Our data show that OSU-HDAC42, a novel phenylbutyrate-derived HDAC inhibitor, exerts a more potent suppressive effect on the expression levels of Hsp90 client proteins (HER2, ER α and Akt) than suberoylanilide hydroxamic acid (SAHA; vorinostat) and MS-275, HDAC inhibitors that are FDA-approved or in cancer clinical trials, respectively.

86 4.1 Introduction:

Core histone acetylation is involved in epigenetic signaling pathways to regulate various cellular physiological processes, including gene expression, chromatin assembly and cell proliferation, thus, misregulation of histone acetylation such as reduced or abnormal histone acetylation often leads to tumorigenesis and has been found in many types of cancer [87]. Histone deacetylase (HDAC) inhibitors have been demonstrated to induce differentiation, growth arrest and apoptosis in many types of human cancer cells in several clinical or preclinical studies [88], including those of breast cancers accompanying with depleting HER2/neu, p-AKT and ER-

α partly through heat shock protein 90-mediated pathway [10, 11]. The anticancer activities of HDAC inhibitors involve histone acetylation-dependent transcriptional modulation and histone acetylation-independent mechanism as well. A lot of important signaling regulators are implied as the nonhistone substrates of HDAC, including p53 [89, 90], stat3 [91], NFkB [92, 93] and heat shock protein 90 [10, 11].

Moreover, we have reported that HDAC inhibitor disrupts HDAC-protein phosphatase 1 complexes leading to the dephosphorylation of Akt and sequentially causes apoptosis [23]. Collectively, these findings propose that HDAC inhibitors have a broad-spectrum anti-tumor mechanism, which underscores the high efficacy of this type of compound in suppressing tumor growth.

A novel phenylbutyrate-based HDAC inhibitor, OSU-HDAC42 was recently developed in our laboratory and its potent anticancer effects has been validated via prostate cancers and hepatocellular carcinoma in both in vitro and in vivo models [94-

98]. To test the efficacy of HDAC inhibitors in breast cancer, the antitumor activity of

OSU-HDAC42 versus suberoylanilide hydroxamic acid (SAHA) or MS-275, which is currently FDA approved for treatment of cutaneous T cell lymphoma or on clinical 87 trails, was assessed in different types of breast cancer. Our results show that OSU-

HDAC42 is the most potent inhibitor on cell viability of breast cancer cells among these HDAC inhibitors and HER2 overexpressed breast caner cell line is the most susceptible one to the treatment of OSU-HDAC42. Moreover, in addiction to inducing hallmark indicators of HDAC inhibition and apoptosis with one-tenth concentration compared to other two inhibitors, OSU-HDAC42 also decreased the expression levels of HER2, ER α and Akt in different breast cancer cells. Finally,

OSU-HDAC42 suppressed the growth of orthotopic xenograft model of HER- overexpressed breast cancer through oral administration and induced intratumoral hyperacetylation of α-tubulin and reduction in HER2, as well as PARP cleavage.

These results suggest that OSU-HDAC42 is orally bioavailable HDAC inhibitor and has significant potential for HER2 positive breast cancer therapy.

88 4.2 Methods and Materials:

4.2.1 Cells culture and reagents

SKBR3, MDA-MB-231, MCF-7 and BT474 cells obtained from American

Type Culture Collection (Manassas, VA) were maintained in Dulbecco's minimal essential medium/Ham's F12 (DMEM/F12; 1:1) supplemented with 10% FBS and 10

µg/ml gentamycin (Sigma-Aldrich) at 37ºC in a humidified incubator containing 5%

CO 2. Chloroquine was purchased from Sigma-Aldrich (St Louis, MO). N-acetyl- leucinyl-L-leucinyl-L-norleucinal (ALLN) was purchased from Calbiochem (San

Diego, CA). The OSU-HDAC42, SAHA and MS275 were synthesized in our laboratory with purities exceeding 99% as shown by nuclear magnetic resonance spectroscopy. Antibodies against Akt1/2, HER2/neu, ER α, HSP90 α/β (F-8), HDAC1,

HDAC6, acetyl-lysine and p21 were purchased from Santa Cruz Biotechnology Inc.

(Santa Cruz, CA). Antibodies against poly (ADP-ribose) polymerase (PARP),

HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8 and hsp70 were purchased from Cell Signaling Technology Inc. (Beverly, MA.). Mouse antibodies against β- actin and acetylated (Ac) -tubulin were purchased from ICN Biomedicals Inc. (Costa

Mesa, CA) and Sigma-Aldrich, respectively.

