ARTICLE IN PRESS

International Journal of Medical Microbiology 298 (2008) 279–290 www.elsevier.de/ijmm

Epidemiological aspects and molecular characterization of burgdorferi s.l. from southern Germany with special respect to the new species Borrelia spielmanii sp. nov. Volker Fingerlea,Ã,1, Ulrike C. Schulte-Spechtela,1, Eva Ruzic-Sabljicb, Sarah Leonhardc, Heidelore Hofmannd, Klaus Webere, Kurt Pfisterc, Franc Strlef, Bettina Wilskea aNational Reference Center for Borreliae, Max von Pettenkofer-Institut fu¨r Medizinische Mikrobiologie und Hygiene der Ludwig-Maximilians-Universita¨tMu¨nchen, Pettenkoferstraße 9a, D-80336 Munich, Germany bUniversity of Ljubljana, Faculty of Medicine, Institute of Microbiology and Immunology, Ljubljana, Slovenia cInstitut fu¨r Vergleichende Tropenmedizin und Parasitologie, Leopoldstr. 5, Munich, Germany dKlinik und Poliklinik fu¨r Dermatologie und Allergologie am Biederstein, TU Mu¨nchen, Munich, Germany eDermatologist, Greinwaldstr. 2, Tutzing, Germany fDepartment of Infectious Diseases, University of Ljubljana, Ljubljana, Slovenia

Received 11 December 2006; received in revised form 29 May 2007; accepted 29 May 2007

Abstract

In 475 Borrelia-infected (2155 ticks investigated) from southern Germany the most common Borrelia burgdorferi sensulatospecieswasB. garinii (34.3%) followed by B. afzelii (25.1%), B. burgdorferi sensu stricto (22.0%), and B. valaisiana (12.7%). B. spielmanii sp. nov. was detected in 5.9% of the 475 infected ticks. Hints for a focal distribution were found for B. spielmanii sp. nov. and B. garinii OspA type 4. In 242 patient isolates, dominance (66.9%) of B. afzelii for skin could be confirmed, while frequency of B. garinii in cerebrospinal fluid (CSF) isolates (51.1%) was comparable to the frequency in nymphal ticks (51.6%). Four patient isolates from southern Germany and two from Slovenia, all isolated from erythema migrans, could be assigned to B. spielmanii sp.nov.Withinthisnewspecieshigh sequence identities were found for rrs, fla,andospA while rrf-rrl, ospC,anddbpA were less conserved: three new ospC and two new dbpA sequence types were found. This genetic heterogeneity reveals that B. spielmanii sp. nov. did not evolve just recently. r 2007 Elsevier GmbH. All rights reserved.

Keywords: Borrelia burgdorferi; Borrelia spielmanii; Ixodes ricinus; ospA; ospC; dbpA; 16S rDNA; 5S-23S intergenic spacer

Introduction infectious disorder caused by spirochaetal belong- ing to the Borrelia burgdorferi sensu lato (s.l.) complex. Lyme borreliosis (LB), the most frequent vector-borne This disease can affect different organs and organ systems, diseaseinEuropeandtheUSA,isamultisystemic most often the skin, but also nervous system, joints, or the heart may be involved (Stanek and Strle, 2003). In Europe, the principal vectors are the hard-bodied ticks Ixodes ÃCorresponding author. Tel.: +49 89 5160 5225; fax: +49 89 5160 4757. ricinus and, at the eastern range, I. persulcatus. E-mail address: [email protected] (V. Fingerle). The B. burgdorferi s.l. complex comprises at least 12 1These authors contributed equally to this work. species wherefrom B. burgdorferi sensu stricto (s.s.),

1438-4221/$ - see front matter r 2007 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2007.05.002 ARTICLE IN PRESS 280 V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290

B. afzelii,andB. garinii are assured to be pathogenic I. ricinus from southern Germany. Also, B. spielmanii is for humans while the pathogenicity of B. valaisiana, present in ticks possibly in a focal manner and seems to B. lusitaniae,andB. bissettii is still unclear, although all be a relevant cause for human LB, at least for erythema three species have been detected occasionally in patient migrans. Molecular genetic analyses provide evidence specimens (Baranton et al., 1992; Canica et al., 1993; that this newly described species did not evolve just Rijpkema et al., 1997; Strle et al., 1997; Wang et al., recently. 1999b; Collares-Pereira et al., 2004). In Europe, the five species B. afzelii, B. garinii, B. burgdorferi s.s., B. valaisiana, and B. lusitaniae have been recorded in Material and methods association with I. ricinus. Thereof, B. afzelii and B. garinii appear to be the most prevalent species Study sites and collection of questing Ixodes ricinus followed by B. burgdorferi s.s. and B. valaisiana, while B. lusitaniae seems to be rare (Hubalek and Halouzka, ticks 1997; Rauter and Hartung, 2005). B. burgdorferi s.s., A total of 2155 I. ricinus were collected by flagging at the only species causing LB in the USA, is homo- eight locations in southern Germany within a radius of geneous with respect to outer surface protein (Osp) A, 150 km around the city of Munich (Tables 1 and 2). In while in Europe at least eight different OspA types Erlangen, located about 150 km north of Munich, have been observed among the human pathogenic sampling was done in an area intensively used for species (Wilske et al., 1993, 1996; Lencakova et al., agricultural purposes at waysides between a cornfield 2006). In 1993, van Dam et al. described a B. burgdorferi s.l. and a fir wood. The study area Passau, about 150 km east-east-north of Munich, was along a dirt road strain (A14S) that could not be classified that time. through a mixed forest with lots of underbrush. The Based on its reactivity with monoclonal antibodies collection region Traunstein is located about 120 km (MAbs), ribotyping, and randomly amplified poly- east-east-south of Munich and comprises a forest track morphic DNA fingerprinting, the authors concluded through a coniferous forest with lots of underbrush, that this isolate could well represent a novel pathogenic predominantly blackberries. The Isar meadow region B. burgdorferi s.l. species (van Dam et al., 1993; Wang et is about 10 km north-west of Munich. Collection of al., 1998). In 1999, further characterization of this strain by protein profiling, reactivity with MAbs, sequences of ticks was done along a grassy dirt road in a humid deciduous forest dominated by birch trees. The English 16S rRNA (rrs), ospA, ospC, fla, and 5S-23S intergenic Garden area is part of a recreational park located in spacer (rrf-rrl) further supported that this strain the city of Munich. The sampling region was the edge represents a new B. burgdorferi s.l. species (Wang et al., of a small deciduous wood (predominant beech and 1999a). Subsequently, Richter et al. (2004) showed that oak trees, lots of underbrush) to public grassland, this new genospecies seems to have a restricted geo- which is intensively used for recreational activities. The graphic distribution and seems to be associated with study area Grafrath, situated about 35 km west of dormice, especially garden dormice, but not mice or voles. In this study, the name ‘‘B. spielmani sp. nov.’’ for Munich, comprises a grassy forest track through a mixed forest. The sampling area Schoffelding, which is this apparently new B. burgdorferi s.l. species was ¨ situated about 50 km west of Munich, was the edge proposed. In a following study, its position as a new of a deciduous forest with lots of underbrush to a species was validated by multilocus sequence analysis swampy grassland. Collection region Bad Tolz, located and its name was changed to the correct spelling ¨ about 45 km south of Munich, was a light coniferous ‘‘B. spielmanii’’ (Richter et al., 2006). forest with a lot of grass and bushes. The collection Further A14S-like or B. spielmanii isolates from areas each had a size of about 1000–1500 m2 except the patients were reported in 2002 from south-western Germany (Rauter et al., 2002), in 2003 from south- English Garden collection area, which had a size of about 400 m2. eastern Germany (Michel et al., 2003), in 2005 from After collection, ticks were assigned to tick species Hungary (Foldvari et al., 2005), and in 2006 from and stage, and individually stored in 1.5-ml reaction Slovenia (Maraspin et al., 2006). Notably, all human tubes at 20 1C until use. Before DNA extraction, each B. spielmanii isolates described so far were cultured from tick was crushed using a separate laboratory spatula. erythema migrans. The aim of this study was to gain more information about the epidemiological situation of B. burgdorferi s.l. Borrelia burgdorferi s.l. strains and cultivation, and, especially, about the new species B. spielmanii, DNA extraction including its molecular heterogeneity. The results of the present study show that all relevant B. burgdorferi s.l. All strains were derived from patient material species described so far for Europe are present in collected in the years 1984–2002 at the Max von ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290 281

