The Mechanistic Function of the NOD-like Receptor NLRX1 in Apoptosis and Cell Death in the Nervous System

by

Muhammed Aashiq Rahman

A thesis submitted in conformity with the requirements for the degree of Masters of Science Immunology University of Toronto

© Copyright by Muhammed Aashiq Rahman 2015 ii

The Mechanistic Function of the NOD-like Receptor NLRX1 in Apoptosis and Cell Death in the Nervous System

Muhammed Aashiq Rahman

Masters of Science

Immunology University of Toronto

2015 Abstract

The mitochondrial protein NLRX1 belongs to the family of cytosolic nucleotide-binding and oligomerization domain (NOD)-like receptors (NLRs). NLRs respond to invasive pathogens, and danger signals released from dead or dying cells. The function of NLRX1 was previously reported to be in anti-viral immunity, however we propose a non-immune role for this protein in apoptosis.

We show here the function of NLRX1 to be inhibitory to extrinsic apoptosis and permissive to intrinsic apoptosis. Furthermore, we validate the previously reported interaction between NLRX1 and sterile-α and TIR motif containing protein 1 (SARM1). SARM1 is expressed in the nervous system, and has a pro-apoptotic function in addition to its role in promoting Wallerian degeneration. We found NLRX1 to have both SARM1-dependent and -independent functions during apoptosis. Furthermore, we test NLRX1 function during Wallerian degeneration following axotomy, and a central nervous system injury model involving ischemic stroke. iii

Acknowledgments

I am grateful for this opportunity to receive a Master’s of Science degree from the University of Toronto. I am honored to have worked with, and mentored by, some of the most brilliant minds in science. I take this opportunity to acknowledge some key individuals who have played essential roles during my time completing this degree. First and foremost, both Drs. Dana Philpott and Stephen Girardin have been fantastic supervisors that have kept both my passion for science, and motivation to determine the unknown fueled throughout my degree. Their continued guidance as well as scholarly insight have directed me in a highly productive and rewarding degree. Furthermore, their exemplary work ethic in balance with their personal family lives has helped me learn the lesson of prioritizing work and personal responsibilities which will be important throughout my life. My committee members Drs. Alberto Martin, and Tania Watts have helped me throughout these years, offering direction and insightful commentary at multiple checkpoints during my ongoing work. Their directional commentary has helped me focus my work and pursue angles that were previously overlooked. I also thank them for their guidance during the production of this manuscript. My lab members (from both Philpott & Girardin labs) have been nothing but extraordinary. The unity between the two laboratories, as well as mutual understandings between every member to help the daily workings of the lab created a family-like environment that facilitates scientific inquiry. Specifically, my colleagues Jessica Tsalikis and Mena Abdel-Nour have been exemplary role models that set the standards high for being ideal graduate students. Raphael Molinaro and Ivan Tattoli have been indispensable in their mentorship and technical expertise, and without them I would have been greatly overwhelmed. Furthermore, I am grateful to Dr. Konstantin Feinberg for teaching me how to compartmentalize neurons, which has helped push my project forward. Finally, Dr. Fraser Soares taught me every biochemical technique I know, and whose patience held even when asked the most basic of questions. Direct contributions: Dr. Tattoli generated the primary MEFs used extensively in this study. Dr. Soares transformed the MEFs, and cloned many of the NLRX1 and SARM1 constructs used. Ashley Zhang and I co- currently performed many of the immunoprecipitation experiments. Finally, I would also like to thank Parvati Dadwal for optimizing all tissue immunostaining experiments and her help and support during rodent surgeries.

iv

Table of Contents

Acknowledgments ...... iii 1. Introduction ...... 1 1.1 Overview of Pattern recognition receptors ...... 1 1.1.1 TLRs, RLRs, CLRs ALRs ...... 1

1.1.2 Nod-like receptors ...... 4

1.2 NLRX1 ...... 7 1.2.1 The physiological conformation of NLRX1 and its localization to the mitochondrial matrix .... 7

1.2.2 NLRX1 function in ROS production, antiviral immunity, autophagy and TLR signalling...... 9

1.2.3 The apoptotic function of NLRX1 is observed in several physiological settings ...... 13

1.3 SARM1 ...... 17 1.3.1 Proposed functions of SARM1 in TLR signalling and immunity...... 18

1.3.2 SARM1 function in Wallerian degeneration and Ca2+ dependent cell death ...... 19

1.4 Cellular death – focus on apoptosis and Wallerian degeneration...... 22 1.4.1 Apoptotic cell death ...... 23

1.4.2 Neuronal cell death and Wallerian degeneration ...... 27

2. Methodology ...... 31 3. Results ...... 35 3.1 NLRX1 blocks the sensitivity to extrinsic apoptosis signalled through TNF receptor following

cancerous SV40 transformation...... 35

3.2 NLRX1 promotes the sensitivity to intrinsic apoptosis inducers following SV40 transformation

...... 36

3.3 SARM1 interacts with NLRX1 and does not require it to localize to the mitochondria...... 37 3.4 NLRX1 forms homotypic interactions that affect SARM1 interaction...... 39 v

3.5 SARM1 functions upstream of NLRX1 during intrinsic and extrinsic apoptosis, but does not

affect NLRX1 block on extrinsic apoptosis...... 40

3.6 NLRX1 does not affect type I apoptosis via differential Smac release...... 42

3.7 NLRX1-KO does not delay Wallerian degeneration via axotomy as seen in SARM1 KO...... 43

3.8 NLRX1 functions during ischemic injury by limiting caspase dependent cell death and

subsequent microglial activation...... 44

3.8 Figures ...... 46 3.9 Tables ...... 63 4. Discussion and future directions: ...... 64

5. References ...... 69

1

1. Introduction

1.1 Overview of Pattern recognition receptors

Pattern recognition receptors (PRRs) are an indispensable group of receptors that belong to the innate arm of the immune response. There are five families of innate pattern recognition receptors that are responsible for the detection and response to conserved extracellular or intracellular danger or infectious signals. These signals collectively termed MAMPs (microbe associated molecular patterns; also known as pathogen-associated molecular patterns or PAMPs) and

DAMPs (danger associated molecular patterns) are expressed by microbes or released by dead or dying cells, respectively. The five PRR families consist of TLRs (Toll-like receptors), ALRs

(AIM-like receptors), CLRs (C-type lectin receptors) , RLRs (RIG-I like receptors), and NLRs

(Nod-like receptors), the latter of which will be the focus here. These receptors cooperatively play a role as first responders to host pathogenic invasion, and have an essential role in the development of an effective adaptive immune response. While these receptors have been classically associated with the innate and adaptive immune response, their function is not limited to these roles. Indeed, as outlined here, the five PRR families play a role in functions such as autophagy, cell death, and tumor immunity, in addition to their more classical role in the initiation and modulation of the immune response.

1.1.1 TLRs, RLRs, CLRs ALRs

The function of TLRs was one of the first to be discovered amongst the pattern recognition receptors1. They are exclusively expressed to sample extracellular ligands either by directly facing the extracellular milieu, or by facing the luminal side of intracellular vesicles, specifically 2 endosomes. TLRs are membrane bound receptors that signal to the cytosol via their toll/interleukin-1 receptor (TIR) domains upon extracellular binding and stimulation of their N- terminal leucine rich repeat (LRR) domain2. TLRs can detect a wide variety of conserved non- self, chemically distinct patterns. TLR 1, 2, 4-6, 10 (Human), and 11-12 (Mouse) are expressed on the cell surface, and detect ligands that are composed of lipids and protein; whereas TLR 3, and 7-9 are expressed in the intracellular vesicular compartment and are most important for the innate antiviral response via the detection of nucleic acid based ligands2–4.

TLR4, the first TLR in a mammalian system to be discovered, was shown to bind lipopolysaccharide (LPS)5, which is a component of the Gram-negative cell wall. Upon binding to LPS, TLR4 recruits the TIR-domain containing adaptor protein, MyD88, together with another

TIR-containing protein, TIRAP. The MyD88-TIRAP-TLR4-LPS interaction acts as a scaffold to signal for NF-κB activation. Other TLRs, following binding to their respective MAMP, will also signal through MyD88 via TIR domain containing adaptors such as TIRAP, TRIF, and TRAM, to activate NF-κB. The exception to this MyD88 dependent signalling is with TLR3, which signals directly through TRIF to activate IRF3 and IRF7 signalling leading to an interferon response6.

TLR4 can also bind the TIR-containing adaptor TRAM, which can direct the signalling through

TRIF to activate IRF3 and IRF71,2,4. Signalling through the NF-κB arm of the TLR response will result in the production of inflammatory cytokines, whereas signalling through the TRIF arm will result in the production of type I interferons2,6. In addition to bacterial sensing, TLRs have the capacity to detect viral, fungal and protozoal MAMPs2.

Collectively, the TLR family can help detect and defend against nearly all potential infectious agents. Although microbes contain a collection of MAMPs that can trigger multiple TLR cascades, members within other family of PRRs can detect other MAMPs from the same microbe, 3 which leads to overlapping detection and response6. Moreover, in the case of the detection of bacterial flagellin, two molecules from distinct PRR families (NLRC4 and TLR5) cooperate for optimal host response. These overlapping responses to the same infectious agent may have evolved to prevent microbe escape, and to tackle the microbe specificity of infection by fine tuning different physiological cell types to various infections2,6.

Retinoic acid-inducible gene I (RIG-I)- like receptors (RLRs) are a family of intercellular receptors that are important in the host innate antiviral response4,7. RLRs have complementary

PRR function with anti-viral TLRs. RIG-I, and MDA5 are two members of this family that directly detect viral RNAs and signal the production of type I and type III interferons (IFNs) via the signalling through mitochondrial antiviral signalling protein (MAVS) found on the surface of mitochondria8,9. The third RLR, LGP2, was initially thought to be a negative regulator for RIG-

I and MDA5, however recent evidence suggests a role for this member in facilitating MDA5- dependent IFN production10–12. RLRs work in unison with other anti-viral sensors such as TLR3 and ALRs to offer a wide range of detection and coordination during anti-viral immunity.

C-type lectin receptors (CTLs or CLRs) are a versatile group of receptors that are typically classified as extracellular/outer-membrane carbohydrate binding receptors13. CLRs are structurally classified into 17 sub families consisting of over 1000 members with various functions13. CLRs are known to be activated by extracellular carbohydrate MAMPs originating from, but not limited to, fungal (Dectin-1, Dectin-2, Mincle), viral (DC-SIGN), Mycobacterium

(Mincle & Dectin-1), and tumor (Dectin-1) origins14–19. Classified broadly into activating, and inhibiting sub-families, CLRs are known to activate, or inhibit pro-inflammatory signals through

NF-κB20. The discovery of CLRs as PRRs to anti-fungal MAMPs has been a primary drive in the field of anti-fungal immunity. 4

The absent in melanoma 2 (AIM2)-like receptor (ALRs) family is composed of 4 members in the human genome and 6 in mice21. It is the newest family of PRRs to be discovered with AIM2 in

2009 and IFI16 in 201022,23. ALRs are cytosolic PRRs that are responsible for detecting and responding to bacterial and viral DNA in the cytosol3,22,24. These receptors contain the IFI200 domain which detects DNA, and can possess up to two N-terminal pyrin domains (PYD)21,22.

Typically pyrin domains are associated with caspase-1 activation and inflammasome assembly, and indeed AIM2 has been shown to follow this pathway23,25. IFI16 has been shown to induce

IFN-β via IRF3 signalling22. In addition to ALRs, the discovery of cGAMP synthase (cGAS) as a cytosolic detector of DNA reveals another arm of host defence to non-self nucleic acid. cGAS is shown to bind DNA found in the cytosolic compartment and increases the production of the second messenger cGAMP, which binds and activates the adaptor stimulator of interferon genes

(STING) resulting in interferon production26. Collectively AIM2 and IFI16, which are the only two members of the ALR family with known PRR activity, as well as the cGAS-STING pathway provide redundant mechanisms of detection and response to cytosolic DNA present during infection.

1.1.2 Nod-like receptors

The nucleotide-binding oligomerization domain (NOD)-like family of receptors (NLRs) are the largest exclusively intracellular group of PRRs. Members of this family have been proposed to have a multitude of functions in addition to initiating the primary immune response seen with other PRRs. Functions including transcriptional regulation, apoptosis, and autophagy have been reported3. NLRs have similar expression profiles as other PRRs; that is, they can be expressed by cells that belong to the myeloid lineage of the immune system such as macrophages, monocytes, 5 dendritic cells and neutrophils21. In addition, NLRs are also expressed in epithelial cells, and in lymphoid cells. The differential expression of these members may help in determining the specific role that they play in the defense against pathogens.

NLRs are generally arranged into three domains. The N-terminal region contains the protein interaction domain, followed by the central nucleotide binding (NOD/NACHT) domain, followed by a string of C-terminal leucine rich repeats (LRRs)27. NLRs are sub-classified into four groups based on the structure of their N-terminal effector regions3,4,28. The four effector regions, which correspond to the four subfamilies NLRA, NLRB, NLRC, and NLRP respectively include acidic transactivation (TA), Baculoviral inhibitory repeat (BIR), caspase recruitment domain (CARD), and pyrin domains (PYD)4,28 (Figure I-1). The protein NLRX1, which is categorised under the

NLRC sub-family because of phylogenetic relationship, is in some cases classified as a separate sub-family, NLRX, as it contains an unique N-terminal domain, and no CARD domains4,25. The majority of NLRs fall under the NLRP and NLRC sub-families, which consist of 20 human, and

26 murine members3 (Figure I-1). The signalling cascades initiated between NLR family members within each sub-family can be similarly analyzed, the major differences in signalling can be seen when comparing members of different sub-families, as expected by their effector domain differences. However, this does not mean that NLRs within each sub-family follow similar functions, as members between sub-families can have homologous functionalities.

The NLRA and NLRB subfamilies contain one member each; and the NLRP sub family consist of 12 members. The members of these three sub-families trigger various responses upon the detection of MAMPs and DAMPs. MHC II transactivator (CIITA), is the NLRA member that is known to function as a transcriptional regulator of the MHC II gene29. Similar to CIITA, NLRC5 belonging to the NLRC subfamily, and also has a role in transcriptional regulation by regulating 6 the MHC I gene30. The expression of CIITA and NLRC5 is upregulated by IFN-γ which highlights their involvement downstream of T-helper cell activation3. In addition to modulating the adaptive immune response, other NLR family members such as NAIP, which belongs to the NLRB sub- family, respond to CprI of the bacterial type 3 secretion system, and activate the inflammasome via NLRC431,32. NLRC4 also belongs to the NLRC sub-family, and is the only inflammasome activator that does so lacking a PYD33,34. Other inflammasome activators belong to the NLRP sub-family, which includes the well-studied NLRP1 and NLRP3. NLRP3 interestingly, has been shown to initiate the inflammasome following the detection of a vast array of environmental, extracellular, and microbial MAMPs and DAMPs3,35. Recent studies have focused on determining the converging factor for NLRP3. Current hypotheses include ATP, and ROS as factors that potentially act downstream of MAMP and DAMP detection36,37.

