125.Full.Pdf

Total Page:16

File Type:pdf, Size:1020Kb

125.Full.Pdf Published OnlineFirst November 6, 2018; DOI: 10.1158/0008-5472.CAN-18-1938 Cancer Molecular Cell Biology Research Inhibition of Thioredoxin/Thioredoxin Reductase Induces Synthetic Lethality in Lung Cancers with Compromised Glutathione Homeostasis Xiang Yan1,2, Xiaoshan Zhang1, Li Wang1, Ran Zhang1, Xingxiang Pu1, Shuhong Wu1, Lei Li3, Pan Tong4, Jing Wang4, Qing H. Meng5, Vanessa B. Jensen6, Luc Girard7, John D. Minna7, Jack A. Roth1, Stephen G. Swisher1, John V.Heymach8, and Bingliang Fang1 Abstract Glutathione (GSH)/GSH reductase (GSR) and thioredoxin/ cancer (NSCLC) cell lines revealed that auranofin sensitivity thioredoxin reductase (TXNRD) are two major compensating correlated with the expression levels of the GSR, glutamate- thiol-dependent antioxidant pathways that maintain protein cysteine ligase catalytic subunit (GCLC), and NAD(P)H qui- dithiol/disulfide balance. We hypothesized that functional none dehydrogenase 1 (NQO1) genes. In NSCLC patient- deficiency in one of these systems would render cells depen- derived xenografts with reduced expression of GSR and/or dent on compensation by the other system for survival, pro- GCLC, growth was significantly suppressed by treatment with viding a mechanism-based synthetic lethality approach for auranofin. Together, these results provide a proof of concept treatment of cancers. The human GSR gene is located on that cancers with compromised expression of enzymes chromosome 8p12, a region frequently lost in human cancers. required for GSH homeostasis or with chromosome 8p dele- GSR deletion was detected in about 6% of lung adenocarci- tions that include the GSR gene may be targeted by a synthetic nomas in The Cancer Genome Atlas database. To test whether lethality strategy with inhibitors of TXNRD. loss of GSR sensitizes cancer cells to TXNRD inhibition, we knocked out or knocked down the GSR gene in human lung Significance:Thesefindings demonstrate that lung cancers cancer cells and evaluated their response to the TXNRD inhib- with compromised expression of enzymes required for glutathi- itor auranofin. GSR deficiency sensitized lung cancer cells to one homeostasis, including reduced GSR gene expression, may this agent. Analysis of a panel of 129 non–small cell lung be targeted by thioredoxin/thioredoxin reductase inhibitors. Introduction maintain cellular thiol redox homeostasis and protein dithiol/ disulfide balance (1, 2). Both GSH and TXN catalyze the reduction Glutathione (GSH)/GSH reductase (GSR) and thioredoxin of disulfide bonds in proteins to dithiols, which is critical for (TXN)/thioredoxin reductase (TXNRD) are two parallel, compen- maintaining protein functions (Fig. 1A). Oxidized GSH (GSSG) sating thiol-dependent antioxidant pathways that regulate and and TXN generated during this catalytic process are converted to their reduced states by GSR and TXNRD, respectively, both using NADPH generated in the pentose phosphate cycle as the hydrogen 1Department of Thoracic and Cardiovascular Surgery, The University of Texas donor. Functional deficiency in one of these systems will render 2 MD Anderson Cancer Center, Houston, Texas. Department of Medical Oncol- cells dependent on compensation by the other system for survival. 3 ogy, Chinese PLA General Hospital, Beijing, China. Department of Experimental In GSR-deficient yeasts (3) and Drosophila (4), the TXN/TXNRD Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas. 4Department of Bioinformatics and Computational Biology, pathway is required for the reduction of GSSG to GSH. Similarly, The University of Texas MD Anderson Cancer Center, Houston, Texas. 5Depart- GSH acts as a backup for human TXNRD1 to reduce TXN, thereby ment of Laboratory Medicine, The University of Texas MD Anderson Cancer preventing cell death induced by gold compound–mediated Center, Houston, Texas. 6Department of Veterinary Medicine and Surgery, The TXNRD1 inhibition (5). Combined inhibition of the GSH and 7 University of Texas MD Anderson Cancer Center, Houston, Texas. Hamon TXN pathways has led to synergistic cancer cell death (6, 7). Center for Therapeutic Oncology, The Harold C. Simmons Comprehensive Because synthetic lethality interactions occur significantly more Cancer Center, University of Texas Southwestern Medical Center, Dallas, Texas. 