Table 1. (a) Prevalence of B. burgdorferi s.l. species according to tick stage and study site

Region Tick stageb n Posc (%) Posd Thereofa

Bb (%) Ba (%) Bg (%) Bv (%) Bs (%)

Bad A 138 25 (18.1) 25 4 (16.0) 5 (20.0) 15 (60.0) 1 (4.0) 0 To¨lze,a N 218 16 (7.3) 16 2 (12.5) 4 (25.0) 9 (56.3) 0 0 Erlangene A 49 13 (26.5) 16 0 2 (12.5) 13 (81.3) 1 (6.3) 0 N 40 2 (5.0) 2 0 0 2 (100) 0 0 Scho¨ffelding A 133 29 (21.8) 35 8 (22.9) 3 (8.6) 20 (57.1) 4 (11.4) 0 N 92 9 (9.8) 10 2 (20.0) 0 8 (80.0) 0 0 Grafrath A 240 88 (36.7) 99 20 (20.2) 30 (30.3) 32 (32.3) 12 (12.1) 5 (5.1) N 106 13 (12.3) 15 2 (13.3) 8 (53.3) 5 (33.3) 0 0 Traunsteine A 222 42 (18.9) 45 11 (24.4) 14 (31.1) 15 (33.3) 3 (6.7) 2 (4.4) N 156 15 (9.6) 15 6 (40.0) 2 (13.3) 7 (46.7) 0 0 EGf A 207 77 (37.2) 78 12 (15.4) 30 (38.5) 9 (11.5) 13 (16.7) 14 (17.9) MIRf A 207 74 (35.7) 75 23 (30.7) 15 (20.0) 23 (30.7) 11 (14.7) 3 (4.0) Passau A 211 70 (33.2) 73 21 (28.8) 14 (19.2) 15 (20.5) 19 (26.0) 4 (5.5) All regionse A 1407 418 (29.7) 446 99 (22.2) 113 (25.3) 142 (31.8) 64 (14.3) 28 (6.3) N 612 55 (9.0) 58 12 (20.7) 14 (24.1) 31 (53.4) 0 0

(b) B. burgdorferi s.l. combinations present in multiple infected ticks

Region Tick stageb Combinations of B. burgdorferi s.l. species and B. garinii OspA typesg

Bad To¨lza,e A0 N0 Erlangene A Ba/Bg3, Ba/Bg7, Bg6/Bv N0 Scho¨ffelding A Bb/Bg4, Bb/Bg6, Bg5/Bg6, Bg5/Bg7, Bg6/Bg7, Bg6/Bv N Bg5/Bg7 Grafrath A Bb/Ba, Bb/Bg3, Bb/Bg4, Bb/Bg5, Bb/Bg6, Ba/Bg3, Ba/Bg4, Ba/Bv, Ba/Bs, Bb/Ba/Bg4 N Bb/Bg3, Bg4/Bg5 Traunsteine A Bb/Ba, Bb/Bg5, Bg5/Bg6 N0 EGf A Ba/Bs MIRf A Bb/Ba Passau A Bb/Bs, Bv/Bs, Bv/Bs

Bb, B. burgdorferi s.s.; Ba, B. afzelii; Bg, B. garinii; Bv, B. valaisiana; Bs, B. spielmanii. aB. lusitaniae was found in one nymphal tick from Bad To¨lz. bA, adults; N, nymphs. cNumber of B. burgdorferi-infected ticks. dNumber of B. burgdorferi s.l. species and OspA types found in the ticks including multiple infections (shown in (b)). eLarvae (n ¼ 136) were investigated in Bad To¨lz (n ¼ 16; none infected), Erlangen (n ¼ 110; one infected with B. garinii and one with B. burgdorferi s.s.), and Traunstein (n ¼ 10; none infected). fEG, English Garden; MIR, meadows of the Isar river. gNumber behind ‘‘Bg’’ corresponds to the B. garinii OspA type.