Two of the best studied NLRs, NOD1 and NOD2 belong to the NLRC sub-family. The remaining four members of this family include NLRC3, NLRC4, NLRC5, and NLRX1. As indicated,

NLRC5 and NLRC4 are responsible for transcriptional regulation and inflammasome activation respectively, the other NLRC family members have unique and varying roles. NOD1 and NOD2 are both CARD containing proteins, and have been shown to detect components of the bacterial cell wall, namely peptidoglycan38–40. Following the detection of peptidoglycan, NOD1 and NOD2 activate downstream NF-κB and MAPK pathways41–43. In addition to NF-κB and MAPK signalling, NOD1 and NOD2 also elicit autophagy as another arm of immune activity to invasive pathogens44. The other two members of the NLRC sub-family are NLRC3 and NLRX1. NLRX1 will be discussed in further detail in the next section of this chapter. NLRC3 contains an N- terminal domain that is undefined, and unlike other NLRC sub-family members, does not contain a CARD domain. The classification of NLRC3 in the NLRC sub-family, like NLRX1, is due to 7 phylogenetic similarity28. NLRC3 is an emerging member of the NLR family, and initial findings have proposed its expression and function in T-cells45. NLRC3 function was also later shown in recent findings to downregulate NF-κB signalling following TLR detection of LPS46. Subsequent studies on NLRC3 will help elucidate the functionality of this protein in immune cells.

1.2 NLRX1

NLRX1 is the fifth member of the NLRC sub-family, and is the only member of the NLRs that is known to localize to the mitochondria47. The localization of NLRX1 to the mitochondria is due to the presence of an N-terminal mitochondrial leader sequence (MLS)48. In addition to the N- terminal MLS, NLRX1 also contains a central NOD/NACHT domain followed by a string of seven leucine rich repeats47. To date, several conflicting roles of NLRX1 activity have been reported ranging from ROS production, antiviral immunity, autophagy, to TLR signal regulation47,49–51. Our recent reports, in tandem with other studies have suggested a role for

NLRX1 in apoptosis, and as such we hypothesize that NLRX1 functioning in various physiological settings as a mediator of this pathway49,52,53.

1.2.1 The physiological conformation of NLRX1 and its localization to the mitochondrial matrix

A biochemical study by our group in 2009 identified the sub-cellular localization of NLRX1 to the matrix face of the mitochondrial inner membrane (MIM)48. This sub-cellular localization was determined by treating human embryonic kidney 293T (HEK293T) cells with various biochemical reagents that fractionate, and isolate different components of the mitochondria. We showed that upon treatment with these conditions, NLRX1 showed a similar localization profile to HSP60, and CoxIV, which are soluble matrix, and matrix facing MIM proteins, respectively. 8

Interestingly, when analyzing the protein sequence of NLRX1 through the in-silico algorithm,

Mitoprot, a strong predicted N-terminal mitochondrial addressing sequence was identified.

Following up with this prediction, the mitochondrial targeting function of NLRX1 was tested, and conserved during overexpression of human NLRX1 protein in Drosophila48. Additionally, the protein was found to be processed in the mitochondria, as the cleavage of the first 40 amino acids occurs after overexpression. When NLRX1 lacking the first 40 amino acids was overexpressed, it was unable to localize to the mitochondria. Furthermore, when the first 156 amino acids of

NLRX1 were cloned to the N-terminal of green fluorescent protein (GFP), the localization of

N156-GFP was targeted to the mitochondria from the cytosol. Additionally, the import and localization to the mitochondria was shown to be driven by the mitochondrial inner membrane potential ΔΨm. This reliance on ΔΨm was determined by showing that the disruption of the potential by H+ ionophore or CCCP blocks the localization of NLRX1 to the mitochondria48.

Finally, NLRX1 was also found in this study, via immunoprecipitation and mass spectrometry, to interact with UQCRC2, an inner membrane bound protein belonging to complex III of the respiratory chain48. UQCRC2 is known to have signal-peptidase activity, thus the proposed interaction with NLRX1 may be occurring transiently during the processing of the leader sequence. The function beyond signal-peptidase activity of UQCRC2 for NLRX1 is still undetermined.

Interestingly, a study in 2012 by Hong et al characterized the crystal structure of the C-terminal

LRR domain of NLRX154. They revealed that the LRR domain forms a hexameric oligomer with multiple intra- and inter-subunit interactions. Furthermore, they showed that the LRR domain from individual NLRX1 monomers forms a three-domain structure with an N-terminal helix

(LRRNT) followed by a central leucine repeat (LRRM), and a C-terminal three-helix bundle 9

(LRRCT). They further determined that the formation of a dimeric molecule is mediated by

LRRCT. The subsequent trimerization of three dimers is driven by LRRNT interactions. Lastly, they identified a positively charged arginine at aa699 as a potential interaction region of NLRX1 to RNA. The discovery of oligomerization and the potential RNA binding capacity of NLRX1 reveals potential physiological functionality of this protein. Disrupting, or deleting the critical binding regions in LRRNT and LRRCT will be a powerful tool during subsequent mechanistic studies.

1.2.2 NLRX1 function in ROS production, antiviral immunity, autophagy and TLR signalling.

The function of NLRX1 was reported by our group to potentiate reactive oxygen species (ROS) upon overexpression47. This potentiation was absent when overexpression was done with NLRX1 lacking the first 150 amino acids, suggesting that the localization of NLRX1 to the mitochondrial matrix is necessary for its function. Interestingly, overexpression of NLRX1 alone was not able to induce NF-κB signalling. However, NLRX1 overexpression during Shigella flexneri infection,

TNF-α treatment, or the treatment with the dsRNA mimetic poly(I:C), showed increases in ROS production. Furthermore, S. flexneri, and TNF-α in the presence of NLRX1 was able to increase

NF-κB and JNK signalling47. This potentiation of inflammatory signaling is hypothesized to be downstream of ROS induction, although the mechanisms of ROS induction, and NLRX1 activation are still unknown.

Another study focused on the interplay between Chlamydia trachomatis infection and epithelial cell ROS production showed that NLRX1 also increases ROS production in the presence of C. trachomatis55. This study further showed the dependence on NLRX1 for ROS production as

NLRX1-/- mouse embryonic fibroblasts (MEFs) produced less ROS during C. trachomatis 10 infection compared to WT MEFs. Furthermore, the crystallography study by Hong et al54 showed the physiological relevance of the hexameric NLRX1 during ROS production by disrupting key residues responsible for the formation of the C-terminal hexamer within the LRRNT and LRRCT regions. Following the overexpression of these altered constructs, and the subsequent analysis of

ROS production in HeLa cells, they reported the inability of mutated LRRNT and LRRCT regions to induce ROS production54.

In contrast to ROS production, Moore et al had proposed the function of NLRX1 to be a direct mediator of antiviral immunity50. They characterized the localization of an N-terminal tagged

NLRX1 to localize to the mitochondrial outer membrane (MOM), where it was shown through overexpression and immunoprecipitation to interact with the anti-viral adapter MAVS. NLRX1 was shown to inhibit MAVS-RIG-I signal propagation resulting in the absence of NF-κB signalling and IFN-β production during stimulation with poly(I:C). Additionally, this group has also proposed the function of NLRX1 in anti-viral autophagy via the interaction with Tu translation elongation factor mitochondrial (TUFM)51. They propose that the interaction with

TUFM allows the formation of an ATG5-ATG12 and ATG16 complex that will initiate the autophagy pathway. Furthermore, another group also reported the suppression of NLRX1 expression correlating with disease severity in three cohorts of cigarette smoke (CS) induced chronic obstructive pulmonary disease (COPD) patients56. They hypothesize that since the

MAVS-RIG-I antiviral pathway is an important player in the physiological response in COPD patients, NLRX1 must play a role in CS driven COPD. As such, CS treated mice also show lower levels of NLRX1 expression correlating with a higher disease index. Furthermore, when NLRX1 was supplemented via lentiviral transduction, the COPD phenotype was reduced. The mechanism of NLRX1 suppression during CS is unknown. 11

The differences in NLRX1 localization may help explain the seemingly contradictory phenotypes observed with this NLR. Our group proposed that the differences in MOM vs MIM localization may be the consequence of differential tag placement resulting in the block of the N-terminal localization sequence48. Indeed, the localization of NLRX1 to the mitochondria was blocked when the protein tag was cloned on to the N-terminal end as opposed to the C-terminal end48.

Furthermore, the processing of the mitochondrial leader sequence that is seen under C-terminal tagged NLRX1 overexpression was absent with the N-terminal tagged construct. This finding highlights the importance of an exposed, non-hindered N-terminal leader sequence in the targeting of NLRX1 to the matrix, and its subsequent processing. Furthermore, two independent studies in

2011 and 2012 published opposing evidence suggesting the function of NLRX1 was MAVS independent, and not directly linked with the anti-viral immune response57,58. Our group, as well as the group led by the late Jürg Tschopp generated NLRX1-KO mouse strains and tested in-vivo, and in-vitro responses to viral stimulation. Mouse embryonic fibroblasts (MEFs), and bone marrow derived macrophages (BMDMs) from wild-type (WT) and NLRX1-KO mice showed similar antiviral responses to stimulation with poly(I:C), and Sendai virus57,58. In addition, nasal inoculation of poly(I:C) and influenza virus; or the intravenous injection of poly(I:C) between

WT and NLRX1-KO mice resulted in similar in-vivo anti-viral responses. Furthermore, the interaction with UQCRC2, and not MAVS, was independently observed during this group's proteomic screen of NLRX1 binding partners58. However, the Tschopp group also reported no differences in NF-κB, and JNK signalling upon TNF-α stimulation, or S. flexneri infection, which is in contrast to our findings58.

Further findings from our group showed the unreliable nature of luciferase reporter assays (LRAs) during experimentation with NLRs59. Both NLRX1 and NLRC3 were shown to post- 12 transcripitionally inhibit LRAs. The overexpression of NLRX1 constructs lacking the N-terminal region, or expressing just the LRR region localize to the cytosol, as our group previously reported.

It was shown that this cytosolic localization increases the inhibition of LRAs. Furthermore, LRA inhibition was shown to be promoter independent as luciferase vectors under the control of constitutive promoters were also inhibited by NLRX1. Our findings of NLRs affecting LRAs can help explain some conflicting reports of NLRX1 function in NF-κB downregulation during TLR signalling via the adaptor molecule TRAF660,61. Altogether, these studies collectively indicate the lack of NLRX1 function during the antiviral response, and the requirement of careful analysis of this protein and its localization during non-confounding experimental conditions.

Further evidence in contradiction to the NLRX1-MAVS interaction was proposed by Li et al in

2011, as they sought to map the type I IFN proteomic network62. They FLAG-tagged cloned a total of 58 proteins with suspected and proposed involvement in the IFN antiviral pathway.

Following stimulation with viral mimetics such as poly(I:C), they proceeded with FLAG affinity purification to isolate interaction complexes. These complexes were then subject to mass spectrometry analysis to determine interactors. As type-I IFNs are a direct consequence of innate antiviral signalling through MAVS-RIG-I, and NLRX1’s proposed interaction to MAVS, they included NLRX1 as a bait in their assays. With the generation of their type I IFN interactome, they determined that NLRX1 was not one of the ten proteins identified to interact with MAVS.

However, their assays identified peroxiredoxin 3 (PRDX3), and Fas activated serine/threonine kinase domain containing protein 5 (FASTKD5) as candidate interacting partners for NLRX1.

Interestingly, these candidate interactors have proposed roles as functioning in metabolic stress and apoptosis. Although the research in FASTKD5 and PRDX3 are limited, they belong to families of proteins involved in regulating Fas receptor mediated apoptosis, and antioxidant 13 function during cell stress, respectively63. Recently, PRDX3 has been linked to inhibiting apoptosis in ovarian cancer cells, primarily through NF-κB signalling64. Additionally, the study by Li et al62 determined sterile alpha and TIR motif containing protein 1 (SARM1) as another candidate interactor of NLRX1. Interestingly, SARM1 functionality has also been recently proposed to play a role in Ca2+ induced cellular death, and Wallerian degeneration. As these interactors are primarily involved in metabolic stress and cell death, we hypothesize NLRX1 as a

NLR involved in this pathway. Moreover, Li et al62 further listed NLRX1 and SARM1 in their supplementary table as interactions validated through direct co-immunoprecipitation, suggesting that SARM1 interacts with NLRX1.

1.2.3 The apoptotic function of NLRX1 is observed in several physiological settings

The discovery of NLRX1 function in apoptosis (See later section 1.3.1 for apoptotic cell death) was proposed in two simultaneous studies conducted by our group and colleagues in 201449,53.

The study by our group (discussed in chapter 3) identified NLRX1 positively directing intrinsic apoptosis and inhibiting extrinsic apoptosis in an opposing manner49. We also observed a significant downregulation of NLRX1 expression following SV40 large-T antigen mediated transformation of primary MEFs to immortalized MEFs. This downregulation was also observed during glucose starvation. We hypothesized that since the transformation of cells mimics a cancerous phenotype, and the fact that cancer cells rely on glycolysis as opposed to oxidative phosphorylation, NLRX1 may play a differential role in the sensitivity of cancer cells to apoptosis.

Indeed, when analysing two murine models of gut carcinogenesis induced by the mitogen azoxymethane (AOM) alone, or AOM plus the gut inflammatory inducer dextran sodium sulphate

(DSS), we witnessed differences in tumor formation between WT and NLRX1-KO animals. 14

Interestingly, AOM alone induces less tumors in NLRX1-KO animals whereas AOM + DSS induces more tumors. This difference in tumor formation was attributed to the modes of cancer induction, and may relate to the differential function of NLRX1 in extrinsic versus intrinsic apoptosis. As DSS involves a rapid disruption of the epithelium and the proportional replenishment of cells to injury, the finding of more tumors in NLRX1-KO animals in the inflammatory AOM + DSS model supports the idea of NLRX1 playing an inhibitory role in the extrinsic arm of apoptosis. Furthermore, as we showed a positive role for NLRX1 during intrinsic apoptosis, the finding of less tumours in NLRX1-KO animals after treatment with AOM alone is supportive of this. During homeostatic turnover of the gut epithelium, a basal reduction in apoptosis by the enterocytes at the crypt apex in NLRX1-KO animals drives a lower proliferation rate during AOM induction leading to fewer tumors49.