4.2.2 Cell Viability Analysis

The viability of breast cancer cells was analyzed by the (3-(4,5-

Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay in six replicates.

Cells were seeded at 5,000 cells/well in 96-well, flat-bottomed plates in 10% FBS- supplemented DMEM/F12 medium. After 24 h, the medium was replaced with that containing the indicated concentrations of individual agents or combinations of drugs and 10% FBS. Control cells were treated with DMSO vehicle at a concentration 89 equal to that in drug-treated cells ( ≤0.1%, final concentration). After 24-, 48- or 72-h treatment, original medium was replaced by 200 µL of MTT reagent to each well and cells were incubated for up to 3 additional h at 37°C. The absorbances were read on a plate reader at a single wavelength of 570 nm. The concentrations of agents that inhibited viability by 50% (IC 50 ) were calculated for single agents and combinations by the median-effect method of Chou and Talalay [25] using CalcuSyn software

(Biosoft, Ferguson, MO).

4.2.3 Immunoblotting

The general procedure for the Western blot analysis was performed as follows.

4.2.4 Immunoprecipitation

SKBR3 was treated with various concentrations of OSU-03012 as indicated 90 time points and lysed by the aforementioned Nonidet P-40 isotonic lysis buffer with a mixture of protease and phosphatase inhibitors. After centrifugation at 13000 xg for

Sepharose beads at 4 °C overnight. After a brief centrifugation, protein A/G-

Sepharose beads were collected and washed with 1XPBS four times, suspended in

2XSDS sample buffer, and subjected to western blot analysis with varied antibodies as indicated.

91 4.3 Results

4.3.1 OSU-HDAC42 inhibited cell proliferation of various breast cancer cell lines with highest potency in HER2-overexpressed cells.

The anti-tumor effects of OSU-HDAC42, SAHA versus MS275 (Fig. 4.1A) were evaluated in four different breast cancer cell lines, SKBR3, BT474, MCF-7 and

MDA-MB-231. The cells were treated with individual agents at dose range from

0.001 to 10 µmol/L, and cell viability was determined using MTT assay at 24, 48 or

72 hours. All HDAC inhibitors showed a dose-dependenet reduction in cell viability and considerable antiproliferative effect wan’t shown until 48 hours. OSU-HDAC42 was significantly the most potent agent among the three HDAC inhibitors at 72 hours

(Fig. 4.1B). SKBR3, a HER2 overexpression cell line, was the most susceptible cell line to the antiproliferative effect of OSU-HDAC42 after 72 hours of treatment (IC 50 value is 0.034 µ mol/L), followed by BT474 (HER2+, ER α+), MCF-7 (HER-, ER α+) and MDA-MB-231 (HER2-, ER α-) cells for which IC 50 values were calculated to be

0.16 µmol/L, 0.2 µ mol/L and 0.79 µ mol/L, respectively (Fig. 4.1C). However, another pan-HDAC inhibitor, SAHA exhibited no significantly differential effect on growth inhibition among all the cell lines tested with IC 50 values after 72 hours treatment (SKBR3, 2.22 µmol/L; BT474, 3.81 µmol/L; MDA-MB-231, 1.42 µmol/L;

MCF-7, 1.39 µmol/L), irrespective of the difference in HER2 expression level. All cell lines were comparably susceptible to the antiproliferative effect of the class I

HDACi, MS-275 with micromolar IC 50 values (SKBR3, 1.46 µmol/L; BT474, 1.57

µmol/L; MDA-MB-231, 2.64 µmol/L; MCF-7, 0.79 µmol/L), which is similar to what we had found in SAHA treated cells. The expression levels of HER2, ER α, p-Akt

(T308), Akt1/2 and HDAC1-8 in different breast cancer cell lines was shown in figure

92 1D.

4.3.2 OSU-HDAC42 induced apoptosis in various breast cancer cell lines

The status of p21 expression and histone H3 acetylationnin drug-treated cells revealed dose-dependent up-regulation of these HDAC-associated biomarkers evidenced by immunoblotting (Fig. 4.2A), which is corresponding to the drugs’ activities in inhibiting cell proliferation. Among these three HDAC inhibitors, OSU-

HDAC42 exhibited the highest potency in stimulating p21 up-regulation and histone

H3 hyperacetylation (Fig. 4.2B). Interesting, all three HDAC inhibitors induced different degrees of significant acetyl-tubulin elevation, which was only seen in

SKBR3 cells, regardless their activity in HDAC6 regulation from previous report. We also observed a higher level of PARP cleavage in HER2-positive cells (SKBR3 and

BT474) versus HER2-negative cells (MCF-7 and MDA-MB-231), consistent with the cell viability data (Fig. 4.2A, C). This indicated that the antiproliferative effect of

OSU-HDAC42 is partly through apoptosis.