Pettenkofer Institut (Table 3) or from Slovenia. All (Roche Molecular Biochemicals, Mannheim, Germany) strains were cultured at 33 1C in MKP medium as according to the manufacturer’s instructions. described previously (Preac-Mursic et al., 1986), har- vested at a density of 107 cells/ml by centrifugation (20,000g, 20 min), washed three times in 200 ml phos- PCR and restriction fragment length polymorphism phate-buffered saline (PBS, pH 7.4), and resuspended in (RFLP) analysis 200 ml PBS. DNA from cultured strains and ticks was extracted Primers for PCR are given in Table 4. All ticks and with ‘‘High Pure PCR Template Preparation Kit’’ Borrelia strains were investigated by a hemi-nested PCR ARTICLE IN PRESS 282 V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290

Table 2. Prevalence of B. garinii OspA types according to tick stage and study site

Region Tick stage n Posa Thereof B. garinii OspA type

3 (%) 4 (%) 5 (%) 6 (%) 7 (%) 8 (%)

Bad To¨lzb A 138 15 3 (20.0) 10 (66.7) 0 2 (13.3) 0 0 N 218 9 1 (11.1) 8 (88.9) 0 0 0 0 Erlangenb A 49 13 4 (30.8) 1 (7.7) 1 (7.7) 5 (38.5) 2 (15.4) 0 N 40 2 1 (50.0) 0001(50.0) 0 Scho¨ffelding A 133 20 1 (5.0) 2 (10.0) 3 (15.0) 11 (55.0) 3 (15.0) 0 N 92 8 1 (12.5) 3 (37.5) 1 (12.5) 1 (12.5) 2 (25.0) 0 Grafrath A 240 32 9 (28.1) 9 (28.1) 10 (31.3) 4 (12.5) 0 0 N 106 5 2 (40.0) 1 (20.0) 1 (20.0) 1 (20.0) 0 0 Traunsteinb A 222 15 3 (20.0) 3 (20.0) 1 (6.7) 6 (40.0) 2 (13.3) 0 N 156 7 0 4 (57.1) 2 (28.6) 1 (14.3) 0 0 EG A 207 9 5 (55.6) 0 1 (11.1) 3 (33.3) 0 0 MIR A 207 23 5 (21.7) 1 (4.3) 4 (17.4) 12 (52.2) 0 1 (4.3) Passau A 211 15 8 (53.3) 0 2 (13.3) 5 (33.3) 0 0 All regions A 1407 142 38 (26.8) 26 (18.3) 22 (15.5) 48 (33.8) 7 (4.9) 1 (0.7) N 612 31 5 (16.1) 16 (51.6) 4 (12.9) 3 (9.7) 3 (9.7) 0

A, adults; N, nymphs. EG, English Garden; MIR, Meadows of the Isar River. aNumber of B. garinii-infected ticks. bLarvae (n ¼ 136) were investigated in Bad To¨lz (n ¼ 16; none infected), Erlangen (n ¼ 110; one infected with B. garinii OspA type 6.), and Traunstein (n ¼ 10; none infected).

Table 3. Prevalence of B. burgdorferi s.l. species and OspA types in 242 human isolates from Germany

Material n Bb (%) Ba (%) Bg (%) Thereof Borrelia garinii OspA type Bbi Bs (%) (%) Type Type 4 Type 5 Type 6 Type Type 3 (%) (%) (%) (%) 7 (%) 8 (%)

Skin 160 10 (6.3) 107 (66.9) 39 (24.4) 4 (2.5) 19 (11.9) 7 (4.4) 7 (4.4) 1 (0.6) 1 (0.6) 4 (2.5) CSF 72 18 (25.0) 15 (20.8) 38 (51.1) 4 (5.6) 16 (22.2) 3 (4.2) 11 (15.3) 2 (2.8) 2 (2.8) 1 (1.4) Synovia 6 2 (33.3) 2 (33.3) 2 (33.3) 1 (16.7) 1 (16.7) Totala 242 32a (13.2) 126a (52.1) 79 (32.6) 8 (3.3) 36 (14.9) 10 (4.1) 19 (7.9) 3 (1.2) 3 (1.2) 1 (0.4) 4 (1.7)

Bb, B. burgdorferi s.s.; Ba, B. afzelii; Bg, B. garinii; Bbi, B. bissettii; Bs, B. spielmanii. aNumbers include two B. burgdorferi s.s. cultured from vitreous body and myocard, and two B. afzelii cultured from blood and bone, respectively.

targeting ospA, using Amplitaq Gold DNA polymerase rrf-rrl, dbpA, ospC, and fla PCR. Amplification of rrs (Applied Biosystems) as described previously (Lencako- used the same protocol as for ospA except for the va et al., 2006; Michel et al., 2003). For RFLP, aliquots annealing temperature being 45 1C. OspC, dbpA, and (7 ml) of each ospA amplicon were digested with 0.5 U rrf-rrl PCRs were carried out as described previously Kpn21 (MBI Fermentas, Lithuania), BglII, SspI, (Postic et al., 1994; Schulte-Spechtel et al., 2005). For HindIII, SfuI and, optionally, XbaI (Roche Molecular tick DNA extractions, a re-PCR for dbpA amplification Biochemicals) overnight. Restriction fragments were was necessary. The fla gene has been amplified accord- electrophoresed, visualized, and documented as de- ing to the protocol of Fukunaga et al. (1996) using the scribed for amplification products (see below). primers listed in Table 4. Both strands of the resulting PCR products were sequenced (see below) using the amplification primer pair or, for fla, characterized by Molecular analysis of B. spielmanii restriction enzyme analysis (HpaII, HhaI, CellI, HincII, and DdeI). DNA extractions positive for B. spielmanii DNA Amplified products and restriction enzyme fragments according to ospA-based RFLP were subjected to rrs, were visualized on a 2% agarose gel (Sea Kem LE ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290 283 agarose, Biozym, Hessisch Oldendorf, Germany) in Table 5. As only PCR amplicons but no isolates could stained with 1 mg/ml ethidium bromide (Bio-Rad, be investigated from the ticks the respective sequences Munich, Germany) and documented with a gel doc- were not deposited at GenBank. umentation system (Herolab, Wiesloch, Germany). Statistical analyses Sequencing and sequence analysis Statistical analyses were performed using the w2 test. p Sequencing was performed with a dye terminator Values of o0.05 were considered statistically significant. cycle sequencing kit (Applied Biosystems, Inc., Foster City, CA). All sequencing reactions were run on an ABI TM PRISM 377 DNA Sequencer. Multiple sequence Results alignments and amino acid sequence alignments were accomplished with DNAMAN Version 5.2.9. software Prevalence of Borrelia burgdorferi s.l. species and (Lynnon Biosoft). OspA types in ticks and patient isolates

Nucleotide sequence accession numbers All tick extractions were subjected to a hemi-nested ospA PCR and subsequently to RFLP for species and GenBank accession numbers for the sequences OspA type differentiation. It is important to mention determined for patient isolates in this study are listed that according to the previous RFLP protocol (Michel et al., 2003) it was not possible to distinguish OspA type Table 4. Amplified gene fragments and corresponding 6 from OspA type 8 and B. valaisiana subgroup II (M53) oligonucleotide primers from B. spielmanii (Wang et al., 2000). Additional digestion with XbaI now allows reliable differentia- 0 0 Fragment Primer sequences (5 –3 ) Target tion of the above-mentioned species and OspA types length (bp) (Fig. 1A)(Lencakova et al., 2006).