In addition to our study, our collaborators Jaworska and colleagues further supported the hypothesis of NLRX1 in apoptosis by showing a role of this protein in inhibiting apoptosis in macrophages during the antiviral response to influenza A virus (IAV)53. They observed an increase in morbidity of NLRX1-KO mice infected with IAH resulting from high viral titer due to lack of type I IFN production from macrophages and increased recruitment of inflammatory cells to the lungs. They attributed the low primary antiviral response in NLRX1-KO mice to an increase in macrophage apoptosis. This contrasts with results by other groups50,65 who had observed increased IFN response in NLRX1-KO cells and proposed that the effect of NLRX1 on antiviral responses was through the direct modulation of MAVS signalling (see above). Jaworska and colleagues postulated that the increase in apoptosis in NLRX1-KO macrophages was due to the disruption of the mitochondrial inner membrane potential (ΔΨm). Furthermore, they showed via co-immunoprecipitation that the anti-apoptotic function of NLRX1 is a result of direct 15 interaction with the pro-apoptotic viral polymerase basic protein 1- frame 2 (PB1-F2) protein.

This study uniquely highlights NLRX1 function as an indirect mediator of antiviral immunity by playing a role in apoptosis rather than directly through antiviral signalling. Furthermore, the finding of PB1-F2 interacting with NLRX1 reveals a selective pressure for potential MAMPs to evolve mechanisms to alter the homeostatic function of NLRX1 during apoptosis.

Recent findings by Singh et al also supported a function for NLRX1 in cancer cell apoptosis66.

Contrary to our results49, however, they reported an increase in sensitivity of human embryonic kidney 293T (HEK293T) cells to extrinsic apoptosis induced through tumour necrosis factor-α

(TNF-α) during the overexpression of NLRX1. Subsequently, they showed the decrease in this sensitivity with NLRX1 knockdown via shRNA. They further attributed the increase in apoptosis sensitivity during NLRX1 overexpression to the increase in activity of upstream caspase 8 activity. Furthermore, they corroborated our previous finding of NLRX1 increasing ROS production during overexpression, by showing that upon treatment with TNF-α during NLRX1 overexpression, an increase in ROS production is observed. Subsequent treatment with the caspase-8 inhibitor z-IETD-fmk during this treatment and overexpression resulted in a decrease in ROS production, further supporting their hypothesis that NLRX1 functions in a caspase- dependent manner. Also in line with our result of NLRX1 being downregulated in cancerous

SV40 transformed MEFs, they showed the decreased levels of NLRX1 protein expression in breast cancer cell lines MCF-7 and T47D. They concluded that NLRX1 may affect tumor growth in the presence of TNF-α due to the decrease in MCF-7 colony formation in soft agar following

NLRX1 overexpression. The seemingly contradictory NLRX1 sensitivities to extrinsic apoptosis reported here versus our study may be attributable to the homeostatic function of NLRX1 levels in the cell (see discussion chapter 4). 16

In addition to the apoptotic function of NLRX1 in cancer and macrophage sensitivity to IAV,

NLRX1 function in apoptosis has also been reported in neuronal N2A cells in a study by Imbeault et al52. Interestingly, this study using N2A NLRX1 knock-in cell lines showed a protective phenotype from rotenone induced cell death. Correspondingly, NLRX1 knock-down N2A cell lines showed an increase in sensitivity to cell death from rotenone treatment. After observing that the pan caspase-inhibitor, z-vad, selectively protected knock-in cells and not knock-down cells from rotenone induced cell death, they hypothesized that NLRX1 promotes cellular death through an apoptotic mechanism as opposed to a necrotic one. Indeed, they observed a higher ratio of necrotic to apoptotic cells in knock-down cells by flow cytometry, using annexin-5 and propidium iodide staining following rotenone treatment. Furthermore, as NLRX1 localizes to the mitochondria, Imbeault et al assayed for mitochondrial number and morphology. They reported an increase in mitochondrial number in NLRX1 knock-in cells, and subsequently found the increase in phosphorylation of the mitochondrial fission mediator DRP152. They also reported the co-immunoprecipitation of DRP1 with NLRX1 suggesting that the protective phenotype seen in

NLRX1 knock-in cells during rotenone treatment can be ascribed to increase in mitochondrial fission.

The function of NLRX1 in cells of the central nervous system (CNS) was further reported by another group looking at the association of NLRX1 in an experimental autoimmune encephalomyelitis (EAE) model of multiple sclerosis67. This group reported the role of NLRX1 as a suppressor of inflammation during EAE, as NLRX1-/- mice exhibited higher inflammatory index and pathology following EAE induction. Corresponding to this increase in inflammation, more resident microglial, and peripheral macrophage activation was reported. The direct mechanism of increased microglial, and macrophage activation was not discussed. Furthermore, 17 whether the increase in pathological score associated with the increase in microglial activation is a consequence of increased cell death in the CNS is unknown.

The studies conducted by our group and colleagues were the first to report the function of NLRX1 in apoptosis49. With the findings of NLRX1 functioning in tumorigenesis, macrophage cell death during IAV infection, and in the central nervous system, NLRX1 appears to have an apoptotic function with multiple physiological consequences. With the identification of SARM1, another protein associated with cell death in the nervous system as a potential interacting partner, we further propose the function of NLRX1 in the nervous system as a differential mediator of cell death in the context of injury.

1.3 SARM1

SARM1 is highly conserved between vertebrates (mammals), and invertebrates, (Drosophila and

C. elegans), and belongs to a family of toll/interleukin-1 receptor (TIR) domain containing adaptor proteins68. Other members of this family include MyD88, TRAM, TRIF and TIRAP, which are involved in TLR signal propagation6,68. In addition to a TIR domain, SARM1 also contains a functional sterile-α/armadillo (SAM) domain. SARM1 has been evolutionarily conserved to have functions downstream of Ca2+ signalling69. Several roles for SARM1 have been proposed including the regulation of intrinsic apoptosis, TLR signalling, and immunity70–73.

Furthermore, recent studies have suggested a role for SARM1 in Wallerian degeneration of axons in the nervous system74–76. Wallerian degeneration is the term used for the degeneration of neuronal axons following an injury event (See section 1.4.2 on Wallerian degeneration)75,76. As

NLRX1 is proposed to interact with SARM1, the function of SARM1 in apoptosis is in support of our hypothesis of NLRX1 in this pathway. 18

1.3.1 Proposed functions of SARM1 in TLR signalling and immunity.

As SARM1 contains a TIR domain, and other TIR-containing cytosolic molecules are involved in direct TLR signalling, it is not surprising to see early research on this molecule aiming to identify a role for SARM1 in the regulation of TLR signalling pathways. In over-expression studies, mammalian SARM1 was proposed to serve as a regulator of TLR signalling; notably, in contrast to other TIR adaptors, SARM1 was shown to be a direct inhibitor of TRIF signalling during immunity resulting in the downregulation of NF-κB77. This function in immunity of

SARM1 was shown to depend on the presence of both the SAM and TIR domains77. SARM1 was also shown to inhibit MAPK pathways during LPS and poly(I:C) stimulation70. Furthermore,

SARM1 RNAi increased the levels of activator protein-1 (AP-1), another transcription factor downstream of TLR activation70.

In addition to immunity in mammals, SARM1 function in immunity was shown to be conserved evolutionarily in C. elegans with the orthologue TIR-1 functioning as a modulator of antimicrobial peptide production following infection with fungi78. The conserved function of

SARM1 in immunity is further supported with recent findings in teleost fish. Interestingly, one group identified similar immune function for the orthologue ciSARM1 during viral and bacterial

PAMP stimulation71. Interestingly they identified two novel splice variants that were shown to localize in different sub-cellular locations. These variants exhibit the capacity to modulate the expression of each other suggesting the ability for SARM1 to regulate its own activity via splicing.

Taken together, these studies highlight an important conserved role for SARM1 in immunity.

19

1.3.2 SARM1 function in Wallerian degeneration and Ca2+ dependent cell death

In contrast to the role of SARM1 in directing immunity, the high expression of SARM1 in the nervous system has led other groups to propose the role of SARM1 in neuronal cell death as a mediator of Wallerian degeneration. The hypothesis that SARM1 functions during Wallerian degeneration was first proposed by Osterloh et al in 201275. This group conducted a screen of

Drosophila mutants that were previously proposed to display delayed degeneration of axons. They identified three mutants that mimic the phenotype observed in the original mutant that delayed

Wallerian degeneration in drosophila, WLDS. These other mutants include l(3)896, l(3)4621, and l(3)470. They located SARM1 as the gene associated with these mutations. Ultimately, they hypothesized that SARM1 loss-of-function results in the long term survival of axons following axotomy. Furthermore, they showed that axon survival in SARM1-deficient animals was conserved between Drosophila and mammals (mouse), as neurons from SARM1-/- mice show significant axonal protection following axotomy both in vivo and in vitro.

Other studies have shown that SARM1 contains an MLS in addition to its TIR domain, which directs the protein to the mitochondria79. The other domain present on SARM1 is the SAM domain which was shown to be important for SARM1 oligomerization and function in Wallerian degeneration79. Subsequent studies have further identified SARM1 function in Wallerian degeneration by looking at its interplay with nicotinamide mononucleotide adenylyltransferase 2

(NMNAT2) and nicotinamide adenine mononuclotide (NAD+) that are known to be important in the Wallerian degeneration pathway.

The WLDS protein is a chimeric protein that contains both NMNAT and Ube4b regions (See section 1.4.2 on Wallerian degeneration). NMNAT activity was previously shown to be involved in delaying Wallerian degeneration similar to the phenotype observed in WLDS mice80. 20

NMNAT2, which is one of three NMNAT family members, is the only member that upon depletion, directly triggers Wallerian degeneration81. NMNAT2, compared to other members of its family, is the first to deplete following axotomy81. As NMNAT2 depletion is hypothesized to trigger the signalling during Wallerian degeneration, one study by Gilley at al sought to test for

SARM1 intersection in this pathway74. They showed the degeneration that ensues following

NMNAT2 depletion requires SARM1 since SARM1-/- axons show a protected phenotype during both NMNAT2 depletion, and axotomy74. NMNAT2, like other NMNATs will convert the substrate NMN into NAD+, thus during Wallerian degeneration, the lack of NMNAT presence leads to rising NMN and depleting NAD+ levels81. In SARM1-/- mice the levels of NMN and

NAD+ were shown to increase and fall accordingly74. Although, the levels of NMN and NAD+ were overall higher in SARM-/- versus WT, the Wallerian degeneration associated rise and fall of these two factors suggests the function of SARM1 downstream of this event. Furthermore, they attributed the function of rising NMN as opposed to declining NAD+ as the main effector in the

Wallerian degeneration phenotype upstream of SARM1 depletion. In contrast, another study by

Gerdts et al showed that SARM1 TIR domain dimerization, which they previously characterized, was sufficient in initiating the Wallerian degeneration phenotype76. This phenotype was observed following the ectopic expression of an inducible genetically engineered molecule that forms

SARM1 TIR domain dimers (sTIR) following the treatment of cells with rapamycin. Interestingly, this degenerative phenotype was attributed to SARM1 dependent NAD+ depletion as the expression of (sTIR) rapidly decreased NAD+ levels. Furthermore, the drop in NAD+ levels following the treatment with Tankyrase1 in both WT and SARM1-/- neurons showed a degenerative phenotype. Together, despite discrepancies in the underlying mechanisms linking 21

SARM1 with NMN, NAD+ and NMNAT2, these two studies outline the function of SARM1 as a necessary mediator of Wallerian degeneration.

In addition to its role in the classic Wallerian degeneration pathway, other groups have shown a conserved function of SARM1 in cell death downstream of Ca2+ signalling. Calcium dependence of SARM1 function was proposed by one group looking at the communication between left and right olfactory neurons in C. elegans69. They showed that the function of SARM1 was downstream of the Ca2+ modulator mir-71 in determining the asymmetric state of olfactory neurons during their programming sensory states to different odors. This calcium dependence of

SARM1 is observable in mammals as shown by Summers et al in a study where they describe the importance of mitochondria in neuronal degeneration82. This group proposed mitochondrial dysfunction as the stimulus that is upstream of SARM1 function in Wallerian degeneration. They highlight the dependence of SARM1 during mitochondrial depolarization following the treatment with the H+ ionophore CCCP. CCCP treatment induced degeneration of WT neurons, and left

SARM1 deficient axons intact. Furthermore, treatment with another mitochondrial disruptor rotenone also showed protection from degeneration in neurons lacking SARM1. Interestingly, this group showed that the degeneration seen during CCCP induction was potently blocked by the

Ca2+ chelator EGTA, but not other inhibitors of common cell death pathways. Moreover, the levels of Ca2+ levels following CCCP treatment were similar in WT and SARM1 deficient neurons. Thus, these two results highlight Ca2+ as an upstream regulator of SARM1 activity.

Furthermore, calcium dependence of SARM function was further proposed by another group looking at the degeneration of retinal ganglion neurons following Ca2+ dependent excitotoxicity following kainic acid (KA) treatment83. This group also showed that the upregulation of SARM1 protein following KA treatment and that the degeneration was halted upon subsequent treatment 22 with SARM1 siRNA following KA stimulation83. Overall, these studies report the function of

SARM1 in neuronal cell death downstream of Ca2+, and to be independent of apoptosis or necrosis.

As SARM1 is expressed in other physiological systems, other studies in non-neuronal settings have also highlighted the importance of SARM1 localization to the mitochondria, and showed a pro-apoptotic function in T-cell population shrinkage following infection72. Taken together, these studies highlight a role of SARM1 as a Ca2+ regulated protein that is upregulated upon axonal injury and promotes a distinct cell death pathway that facilitates Wallerian degeneration through oligomer formation and TIR domain signalling. Although both rising NMN and declining NAD+ levels have been proposed as possible events associated with SARM1-induced degeneration, the exact mechanism of degeneration induction is still unknown. The interaction of SARM1 with our mitochondrial protein of interest, NLRX1, can offer an alternate avenue of cell death research that may help elucidate the mechanistic role of these two molecules.