4.3.3 Treatment with HDAC inhibitors attenuated the expression levels of HER2 and ER ααα in various breast cancer cells .

It has been reported that HDAC inhibitors down-regulated HER2 and ER α by transcriptional regulation or through hsp90-mediated protein degradation [10, 11]. To shed the light into the mechanism underlying the differential antiproliferative activities of OSU-HDAC42, SAHA and MS-275, the effects of these agents on the expression levels of HER2, ER α and Akt were compared in different breast cancer cell lines by immunobloting method (Fig. 4.3A).

Immunoblotting analysis revealed that OSU-HDAC42, even at 0.1 µmol/L, 93 caused around 90% substantial reductions in the levels of HER2 and total-Akt, compared to DMSO-treated controls in SKBR3 cell after 24 hours of exposure. In contrast, both SAHA and MS-275 required at least 2.5-5 µmol/L to reach similar levels of HER2 and Akt down-regulation (Fig. 4.3B). The effect of HDAC inhibitors on HER2 or Akt was less effective in BT474 cells at 24 hours of treatment, while only

50% reduction of HER2 and little considerable decrease of Akt were observed. In addiction, no notable ER α regulation was found in HDAC inhibitors treated BT474 cell. HDAC inhibitors significantly reduced ER α expression level dose-dependently in MCF-7. OSU-HDAC42 presented 10-fold higher potency than SAHA or MS-275 on ER α down-regulation since 0.25 µmol/L OSU-HDAC42, 2.5 µ mol/L SAHA and

2.5 µmol/L MS-275 caused 94, 95% and 94% ER α reduction, respectively. However, only MS-275 caused a substantial and dose-dependent Akt down-regulation in MCF-7 cells. No considerable ER α re-expression and Akt down-regulation was seen in

HDAC inhibitors-treated MDA-MB-231 cells (Fig4.3B).

4.3.4 HDAC inhibitors induce hsp90 acetylation in HER2-overexpressed cell line

It has been reported that HDAC inhibitors cause HER2, Akt and ER α down- regulation through HDAC6-mediated hsp90 hyperacetylation and inhibition (Fuino, et al., 2003; Scott, et al., 2002; Fiskus, et al., 2007; Doung et al., 2008). Here, we tested the actetylation level of hsp90 in HDAC inhibitors –treated breast cancer cells.

Consistent with the effect of HDAC inhibitors on total Akt levels in different breast cancer cell lines, all three HDAC inhibitors caused dose-dependent increase of hsp90 acetylation level, which was only observed in SKBR3 cells (Fig. 4.4A). In addiction, hsp70 expression level was up-regulated by OSU-HDAC42 served as an indication of

94 hsp90 inhibition (Fig. 4.4B). This protein degradation can be partly reversed by lysosme inhibitor, choloroquine, but not responded to proteasome inhibitor, ALLN

(Fig. 4.4C). However, the OSU-HDAC42-down regulated ER α level was reversed by

ALLN (Fig. 4.4D).

95 Fig. 4.1 Antiproliferation effects of OSU-HDAC42, SAHA and MS-275 in four different breast cancer cell lines. A, chemical structures of OSU-HDAC42, SAHA and MS275. B, time- and dose-depepndent effects of OSU-HDAC42, SAHA and

MS275 on cell viability in SKBR3, BT474, MDA-MB-231 and MCF-7 cells. Cells were exposed to OSU-HDAC42, SAHA or MS-275 at the indicated concentrations in

10% FBS-supplemented RPMI 1640 in 96-well plates for 24, 48, or 72 hours, and cell viability was assessed by MTT assay. Points, mean; bars, ±SE ( n = 6). C, effect of

OSU-HDAC42 on the viability of HER2 over-expression cell line, SKBR3 in comparison to BT474, MCF-7 and MDA-MB-231. D, HER2, ER α, HDAC1,

HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7 and HDAC8 status of four human breast cancer cell lines: SKBR3 (HER2+, ER α-), BT474 (HER2+, ER α+),

MCF-7 (HER-, ER α+) and MDA-MB-231 (HER2-, ER α-).