390 ttaacaggaaaagctagattagaatcatca dbpA univ.3 for Of the 2155 I. ricinus ticks, 475 were infected with atcccttgagctgtagttgga dbpA univ.3 rev B. burgdorferi s.l., corresponding to a total infection rate a 818–838 gggaataggtctaatattagc V1a (ospA for) a of 22% (Table 1). Infection rates were significantly ggggataggtctaatattagc V1b (ospA for) b a higher in adults compared with nymphs in all regions 798–818 gccttaatagcatgtaagc V3a (ospA for nested) a gccttaatagcatgcaagc V3b (ospA for nested) where both stages were investigated. Total infection a cataaattctctttattttaaagc R2 (ospA rev) rates at the different locations ranged for adults from a ccttattttaaagcggc R37 (ospA rev) 18.1% (Bad To¨lz) to 37.2% (English Garden) (po0.001) 600 atgaaaaagaatacattaagtgcg ospC for and for nymphs from 5% (Erlangen) to 12.3% ttaggtttttttggactttctgc ospC rev (Grafrath) (p40.05). From the 136 larvae only 2 580 gcagttcaatcaggtaacgg fla for aggttttcaatagcatactc fla rev (1.5%) were infected, therefore they are not further 210 ctgcgagttcgcgggaga rrf-rrl for considered. tcctaggcattcaccata rrf-rrl rev The most common species found in ticks was 1400 agagtttgatcctggcttag 16S RNA for B. garinii (34.3%), followed by B. afzelii (25.1%), t(g/t)aaggaggtgatccagc 16S RNA rev B. burgdorferi s.s. (22.0%), B. valaisiana (12.7%), and aPrimer name according to Michel et al. (2003). B. spielmanii (5.9%). Even one B. lusitaniae was present bFragment length after hemi-nested amplification. in a nymphal tick from Bad To¨lz. Comparing the

Table 5. Accession numbers of the ospA, dbpA, ospC, rrf-rrl, rrs, and fla sequences of B. spielmanii isolates determined in this study

Strain Origin ospA ospC dbpA rrf-rrl Rrs Fla

PSigII G AM158262 AM158268 (AJ767066) AM160603 AM182226 AM159174 PHap G AM158263 AM158269 (AJ767065) AM160604 AM182227 AM159175 PMew G AM158264 AM158270 AM176559 AM160605 AM182228 AM159176 PMai G AM158265 AM158271 AM176560 AM160606 AM182229 AM159177 PAnz Sl AM158266 AM158272 AM176561 AM160607 AM182230 AM159178 PJes Sl AM158267 AM158273 AM176562 AM160608 AM182231 AM159179 PC-Eq17 F na AM183121 AM176564 AM183337 (AY147008)na A14S NL (AF102057)(AF102058) AM176563 (U76616)(AF102056)(DQ111034)

G, Germany; F, France; NL, Netherlands; Sl, Slovenia; na, not available. Numbers in parentheses: not determined in this study. ARTICLE IN PRESS 284 V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290

SspI SfuI XbaI BglII Kpn21HindIII M SspI SfuI XbaI BglII Kpn21HindIII M HpaII HhaI CelII HincII DdeI

1031 1031

800 800

600 600

400 400

250

150 250

50 150 798 798 798 665 654 798 801 801 556 665 654 801 580 350 580 580 350 Fragment- 113 144 242 133 144 230 230 length

Fig. 1. Typical restriction fragment length polymorphism (RFLP) patterns of the amplified ospA and fla genes from B. spielmanii sp. nov. (A) RFLP pattern of the B. spielmanii sp. nov. ospA PCR fragment (left side) compared to the B. valaisiana ospA subgroup II fragment (strain M53, right side). Note: reliable differentiation is only achieved by XbaI digestion. (B) RFLP pattern of the flagellin PCR fragment of B. spielmanii sp. nov. M: DNA molecular weight marker (bp). different tick stages, B. valaisiana was significantly more The RFLP used in the present study allows a reliable prevalent in adults (p ¼ 0.002) and B. garinii in nymphs differentiation of mixed infections of single ticks with (p ¼ 0.001). Notably, B. valaisiana and B. spielmanii different B. burgdorferi s.l. species and even B. garinii were exclusively detected in adult ticks. Regarding the OspA types according to characteristic RFLP patterns as different study sites, the proportion of species present in shown in previous studies (Lencakova et al., 2006; Michel infected adult ticks was between 0% and 30.7% for et al., 2003). Infection of single ticks with two different B. burgdorferi s.s., between 8.6% and 38.5% for species or B. garinii OspA types was present in 26 adults B. afzelii, between 11.5% and 81.3% for B. garinii, and 3 nymphs (Table 1b). In one adult tick, even three between 4.0% and 26.0% for B. valaisiana, and between different species were detectable: B. burgdorferi s.s., 0% and 17.9% for B. spielmanii. Regarding nymphal B. afzelii,andB. garinii OspA type 4. The rate of ticks, these proportions were between 0% and 40.0% for multiple infections in infected ticks was not different in B. burgdorferi s.s., between 0% and 53.3% for B. afzelii, adults compared with nymphs (p ¼ 0.98). The prevalence and between 33.3% and 100% for B. garinii. The most of B. burgdorferi species and B. garinii OspA types in unusual prevalence pattern was found in the English multiple infected ticks was comparable to the distribution Garden: here B. afzelii was the significantly most in ticks harbouring only a single infection and there was common species (pp0.004), followed by B. spielmanii, no obvious predominance of a specific species or OspA while B. garinii was, except for B. lusitaniae, the least type combination as found in other studies (Kurtenbach prevalent species. Of note, here the prevalence of et al., 2001; Lencakova et al., 2006). B. spielmanii is significantly higher when compared with Furthermore, 242 patient strains (Table 3) collected in any other study site (pp0.032). Regarding OspA types the period between 1984 and 2002 at the Max von of B. garinii, the significantly most frequent ones were Pettenkofer Institute were characterized to species and type 6 (33.8% of all B. garinii, p ¼ 0.008) in adult ticks OspA type level by ospA RFLP and sequencing of ospA. and type 4 (51.5%, po0.001) in nymphs, while Among 160 skin isolates B. afzelii (66.9%) was the especially type 8 was rare and detectable in only one significantly most frequent species (po0.001), followed adult tick (Table 3). Significant stage-dependent differ- by B. garinii (24.4%). Regarding B. garinii in skin ences in prevalence were present for OspA type 4 isolates, OspA type 4 accounts for 19 of the 39 OspA (po0.001) and type 6 (p ¼ 0.002). Comparison of the types found. Notably, four skin isolates could be different regions and tick stages results in a quite assigned to the new species B. spielmanii. heterogeneous picture, possibly caused in part by the In cerebrospinal fluid (CSF) isolates, B. garinii low numbers of positive ticks. However, noteworthy is (51.1%) was the significantly most often found species the high prevalence of B. garinii OspA type 4 in Bad (po0.001) followed by B. burgdorferi s.s. (25%) and To¨lz, where this type contributes 18 of the 24 B. garinii B. afzelii (20.8%). Also, one B. bissettii was detected. found in ticks. Regarding B. garinii CSF isolates, OspA type 4 accounts ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290 285