1.4 Cellular death – focus on apoptosis and Wallerian degeneration

There are several mechanisms of biological cell death seen under physiological conditions. These mechanisms include apoptosis, necrosis, necroptosis and autophagy. These four forms of cellular death are present in all mammalian organ systems and are initiated via different stimuli.

Furthermore, the interplay between these mechanisms in a given system can shape the physiological outcome during development or following injury or infection. In addition, the nervous system specific pathway of Wallerian degeneration explains the process of axonal death that likely occurs separately from these pathways. The mechanisms of apoptotic cell death and

Wallerian degeneration will be outlined here. 23

1.4.1 Apoptotic cell death

Apoptosis is a mechanism by which cells undergo programmed internal destruction eventually leading to the suicidal death of the cell. In contrast to other forms of cell death such as necrosis, apoptosis is a highly controlled process with multiple levels of regulation that allows the cell, or an organ system to modulate how and when to die. The initial thought of any form of death is negative, however the programmed cell death through apoptosis allows for the development, and regulation of a functioning system. One example of apoptosis during development can be observed during embryogenesis of digits in mammals where excess tissue is programmed to die to form distinct fingers84. Other forms of apoptosis occur continuously in adult systems such as during gut homeostasis where epithelial cells at the apex of the villi undergo apoptosis under normal physiological conditions resulting in the healthy turnover of the gut system followed by crypt stem cell replenishment49.

Apoptotic cells generally illicit characteristic morphological changes that include the blebbing of their plasma membrane, as well as condensation, and fragmentation of the nucleus. The fragments of apoptotic cells are then immediately taken up by phagocytic cells, such as macrophages. This rapid collection of debris allows limiting the presence of immune activating DAMPs in the extracellular milieu, thus maintaining a non-inflammatory environment84. The mechanisms leading to apoptosis can be initiated endogenously as seen during development, or exogenously during injury or infection84. The apoptotic triggers can occur from within the cell, resulting in a form of apoptosis termed “intrinsic apoptosis”, or from extracellular signals transduced through the plasma membrane, resulting in “extrinsic apoptosis”. Both types of apoptosis utilize the activity of cysteine proteases termed effector caspases84. 24

Extrinsic apoptosis involves signalling through death receptors (DRs) on the surface of the cell.

DRs include Fas receptor, as well as members of the tumor necrosis factor (TNF) family of receptors found on the plasma membrane (Figure I-2). Death receptors can be sub-divided based on the subsequent signalling that is initiated directly following ligand interaction. Class I/DISC receptors are Fas, TRAIL-R1, and TRAIL-R2, whereas class II/TRADD receptors include TNF-

R1, DR3, DR6 and EDAR85. Binding of ligands such as TNF-α, or Fas ligand to their respective

DRs initiates signalling through the cytosolic portion of the protein. Class I/DISC receptors recruit

Fas-associated protein with death domain (FADD) to the membrane bound DR. FADD interacts with the DR through homotypic death domain (DD) interactions found on both proteins85. Class

II/TRADD receptors also recruit adaptor proteins via the DD, however the main adaptor molecule is the DD-containing tumor necrosis factor receptor type 1-associated death domain protein

(TRADD). TRADD has also been shown to interact and recruit FADD via DDs resulting in

FADD-driven signalling86. Recruitment of FADD or TRADD to DRs will signal subsequent cascades, including caspase, NF-κB, and MAPK cascades that result in apoptosis, or cell survival85.

Stimulation of the TNF-R1 receptor via the ligand TNF-α initiates both pro-apoptotic and pro- survival signalling87. The pro-survival arm of TNF-R1 signalling is mediated through complex-I formation, which includes RIP1 recruitment by TRADD via a homotypic DD interaction followed by subsequent cIAP, and TRAF2/5 interactions87. The formation of complex I following TNF-α binding results in the propagation of NF-κB, and MAPK signalling through RIP1 polyubiquitination by cIAPs87. Uninhibited NF-κB translocates to the nucleus to initiate the transcription of anti-apoptotic cIAPs, and c-FLIP87. The pro-apoptotic signalling initiated by

TNF-R1 is via the formation of complex II, triggering the pro-apoptotic caspase cascade. Complex 25

II forms when RIP1 is left unubiquitinated due to low levels of cIAPs resulting in the recruitment of FADD via DD interaction86. FADD recruitment to class II/TRADD DRs mimics signalling through type I/DISC receptors88. FADD interacts with pro-caspase 8 and -10 via homotypic death effector domain (DED) interaction85. The interaction between FADD and pro-caspase-8 and -10 results in the formation of the death inducing signaling complex (DISC)88. DISC formation results in the auto-cleavage of pro-caspase-8 and -10 into the active caspase-8 and caspase-10 forms, respectively88.

Activated caspase-8 and -10, in Type I apoptosis, can directly cleave the effector caspases -3 -6 and -7 resulting in apoptosis following poly ADP-ribose polymerase 1 (PARP-1) cleavage in a mitochondria-independent manner88. Alternatively, activated caspase-8 can initiate a mitochondria-dependent apoptotic pathway resulting in the cleavage of pro-apoptotic Bcl-2 family proteins during type II apoptosis89. Inactive Bcl-2 member Bid is cleaved by activated caspase-8 into to its active form t-Bid following DISC formation. The interaction of t-Bid with

BAX or BAK results in the oligomerization and insertion of BAX/BAK into the outer membrane of the mitochondria. This oligomeric insertion triggers the loss of mitochondrial integrity thus causing mitochondrial outer membrane permeabilization (MOMP). MOMP induction facilitates the release of cytochrome c, and second mitochondria-derived activator of caspases (Smac) found within the inner mitochondrial membrane space. Release of cytochorome c into the cytosol results in its association with apoptotic protease-activating factor-1 (APAF-1) leading to the formation of the apoptosome that includes cleaved caspase-3 and -990. Cleavage of effector caspase-3 initiates the execution of apoptosis following the cleavage of PARP-1 (Figure I-2).

Both type I and type II apoptosis initiated through either class of DRs are tightly regulated by intracellular anti-apoptotic factors. The two main families of anti-apoptotic regulators are the 26

FLICE-like inhibitory proteins (cFLIPs) and the inhibitor of apoptosis (IAPs). cFLIPs are known to directly block the formation of DISC via homotypic DED interactions with FADD85. IAPs are known to work at multiple levels of the apoptosis pathway including at the apoptosome via XIAP directly inhibiting cleaved caspase-9 function91. IAPs also affect upstream apoptotic signalling by directly modulating TNF-R1 associated RIP1. The uibiquitination of RIP1 via cIAPs directs the

TNF-R1 signalling through a pro-survival phenotype91. In addition to cFLIPs, and IAPs, the Bcl-

2 family of proteins contain both pro-apoptotic and anti-apoptotic members. Two well studied anti-apoptotic members of this family include Bcl-2, and Bcl-xL that are known to block the formation of MOMP via interactions with pro-apoptotic Bcl-2 family members such as Bid92.

Interestingly, other Bcl-2 family members are involved in inhibiting Bcl-xL and Bcl-2 thereby offering a secondary layer of regulation92. Furthermore, Smac release following MOMP formation inhibits XIAP and other IAPs furthering the pro-death signalling93. Moreover, the overlapping inhibition of apoptosis via IAPs, cFLIPs and anti-apoptotic Bcl-2 members creates a level of redundancy that allows the cells to tightly regulate programmed death.

Intrinsic apoptosis, which involves death signalling induced by intracellular initiators such as

DNA damage, endoplasmic reticulum (ER) stress, hypoxia, or lack of nutrients, results in similar signalling cascades that are observed downstream of DR signalling in type II apoptosis (Figure I-

2). These intracellular insults, without signalling through DRs, are mitochondria-dependent, and directly or indirectly affecting the ΔΨm of the mitochondria which results in an increase in

84 mitochondrial permeability . The disruption of ΔΨm, destroys the mitochondrial integrity resulting in release of Smac and cytochrome c from the mitochondrial inner membrane space and formation of the apoptosome84. The intrinsic pathway can also interplay with Bcl-2 family members and form the MOMP via the processing of Bid to tBid depending on the intracellular 27 insult94. This form of apoptosis also has the capacity to be regulated via similar mechanisms by anti-apoptotic Bcl-2 family members.

Overall both intrinsic and extrinsic apoptosis are tightly regulated mechanisms that the cell utilizes to control the process of programmed cell death. Cellular death is a necessary process that allows an organ system, and ultimately an organism, to develop and shape itself in a controlled systematic manner. Furthermore, as anti-apoptotic proteins are often labelled as pro-oncogenic, determining specific regulatory mechanisms within the apoptotic pathway can help identify potential areas for anti-tumor therapies.

1.4.2 Neuronal cell death and Wallerian degeneration

The formation of MOMP in apoptosis is considered a ‘point of no return’ for the cell. The release of cytochrome c from the mitochondria, and the subsequent formation of the apoptosome with

APAF-1 does indeed create an irreversible commitment to cell death. However, studies in neuronal cell death have shown an interesting phenomenon where even following neuronal

MOMP formation, the neuronal cell remains viable. One study identified the micro-RNA miR-

29b as a pro-survival factor expressed in neurons that constitutively inhibits pro-apoptotic Bcl-2 members95. Another study observed the degradation of cytochrome c following MOMP formation in neurons by PARC, an E3 ligase96. Unbound cytochrome c is targeted for degradation as neurons express very low levels of APAF-1. The presence of low APAF-1 and pro-survival miRNAs in neurons implies that canonical cell death pathways may have alternative regulations in these cells.

It is not surprising to see an extra layer of regulatory mechanisms in neurons, as neurons are a unique biological system that must persist throughout the life of the organism. Although there are mechanisms in place to restrict cell death under normal physiological conditions, neurons still 28 undergo various forms of cell death induced upon injury including apoptosis and Wallerian degeneration.

As opposed to apoptosis, necrosis and autophagy that describe the mechanisms involved in the death of the entire cell, Wallerian degeneration describes a unique process observable in the nervous system that describes the death of axons separate from the cell body. Indeed, Wallerian degeneration is the cellular process through which neurites stemming from the cell body of neurons from both the central nervous system (CNS) and peripheral nervous system (PNS), undergo granular degeneration following an injury event such as growth factor deprivation or direct axonal severing97. Interestingly, this degeneration, initially considered a non-programmed type of axonal decay, was shown to have signalling regulation with the discovery of the Wallerian degeneration slow (WLDS) mice97. These mice were further characterized to have delayed degeneration of their neurites during injury and in a multitude of neuronal disorders98.

Interestingly, this phenotype of WLDS on the axon was not found to translate to the cell body, as the soma of WLDS neurons followed a similar course of cell death to WT neurons following trophic factor deprivation99. Additionally, this WLDS phenotype occurred independent of caspase activity, and of the apoptotic mediators Bax and Bak, suggesting an independent mechanism of cell death that does not involve canonical apoptosis100,101.

The delayed degeneration phenotype seen in WLDS mice arises with the expression of a modified

WLDS protein that contains the function of ubiquitin ligase activity of Ube4b covalently attached to nicotinamide mononucleotide adenylyltransferase 1 (NMNAT1). The functionality of both segments of the WLDS chimeric protein are necessary to yield the delayed axonal death as the

Ube4b acts to direct the full protein into the cytoplasm where it can have its function in the axonal compartment80. During Wallerian degeneration, there is an accumulation of nicotinamide 29 mononuclotide (NMN) and a decline of NAD+. Therefore, the phenotype of the WLDS protein is thought to act primarily through the NMNAT region by increasing nicotinamide adenine dinucleotide (NAD+) levels in the cell by converting NMN precursor to NAD+ 102. Whether it is the decline in NAD+ in the severed axon or the accumulation of precursor NMN that contributes to Wallerian degeneration is still debated74,76,81,103. Additionally, the expression of other members of the NMNAT family, NMNAT2 and NMNAT3 was also shown to mimic NMNAT1 activity in delaying axonal death74,81. However, the depletion of NMNAT2 alone was sufficient to trigger

Wallerian degeneration104. NMNAT1 in the chimeric WLDS protein is hypothesized to function in tandem with the cytosolic targeting function of Ube4b. Coincidentally, the function of the

NMNAT family has been shown to be localized specifically to the axonal compartment105. This was shown when the nuclear localization signal (NLS) from NMNAT1 in WLDS was deleted or when cytoplasmically targeted NMNAT1 was transduced via lentivirus following axotomy; in these conditions, the injured axons exhibited delayed degeneration105.

Downstream effector mechanisms of Wallerian degeneration are still contested. Evidence for the decline in NAD+ as the mediator in Wallerian degeneration was shown with studies measuring the levels of NAD+ and ATP during Wallerian degeneration. One study observed the drop in

NAD+, and ATP levels a few hours following axotomy in WT animals. In WLDS animals, this drop in NAD+ and ATP was not seen, and supplementing NAD+ to WT degenerating axons was shown to delay Wallerian degeneration102. In contrast, others have shown that inhibiting the enzyme that catalyzes NMN production, nicotinamide phosphoribosyltransferase (NAMPT), via

FK866 treatment offered protection to axons following injury103. This protection was observed despite the lowering of NAD+ levels, therefore the authors attributed this protection to the decrease in NMN levels, a direct product of NAMPT activity. Furthermore, giving NMN to cells 30 treated with FK866 produced a degenerative phenotype. Likely there is an interplay between declining NAD+ and rising NMN as causative events of Wallerian degeneration. Recent studies have identified SARM1 as playing a direct role in Wallerian degeneration associated with NAD+ and NMN (See section 1.3 on SARM1). The role of SARM1 in Wallerian degeneration, and subsequent death will help elucidate the downstream mechanisms of Wallerian degeneration induction. Finally, the other cell death regulator NLRX1 was proposed to interact with SARM1, which increases the complexity of Wallerian degeneration signalling and subsequent neuronal cell death. Studying the mode of the SARM1-NLRX1 interaction, and their respective roles in apoptosis and Wallerian degeneration will help uncover the biology of these pathways.

My work with the NLRX1 project began with the understanding that this protein was involved in antiviral immunity. With these findings unable to be corroborated, the requirement of a new hypothesis of NLRX1 was necessary. The findings by our research group, where my contributions began, indicate NLRX1 functionality in apoptosis. In this thesis I outline the most recent developments with NLRX1. I begin the results section with my contributions to the recent publication by Soares et al49. In this study we show the function of NLRX1 to be directly permissive to intrinsic and inhibiting extrinsic apoptosis. Furthermore, I present here unpublished data that validates a previous report of NLRX1 interacting with the nervous system protein

SARM1, and show SARM1 functionality in NLRX1-dependent apoptosis. Finally, I explore the role of NLRX1 in a CNS ischemic injury model as well as SARM1-dependent Wallerian degeneration.