8Department of Thoracic/Head and Neck Medical Oncology, The University of frequently among genes involved in similar biological processes, Texas MD Anderson Cancer Center, Houston, Texas. such as those in parallel or compensating pathways (8), we hypothesized that loss and/or reduced expression of enzymes Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). required for GSH homeostasis, including GSR and glutamate- cysteine ligase (the first rate-limiting enzyme of GSH synthesis), in X. Yan and X. Zhang contributed equally to this article. a subgroup of cancers predisposes them to vulnerability to treat- Corresponding Author: Bingliang Fang, The University of Texas MD Anderson ment with TXNRD inhibitors, providing a mechanism-based Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030. Phone: 713-563-9147; synthetic lethality therapy for these cancers. Fax: 713-794-4901; E-mail: [email protected] The human GSR gene is located on chromosome 8p12, a region doi: 10.1158/0008-5472.CAN-18-1938 frequently lost in lung cancers (9, 10) and other types of cancers, Ó2018 American Association for Cancer Research. including breast (11), head and neck (12), prostate (13), bladder www.aacrjournals.org 125 Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst November 6, 2018; DOI: 10.1158/0008-5472.CAN-18-1938 Yan et al. Figure 1. GSR gene deletions in human cancers from TCGA database. A, GSH/GSR and TXN/ TXNRD pathways in regulating protein dithiol/disulfide balance. Both GSH and TXN catalyze the reduction of disulfide bonds in proteins to dithiols, which is critical for maintaining protein functions. B, Alterations in GSR and other selected genes in lung adenocarcinomas. The mutation frequencies are shown on the left side of the graph. Deletions of the GRS gene overlap mostly with the deletion of TUSC3, a gene located in chromosome 8p22, indicating co- occurrence of GSR deletion and chromosome 8p loss. C, Frequencies of GSR gene deletions in different types of cancers. The data were obtained by using the cBioPortal for Cancer Genomics. (14), and gastric/colorectal (10) cancers and lymphoma (15). PCR Detection Kit (Sigma-Aldrich) and authenticated per rou- Accumulating evidence has shown that loss of chromosome 8p tine at our institution's Characterized Cell Line Core using a increases tumor invasiveness and metastasis potential (16–18) short tandem repeat DNA fingerprint assay with a PowerPlex 16 and confers resistance to chemotherapy and poor survival HS kit (Promega). in patients with cancer (13, 18). Targeted deletion of chromosome 8p yielded altered lipid metabolism and increased autophagy, Gene knockout and knockdown in lung cancer cells which trigger invasiveness and confer tumor growth under stress A549–GSR-knockout cells were generated by using the CRISPR/ conditions (18). Unfortunately, therapeutic strategies for cancers Cas9 genome editing system. Briefly, GSR-specific guide RNA with chromosome 8p loss have yet to be developed. Loss of (gRNA) expression vectors were generated as described (20). the GSR gene may offer a unique opportunity for treatment of LentiCas9-Blast (plasmid 52962) and gRNA cloning vector lenti- cancer in a subgroup of patients whose cancer has chromosome Guide-Puro (plasmid 52963) were obtained from Addgene. The 8p aberrations. CRISPR guide sequences targeting GSR were GATCATGCAT- To explore the concept of targeting cancers in which expression GAATTCAGAG (gRNA1) and GTGAGGGTAAATTCAATTGG of enzymes required for GSH homeostasis is reduced or lost, we (gRNA2). A549 cells were cotransfected with lentiCas9-Blast and searched The Cancer Genome Atlas (TCGA) database for genetic gRNA expression vectors. The transfected cells were selected using alterations and found that deep GSR deletion was detected in 6% puromycin (2 mg/mL) for 48 hours. Isolated single colonies were of lung adenocarcinomas, 3.5% of squamous cell lung cancers, analyzed by Western blot. The colonies without GSR expression and 4% to 9% of prostate, breast, liver, ovarian, and