Fig. 2. DNA sequence alignment of the rrf-rrl intergenic region of representative Borrelia species. Strains isolated from humans are A14S, PAnz, PHap, PJes, PMai, PMew, and PSig. MIR (Meadows of the Isar River) and EG (English Garden) indicate the collection site of the ticks. Sequences from B. spielmanii sp. nov. found in ticks are based on direct PCR from tick DNA extractions. for 16/38 (42%) OspA types found. Isolates from described previously (Fukunaga et al., 1996). In addition, synovial fluid belonged to B. burgdorferi s.s., B. afzelii, B. spielmanii clearly could be differentiated by typical and B. garinii, two strains each (B. garinii were OspA restriction patterns (Fig. 1B):digestionwithHhaIand types 4 and 6, respectively). DdeI resulted in DNA fragments of 350 and 230 bp Furthermore, screening of more than 1000 erythema length for both enzymes. This pattern was found for all migrans isolates from Slovenia by pulsed field gel tick extractions, which were pre-defined as containing electrophoresis (PFGE) of MluI-digested total DNA B. spielmanii DNA according to ospA-based RFLP. resulted in two strains, which presented an atypical Sequences of rrs (for patient isolates only), rrf-rrl,and PFGE pattern (data not shown). Subsequently, both the inner part of fla were determined as these sequences strains, PAnz and PJes, were identified as B. spielmanii provide hints to the evolutionary derivation of bacterial strains according to their ospA RFLP and sequence. strains (Postic et al., 1994). Compared to sequences of the previously described B. spielmanii strains A14S and PC-Eq17 (Richter et al., 2004), our six patient strains Molecular characterization of B. spielmanii showed 99–100% identity to rrs, 100% to the inner part of fla, and 96–100% to rrf-rrl (data shown in Figs. 2 To gain deeper insight into the genetic diversity of and 3 for rrf-rrl only). This clearly indicates that our B. spielmanii, patient isolates (n ¼ 6) and tick materials patient strains can be assigned to B. spielmanii. Notably, (n ¼ 28) were subjected to further genetic analysis. PCR compared to the rrf-rrl sequence of B. burgdorferi s.s. targeting the inner part of fla followed by RFLP could strain B31 several deletions within nucleotides from identify B. burgdorferi s.s., B. garinii, and B. afzelii as positions 39 to 88 (Fig. 2) are present. ARTICLE IN PRESS 286 V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290

dbpA rrf-rrl previous reports from Europe, where prevalences were 100% 90% 80% 70% 100% 95% 0–11% for larvae, 2–43% for nymphs, and 3–58% for adult ticks (Hubalek and Halouzka, 1997). Most studies

PAnz PAnz throughout Europe recognized B. garinii and/or B. afzelii as the predominant species, while B. burgdor- PJes PJes 100% feri s.s. and B. valaisiana are less frequent, and detection EG 54 EG 54 100% EG 14 99% of B. lusitaniae is rare (Hubalek and Halouzka, 1997; EG 14 Rauter and Hartung, 2005; Richter and Matuschka, PC-Eq17 PC-Eq17 2006). Occurrence of the different B. burgdorferi s.l. 69% 96% species thereby may vary considerably between different A14S A14S European countries and even between closely located PMai PMai areas (van Dam et al., 1993; Eiffert et al., 1995; PMew 100% PSigII 100% Rijpkema et al., 1996; Hubalek and Halouzka, 1997; PSigII MIR 71 Gern et al., 1999; Rauter et al., 2002; Michel et al., 2003; MIR 71 PMew Casati et al., 2004; Jouda et al., 2004; Lencakova et al., PHap PHap 2006). Accordingly, in the present study, B. garinii was the predominant species in nymphal and adult Fig. 3. Comparision of the dbpA and rrf-rrl gene sequence identity trees from B. spielmanii sp. nov. ticks in most study sites, followed by B. afzelii and B. burgdorferi s.s. with similar frequencies. However, any one of the three human pathogenic species was In contrast, ospC and dbpA sequences were more found as the most common one in at least one of the heterogeneous. B. spielmanii showed sequence identities investigated study sites, and the prevalence pattern of between 66% and 100% for dbpA and between 84% and species and OspA type frequencies varied considerably 100% for ospC (Figs. 3 and 4). As shown by sequence between the regions. According to these data, all of the identity trees for ospA, ospC, and dbpA (Fig. 4), the known human pathogenic species and B. garinii B. spielmanii strains cluster in separate groups when subtypes must therefore be considered for development compared with other human pathogenic B. burgdorferi of vaccines or diagnostic tests in Europe. A further s.l. Sequence comparison of the three gene loci shows interesting finding, as also observed previously, is the an identical ospA gene, two different dbpA gene focal occurrence of certain species or subtypes, espe- clusters, and a heterogeneous ospC within the species cially that of OspA type 4 in Bad To¨lz and B. spielmanii B. spielmanii. An interesting result is that the two dbpA in the English Garden (Peter et al., 1995; Michel et al., gene groups of B. spielmanii are in close concordance 2003; Richter et al., 2004). This probably new species with the two different non-coding rrf-rrl regions (Fig. 3), was detectable in a surprisingly high proportion of while such a correlation cannot be found within other infected ticks from the English Garden, a highly B. burgdorferi s.l. species (data not shown). frequented recreational area in the city of Munich. Co- instantaneously, three of the four isolates were from patients living in the Munich area, while the address of Discussion the fourth patient is unknown but the skin biopsy was sent by a dermatologist from Munich. Taken together, these data argue for a focal occurrence of B. spielmanii The still expanding knowledge on the heterogeneity as also found in the study by Richter et al. (2004). and prevalence of the causative agents of LB in Europe The present study confirms that in Europe there is a is a prerequisite for development of diagnostic tests, for strong prevalence of B. afzelii among human skin development of vaccines, as well as for local risk isolates, whereas isolates from CSF are most commonly assessment. The goal of the present study was to B. garinii (Table 3), a finding that might argue for a gain more information regarding the heterogeneity of species-specific organotropism (Canica et al., 1993; B. burgdorferi s.l. in patient isolates and in ticks from Wilske et al., 1993; Eiffert et al., 1995; Ruzic-Sabljic southern Germany with special respect to B. spielmanii. et al., 2001, 2002). The fact that B. garinii might be Furthermore, we were interested in the genetic hetero- neurotropic is further supported by the finding that geneity of the latter species. recombinant DbpA derived from B. garinii showed the highest sensitivity with sera from patients with early Prevalence of Borrelia burgdorferi s.l. in patient neuroborreliosis when compared with recombinant isolates and ticks DbpA of B. afzelii and B. burgdorferi s.s. (Schulte- Spechtel et al., 2005). Under the assumption that all The prevalence of B. burgdorferi s.l. in questing B. burgdorferi s.l. species are equally transmitted from I. ricinus found in the present study is in line with ticks to humans and have no organotropism, the species ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290 287

ospA ospC dbpA

100% 95% 90% 85% 100% 95% 90% 85% 80% 100% 90% 80% 70%65%

ZS7 ZS7 N40 86% 100%

N40 297 PGl 97% 84% B. burg- PGl N40 B31 86% 81% dorferi s.s. B31 100% ZS7 B31 94% 85% 297 PGl 297