Fig. 4.1

97 Fig. 4.2 E ffects of OSU-HDAC42 versus SAHA or MS-275 on the different biomarkers associated with HDAC inhibition or apoptosis in different breast cancer cell lines. The cells were exposed to indicated concentrations of OSU-

HDAC42, SAHA or MS275 in 10%-FBS containing DMEM/F12 medium for 24 hours. A, representative immunoblots of HER2 overexpression cell lines, SKBR3 and

BT474. B, signals of p21, Acetyl-H3 and Acetyl-tubulin were quantitated by image analysis software and normalized against that of β-actin. Top panel , SKBR3. bottom panel , BT474. The data was extracted from A. C, representative immunoblots of

HER2 negative cell lines, MCF-7 and MDA-MB-231.

Fig. 4.2

99 Fig. 4.3 Effects of OSU-HDAC42 versus SAHA or MS-275 on protein expression levels of HER2, Akt1/2 and ER ααα in different breast cancer cell lines. The cells were exposed to indicated concentrations of OSU-HDAC42, SAHA or MS275 in

10%-FBS containing DMEM/F12 medium for 24 hours. A, representative immunoblots of HER2, Akt1/2 or ER α expression level in various breast cancer cell lines. B, signals of HER2, Akt1/2 or ER α were quantitated by image analysis software and normalized against that of β-actin.

100

Fig. 4.3

101 Fig. 4.4 Effects of OSU-HDAC42 versus SAHA or MS-275 on hsp90 regulation.

A, Cells were exposed to indicated concentrations of OSU-HDAC42, SAHA or

MS275 in 10%-FBS containing DMEM/F12 medium for 24 hours. The hsp90 protein in cell lysate was pull-down and then level of acetyl-lysine or hsp90 was detected by immunoblotting. The representative immunoblots show the acetylation level of hsp90 and endogenous level of hsp90 in various breast cancer cell lines. B, dose-dependent effect of OSU-HDAC42 on hsp70 expression level. C, effect of proteasome (ALLN) or lysosome (Choloroquine) inhibitor on HER2 degradation causing by OSU-

HDAC42. D, effect of ALLN on OSU-HDAC42 inducing ER α degradation.

102

Fig. 4.

103

Bibliography

1. Zhao, H., et al., Different gene expression patterns in invasive lobular and ductal carcinomas of the breast. Mol Biol Cell, 2004. 15 (6): p. 2523-36.

2. Sorlie, T., et al., Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A, 2003. 100 (14): p. 8418- 23.

3. Mandlekar, S. and A.N. Kong, Mechanisms of tamoxifen-induced apoptosis. Apoptosis, 2001. 6(6): p. 469-77.

4. Vivanco, I. and C.L. Sawyers, The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer, 2002. 2(7): p. 489-501.

5. Aita, V.M., et al., Cloning and genomic organization of beclin 1, a candidate tumor suppressor gene on chromosome 17q21. Genomics, 1999. 59 (1): p. 59- 65.

6. Liang, X.H., et al., Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature, 1999. 402 (6762): p. 672-6.

7. Rubinsztein, D.C., et al., Potential therapeutic applications of autophagy. Nat Rev Drug Discov, 2007. 6(4): p. 304-12.

8. Zhang, H. and F. Burrows, Targeting multiple signal transduction pathways through inhibition of Hsp90. J Mol Med, 2004. 82 (8): p. 488-99.

9. Kamal, A., et al., A high-affinity conformation of Hsp90 confers tumour selectivity on Hsp90 inhibitors. Nature, 2003. 425 (6956): p. 407-10.

10. Fiskus, W., et al., Hydroxamic acid analogue histone deacetylase inhibitors attenuate estrogen receptor-alpha levels and transcriptional activity: a result of hyperacetylation and inhibition of chaperone function of heat shock protein 90. Clin Cancer Res, 2007. 13 (16): p. 4882-90.

11. Fuino, L., et al., Histone deacetylase inhibitor LAQ824 down-regulates Her-2 and sensitizes human breast cancer cells to trastuzumab, taxotere, gemcitabine, and epothilone B. Mol Cancer Ther, 2003. 2(10): p. 971-84.

12. Vargo-Gogola, T. and J.M. Rosen, Modelling breast cancer: one size does not fit all. Nat Rev Cancer, 2007. 7(9): p. 659-72.

105 13. Fisher, B., et al., Tamoxifen for prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel Project P-1 Study. J Natl Cancer Inst, 1998. 90 (18): p. 1371-88.