colon cancers, were subjected to detection of genomic mutations by DNA suggesting that loss of the GSR gene occurs in a subset of human sequencing. cancers. We then tested whether loss of GSR in cancer cells will For siRNA-mediated gene knockdown, scramble control siRNA result in their vulnerability to auranofin, a TXNRD inhibitor (19). or siRNA targeting the GSR or the glutamate-cysteine ligase Our results show that reduced expression of enzymes required for catalytic subunit (GCLC) gene (all, Sigma-Aldrich) was trans- GSH homeostasis sensitized cancer cells to TXNRD inhibitor fected into cells with oligofectamine (Sigma-Aldrich) according auranofin. to the manufacturer's instructions. Plasmids for lentiviral vectors expressing cDNA or short-hairpin RNA (shRNA) used in this study were obtained from Open Biosystems through our institution's Materials and Methods shRNA and ORFeome Core facility. Lentiviral vectors were pack- Cell lines and cell culture aged in 293 cells after cotransfection with lentiviral packaging Human non–smallcelllungcancer(NSCLC)celllines, plasmids by using Fugene 6 as
Recommended publications
  • The Thioredoxin Trx-1 Regulates the Major Oxidative Stress Response Transcription Factor, Skn-1, in Caenorhabditis Elegans
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 5-2016 THE THIOREDOXIN TRX-1 REGULATES THE MAJOR OXIDATIVE STRESS RESPONSE TRANSCRIPTION FACTOR, SKN-1, IN CAENORHABDITIS ELEGANS Katie C. McCallum Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Cellular and Molecular Physiology Commons, Medicine and Health Sciences Commons, Molecular Genetics Commons, and the Organismal Biological Physiology Commons Recommended Citation McCallum, Katie C., "THE THIOREDOXIN TRX-1 REGULATES THE MAJOR OXIDATIVE STRESS RESPONSE TRANSCRIPTION FACTOR, SKN-1, IN CAENORHABDITIS ELEGANS" (2016). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 655. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/655 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE THIOREDOXIN TRX-1 REGULATES THE MAJOR OXIDATIVE STRESS RESPONSE TRANSCRIPTION FACTOR, SKN-1, IN CAENORHABDITIS ELEGANS A DISSERTATION Presented to the Faculty of The University of Texas Health Science Center at Houston and The University of Texas MD Anderson Cancer Center Graduate School of Biomedical Sciences in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY by Katie Carol McCallum, B.S.
    [Show full text]
  • Domain Structure of the Glucocorticoid Receptor Protein
    Proc. Nati. Acad. Sci. USA Vol. 84, pp. 4437-4440, July 1987 Biochemistry Domain structure of the glucocorticoid receptor protein (proteolysis/steroid binding/DNA binding/protein sequence) JAN CARLSTEDT-DUKE*, PER-ERIK STROMSTEDT*, ORJAN WRANGEt, TOMAS BERGMANt, JAN-AKE GuSTAFSSON*, AND HANS JORNVALLf *Department of Medical Nutrition, Karolinska Institute, Huddinge University Hospital, F69, S-141 86 Huddinge, Sweden; and Departments of tMedical Cell Genetics and tChemistry, Karolinska Institute, Box 60400, S-104 01 Stockholm, Sweden Communicated by Viktor Mutt, March 26, 1987 (receivedfor review December 1, 1986) ABSTRACT The purified rat liver glucocorticoid receptor GR was eluted with 27.5 mM MgCl2 and further purified by protein was analyzed by limited proteolysis and amino acid chromatography on DEAE-Sepharose, eluted with a linear sequence determination. The NH2 terminus appears to be NaCl gradient. The receptor was detected by analysis for 3H blocked. The steroid-binding domain, defined by a unique radioactivity. Each purification resulted in a yield of '50 ,g tryptic cleavage site, corresponds to the COOH-terminal part of GR, starting from eight rat livers. The purified prepara- of the protein with the domain border in the region of residue tions of GR contained the 94-kDa GR, the 72-kDa GR- 518. The DNA-binding domain, defined by a region with associated protein that is unrelated to GR (12, 13), as well as chymotryptic cleavage sites, is immediately adjacent to the very small amounts of proteolytic GR fragments (usually steroid-binding domain and reflects another domain border in <5% of total protein according to densitometric analysis of the region of residues 410-414.