VS461 PBr PKo 100% 100% PBo PGau 99% PHez 99% PGau 89% PBo PHei 100% B. afzelii 74% PKo 87% A91 B29 96% 99% A91 86% T25 100% PTrob 100% 100% PLud PBi 96% PRef 97%

PAnz PHez PLa

PHap PJes PJes 100%

PJes PAnz PC-Eq17 79% PMai PLud 81% PAnz

88% EG 54 PMew TN 100% 88%

A14S PWud II Grafrath 49

PSig II PHei Grafrath 78 87%85% 89% 100% MIR 71 PFim Grafrath 123 B. spiel- 99% EG 191 manii EG 127 VS461 85% Grafrath 49 PBr EG 11 66% 89% EG 11 PRef PGau 100% 97% PC-Eq17 T25 PLud 100% 99% 95% EG 191 B29 A91 88% PBo Grafrath 123 PLa 93% 98% Grafrath 78 PSig II PKo

86% EG 54 PHap VS461

PBr (3)* PMew A14S 84% 92% 100% MIR 71 PMai 77% PRef (7)* 98% 99% T25 (7)* PMai PMew 98% EG 127 PSig II PTrob (4)* 100% A14S MIR 71 PBi (4)* 87% 87% 100% 93% EG 127 PHei (5)* PC-Eq17 B. garinii 72% PHap B29 (6)* EG 11 94% PTrob PFim (6)* EG 191 90% Grafrath 78 PBi PHez (6)* 100% PFim 100% TN (6)* EG 54 100% 82% TN PWudII (6)* Grafrath49 PWud II PLa (8)* Grafrath 123

Fig. 4. Comparison of ospA,ospC, and dbpA gene sequence identity trees from selected strains of B. burgdorferi s.s., B. afzelii, B. garinii, and B. spielmanii sp. nov. Grafrath, MIR (Meadows of the Isar River), and EG (English Garden) indicate the collection sites of the ticks. Ãnumbers in brackets indicate the B. garinii OspA type. ARTICLE IN PRESS 288 V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290 pattern present in the respective organs should match Another noticeable fact is that all rrf-rrl sequences of the the pattern found in ticks. This is in the present study B. spielmanii strains have deletions that cannot be found clearly not true for B. afzelii, since its prevalence in skin within the rrf-rrl region of other B. burgdorferi s.l. is significantly higher (po0.001) when compared with its species (Fig. 2). These deletions lead to the outgrouping prevalence in infected nymphs or adults. In our opinion, of this species, but their significance remains unclear. postulation of an organotropism for B. afzelii for skin is Further references for the heterogeneity of B. spielmanii justified by several congruent studies and is, in addition, aretheexistenceoffourseparateospC types and two reflected by the fact that the skin manifestation acro- dbpA clusters (Fig. 4). Compared to the few sequences dermatitis chronica athrophicans is non-existent in the that have been to our disposal, this heterogeneity is USA, where B. afzelii does not occur. Prevalence of noteworthy. At the small study site English Garden in B. garinii in CSF isolates is significantly higher when Munich measuring about 400 m2,bothdbpA types compared with the prevalence in adult ticks (po0.001), and two out of the four ospC types were present. We but matches the prevalence in nymphs (p ¼ 0.6). More- assume that the heterogeneity within this species is even over, the overall prevalence pattern in nymphs revealed higher than observed here. Notably, the alignment of the no significant differences to CSF isolates, not even for DbpA protein sequences confirms the functionality of the the different B. garinii OspA types. Since I. ricinus DbpA proteins of the B. spielmanii strainsasthelysine nymphs are the most important vectors for human residue at position 82 (reference strain B. burgdorferi s.s. disease, organotropism of B. garinii for the central B31) required for the binding of decorin (Pikas et al., nervous system could not be substantiated, which is in 2003) is conserved (data not shown). line with a previous study (Eiffert et al., 1995). It is suggested that invasiveness of B. burgdorferi s.l. is Furthermore, our results confirm that the strains linked to certain OspC groups (Lagal et al., 2003). So causing Lyme arthritis in Europe are heterogeneous far, B. spielmanii was only detected in patients with (Eiffert et al., 1998; Vasiliu et al., 1998) and not limited localized skin disease and its potential for systemic to B. burgdorferi s.s. as primarily supposed (Jaulhac infection is unknown. More data of patient- and tick- et al., 1996; Lunemann et al., 2001). Nevertheless, our derived isolates of B. spielmanii are required to find out results must be interpreted with caution. The patient whether there are certain OspC types that are invasive or isolates were collected from all over Germany, pre- on the other hand are perhaps even not pathogenic. dominantly southern Germany, between 1984 and 2002, In conclusion, we have found a broad heterogeneity while the ticks represent only eight small areas from of B. burgdorferi s.l. species and OspA types in ticks and southern Germany and were collected in 2003/2004. patient isolates from Germany, including the new Furthermore, different detection methods may influence species B. spielmanii sp. nov. Delineation of the latter the results, e.g. some species or strains grow better in as a new species as well as its human pathogenic culture and may even be selectively amplified by PCR. potential including new isolates from Germany and Interestingly, one CSF isolate could be assigned to the Slovenia could further be substantiated. Such data are a species B. bissettii. This species was found in Ixodes ticks basic requirement for development of diagnostic tests, from the USA and has rarely been isolated from vaccines, as well as for risk assessment after a tick bite. European patients, but its human pathogenicity is still a matter of discussion (Strle et al., 1997; Postic et al., 1998). Unfortunately, until now we could not obtain Acknowledgements information regarding the patients’ symptoms, labora- tory test results, or anamnestic data, and therefore the We thank Cecilia Hizo-Teufel for excellent technical relevance of this isolate remains unclear. work and Ju¨rgen Heesemann for generous support. This work was supported in part by the Robert-Koch-Institut, grant no. ZV2-1369-338, and the ‘‘Bayerisches Staatsmi- Molecular characterization of B. spielmanii nisterium fu¨r Umwelt, Gesundheit und Verbrau- cherschutz’’. Part of the tick study was part of Sarah In this study, rrs, rrf-rrl, the inner part of fla, ospA, Leonhard’s thesis, which will be published elsewhere. ospC, and dbpA genes from the patient isolates and tick- derived B. spielmanii amplicons have been partially sequenced. Comparison of rrs, fla, rrf-rrl,andospA References sequences to the recently published sequences (Richter et al., 2006) clearly confirmed the assignment of these Baranton, G., Postic, D., Saint, G., Boerlin, I.P., Piffaretti, strains to B. spielmanii. Regarding the rrf-rrl region one J.C., Assous, M., Grimont, P.A., 1992. Delineation of has to mention that the sequences cluster into two Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., groups showing 96% sequence identity only, similar to group VS461 associated with Lyme borreliosis. Int. J. Syst. the low rrf-rrl sequence identity found within B. garinii. Bacteriol. 42, 378–383. ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290 289