14. Fisher, B., et al., Tamoxifen for the prevention of breast cancer: current status of the National Surgical Adjuvant Breast and Bowel Project P-1 study. J Natl Cancer Inst, 2005. 97 (22): p. 1652-62.

15. Gelmann, E.P., Tamoxifen induction of apoptosis in estrogen receptor-negative cancers: new tricks for an old dog? J Natl Cancer Inst, 1996. 88 (5): p. 224-6.

16. Zhu, J., et al., From the cyclooxygenase-2 inhibitor celecoxib to a novel class of 3-phosphoinositide-dependent protein kinase-1 inhibitors. Cancer Res, 2004. 64 (12): p. 4309-18.

17. Kucab, J.E., et al., Celecoxib analogues disrupt Akt signaling, which is commonly activated in primary breast tumours. Breast Cancer Res, 2005. 7(5): p. R796-807.

18. Tseng, P.H., et al., Overcoming trastuzumab resistance in HER2- overexpressing breast cancer cells by using a novel celecoxib-derived phosphoinositide-dependent kinase-1 inhibitor. Mol Pharmacol, 2006. 70 (5): p. 1534-41.

19. Caron, R.W., et al., Activated forms of H-RAS and K-RAS differentially regulate membrane association of PI3K, PDK-1, and AKT and the effect of therapeutic kinase inhibitors on cell survival. Mol Cancer Ther, 2005. 4(2): p. 257-70.

20. Tong, Z., et al., Cytotoxicity of a non-cyclooxygenase-2 inhibitory derivative of celecoxib in non-small-cell lung cancer A549 cells. Lung Cancer, 2006. 52 (1): p. 117-24.

21. Kato, M., et al., Role of the Akt/FoxO3a pathway in TGF-beta1-mediated mesangial cell dysfunction: a novel mechanism related to diabetic kidney disease. J Am Soc Nephrol, 2006. 17 (12): p. 3325-35.

22. Yacoub, A., et al., OSU-03012 promotes caspase-independent but PERK-, cathepsin B-, BID-, and AIF-dependent killing of transformed cells. Mol Pharmacol, 2006. 70 (2): p. 589-603.

23. Chen, C.S., et al., Histone acetylation-independent effect of histone deacetylase inhibitors on Akt through the reshuffling of protein phosphatase 1 complexes. J Biol Chem, 2005. 280 (46): p. 38879-87.

24. Johnston, S.R., Clinical efforts to combine endocrine agents with targeted therapies against epidermal growth factor receptor/human epidermal growth factor receptor 2 and mammalian target of rapamycin in breast cancer. Clin Cancer Res, 2006. 12 (3 Pt 2): p. 1061s-1068s. 106 25. Chou, T.C. and P. Talalay, Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul, 1984. 22 : p. 27-55.

26. Tsai, E.M., et al., Akt activation by estrogen in estrogen receptor-negative breast cancer cells. Cancer Res, 2001. 61 (23): p. 8390-2.

27. Clark, A.S., et al., Constitutive and inducible Akt activity promotes resistance to chemotherapy, trastuzumab, or tamoxifen in breast cancer cells. Mol Cancer Ther, 2002. 1(9): p. 707-17.

28. Burgering, B.M. and G.J. Kops, Cell cycle and death control: long live Forkheads. Trends Biochem Sci, 2002. 27 (7): p. 352-60.

29. Cross, D.A., et al., Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature, 1995. 378 (6559): p. 785-9.

30. Srivastava, A.K. and S.K. Pandey, Potential mechanism(s) involved in the regulation of glycogen synthesis by insulin. Mol Cell Biochem, 1998. 182 (1- 2): p. 135-41.

31. Porchia, L.M., et al., 2-Amino-N-{4-[5-(2-phenanthrenyl)-3-(trifluoromethyl)- 1H-pyrazol-1-yl]-phe nyl} Acetamide (OSU-03012), a Celecoxib Derivative, Directly Targets p21-Activated Kinase. Mol Pharmacol, 2007. 72 (5): p. 1124- 31.

32. Viglietto, G., et al., Cytoplasmic relocalization and inhibition of the cyclin- dependent kinase inhibitor p27(Kip1) by PKB/Akt-mediated phosphorylation in breast cancer. Nat Med, 2002. 8(10): p. 1136-44.

33. Kirkegaard, T., et al., AKT activation predicts outcome in breast cancer patients treated with tamoxifen. J Pathol, 2005. 207 (2): p. 139-46.