31

2. Methodology

Mice Wild type, NLRX1 knockout mice (NLRX1-KO) and SARM1 knockout mice (SARM1-KO) on a pure C57Bl/6 background were bred in a pathogen-free facility and animals 6-8 weeks of age were used in this study. Experimental groups were compared with littermate controls. Animal studies were conducted under protocols approved by University of Toronto Committee on Use and Care of Animal. NLRX1-deficient mice have been previously described57.

Pial vessel disruption model of ischemia Using accepted sterile techniques for rodent surgeries, fur on and around the incision area was removed to expose skin followed by animal placement in a stereotaxic apparatus. Following incision, using a dental drill, a skull opening was made at coordinates (AP +2.0 to -1.0; L 0.7-1.0) to bregma. Dura was cut and retracted from the skull opening followed by removal of pial vessles via direct rubbing with a saline soaked cotton swab. Mice were anesthetized using isoflurane for the entirety of the procedure, followed by a post- operation ketoprofen injection (3 mg/kg) directly prior to surgery. Mice were sacrificed 24 hours post surgury via CO2 overdose followed by trans-cardial perfusion of 30mL PBS followed by 30 mL 4% paraformaldehyde (PFA) injection. Brains were isolated and post-fixed overnight in 20% sucrose + 4% PFA. Brains were removed from 4% PFA and placed in 20% sucrose and sectioned via cryostat within 10 days at 15uM at -20 oC.

Cell Culture and cell lines. Murine embryonic fibroblast (MEF) cells, as well as HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Wisent, Canada) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Wisent, Canada) and 1% penicillin/streptomycin. N2A cells were cultured in the same media but with low glucose and pyruvate. Cells were maintained in 95% air and 5% CO2 at 37 °C. Generation of primary WT and NLRX1-KO MEFs has been previously described57. WT and NLRX1-KO MEFs transformed cell lines were generated using the SV40 large T antigen. In brief, WT and NLRX1-KO MEFs were transduced with purified SV40 large T antigen LentifectTM Lentiviral Particles (GeneCopoeia) for 24hours and puromycin was added to select cells that were positive for the SV40 large T antigen. Cells positive for the SV40 large T antigen were verified by measuring the expression of the SV40 large T-antigen by qPCR. Similarly, WT and NLRX1-KO SV40-Tschopp MEFs were also monitored for SV40 expression and grown in similar conditions as described above. All experiments utilizing Western blot analysis were replicated a minimum two times.

Cell death treatments Wild type and NLRX1-KO MEFs were treated with TNF-α (10ng/mL) (Cell Signalling) + Cycloheximide (10mg/mL) (Sigma) for 6 hours to induce extrinsic apoptosis. MEFs were also treated with A2812)(* Ca2+ ionophore (2.5uM), thapsigargin (3uM), or 2-deoxyglucose (20mM) for 18 hours or as indicated to induce intrinsic apoptosis. Western blot analysis of cleaved caspase-3 (9661s, Cell Signaling) and cleaved PARP1 (9544s, Cell Signaling) were used to detect 32 apoptosis induction. Anti-tubulin (T9026, Sigma) was used to visualize normalization. All experiments utilizing Western blot analysis were replicated a minimum two times.

Cortical Neuron isolation and Campenot chamber system Primary neurons were isolated using established methods using E16.5 embryos106. Campenot chamber systems were created using established methods107. Using a pin rake (CAMP-PR) (Tyler research corp), scratches on 3 cm culture dishes coated with collagen (Sigma) were created followed by placement of Campenot chambers (CAMP8-20x20mm) (Tyler research corp) directly on top of scratches. Prior to this placement, high vacuum grease (60705 Dow Corning) was applied to Campenot chambers to create separation between the regions. P0 to P4 pups from WT, NLRX1-KO and SARM1-KO animals were sacrificed via decapitation followed by isolation of superior cervical ganglion. Four isolated ganglion were placed in the central compartment and cultured in UltraCULTURETM media without L-glutamine (BioWhittaker), + 1% penicillin/streptomycin, 3% methylcellulose, and nerve growth factor (60ng/uL) (Cedarlane). Axotomy was performed 4 days following initial plating of cells. Cells were maintained in 95% air and 5% CO2 at 37 °C.

Cloning overexpression constructs All constructs used in this study have been developed through PCR using standard cloning techniques. C-terminal HA tagged SARM1, full length C-terminal HA, C-terminal Flag tagged NLRX1, and delta-(667-696) LRRNT-NLRX1 was sub-cloned into the pcDNA3.1 expression vector through PCR amplification. C-terminal Flag tagged delta-NACHT-NLRX1 was sub- cloned into the pcDNA3.1 expression vector using overlapping cloning primers. These constructs were overexpressed in HEK293T cells overnight followed by cell lysis and immunoprecipitation using protein G agarose beads (Thermo-Fisher) + anti-HA (G036, Abm), or anti-Flag antibodies (F1804-M2, Sigma). Western-blot analysis of SARM1 and NLRX1 was perfomed using anti-Flag antibody, anti-HA antibody, anti-SARM1 antibody (GTX77621, Genetex) and anti-NLRX1 antibody (17215-I-AP, Proteintec). C-terminal Flag tagged NLRX1 and C-terminal HA tagged SARM1 used in MEF ectopic expression were sub-cloned into the pHR lentiviral vector through PCR amplification. NLRX1- FLAG and SARM-HA was co-transfected with psPAX2 packaging plasmid and pMD2.G envelope plasmid in 70% confluent HEK293T cells for 48 hours to generate lentiviral particles. Wild-type and NLRX1-KO SV40 MEFs were subject to treatments following 4 days of lentiviral transduction. NLRX1 overexpression was detected using an anti-NLRX1 antibody (04-146, Millipore), and SARM1 was detected using anti-SARM1 antibody.

Cloning SARM1 knockdowns SARM1 knockdown constructs were cloned into the pLKO.1 lentiviral vector. Constructs used include: (sh1)- 5’CCGGCTTTATCAGTTACCGGAGGAACTCGAGTTCCTCCGGTAACTGATAAAGTTTTTG3’ (sh2)- 33

5’CCGGCAAGGTCTATGCGATGCTATACTCGAGTATAGCATCGCATAGACCTTGTTTTTG 3’ (sh3)- 5’CCGGGCTTATCCAAAGCGTCATAGCCTCGAGGCTATGACGCTTTGGATAAGCTTTTTG 3’ (sh4)- 5’CCGGGCAAGAACATTGTGCCCATCACTCGAGTGATGGGCACAATGTTCTTGCTTTTTG 3’ (sh5)- 5’CCGGGCAGCCTCCTTTGGCATATTGCTCGAGCAATATGCCAAAGGAGGCTGCTTTTTG 3’ These constructs were co-transfected with psPAX2 packaging plasmid and pMD2.G envelope plasmid in 70% confluent HEK293T cells for 48 hours to generate lentiviral particles. N2A cells were transduced with viral particles followed by puromycin selection for 5 days following transduction. Presence of SARM1 was probed via western blot analysis using anti-SARM1 (GTX77621, Genetex).

Immunofluorescence Cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. Both fixed cells and brain sections were washed with PBS, and blocked with 1% bovine serum albumin (Sigma) for 30 minutes at room temperature, followed by incubation of primary antibody for 30 minutes at room temperature for cells, or overnight at 4 oC for sections. After subsequent PBS washes, secondary antibody was incubated for 30 minutes for cells or 1 hour for sections at room temperature. Cells and sections were mounted with aqueous Dako mounting medium (S3025) prior to microscopy. Antibodies used include anti-Flag, anti-HA, anti-BIII Tubulin (T8660, Sigma), anti-cleaved caspase 3, and anti-Iba1 (PA5-29436, Pierce) for primary.

Secondary antibodies used Secondary antibodies used for western blots include peroxidase conjugated anti-rabbit and anti mouse secondaries (111-035-003, Jackson Labs). Secondary antibodies used for immunofluorescence include Cy3 (115-165-003, Jackson Labs), Alexa-Fluor 488 anti-mouse (A11001, Life Technologies) and anti-rabbit (A11008, Life Technologies). All experiments utilizing Western blot analysis were replicated a minimum two times.

Mitochondrial fractionation MEFs were collected following TNF-α + Cycloheximide treatment for 6 hours in PBS. Cells were centrifuged at 1000g followed by PBS removal. Cells were lysed using MIB (210 mM mannitol, 70 mM sucrose, 1 mM EDTA, and 10 mM Hepes (pH 7.5), supplemented with protease inhibitor cocktail complete). Lysates were centrifuged at 1000g to remove plasma membrane fraction, and subsequently centrifuged at 6000g to isolate mitochondria. Isolated mitochondrial pellets were lysed in Ripa buffer and subject to Western blot analysis.

Iba1, Caspase-3, and BIII tubulin quantification. Iba1 and caspase-3 positive cells in the wild type and NLRX1-KO sections were counted in 3 sections per animal (n=6 animals per group). Iba1 was counted with 5 representative regions around the ischemic area, whereas caspase-3 was counted in the entire ischemic region. 34

Statistical analysis. Prism software was used to plot data and determine statistical significance using a Student’s t test or ANOVA. Data is presented as means ± SD or mean ± SEM as indicated. p-value of <0.05 was considered to be statistically significant.

35

3. Results

3.1 NLRX1 blocks the sensitivity to extrinsic apoptosis signalled through TNF receptor following cancerous SV40 transformation.

NLRX1 localizes to the mitochondrial matrix and is unable to attenuate anti-viral responses via the RIG-I-MAVS pathway48,57. Thus, the question of NLRX1 function was still undetermined.

We assayed for NLRX1 expression via qPCR under various stimuli such as LPS treatment, viral, and bacterial infection. We found no difference in the expression of NLRX1 under these stimuli49.

Interestingly, following the transformation of primary MEFs to cancerous transformed MEFs via lentiviral transduction of SV40 large T antigen, we found a significant downregulation of NLRX1 mRNA and protein levels49. Protein levels in WT transformed MEFs were downregulated to undetectable levels by western-blot analysis, although mRNA levels were still detectible through qPCR as reported49. As mitochondria are important during the signal transduction of extrinsic apoptotic stimuli induced via TNFα-R1, we assayed for NLRX1 function in this pathway by comparing the sensitivity of primary and SV40-transformed WT and NLRX1-KO MEFs to an extrinsic apoptotic stimulus. We isolated MEFs from WT and in-house generated NLRX1 knockout mice as previously described57. We treated these cells with TNF-α and simultaneously with the translation inhibitor cycloheximide (CHX) to induce caspase-8 dependent extrinsic apoptosis. Stimulation by TNF-α initiates both pro-survival as well as pro-apoptotic signalling, however the pro-survival pathway requires the activity of NF-κB that drives the expression of cIAPs, thus the inhibition of translation of cIAPs via CHX results in pro-apoptotic signals only91.

We found that primary NLRX1-KO MEFs showed no significant difference in apoptosis compared to WT MEFs (Figure R1A). Interestingly, we observed that NLRX1-KO transformed

MEFs were more sensitive to TNF-α + CHX treatment compared to WT transformed MEFs, as indicated by increased effector caspase-3, and PARP-1 cleavage (Figure R1B). Furthermore, we 36 also treated SV40-transformed WT and NLRX1-KO MEFs from mice independently isolated by

Jurg Tschopp’s group with TNF-α + CHX and observed a similar increase in sensitization to extrinsic apoptosis in NLRX1-KO cells (Figure R1C). Finally, we wanted to test whether ectopic

NLRX1 expression would reverse the sensitivity seen in these KO MEFs. We expressed NLRX1-

Flag ectopically via lentiviral transduction in WT and NLRX1-KO transformed MEFs and subsequently treated them with TNF-α + CHX. We observed a decrease in the sensitivity of

NLRX1-KO MEFs ectopically expressing NLRX1-Flag compared to NLRX1-KO MEFs, suggesting that the phenotype observed is NLRX1-dependent rather than a consequence of transformation differences (Figure R1D). Overall, these results highlight the inhibitory function of NLRX1 in extrinsic apoptosis in transformed cells.

3.2 NLRX1 promotes the sensitivity to intrinsic apoptosis inducers following SV40 transformation

In addition to the downregulation of NLRX1 expression during SV40 transformation, we also observed a similar downregulation of NLRX1 expression during glucose starvation49. As sustained glucose deprivation results in the intrinsic apoptotic death of the cell, we wanted to test the sensitivity of primary and transformed WT and NLRX1-KO MEFs to intrinsic signals of cell death to determine if it followed the same trend as what we observed in the case of extrinsic apoptosis. Glucose starvation of cells can be accomplished by treatment with the glycolysis inhibitor 2-deoxyglucose (2-DG). Upon treatment of primary MEFs with 2-DG, we found no induction of apoptosis in WT or NLRX1-KO cells upon 18 hours of treatment as indicated by the lack of effector caspase-3 or PARP-1 cleavage (Figure R2A). However, 18 hours of 2-DG stimulation in transformed MEFs resulted in observable cleavage of caspase-3 and PARP-1 with 37 a noted decreased sensitivity in NLRX1-KO MEFs (Figure R2B). This observation led to the hypothesis that NLRX1 functions to promote intrinsic apoptosis. We followed up with this hypothesis by treating cells with other intrinsic apoptotic inducers, such as the calcium ionophore

A2318, which triggers an increase in intracellular Ca2+. Following 18 hours of A23187 treatment, primary NLRX1-KO showed a slight decrease in sensitivity to apoptosis compared to WT as observable by the cleavage of PARP-1 (Figure R2C). Furthermore, this decreased sensitivity was more prominently visible in transformed NLRX1 MEFs as compared to WT observable by both the decrease of cleaved caspase-3 and PARP-1 (Figure R2D). Furthermore, as Ca2+ levels increase intracellularly during physiological ER stress, we wanted to test whether cell death following prolonged ER stress was also affected by NLRX1. We used the ER stress inducer thapsigargin to assess the sensitivity of WT and NLRX1-KO MEFs to cell death following ER stress. Following 18 hours of treatment with thapsigargin, we observed, similar to A23187 treatment, a slight decrease in the sensitivity of NLRX1-KO primary MEFs to cell death as observable by a decrease in caspase-3 cleavage (Figure R2E). Interestingly, this decrease was more prominent in transformed NLRX1-KO MEFs compared to WT as observable by both an increase in caspase-3 and PARP-1 cleavage (Figure R2F). Overall, these results highlight the function of NLRX1 as a molecule that promotes apoptotic signals originating from within the cell.