Canica, M.M., Nato, F., du, M.L., Mazie, J.C., Baranton, G., selected localities in Slovakia and Poland. Int. J. Med. Postic, D., 1993. Monoclonal antibodies for identification Microbiol. 296S1, 108–118. of Borrelia afzelii sp. nov. associated with late cutaneous Lunemann, J.D., Zarmas, S., Priem, S., Franz, J., Zschender- manifestations of Lyme borreliosis. Scand. J. Infect. Dis. lein, R., Aberer, E., Klein, R., Schouls, L., Burmester, 25, 441–448. G.R., Krause, A., 2001. Rapid typing of Borrelia burgdor- Casati, S., Bernasconi, M.V., Gern, L., Piffaretti, J.C., 2004. feri sensu lato species in specimens from patients with Diversity within Borrelia burgdorferi sensu lato genospecies different manifestations of Lyme borreliosis. J. Clin. in Switzerland by recA gene sequence. FEMS Microbiol. Microbiol. 39, 1130–1133. Lett. 238, 115–123. Maraspin, V., Ruzic-Sabljic, E., Strle, F., 2006. Lyme Collares-Pereira, M., Couceiro, S., Franca, I., Kurtenbach, K., Borreliosis and Borrelia spielmanii. Emerg. Infect. Dis. 12, Schafer, S.M., Vitorino, L., Goncalves, L., Baptista, S., 1177. Vieira, M.L., Cunha, C., 2004. First isolation of Borrelia Michel, H., Wilske, B., Hettche, G., Goettner, G., Heimerl, C., lusitaniae from a human patient. J. Clin. Microbiol. 42, Reischl, U., Schulte-Spechtel, U., Fingerle, V., 2003. An 1316–1318. ospA-polymerase chain reaction/restriction fragment Eiffert, H., Ohlenbusch, A., Christen, H.J., Thomssen, R., length polymorphism-based method for sensitive detection Spielman, A., Matuschka, F.R., 1995. Nondifferentia- and reliable differentiation of all European Borrelia tion between spirochetes from vector burgdorferi sensu lato species and OspA types. Med. ticks and human cerebrospinal fluid. J. Infect. Dis. 171, Microbiol. Immunol. (Berl.) 193, 219–226. 476–479. Peter, O., Bretz, A.G., Bee, D., 1995. Occurrence of different Eiffert, H., Karsten, A., Thomssen, R., Christen, H.J., 1998. genospecies of Borrelia burgdorferi sensu lato in ixodid Characterization of Borrelia burgdorferi strains in Lyme ticks of Valais, Switzerland. Eur. J. Epidemiol. 11, arthritis. Scand. J. Infect. Dis. 30, 265–268. 463–467. Foldvari, G., Farkas, R., Lakos, A., 2005. Borrelia spielmanii Pikas, D.S., Brown, E.L., Gurusiddappa, S., Lee, L.Y., Xu, erythema migrans, Hungary. Emerg. Infect. Dis. 11, Y., Hook, M., 2003. Decorin-binding sites in the adhesin 1794–1795. DbpA from Borrelia burgdorferi: a synthetic peptide Fukunaga, M., Okada, K., Nakao, M., Konishi, T., Sato, Y., approach. J. Biol. Chem. 278, 30920–30926. 1996. Phylogenetic analysis of Borrelia species based on Postic, D., Assous, M.V., Grimont, P.A., Baranton, G., 1994. flagellin gene sequences and its application for molecular Diversity of Borrelia burgdorferi sensu lato evidenced by typing of Lyme disease borreliae. Int. J. Syst. Bacteriol. 46, restriction fragment length polymorphism of rrf (5S)-rrl 898–905. (23S) intergenic spacer amplicons. Int. J. Syst. Bacteriol. 44, Gern, L., Hu, C.M., Kocianova, E., Vyrostekova, V., 743–752. Rehacek, J., 1999. Genetic diversity of Borrelia burgdorferi Postic, D., Ras, N.M., Lane, R.S., Hendson, M., Baranton, sensu lato isolates obtained from Ixodes ricinus ticks G., 1998. Expanded diversity among Californian Borrelia collected in Slovakia. Eur. J. Epidemiol. 15, 665–669. isolates and description of Borrelia bissettii sp. nov. Hubalek, Z., Halouzka, J., 1997. Distribution of Borrelia (formerly Borrelia group DN127). J. Clin. Microbiol. 36, burgdorferi sensu lato genomic groups in Europe, a review. 3497–3504. Eur. J. Epidemiol. 13, 951–957. Preac-Mursic, V., Wilske, B., Schierz, G., 1986. European Jaulhac, B., Chary-Valckenaere, I., Sibilia, J., Javier, R.M., Borrelia burgdorferi isolated from humans and ticks. Piemont, Y., Kuntz, J.L., Monteil, H., Pourel, J., 1996. Culture conditions and antibiotic susceptibility. Zentralbl. Detection of Borrelia burgdorferi by DNA amplification in Bakteriol. Mikrobiol. Hyg. [A] 263, 112–118. synovial tissue samples from patients with Lyme arthritis. Rauter, C., Hartung, T., 2005. Prevalence of Borrelia Arthritis Rheum. 39, 736–745. burgdorferi sensu lato genospecies in Ixodes ricinus ticks Jouda, F., Perret, J.L., Gern, L., 2004. Ixodes ricinus density, in Europe: a metaanalysis. Appl. Environ. Microbiol. 71, and distribution and prevalence of Borrelia burgdorferi 7203–7216. sensu lato infection along an altitudinal gradient. J. Med. Rauter, C., Oehme, R., Diterich, I., Engele, M., Hartung, T., Entomol. 41, 162–169. 2002. Distribution of clinically relevant Borrelia genospe- Kurtenbach, K., De Michelis, S., Sewell, H.S., Etti, S., cies in ticks assessed by a novel, single-run, real-time PCR. Scha¨fer, S.M., Hails, R., Collares-Pereira, M., Santos-Reis, J. Clin. Microbiol. 40, 36–43. M., Hanincova´, K., Labuda, M., Bormane, A., Donaghy, Richter, D., Matuschka, F.R., 2006. Perpetuation of the Lyme M., 2001. Distinct combinations of Borrelia burgdorferi disease spirochete Borrelia lusitaniae by lizards. Appl. sensu lato genospecies found in individual questing ticks Environ. Microbiol. 72, 4627–4632. from Europe. Appl. Environ. Microbiol. 67, 4926–4929. Richter, D., Schlee, D.B., Allgower, R., Matuschka, F.R., Lagal, V., Postic, D., Ruzic-Sabljic, E., Baranton, G., 2003. 2004. Relationships of a novel Lyme disease spirochete, Genetic diversity among Borrelia strains determined by Borrelia spielmani sp. nov., with its hosts in Central Europe. single-strand conformation polymorphism analysis of the Appl. Environ. Microbiol. 70, 6414–6419. ospC gene and its association with invasiveness. J. Clin. Richter, D., Postic, D., Sertour, N., Livey, I., Matuschka, Microbiol. 41, 5059–5065. F.R., Baranton, G., 2006. Delineation of Borrelia burgdor- Lencakova, D., Hizo-Teufel, C., Pet’ko, B., Schulte-Spechtel, feri sensu lato species by multilocus sequence analysis and U., Stanko, M., Wilske, B., Fingerle, V., 2006. Prevalence confirmation of the delineation of Borrelia spielmanii sp. of Borrelia burgdorferi s.l. OspA types in Ixodes ticks from nov. Int. J. Syst. Evol. Microbiol. 56, 873–881. ARTICLE IN PRESS 290 V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) 279–290