34. Ding, H., et al., Celecoxib derivatives induce apoptosis via the disruption of mitochondrial membrane potential and activation of caspase 9. Int J Cancer, 2005. 113 (5): p. 803-10.

35. Ge, J., et al., Design, synthesis, and biological evaluation of hydroquinone derivatives of 17-amino-17-demethoxygeldanamycin as potent, water-soluble inhibitors of Hsp90. J Med Chem, 2006. 49 (15): p. 4606-15.

36. Zhang, S., et al., OSU-03012, a novel celecoxib derivative, is cytotoxic to myeloma cells and acts through multiple mechanisms. Clin Cancer Res, 2007. 13 (16): p. 4750-8.

37. Sharma, D., et al., Restoration of tamoxifen sensitivity in estrogen receptor- negative breast cancer cells: tamoxifen-bound reactivated ER recruits distinctive corepressor complexes. Cancer Res, 2006. 66 (12): p. 6370-8.

107 38. Roberts, C.G., et al., Synergistic cytotoxicity between tamoxifen and the plant toxin persin in human breast cancer cells is dependent on Bim expression and mediated by modulation of ceramide metabolism. Mol Cancer Ther, 2007. 6(10): p. 2777-85.

39. Lagadec, C., et al., Tamoxifen and TRAIL synergistically induce apoptosis in breast cancer cells. Oncogene, 2008. 27 (10): p. 1472-7.

40. Redondo, M., et al., Anticlusterin treatment of breast cancer cells increases chemotherapy- and tamoxifen-sensitivity and counteracts the inhibitory action of dexamethasone on chemotherapy-induced cytotoxicity. Breast Cancer Res, 2007. 9(6): p. R86.

41. Sabnis, G., et al., Inhibition of the phosphatidylinositol 3-kinase/Akt pathway improves response of long-term estrogen-deprived breast cancer xenografts to antiestrogens. Clin Cancer Res, 2007. 13 (9): p. 2751-7.

42. Yarden, Y., Biology of HER2 and its importance in breast cancer. Oncology, 2001. 61 Suppl 2 : p. 1-13.

43. Brough, P.A., et al., 4,5-diarylisoxazole Hsp90 chaperone inhibitors: potential therapeutic agents for the treatment of cancer. J Med Chem, 2008. 51 (2): p. 196-218.

44. Cobleigh, M.A., et al., Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2- overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol, 1999. 17 (9): p. 2639-48.

45. Miles, D.W., Update on HER-2 as a target for cancer therapy: herceptin in the clinical setting. Breast Cancer Res, 2001. 3(6): p. 380-4.

46. Vogel, C.L., et al., Efficacy and safety of trastuzumab as a single agent in first- line treatment of HER2-overexpressing metastatic breast cancer. J Clin Oncol, 2002. 20 (3): p. 719-26.

47. Schnur, R.C., et al., Inhibition of the oncogene product p185erbB-2 in vitro and in vivo by geldanamycin and dihydrogeldanamycin derivatives. J Med Chem, 1995. 38 (19): p. 3806-12.

48. Soga, S., et al., Development of radicicol analogues. Curr Cancer Drug Targets, 2003. 3(5): p. 359-69.

49. Chiosis, G., et al., A small molecule designed to bind to the adenine nucleotide pocket of Hsp90 causes Her2 degradation and the growth arrest and differentiation of breast cancer cells. Chem Biol, 2001. 8(3): p. 289-99.

50. Lanza-Jacoby, S., et al., The cyclooxygenase-2 inhibitor, celecoxib, prevents the development of mammary tumors in Her-2/neu mice. Cancer Epidemiol 108 Biomarkers Prev, 2003. 12 (12): p. 1486-91.

51. Wang, Y.C., et al., Targeting endoplasmic reticulum stress and Akt with OSU- 03012 and gefitinib or erlotinib to overcome resistance to epidermal growth factor receptor inhibitors. Cancer Res, 2008. 68 (8): p. 2820-30.

52. Hieronymus, H., et al., Gene expression signature-based chemical genomic prediction identifies a novel class of HSP90 pathway modulators. Cancer Cell, 2006. 10 (4): p. 321-30.

53. Bhat, T.N., et al., The PDB data uniformity project. Nucleic Acids Res, 2001. 29 (1): p. 214-8.

54. Rosenfeld, R.J., et al., Automated docking of ligands to an artificial active site: augmenting crystallographic analysis with computer modeling. J Comput Aided Mol Des, 2003. 17 (8): p. 525-36.