    [Show full text]
  • Role of Thioredoxin-Interacting Protein in Diseases and Its Therapeutic Outlook
    International Journal of Molecular Sciences Review Role of Thioredoxin-Interacting Protein in Diseases and Its Therapeutic Outlook Naila Qayyum 1,†, Muhammad Haseeb 1,† , Moon Suk Kim 1 and Sangdun Choi 1,2,* 1 Department of Molecular Science and Technology, Ajou University, Suwon 16499, Korea; [email protected] (N.Q.); [email protected] (M.H.); [email protected] (M.S.K.) 2 S&K Therapeutics, Woncheon Hall 135, Ajou University, Suwon 16499, Korea * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: Thioredoxin-interacting protein (TXNIP), widely known as thioredoxin-binding protein 2 (TBP2), is a major binding mediator in the thioredoxin (TXN) antioxidant system, which involves a reduction-oxidation (redox) signaling complex and is pivotal for the pathophysiology of some diseases. TXNIP increases reactive oxygen species production and oxidative stress and thereby contributes to apoptosis. Recent studies indicate an evolving role of TXNIP in the pathogenesis of complex diseases such as metabolic disorders, neurological disorders, and inflammatory illnesses. In addition, TXNIP has gained significant attention due to its wide range of functions in energy metabolism, insulin sensitivity, improved insulin secretion, and also in the regulation of glucose and tumor suppressor activities in various cancers. This review aims to highlight the roles of TXNIP in the field of diabetology, neurodegenerative diseases, and inflammation. TXNIP is found to be a promising novel therapeutic target in the current review, not only in the aforementioned diseases but also in prolonged microvascular and macrovascular diseases. Therefore, TXNIP inhibitors hold promise for preventing the growing incidence of complications in relevant diseases.
    [Show full text]
  • Is Glyceraldehyde-3-Phosphate Dehydrogenase a Central Redox Mediator?
    1 Is glyceraldehyde-3-phosphate dehydrogenase a central redox mediator? 2 Grace Russell, David Veal, John T. Hancock* 3 Department of Applied Sciences, University of the West of England, Bristol, 4 UK. 5 *Correspondence: 6 Prof. John T. Hancock 7 Faculty of Health and Applied Sciences, 8 University of the West of England, Bristol, BS16 1QY, UK. 9 [email protected] 10 11 SHORT TITLE | Redox and GAPDH 12 13 ABSTRACT 14 D-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is an immensely important 15 enzyme carrying out a vital step in glycolysis and is found in all living organisms. 16 Although there are several isoforms identified in many species, it is now recognized 17 that cytosolic GAPDH has numerous moonlighting roles and is found in a variety of 18 intracellular locations, but also is associated with external membranes and the 19 extracellular environment. The switch of GAPDH function, from what would be 20 considered as its main metabolic role, to its alternate activities, is often under the 21 influence of redox active compounds. Reactive oxygen species (ROS), such as 22 hydrogen peroxide, along with reactive nitrogen species (RNS), such as nitric oxide, 23 are produced by a variety of mechanisms in cells, including from metabolic 24 processes, with their accumulation in cells being dramatically increased under stress 25 conditions. Overall, such reactive compounds contribute to the redox signaling of the 26 cell. Commonly redox signaling leads to post-translational modification of proteins, 27 often on the thiol groups of cysteine residues. In GAPDH the active site cysteine can 28 be modified in a variety of ways, but of pertinence, can be altered by both ROS and 29 RNS, as well as hydrogen sulfide and glutathione.