Taken together with the results seen with extrinsic apoptosis, we find that NLRX1 differentially sensitizes transformed cells to intrinsic versus extrinsic apoptosis.

3.3 SARM1 interacts with NLRX1 and does not require it to localize to the mitochondria.

SARM1 is a protein expressed heavily in the nervous system involved in calcium dependent cell death and Wallerian degeneration72,75. The localization of SARM1 to the mitochondria has been 38 reported by several independent studies72,79. We wanted to test the localization of SARM1 in our system by co-overexpressing C-terminal HA tagged SARM1 with C-terminal Flag tagged

NLRX1 followed by immunofluorescence (IF) analysis. Since we previously demonstrated that

NLRX1 localized to mitochondria, we used NLRX1 staining as an indicator of mitochondrial staining. In IF, we found that stainings for both SARM1 and NLRX1 were remarkably similar and co-localized in all cells over-expressing both constructs, thus showing that SARM1 localizes to mitochondria (Figure R3A). Furthermore, when in silico analysis of SARM1 protein sequence was performed via Mitoprot, a strong MLS was predicted, suggesting that the protein could be targeted to the mitochondrial matrix. We next wanted to determine whether the expression of

NLRX1 is necessary for SARM1 localization to the mitochondria. We overexpressed C-terminal

HA tagged SARM1 in WT and NLRX1-KO MEFs via lentiviral transduction. We found in both

WT and NLRX1-KO MEFs that SARM1-HA localizes to the mitochondria (Figure R3B), thus showing that NLRX1 expression is not required for SARM1 to localize to mitochondria. As

SARM1 is more conserved in evolution than NLRX1 (SARM1 is found in C. elegans and

Drosophila while NLRX1 is unique to Vertebrates), it is not surprising to observe the localization of SARM1 being independent of NLRX1. Interestingly, the interaction between SARM1 and

NLRX1 was shown by Li et al in their interaction study of the RIG-I interferon pathway62. This group, in addition to finding the interaction of these two molecules through overexpression and subsequent mass spectrometry, further validated the interaction with a direct co- immunopreciptation. We wanted to test for the interaction of SARM1 and NLRX1 in our system by overexpression. We co-overexpressed NLRX1-Flag with SARM1-HA in HEK-293T cells and immunoprecipitated Flag or HA, followed by western blot for endogenous SARM1 and NLRX1.

We found the interaction to be present in both directions of the co-immunoprecipitation during 39 co-overexpression as indicated by the presence of the SARM1 band in the immunoprecipitate-

Flag lanes (Figure R3C, indicated by *). Furthermore, the reverse pull down of NLRX1-Flag can be seen during co-precipitation of HA during co-overexpression (Figure R3C indicated by **).

Interestingly, we also identified an interaction with endogenous NLRX1 following overexpression, and immunoprecipitation of SARM1-HA (Figure R3C indicated by ∞). Overall these results suggest the localization of SARM1 to the mitochondrial matrix, and that SARM1 and NLRX1 interact in mitochondria.

3.4 NLRX1 forms homotypic interactions that affect SARM1 interaction.

Hong et al proposed that NLRX1 forms a hexamer based on crystal structure analysis of the c- terminal portion of the protein54. We wanted to test the ability of NLRX1 to form homotypic interactions by co-immunoprecipitation. To this end, we co-overexpressed C-terminal Flag and

HA tagged NLRX1 constructs in HEK-293T cells and immunoprecipitated Flag or HA. We observed that NLRX1 can form self-interactions, since both Flag- and HA-immunoprecipitated constructs can pull down proteins expressing the reverse tag during co-overexpression (Figure

R4A indicated by * and ∞). We next wanted to test whether the NACHT domain of NLRX1 was necessary for the interaction with SARM1. A previous student in the lab had generated a

ΔNACHT-NLRX1-Flag construct that lacks aa157 to aa374. We co-overexpressed full length

NLRX1-Flag or ΔNACHT-NLRX1-Flag with SARM1-HA. We found that the interaction observed with full length NLRX1-Flag was not diminished with ΔNACHT-NLRX1-Flag, suggesting a NACHT domain independent interaction between these two proteins (Figure R4B indicated by * and ∞ respectively). In their C-terminal NLRX1 crystal structure characterization,

Hong et al identified key regions within the C-terminal domain, termed LRRNT (aa667-696) and 40

LRRCT (aa697-970), which are required for the formation of the NLRX1 hexamer54.

Interestingly, mutating these regions of the protein, and the subsequent overexpression of these mutated products decreased the ROS production observed with the full length overexpression suggesting a physiological relevance for the hexamer formation. We wanted to test whether the formation of the hexamer was important during the NLRX1-SARM1 interaction. We used a

ΔLRRNT-NLRX1-Flag construct that lacks aa667 to 696 that we overexpressed in tandem with

SARM1-HA. Interestingly, the immunoprecipitated NLRX1 band following HA pulldown showed a decreased intensity compared to the full length NLRX1-Flag pull down (Figure R4C indicated by * and ∞ respectively). This decreased interaction suggests a possible role for NLRX1 hexamer formation during SARM1 interaction. Furthermore, this result suggests that the direct binding region is within the LRRCT region, or the N-terminal region of the protein. These studies have confirmed the capacity of NLRX1 to form homotypic interactions, which likely facilitate the interaction with SARM1. Subsequent studies with full LRR deletions and partial LRRCT deletions will determine the mode of interaction of these two proteins. NLRX1 constructs used for immunoprecipitation and overexpression are listed in table 1.

3.5 SARM1 functions upstream of NLRX1 during intrinsic and extrinsic apoptosis, but does not affect NLRX1 block on extrinsic apoptosis.

With the identification of SARM1 as an interactor of NLRX1, we wanted to test the capacity of

SARM1 to impact the ability of NLRX1 to regulate extrinsic and intrinsic apoptosis. We developed several SARM1 shRNA constructs via the PLKO.1 lentiviral expression system and tested their capacity of knocking down mRNA levels of SARM1 by probing for endogenous

SARM1 protein in the mouse N2A neuroblastoma cell line. We identified one construct, labelled 41 sh2, that was able to knockdown SARM1 effectively compared to scramble and others (Figure

R5A). Prior to testing the effects of the knockdown MEFs, we first validated that SARM1 was expressed in MEFs (Figure R5B). We next tested the effect of SARM1 knockdown during intrinsic apoptosis in either WT or NLRX1-KO MEFs. We transduced these lines with scramble, the competent sh2 knockdown construct, and the incompetent sh5 knockdown construct for four days followed by treatment with calcium ionophore A23187 for 18 hours. We found that under the conditions of SARM1 knockdown both WT and NLRX1-KO MEFs were unable to trigger apoptotic pathways indicated by the lack of PARP-1 and caspase-3 cleavage, suggesting a pro- apoptotic function of SARM1 (Figure R5C). This pro-apoptotic function is in line with the previously reported function of SARM1 in apoptosis72. This result also unveils the requirement for SARM1 during the NLRX1 intrinsic apoptosis pathway.

We next wanted to test the effects of SARM1 knockdown during extrinsic apoptosis. We transduced WT and NLRX1-KO MEFs with lentiviruses containing either scramble, SARM1- sh2, or SARM1-Sh5 for four days followed by treatment with TNF-α + CHX for 6 hours. In WT

MEFs, similar to what we observed in the case of intrinsic apoptosis, we observed blunted levels of cleaved PARP-1 and caspase-3 in cells displaying effective knocked down expression of

SARM1 (Figure R5D). However, in NLRX1-KO MEFs we observed no effect of SARM1 knockdown during the increased sensitivity of NLRX1-KO MEFs to extrinsic apoptosis.

Furthermore, we also observed no overall decrease in sensitivity to extrinsic stimuli under

SARM1 knockdown in NLRX1-KO MEFs as seen in wild-type (Figure R5C). Our results using

SARM1 knockdown suggest a dualistic function of NLRX1 during intrinsic and extrinsic apoptosis. In conditions where both NLRX1 and SARM1 are present, NLRX1 functions by affecting SARM1 activity, likely modulating its activity through a balance of interactions with 42 monomeric versus hexameric complexes. Furthermore, as extrinsic apoptosis can signal through the mitochondria, NLRX1 dependence for SARM1 activity is also observable during extrinsic signals when both of these molecules are present. Interestingly, NLRX1 also inhibits extrinsic apoptosis, suggestive of two simultaneous arms of this apoptotic pathway within a cell. We hypothesize that this inhibition by NLRX1 works independently of SARM1 function in an alternative arm of extrinsic apoptosis. Interestingly, two types of extrinsic apoptosis have been previously reported88. Type II apoptosis is mitochondrial dependent and follows the canonical pathway resulting in MOMP formation leading to caspase-3 cleavage. Type I apoptosis however has been reported to be mitochondria-independent, requiring the activity of caspase-8 leading to the cleavage of caspase-3 directly. This type I arm of apoptosis is modulated by XIAP, as well as

Smac release from the mitochondria91. We hypothesize NLRX1 functions to modulate Smac release from the mitochondria as a means of inhibiting this arm of apoptosis independently of

SARM1 (Figure R6A).

3.6 NLRX1 does not affect type I apoptosis via differential Smac release.

We wanted to test the capacity of NLRX1 to affect mitochondrial type I apoptosis as a mechanism of SARM1 independence. In this regard, we hypothesized the role of NLRX1 to be upstream of

Smac release from the mitochondria. Smac inhibits the effects of IAPs in the cytosol following

MOMP formation91. We wanted to test NLRX1 capacity to inhibit Smac release into the cytosol under extrinsic apoptotic stimulus. We treated WT and NLRX1-KO MEFs with TNF + CHX for

6 hours followed by mitochondrial fractionation. The cytosolic, mitochondrial, as well as separate whole cell lysates were probed for the cleavage of PARP-1, and Smac. Endogenous NLRX1 was also probed to determine whether the sub-cellular localization of this molecule changed during 43 stimulation. We found that NLRX1 expression does not affect the release of Smac from the mitochondria into the cytosol following TNF-R1 signalling during extrinsic apoptosis as indicated by similar Smac presence in the cytosolic fraction following stimulus in both WT and NLRX1-

KO MEFs (Figure R6B). This finding interestingly is in line with our previous report, which showed that that the effects of NLRX1 on extrinsic apoptosis were mitochondria intrinsic. Indeed, we showed that the sensitivity of cytochrome c release from isolated mitochondria from NLRX1-

KO MEFs was increased as compared to isolated mitochondria from WT MEFs following direct t-bid treatment49. Interestingly, NLRX1 retained its mitochondrial localization during stimulation with TNF-α (Figure R6B). Together, these results suggest that NLRX1 negatively regulates extrinsic apoptosis in a mitochondria-intrinsic and SARM1-independent manner, through a mechanism that remains unclear at this stage.

3.7 NLRX1-KO does not delay Wallerian degeneration via axotomy as seen in SARM1 KO.

Osterloh et al reported a crucial role for SARM1 in promoting Wallerian degeneration75. SARM1

KO neurons following axotomy exhibit delayed granular disintegration compared to WT75. As

NLRX1 cooperates with SARM1 in the regulation of apoptosis, we wanted to test whether

NLRX1 functions during the SARM1-dependent axotomy of neurons. We utilized the Campenot chamber system to culture the soma of neurons separate from their neurite outgrowth. In our hands, the chamber system yielded complete separation of axon and neurites (Figure R7A).

Following culture of neurons for four days, one arm of the chamber is subject to axotomy whilst the other arm is left intact as an uncut control. A schematic representation of our in-vitro culture system is outlined (Fig R7A). Quantification of degenerating axons from the axotomized arm is normalized to the uncut arm. We isolated superior cervical ganglion neurons from P0-P4 newborn 44

WT, SARM1 KO, and NLRX1-KO mice and plated them in our chamber cultures for four days before axotomy. Uncut, two hour, and six hour axotomized cultures were analyzed for degenerating axons. We found no difference between WT and NLRX1-KO axon degeneration, however SARM1 KO axons showed a complete protective phenotype, as previously reported

(Figure R7B, Figure R7C). Since axotomy-mediated cell death is thought to depend on Ca2+ accumulation in axons, thus an intrinsic form of cell death, and since we found that NLRX1 was dispensable for SARM1-mediated intrinsic cell death in MEFs, this result may not be surprising.

However, Wallerian degeneration can also be induced by extrinsic cues, such as growth factor withdrawal. It will thus be interesting to study NLRX1 functions in tandem with SARM1 in these pathways.

3.8 NLRX1 functions during ischemic injury by limiting caspase dependent cell death and subsequent microglial activation.

We found two arms of NLRX1 activity during extrinsic apoptosis following SARM1 knock down.

As one of these arms is independent of SARM1 we wanted to test NLRX1 function during central nervous system injury that is not Wallerian degeneration. As NLRX1 functions during caspase- dependent apoptotic cell death, we utilized the pial vessel disruption model to induce permanent ischemic injury in mice. Previous reports have described the maximum amount of apoptotic cell death following ischemic injury to be up to 24 hours following injury108. Using E.16 embryonic isolation of primary cortical neurons we determined the expression of NLRX1 in these cells

(Figure R8A). We subjected WT and NLRX1-KO mice to ischemic injury for 24 hours followed by sacrifice and brain isolation. Our treatment paradigm is outlined (Figure R8B). We analyzed

15-micron brain sections around the ischemic hemisphere for the cleavage of caspase-3 by IF. We 45 saw a significant two-fold increase in the cleavage of caspase-3 in NLRX1-KO mice compared to WT 24 hours following ischemic injury (Figure R8C & D). Furthermore, we also observed a significant doubling of microglial activation via the immunostaining for Iba-1+ cells in NLRX1-

KO mice compared to WT. This increase in microglial activation in NLRX1-KO mice has also been reported by Eitas et al during EAE induction67. Interestingly, this group proposed the activation as a direct effect of NLRX1 and not secondary following apoptosis. We propose this activation as a result of increased apoptosis and damage in these mice, as supported by our caspase-3 IF data. Subsequent studies focusing on behavioral deficits, as well as recovery following injury in NLRX1-KO mice will determine the clinical relevance of NLRX1 during ischemia. Furthermore, co-stain experiments utilizing cleaved caspase-3 in tandem with neuronal, glial and immune markers will determine the cell specificity of apoptosis.