55. Du, Y., et al., High-throughput screening fluorescence polarization assay for tumor-specific Hsp90. J Biomol Screen, 2007. 12 (7): p. 915-24.

56. Vlahos, C.J., et al., A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4- morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J Biol Chem, 1994. 269 (7): p. 5241-8.

57. Hommelgaard, A.M., M. Lerdrup, and B. van Deurs, Association with membrane protrusions makes ErbB2 an internalization-resistant receptor. Mol Biol Cell, 2004. 15 (4): p. 1557-67.

58. Lerdrup, M., et al., Endocytic down-regulation of ErbB2 is stimulated by cleavage of its C-terminus. Mol Biol Cell, 2007. 18 (9): p. 3656-66.

59. Gilboa, L., et al., Roles for a cytoplasmic tyrosine and tyrosine kinase activity in the interactions of Neu receptors with coated pits. J Biol Chem, 1995. 270 (13): p. 7061-7.

60. Di Paolo, G. and P. De Camilli, Phosphoinositides in cell regulation and membrane dynamics. Nature, 2006. 443 (7112): p. 651-7.

61. Gutierrez, M.G., et al., Rab7 is required for the normal progression of the autophagic pathway in mammalian cells. J Cell Sci, 2004. 117 (Pt 13): p. 2687-97.

62. Jager, S., et al., Role for Rab7 in maturation of late autophagic vacuoles. J Cell Sci, 2004. 117 (Pt 20): p. 4837-48.

63. Massey, A.C., et al., Consequences of the selective blockage of chaperone- mediated autophagy. Proc Natl Acad Sci U S A, 2006. 103 (15): p. 5805-10.

64. Biederbick, A., H.F. Kern, and H.P. Elsasser, Monodansylcadaverine (MDC) is 109 a specific in vivo marker for autophagic vacuoles. Eur J Cell Biol, 1995. 66 (1): p. 3-14.

65. Finn, P.F., et al., Effects of small molecules on chaperone-mediated autophagy. Autophagy, 2005. 1(3): p. 141-5.

66. Solit, D.B., et al., 17-Allylamino-17-demethoxygeldanamycin induces the degradation of androgen receptor and HER-2/neu and inhibits the growth of prostate cancer xenografts. Clin Cancer Res, 2002. 8(5): p. 986-93.

67. Eskelinen, E.L., Roles of LAMP-1 and LAMP-2 in lysosome biogenesis and autophagy. Mol Aspects Med, 2006. 27 (5-6): p. 495-502.

68. Fujita, E., et al., Two endoplasmic reticulum-associated degradation (ERAD) systems for the novel variant of the mutant dysferlin: ubiquitin/proteasome ERAD(I) and autophagy/lysosome ERAD(II). Hum Mol Genet, 2007. 16 (6): p. 618-29.

69. Park, M., et al., OSU-03012 stimulates PERK-dependent increases in HSP70 expression, attenuating its lethal actions in transformed cells. Mol Pharmacol, 2008.

70. Park, M.A., et al., PERK-dependent regulation of HSP70 expression and the regulation of autophagy. Autophagy, 2008. 4(3).

71. Xu, W., et al., Sensitivity of mature Erbb2 to geldanamycin is conferred by its kinase domain and is mediated by the chaperone protein Hsp90. J Biol Chem, 2001. 276 (5): p. 3702-8.

72. Scheibel, T., T. Weikl, and J. Buchner, Two chaperone sites in Hsp90 differing in substrate specificity and ATP dependence. Proc Natl Acad Sci U S A, 1998. 95 (4): p. 1495-9.

73. Sliutz, G., et al., Drug resistance against gemcitabine and topotecan mediated by constitutive hsp70 overexpression in vitro: implication of quercetin as sensitiser in chemotherapy. Br J Cancer, 1996. 74 (2): p. 172-7.

74. Song, X., et al., Cyclooxygenase-2, player or spectator in cyclooxygenase-2 inhibitor-induced apoptosis in prostate cancer cells. J Natl Cancer Inst, 2002. 94 (8): p. 585-91.

75. Tikhomirov, O. and G. Carpenter, Geldanamycin induces ErbB-2 degradation by proteolytic fragmentation. J Biol Chem, 2000. 275 (34): p. 26625-31.

76. Tikhomirov, O. and G. Carpenter, Identification of ErbB-2 kinase domain motifs required for geldanamycin-induced degradation. Cancer Res, 2003. 63 (1): p. 39-43.