Rijpkema, S., Golubic, D., Molkenboer, M., Verbeek-de van Dam, A.P., Kuiper, H., Vos, K., Widjojokusumo, A., de Kruif, N., Schellekens, J., 1996. Identification of four Jongh, B.M., Spanjaard, L., Ramselaar, A.C., Kramer, genomic groups of Borrelia burgdorferi sensu lato in Ixodes M.D., Dankert, J., 1993. Different genospecies of Borrelia ricinus ticks collected in a Lyme borreliosis endemic region burgdorferi are associated with distinct clinical manifesta- of northern Croatia. Exp. Appl. Acarol. 20, 23–30. tions of Lyme borreliosis. Clin Infect. Dis. 17, 708–717. Rijpkema, S.G., Tazelaar, D.J., Molkenboer, M.J., Noordhoek, Vasiliu, V., Herzer, P., Ro¨ssler, D., Lehnert, G., Wilske, B., G.T., Plantinga, G., Schouls, L.M., Schellekens, J.F., 1997. 1998. Heterogeneity of Borrelia burgdorferi sensu lato Detection of Borrelia afzelii, Borrelia burgdorferi sensu demonstrated by an ospA-type-specific PCR in synovial stricto, Borrelia garinii and group VS116 by PCR in skin fluid from patients with Lyme arthritis. Med. Microbiol. biopsies of patients with erythema migrans and acroderma- Immunol. (Berl.) 187, 97–102. titis chronica atrophicans. Clin. Microbiol. Infect. 3, 109–116. Wang, G., van Dam, A.P., Spanjaard, L., Dankert, J., 1998. Ruzic-Sabljic, E., Lotric-Furlan, S., Maraspin, V., Cimper- Molecular typing of Borrelia burgdorferi sensu lato by man, J., Pleterski-Rigler, D., Strle, F., 2001. Analysis of randomly amplified polymorphic DNA fingerprinting Borrelia burgdorferi sensu lato isolated from cerebrospinal analysis. J. Clin. Microbiol. 36, 768–776. fluid. APMIS 109, 707–713. Wang, G., van Dam, A.P., Dankert, J., 1999a. Phenotypic and Ruzic-Sabljic, E., Maraspin, V., Lotric-Furlan, S., Jurca, T., genetic characterization of a novel Borrelia burgdorferi Logar, M., Pikelj-Pecnik, A., Strle, F., 2002. Characteriza- sensu lato isolate from a patient with Lyme borreliosis. tion of Borrelia burgdorferi sensu lato strains isolated from J. Clin. Microbiol. 37, 3025–3028. human material in Slovenia. Wien. Klin. Wochenschr. 114, Wang, G., van Dam, A.P., Schwartz, I., Dankert, J., 1999b. 544–550. Molecular typing of Borrelia burgdorferi sensu lato: Schulte-Spechtel, U., Fingerle, V., Goettner, G., Rogge, S., taxonomic, epidemiological, and clinical implications. Clin. Wilske, B., 2005. Molecular analysis of decorin binding Microbiol. Rev. 12, 633–653. protein A (DbpA) reveals five major groups among Wang, G., van Dam, A.P., Dankert, J., 2000. Two distinct European Borrelia burgdorferi sensu lato strains with ospA genes among Borrelia valaisiana strains. Res. Micro- impact for the development of serological assays and biol. 151, 325–331. indicates lateral gene transfer of the dbpA gene. Int. J. Wilske, B., Preac-Mursic, V., Go¨bel, U.B., Graf, B., Jauris, S., Med. Microbiol. 296S1, 250–266. Soutschek, E., Schwab, E., Zumstein, G., 1993. An OspA Stanek, G., Strle, F., 2003. Lyme borreliosis. Lancet 362, serotyping system for Borrelia burgdorferi based on 1639–1647. reactivity with monoclonal antibodies and OspA sequence Strle, F., Picken, R.N., Cheng, Y., Cimperman, J., Maraspin, analysis. J. Clin. Microbiol. 31, 340–350. V., Lotric-Furlan, S., Ruzic-Sabljic, E., Picken, M.M., Wilske, B., Busch, U., Eiffert, H., Fingerle, V., Pfister, H.W., 1997. Clinical findings for patients with Lyme borreliosis Ro¨ssler, D., Preac-Mursic, V., 1996. Diversity of OspA and caused by Borrelia burgdorferi sensu lato with genotypic OspC among cerebrospinal fluid isolates of Borrelia and phenotypic similarities to strain 25015. Clin. Infect. burgdorferi sensu lato from patients with neuroborreliosis Dis. 25, 273–280. in Germany. Med. Microbiol. Immunol. (Berl.) 184, 195–201.