46

3.8 Figures

47

48

49

50

51

52

53

54

55

56

57

58

59

60

61

62

63

3.9 Tables

NLRX1 Constructs Deleted region Pictorial representation NLRX1 Full length None with C-terminal HA tag in pcDNA3.1

NLRX1 Full length None with C-terminal Flag tag in pcDNA3.1

Delta NACHT NACHT region NLRX1 with C- (amino acid terminal Flag tag. 157-374) ΔNACHT-NLRX1- Flag in pcDNA3.1

Delta N-terminal LRRNT region Leucine Rich (amino acid repeat (LRRNT) 667-696) NLRX1 with C- terminal Flag tag ΔLRRNT-NLRX1- Flag in pcDNA3.1

Table 1. Representation of cloned NLRX1 constructs used during immunoprecipitation and overexpression experiments.

64

4. Discussion and future directions:

NLRX1 is an NLR protein that localizes to the mitochondrial matrix. The unconventional localization of this protein compared to other members of its family has led us to the hypothesis of its function in mitochondrial physiology rather than immune regulation as previously proposed.

Our group, in addition to others, have shown the lack of direct NLRX1 function in the immune antiviral response57,58. Subsequently, NLRX1 function during apoptosis was proposed by us and colleagues49,53. We show here the effects of NLRX1 promoting intrinsic and inhibiting extrinsic apoptosis, respectively. Interestingly, the finding of SARM1 to be an interactor of NLRX1 was proposed by Li et al62. We further validated this interaction and showed the capacity of NLRX1 to interact with SARM1 via full length and ΔNACHT constructs suggesting the interacting region to be located within the immediate N-terminal or C-terminal regions. As the N-terminal region is required for NLRX1 entry into the mitochondrial matrix we believe the interacting region is likely within the LRR domain. We followed up with results proposed by Hong et al that suggested the formation of a hexameric molecule to affect physiological responses54. We tested the capacity of

NLRX1 constructs lacking aa667-696, termed the LRRNT region that is suggested as an important region in hexamer stability. We identified a decrease in interaction ability of this

ΔLRRNT construct as compared to full length NLRX1, which identifies the C-terminal region as either a direct region of interaction, or required for hexamer formation, which would ultimately promote the interaction. Future studies using a complete LRR deletion construct will help confirm the location of interaction and are currently ongoing.

We also determined SARM1 requirement for NLRX1 function during both intrinsic and one arm of extrinsic apoptosis, although, the mechanism of downstream effect of NLRX1 is still unknown.

Interestingly, Gerdst et al proposed that the dimerization of SARM1 plays key role in mediating 65

SARM1-dependent neuronal degeneration79. Future studies looking at the capacity of SARM1 dimer formation in the presence or absence of NLRX1 will determine if SARM1 dimer formation is the downstream mechanism that NLRX1 functions to modulate. Additionally, we found that there also exists a second arm of extrinsic apoptosis that NLRX1 inhibits independently from

SARM1. We initially hypothesized this second arm of extrinsic apoptosis to be type I apoptosis, which is mechanistically regulated by Smac release from the mitochondria during MOMP formation. However, when testing mitochondrial fractionations following TNFα + CHX induced extrinsic apoptosis, we found no difference in Smac release in NLRX1-KO MEFs as compared to

WT. We hypothesize that this secondary extrinsic arm that NLRX1 affects is likely mitochondria- intrinsic as we showed previously that t-bid sensitivity leading to cytochrome c release was increased in mitochondria isolated from NLRX1-KO MEFs as compared to WT. This mitochondrial inherent second arm of extrinsic apoptosis may be dependent on ROS, as we have previously shown NLRX1 to affect ROS levels under basal, as well as NLRX1 overexpression conditions (Figure D-1)47,49,55. Further investigation using N-acetyl-L-cystine, a ROS scavenger, during intrinsic and extrinsic apoptotic treatments with WT and NLRX1-KO MEFs will determine the function of ROS in these pathways.

We next tested the function of NLRX1 during SARM1-mediated Wallerian degeneration following axotomy. We found no effect of NLRX1 deletion during the degeneration of axons 2 and 6 hours following axotomy as compared to WT. This lack of NLRX1 function during this injury event led us to the hypothesize a dualistic function of SARM1, one that involves caspase activity, involving NLRX1, and one that is caspase independent downstream of axotomy, which would be NLRX1-independent (Figure D-1). In line with this hypothesis, SARM1 has been proposed to also affect axon degeneration following neural growth factor (NGF) withdrawal. 66

Gerdst et al identified an early and late phenotype during axon degeneration during NGF withdrawal where SARM1 promoted the early degeneration although had no effect on axonal degeneration during the late stage of degeneration79. Interestingly, they showed the late stage to be dependent on caspase activity. It is during this caspase-dependent late stage of axon degeneration that we propose the function of NLRX1 in this system. Possibly, NLRX1 functions to switch the dependence of axons from non-apoptotic-mediated degeneration to caspase- mediated degeneration, both of which being SARM1-dependent. Future work with NLRX1-KO, and SARM1-KO neuron cultures treated with NGF withdrawal will determine if NLRX1 will affect this pathway. Furthermore, the development of SARM1:NLRX1 double knock out mice will help determine whether during NGF withdrawal, the switch between SARM1 dependence to caspase dependence still occurs. Moreover, conflicting results of SARM1 functioning upstream of NAD+ or NMN levels is proposed as a mechanism downstream of axotomy74,81,103. We hypothesize that NLRX1 functions in the caspase dependent arm of axonal degeneration, likely modulating SARM1 activity, and not during NAD+ or NMN associated degeneration (Figure D1).

Similarly, Yan et al have identified SARM1 isoforms in teleost fish71. These isoforms were found to have differential sub-cellular localizations, and opposing function during apoptosis in these organisms. Existence of mammalian isoforms of SARM1 is listed under Ensembl, although their characterization in physiological settings is still not determined. The possibility of isoform effects of SARM1 as a mode of multiple functions could be a potential explanation of how this molecule affects NLRX1 function in both extrinsic and intrinsic apoptosis, as well as during neuronal degeneration.

In addition to SARM1 dependence, NLRX1 also functions in an arm of extrinsic apoptosis that is

SARM1-independent (Figure D1). As the role of NLRX1 has been proposed in the CNS, we tested 67 the ability of NLRX1 to affect physiological CNS outcome during an ischemic injury event. In this regard, NLRX1-KO mice showed marked increase in both apoptosis as well as activation of microglia 24 hours following ischemic injury. The increase in cell death in NLRX1-KO mice provides further support in addition to our in vitro findings in MEFs. Interestingly, NLRX1’s ability to inhibit CNS cell death may provide this system an additional layer of regulation that has been previously reported in neurons95. Interestingly, using an available database published by

Cahoy et al we plotted the difference in expression of SARM1 and NLRX1 in various CNS cell types from post-natal development to adulthood and saw an opposing expression pattern for these two molecules (Figure D-2)109. This opposing expression pattern hints at physiological modulation of these two proteins under basal levels, likely as a mechanism of creating settings permissive or inhibitory to cell death during development and through adulthood. Moreover, the observation of cellular modulation of NLRX1 levels is also seen with our previous reports of

NLRX1 being downregulated upon glucose starvation and SV40 transformation49. As NLRX1 functions to modulate both intrinsic and extrinsic apoptosis, we hypothesize that during cancer development, cells may modulate NLRX1 levels to create optimal settings that minimize the sensitivities to both arms of apoptosis. This idea of NLRX1 levels differentially affecting apoptosis can explain some of the opposing results presented by Singh et al66. We present the results of NLRX1 inhibiting extrinsic, and promoting intrinsic apoptosis using a knockout system in MEFs. Singh et al, following overexpression of NLRX1, found an increase in apoptosis following TNF-α treatment, and the subsequent dampening of this response during knockdown of NLRX1. Within our system we saw a downregulation of NLRX1 in MEFs upon transformation, thus under basal conditions our wild-type NLRX1 MEFs may behave similarly to this group’s knockdown. Likely during higher NLRX1 expression, the formation of the NLRX1 hexamer may 68 act to modulate the apoptosis as seen during these assays. Future studies directed at determining the balance between hexameric versus monomeric NLRX1 will help determine the mechanisms of apoptosis sensitivities.

In sum, we have identified an apoptotic function for NLRX1. This function in apoptosis has a dualistic effect by promoting intrinsic and inhibiting extrinsic apoptosis. We validated the previously reported interaction of NLRX1 with the CNS protein SARM1 and found the effects of

NLRX1 hexamer formation to affect SARM1 interaction. Interestingly SARM1 works upstream of both intrinsic and extrinsic arms of apoptosis, however NLRX1 effects of inhibiting extrinsic apoptosis is SARM1-independent. NLRX1 also showed no effects on SARM1 dependent axotomy, possibly working through caspase-dependent apoptosis during NGF withdrawal, a hypothesis that will be tested in the near future. Finally, we found that NLRX1 affected cell death and microglial activation following ischemia injury event, suggesting the role of this protein as a secondary mechanism of regulation of cell death in the CNS. Future studies that focus to determine NLRX1 hexamer activity during apoptosis will help elucidate the mechanism of differential sensitivities to extrinsic and intrinsic apoptosis. Furthermore, studies focusing on

SARM1 homodimer formation in the presence or absence of NLRX1, as well as isoform identification will help determine the interplay of these two molecules. Overall, NLRX1 and

SARM1 are key emerging molecules in the apoptosis and Wallerian degeneration pathways. Our studies directed at identifying the molecular mechanism of these two members will create a more holistic understanding of cell death, which will aid in furthering our understanding of pathways involved during brain injury and neurodegeneration. 69

5. References

1. Beutler, B. a. Review article TLRs and innate immunity. Immunity 113, 1399–1407 (2009).

2. Kumar, H., Kawai, T. & Akira, S. Toll-like receptors and innate immunity. Biochem. Biophys. Res. Commun. 388, 621–625 (2009).

3. Motta, V., Soares, F., Sun, T. & Philpott, D. J. NOD-Like Receptors: Versatile Cytosolic Sentinels. Physiol. Rev. 95, 149–178 (2015).

4. Kawai, T. & Akira, S. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int. Immunol. 21, 317–337 (2009).

5. Poltorak, a et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282, 2085–2088 (1998).

6. Blasius, A. L. & Beutler, B. Intracellular Toll-like Receptors. Immunity 32, 305–315 (2010).

7. Satoh, T. et al. LGP2 is a positive regulator of RIG-I- and MDA5-mediated antiviral responses. Proc. Natl. Acad. Sci. U. S. A. 107, 1512–1517 (2010).

8. Yoneyama, M., Onomoto, K., Jogi, M., Akaboshi, T. & Fujita, T. ScienceDirect Viral RNA detection by RIG-I-like receptors. Curr. Opin. Immunol. 32, 48–53 (2015).

9. Wu, B. et al. Molecular Imprinting as a Signal-Activation Mechanism of the Viral RNA Sensor RIG-I. Mol. Cell 55, 511–523 (2014).

10. Yoneyama, M. et al. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J. Immunol. 175, 2851–2858 (2005).

11. Venkataraman, T. et al. Loss of DExD/H box RNA helicase LGP2 manifests disparate antiviral responses. J. Immunol. 178, 6444–6455 (2007).

12. Deddouche, S. et al. Identification of an LGP2-associated MDA5 agonist in picornavirus- infected cells. Elife 2014, 1–20 (2014).

13. Zelensky, A. N. & Gready, J. E. The C-type lectin-like domain superfamily. FEBS J. 272, 6179–6217 (2005).

14. Dambuza, I. M. & Brown, G. D. ScienceDirect C-type lectins in immunity : recent developments. Curr. Opin. Immunol. 32, 21–27 (2015).

15. Sancho, D. & Reis e Sousa, C. Sensing of cell death by myeloid C-type lectin receptors. Curr. Opin. Immunol. 25, 46–52 (2013). 70

16. Sancho, D. & Reis e Sousa, C. Signaling by Myeloid C-Type Lectin Receptors in Immunity and Homeostasis. Annu. Rev. Immunol. 30, 491–529 (2012).

17. Kerrigan, A. M. & Brown, G. D. Syk-coupled C-type lectins in immunity. Trends Immunol. 32, 151–156 (2011).

18. Yamasaki, S. et al. Mincle is an ITAM-coupled activating receptor that senses damaged cells. Nat. Immunol. 9, 1179–1188 (2008).

19. Chiba, S. et al. Recognition of tumor cells by Dectin-1 orchestrates innate immune cells for anti-tumor responses. Elife e04177 (2014). doi:10.7554/eLife.04177

20. Drummond, R. a. & Brown, G. D. Signalling C-Type Lectins in Antimicrobial Immunity. PLoS Pathog. 9, 9–11 (2013).

21. Hansen, J. D., Vojtech, L. N. & Laing, K. J. Sensing disease and danger: A survey of vertebrate PRRs and their origins. Dev. Comp. Immunol. 35, 886–897 (2011).

22. Unterholzner, L. et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997–1004 (2010).

23. Hornung, V. et al. AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC. Nature 458, 514–518 (2009).

24. Bürckstümmer, T. et al. An orthogonal proteomic-genomic screen identifies AIM2 as a cytoplasmic DNA sensor for the inflammasome. Nat. Immunol. 10, 266–272 (2009).

25. Fernandes-Alnemri, T., Yu, J.-W., Datta, P., Wu, J. & Alnemri, E. S. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature 458, 509–513 (2009).

26. Sun, L. et al. Cyclic GMP-AMP Synthase Is a Cytosolic DNA Sensor That Activates the Type I interferon Pathway. Science 339, 786-791 (2013).

27. Koonin, E. V. & Aravind, L. The NACHT family - A new group of predicted NTPases implicated in apoptosis and MHC transcription activation. Trends Biochem. Sci. 25, 223– 224 (2000).

28. Boss, J. M., Howard, I., Medical, H. & Schreiber, S. The NLR gene family : An official nomenclature. Immunity 28, 285–287 (2009).

29. Beresford, G. W. & Boss, J. M. CIITA coordinates multiple histone acetylation modifications at the HLA-DRA promoter. Nat. Immunol. 2, 652–657 (2001).

30. Meissner, T. B. et al. NLR family member NLRC5 is a transcriptional regulator of MHC class I genes. Proc. Natl. Acad. Sci. U. S. A. 107, 13794–13799 (2010). 71

31. Zhao, Y. et al. The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus. Nature 477, 596–600 (2011).

32. Zhao, Y. & Shao, F. The NAIP – NLRC4 inflammasome in innate immune detection of bacterial flagellin and type III secretion apparatus. 85–102 (2015).

33. Mariathasan, S. et al. Differential activation of the inflammasome by caspase-1 adaptors ASC and Ipaf. Nature 430, 213–218 (2004).