77. Sorkin, A., P.P. Di Fiore, and G. Carpenter, The carboxyl terminus of 110 epidermal growth factor receptor/erbB-2 chimerae is internalization impaired. Oncogene, 1993. 8(11): p. 3021-8.

78. Lerdrup, M., et al., Geldanamycin stimulates internalization of ErbB2 in a proteasome-dependent way. J Cell Sci, 2006. 119 (Pt 1): p. 85-95.

79. Johnson, E.E., et al., Gene silencing reveals a specific function of hVps34 phosphatidylinositol 3-kinase in late versus early endosomes. J Cell Sci, 2006. 119 (Pt 7): p. 1219-32.

80. Arico, S., et al., The tumor suppressor PTEN positively regulates macroautophagy by inhibiting the phosphatidylinositol 3-kinase/protein kinase B pathway. J Biol Chem, 2001. 276 (38): p. 35243-6.

81. Liang, X.H., et al., Beclin 1 contains a leucine-rich nuclear export signal that is required for its autophagy and tumor suppressor function. Cancer Res, 2001. 61 (8): p. 3443-9.

82. Munster, P.N., et al., Degradation of HER2 by ansamycins induces growth arrest and apoptosis in cells with HER2 overexpression via a HER3, phosphatidylinositol 3'-kinase-AKT-dependent pathway. Cancer Res, 2002. 62 (11): p. 3132-7.

83. Goldberg, A.L., Protein degradation and protection against misfolded or damaged proteins. Nature, 2003. 426 (6968): p. 895-9.

84. Luders, J., J. Demand, and J. Hohfeld, The ubiquitin-related BAG-1 provides a link between the molecular chaperones Hsc70/Hsp70 and the proteasome. J Biol Chem, 2000. 275 (7): p. 4613-7.

85. Garrido, C., et al., HSP27 and HSP70: potentially oncogenic apoptosis inhibitors. Cell Cycle, 2003. 2(6): p. 579-84.

86. Hippert, M.M., P.S. O'Toole, and A. Thorburn, Autophagy in cancer: good, bad, or both? Cancer Res, 2006. 66 (19): p. 9349-51.

87. Cress, W.D. and E. Seto, Histone deacetylases, transcriptional control, and cancer. J Cell Physiol, 2000. 184 (1): p. 1-16.

88. Minucci, S. and P.G. Pelicci, Histone deacetylase inhibitors and the promise of epigenetic (and more) treatments for cancer. Nat Rev Cancer, 2006. 6(1): p. 38-51.

89. Roy, S., et al., Histone deacetylase inhibitors differentially stabilize acetylated p53 and induce cell cycle arrest or apoptosis in prostate cancer cells. Cell Death Differ, 2005. 12 (5): p. 482-91.

90. Bode, A.M. and Z. Dong, Post-translational modification of p53 in tumorigenesis. Nat Rev Cancer, 2004. 4(10): p. 793-805. 111 91. Yuan, Z.L., et al., Stat3 dimerization regulated by reversible acetylation of a single lysine residue. Science, 2005. 307 (5707): p. 269-73.

92. Chen, L., et al., Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science, 2001. 293 (5535): p. 1653-7.

93. Chen, L.F. and W.C. Greene, Regulation of distinct biological activities of the NF-kappaB transcription factor complex by acetylation. J Mol Med, 2003. 81 (9): p. 549-57.

94. Kulp, S.K., et al., Antitumor effects of a novel phenylbutyrate-based histone deacetylase inhibitor, (S)-HDAC-42, in prostate cancer. Clin Cancer Res, 2006. 12 (17): p. 5199-206.

95. Sargeant, A.M., et al., OSU-HDAC42, a histone deacetylase inhibitor, blocks prostate tumor progression in the transgenic adenocarcinoma of the mouse prostate model. Cancer Res, 2008. 68 (10): p. 3999-4009.

96. Lu, Q., et al., Structure-based optimization of phenylbutyrate-derived histone deacetylase inhibitors. J Med Chem, 2005. 48 (17): p. 5530-5.

97. Lu, Q., et al., Zn2+-chelating motif-tethered short-chain fatty acids as a novel class of histone deacetylase inhibitors. J Med Chem, 2004. 47 (2): p. 467-74.

98. Lu, Y.S., et al., Efficacy of a novel histone deacetylase inhibitor in murine models of hepatocellular carcinoma. Hepatology, 2007. 46 (4): p. 1119-30.

112