34. Sutterwala, F. S. et al. Immune recognition of Pseudomonas aeruginosa mediated by the IPAF/NLRC4 inflammasome. J. Exp. Med. 204, 3235–3245 (2007).

35. Franchi, L., Eigenbrod, T., Muñoz-Planillo, R. & Nuñez, G. The inflammasome: a caspase-1-activation platform that regulates immune responses and disease pathogenesis. Nat. Immunol. 10, 241–247 (2009).

36. Pelegrin, P. & Surprenant, A. Pannexin-1 mediates large pore formation and interleukin- 1beta release by the ATP-gated P2X7 receptor. EMBO J. 25, 5071–5082 (2006).

37. Dostert, C. et al. Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica. Science 320, 674–677 (2008).

38. Girardin, S. E. et al. Nod1 detects a unique muropeptide from gram-negative bacterial peptidoglycan. Science 300, 1584–1587 (2003).

39. Girardin, S. E. et al. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278, 8869–8872 (2003).

40. Girardin, S. E. et al. CARD4/Nod1 mediates NF-kappaB and JNK activation by invasive Shigella flexneri. EMBO Rep. 2, 736–742 (2001).

41. Park, J.-H. et al. Nod1/RICK and TLR signaling regulate chemokine and antimicrobial innate immune responses in mesothelial cells. J. Immunol. 179, 514–521 (2007).

42. Is, R. I. P. et al. CELL BIOLOGY AND METABOLISM : RIP2 Is a Novel NF- ␬ B- activating and Cell Death-inducing Kinase *. 273, 16968–16975 (1998).

43. Bertrand, M. J. M. et al. Cellular Inhibitors of Apoptosis cIAP1 and cIAP2 Are Required for Innate Immunity Signaling by the Pattern Recognition Receptors NOD1 and NOD2. Immunity 30, 789–801 (2009).

44. Balzola, F., Bernstein, C., Ho, G. T. & Lees, C. Nod1 and Nod2 direct autophagy by recruiting ATG16L1 to the plasma membrane at the site of bacterial entry: Commentary. Inflamm. Bowel Dis. Monit. 10, 140–141 (2010). 72

45. Conti, B. J. et al. CATERPILLER 16.2 (CLR16.2), a novel NBD/LRR family member that negatively regulates T cell function. J. Biol. Chem. 280, 18375–18385 (2005).

46. Schneider, M. et al. The innate immune sensor NLRC3 attenuates Toll-like receptor signaling via modification of the signaling adaptor TRAF6 and transcription factor NF- κB. Nat. Immunol. 13, 823–831 (2012).

47. Tattoli, I. et al. NLRX1 is a mitochondrial NOD-like receptor that amplifies NF-kappaB and JNK pathways by inducing reactive oxygen species production. EMBO Rep. 9, 293– 300 (2008).

48. Arnoult, D. et al. An N-terminal addressing sequence targets NLRX1 to the mitochondrial matrix. J. Cell Sci. 122, 3161–3168 (2009).

49. Soares, F. et al. The mitochondrial protein NLRX1 controls the balance between extrinsic and intrinsic apoptosis. J. Biol. Chem. 289, 19317–19330 (2014).

50. Moore, C. B. et al. NLRX1 is a regulator of mitochondrial antiviral immunity. Nature 451, 573–577 (2008).

51. Lei, Y., Wen, H. & Ting, J. P. Y. The NLR protein, NLRX1, and its partner, TUFM, reduce type I interferon, and enhance autophagy. Autophagy 9, 432–433 (2013).

52. Imbeault, E., Mahvelati, T. M., Braun, R., Gris, P. & Gris, D. Nlrx1 regulates neuronal cell death. Mol. Brain 7, 1–8 (2014).

53. Jaworska, J. et al. NLRX1 prevents mitochondrial induced apoptosis and enhances macrophage antiviral immunity by interacting with influenza virus PB1-F2 protein. Proc. Natl. Acad. Sci. U. S. A. 111, E2110–9 (2014).

54. Hong, M., Yoon, S. Il & Wilson, I. a. Structure and Functional Characterization of the RNA-Binding Element of the NLRX1 Innate Immune Modulator. Immunity 36, 337–347 (2012).

55. Abdul-Sater, A. a. et al. Enhancement of reactive oxygen species production and chlamydial infection by the mitochondrial Nod-like family member NLRX1. J. Biol. Chem. 285, 41637–41645 (2010).

56. Kang, M. et al. Suppression of NLRX1 in chronic obstructive pulmonary disease. i, (2015).

57. Soares, F. et al. NLRX1 does not inhibit MAVS-dependent antiviral signalling. Innate Immun. 19, 438–48 (2013).

58. Rebsamen, M. et al. NLRX1/NOD5 deficiency does not affect MAVS signalling. Cell Death Differ. 18, 1387 (2011). 73

59. Ling, A. et al. Post-transcriptional inhibition of luciferase reporter assays by the nod-like receptor proteins NLRX1 and NLRC3. J. Biol. Chem. 287, 28705–28716 (2012).

60. Dennis, M. K. et al. NIH Public Access. 127, 358–366 (2012).

61. Allen, I. C. et al. NLRX1 Protein Attenuates Inflammatory Responses to Infection by Interfering with the RIG-I-MAVS and TRAF6-NF-κB Signaling Pathways. Immunity 34, 854–865 (2011).

62. Li, S., Wang, L., Berman, M., Kong, Y. Y. & Dorf, M. E. Mapping a Dynamic Innate Immunity Protein Interaction Network Regulating Type I Interferon Production. Immunity 35, 426–440 (2011).

63. Tian, Q., Taupin, J., Elledge, S., Robertson, M. & Anderson, P. Fas-activated serine/threonine kinase (FAST) phosphorylates TIA-1 during Fas-mediated apoptosis. J. Exp. Med. 182, 865–874 (1995).

64. Duan, J. siRNA targeting of PRDX3 enhances cisplatin-induced apoptosis in ovarian cancer cells through the suppression of the NF-κB signaling pathway. Mol. Med. Rep. 1688–1694 (2013). doi:10.3892/mmr.2013.1370

65. Allen, I. C. et al. NIH Public Access. 34, 854–865 (2012).

66. Singh, K. et al. Biochimica et Biophysica Acta NLRX1 acts as tumor suppressor by regulating TNF- α induced apoptosis and metabolism in cancer cells. BBA - Mol. Cell Res. 1853, 1073–1086 (2015).

67. Eitas, T. K. et al. The nucleotide-binding leucine-rich repeat (NLR) family member NLRX1 mediates protection against experimental autoimmune encephalomyelitis and represses macrophage/ microglia-induced inflammation. J. Biol. Chem. 289, 4173–4179 (2014).

68. Fornarino, S. et al. Evolution of the TIR domain-containing adaptors in humans: Swinging between constraint and adaptation. Mol. Biol. Evol. 28, 3087–3097 (2011).

69. Hsieh, Y. W., Chang, C. & Chuang, C. F. The MicroRNA mir-71 Inhibits Calcium Signaling by Targeting the TIR-1/Sarm1 Adaptor Protein to Control Stochastic L/R Neuronal Asymmetry in C. elegans. PLoS Genet. 8, (2012).

70. Peng, J. et al. SARM inhibits both TRIF- and MyD88-mediated AP-1 activation. Eur. J. Immunol. 40, 1738–1747 (2010).

71. Yan, N. et al. Grass carp SARM1 and its two splice variants negatively regulate IFN-I response and promote cell death upon GCRV infection at different subcellular locations. Dev. Comp. Immunol. 48, 102–115 (2015). 74

72. Panneerselvam, P. et al. T-cell death following immune activation is mediated by mitochondria-localized SARM. Cell Death Differ. 20, 478–89 (2013).

73. Murata, H., Sakaguchi, M., Kataoka, K. & Huh, N.-H. SARM1 and TRAF6 bind to and stabilize PINK1 on depolarized mitochondria. Mol. Biol. Cell 24, 2772–84 (2013).

74. Gilley, J., Orsomando, G., Nascimento-Ferreira, I. & Coleman, M. P. Absence of SARM1 Rescues Development and Survival of NMNAT2-Deficient Axons. Cell Rep. 10, 1974–1981 (2015).

75. Osterloh, J. M. et al. dSarm/Sarm1 Is Required for Activation of an Injury-Induced Axon Death Pathway. Science (80-. ). 337, 481–484 (2012).

76. Gerdts, J., Brace, E. J., Sasaki, Y., Diantonio, A. & Milbrandt, J. ) chimeric protein ( 3 ). The active moiety of Wld. (2010).

77. Carty, M. et al. The human adaptor SARM negatively regulates adaptor protein TRIF- dependent Toll-like receptor signaling. Nat. Immunol. 7, 1074–1081 (2006).

78. Couillault, C. et al. TLR-independent control of innate immunity in Caenorhabditis elegans by the TIR domain adaptor protein TIR-1, an ortholog of human SARM. Nat. Immunol. 5, 488–494 (2004).

79. Gerdts, J., Summers, D. W., Sasaki, Y., DiAntonio, A. & Milbrandt, J. Sarm1-mediated axon degeneration requires both SAM and TIR interactions. J. Neurosci. 33, 13569–80 (2013).

80. Freeman, M. R. Signaling mechanisms regulating Wallerian degeneration. Curr. Opin. Neurobiol. 27, 224–231 (2014).

81. Gilley, J., Adalbert, R., Yu, G. & Coleman, M. P. Rescue of peripheral and CNS axon defects in mice lacking NMNAT2. J. Neurosci. 33, 13410–13424 (2013).

82. Summers, D. W., DiAntonio, A. & Milbrandt, J. Mitochondrial dysfunction induces sarm1-dependent cell death in sensory neurons. J. Neurosci. 34, 9338–50 (2014).

83. Massoll, C., Mando, W. & Chintala, S. K. Excitotoxicity upregulates SARM1 protein expression and promotes Wallerian-like degeneration of retinal ganglion cells and their axons. Investig. Ophthalmol. Vis. Sci. 54, 2771–2780 (2013).

84. Manuscript, A. NIH Public Access. Changes 29, 997–1003 (2012).

85. Lee, E. W., Seo, J., Jeong, M., Lee, S. & Song, J. The roles of FADD in extrinsic apoptosis and necroptosis. BMB Rep. 45, 496–508 (2012). 75

86. Hsu, H., Shu, H. B., Pan, M. G. & Goeddel, D. V. TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell 84, 299–308 (1996).

87. Marques-Fernandez, F. et al. TNFα induces survival through the FLIP-L-dependent activation of the MAPK/ERK pathway. Cell Death Dis. 4, e493 (2013).

88. Wilson, N. S., Dixit, V. & Ashkenazi, A. Death receptor signal transducers: nodes of coordination in immune signaling networks. Nat. Immunol. 10, 348–355 (2009).

89. Shamas-Din, A. et al. TBid undergoes multiple conformational changes at the membrane required for bax activation. J. Biol. Chem. 288, 22111–22127 (2013).

90. Chipuk, J. E., Bouchier-Hayes, L. & Green, D. R. Mitochondrial outer membrane permeabilization during apoptosis: the innocent bystander scenario. Cell Death Differ. 13, 1396–1402 (2006).

91. Berthelet, J. & Dubrez, L. Regulation of Apoptosis by Inhibitors of Apoptosis (IAPs). Cells 2, 163–187 (2013).

92. Czabotar, P. E., Lessene, G., Strasser, A. & Adams, J. M. Control of apoptosis by the BCL-2 protein family: implications for physiology and therapy. Nat. Rev. Mol. Cell Biol. 15, 49–63 (2014).

93. Schimmer, A. D. et al. Small-molecule antagonists of apoptosis suppressor XIAP exhibit broad antitumor activity. Cancer Cell 5, 25–35 (2004).

94. Favaloro, B., Allocati, N., Graziano, V., Di Ilio, C. & De Laurenzi, V. Role of apoptosis in disease. Aging (Albany. NY). 4, 330–349 (2012).

95. Kole, A. J., Swahari, V., Hammond, S. M. & Deshmukh, M. miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. Genes Dev. 25, 125–130 (2011).

96. Isolation, M. Cytochrome c release from isolated mitochondria. 94, 7–8 (2013).

97. Conforti, L., Gilley, J. & Coleman, M. P. Wallerian degeneration: an emerging axon death pathway linking injury and disease. Nat. Rev. Neurosci. 15, 394–409 (2014).

98. Godzik, K. & Coleman, M. P. The Axon-Protective WLDS Protein Partially Rescues Mitochondrial Respiration and Glycolysis After Axonal Injury. J. Mol. Neurosci. 55, 865–871 (2014).

99. Deckwerth, TL., & Johnson, EM Jr., Neurites Can Remain Viable after Destruction of the Neuronal Soma by Programmed Cell Death (Apoptosis. Developmental Biology. 165 63- 72. (1994). 76

100. Finn, J. T. et al. Evidence that Wallerian degeneration and localized axon degeneration induced by local neurotrophin deprivation do not involve caspases. J. Neurosci. 20, 1333–1341 (2000).

101. Whitmore, A. V, Lindsten, T., Raff, M. C. & Thompson, C. B. The proapoptotic proteins Bax and Bak are not involved in Wallerian degeneration. Cell Death Differ. 10, 260–261 (2003).

102. Araki, T., Sasaki, Y. & Milbrandt, J. Increased nuclear NAD biosynthesis and SIRT1 activation prevent axonal degeneration. Science 305, 1010–1013 (2004).

103. Di Stefano, M. et al. A rise in NAD precursor nicotinamide mononucleotide (NMN) after injury promotes axon degeneration. Cell Death Differ. 22, 731–742 (2014).

104. Gilley, J. & Coleman, M. P. Endogenous Nmnat2 Is an Essential Survival Factor for Maintenance of Healthy Axons. PLoS Biol. 8, (2010).

105. Sasaki, Y. & Milbrandt, J. Axonal degeneration is blocked by nicotinamide mononucleotide adenylyltransferase (Nmnat) protein transduction into transected axons. J. Biol. Chem. 285, 41211–41215 (2010).

106. Seibenhener, M. L. & Wooten, M. W. Isolation and Culture of Hippocampal Neurons from Prenatal Mice. J. Vis. Exp. 1–7 (2012). doi:10.3791/3634

107. Manuscript, A. & Herpesviruses, A. NIH Public Access. (2009). doi:10.1002/0471143030.cb2604s43.Compartmented

108. Sims, N. R. & Muyderman, H. Mitochondria, oxidative metabolism and cell death in stroke. Biochim. Biophys. Acta 1802, 80–91 (2010).

109. Cahoy, J. D. et al. A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function. J. Neurosci. 28, 264–278 (2008).