    [Show full text]
  • AMPK Attenuates Adriamycin-Induced Oxidative Podocyte Injury
    Molecular Pharmacology Fast Forward. Published on December 30, 2013 as DOI: 10.1124/mol.113.089458 Molecular PharmacologyThis article Fast has not Forward. been copyedited Published and formatted. on TheDecember final version 30, may 2013 differ asfrom doi:10.1124/mol.113.089458 this version. MOL #89458 AMPK Attenuates Adriamycin-Induced Oxidative Podocyte Injury through Thioredoxin-Mediated Suppression Downloaded from of ASK1-P38 Signaling Pathway molpharm.aspetjournals.org Kun Gao, Yuan Chi, Wei Sun, Masayuki Takeda and Jian Yao Departments of Molecular Signaling (K.G., Y.C., J.Y.), Interdisciplinary Graduate School of at ASPET Journals on September 30, 2021 Medicine and Engineering, University of Yamanashi, Yamanashi, Japan; Department of Nephrology (K.G., W.S.), Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, China; and Department of Urology (M.T.), Interdisciplinary Graduate School of Medicine and Engineering, University of Yamanashi, Yamanashi, Japan 1 Copyright 2013 by the American Society for Pharmacology and Experimental Therapeutics. Molecular Pharmacology Fast Forward. Published on December 30, 2013 as DOI: 10.1124/mol.113.089458 This article has not been copyedited and formatted. The final version may differ from this version. MOL #89458 Running title: AMPK attenuates oxidative cell injury Address correspondence to: Jian Yao, M.D., Ph.D., Department of Molecular Signaling, Interdisciplinary Graduate School of Medicine and Engineering, University of Yamanashi, Chuo, Yamanashi 409-3898, Japan. Tel/Fax:
    [Show full text]
  • Role of Transglutaminase 2 in Cell Death, Survival, and Fibrosis
    cells Review Role of Transglutaminase 2 in Cell Death, Survival, and Fibrosis Hideki Tatsukawa * and Kiyotaka Hitomi Cellular Biochemistry Laboratory, Graduate School of Pharmaceutical Sciences, Nagoya University, Tokai National Higher Education and Research System, Nagoya 464-8601, Aichi, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-52-747-6808 Abstract: Transglutaminase 2 (TG2) is a ubiquitously expressed enzyme catalyzing the crosslink- ing between Gln and Lys residues and involved in various pathophysiological events. Besides this crosslinking activity, TG2 functions as a deamidase, GTPase, isopeptidase, adapter/scaffold, protein disulfide isomerase, and kinase. It also plays a role in the regulation of hypusination and serotonylation. Through these activities, TG2 is involved in cell growth, differentiation, cell death, inflammation, tissue repair, and fibrosis. Depending on the cell type and stimulus, TG2 changes its subcellular localization and biological activity, leading to cell death or survival. In normal unstressed cells, intracellular TG2 exhibits a GTP-bound closed conformation, exerting prosurvival functions. However, upon cell stimulation with Ca2+ or other factors, TG2 adopts a Ca2+-bound open confor- mation, demonstrating a transamidase activity involved in cell death or survival. These functional discrepancies of TG2 open form might be caused by its multifunctional nature, the existence of splicing variants, the cell type and stimulus, and the genetic backgrounds and variations of the mouse models used. TG2 is also involved in the phagocytosis of dead cells by macrophages and in fibrosis during tissue repair. Here, we summarize and discuss the multifunctional and controversial Citation: Tatsukawa, H.; Hitomi, K. roles of TG2, focusing on cell death/survival and fibrosis.
    [Show full text]
  • AMP-Activated Protein Kinase: the Current Landscape for Drug Development
    REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1).
    [Show full text]
  • Thioredoxin-Interacting Protein (Txnip) Is a Glucocorticoid-Regulated Primary Response Gene Involved in Mediating Glucocorticoid-Induced Apoptosis
    Oncogene (2006) 25, 1903–1913 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE Thioredoxin-interacting protein (txnip) is a glucocorticoid-regulated primary response gene involved in mediating glucocorticoid-induced apoptosis Z Wang, YP Rong, MH Malone, MC Davis, F Zhong and CW Distelhorst Departments of Medicine and Pharmacology, Comprehensive Cancer Center, Case Western Reserve University School of Medicine and University Hospitals of Cleveland, Cleveland, OH, USA Glucocorticoid hormones induce apoptosis in lymphoid Introduction cells.This process is transcriptionally regulated and requires de novo RNA/protein synthesis.However, the Glucocorticoid-induced apoptosis plays an important full spectrum of glucocorticoid-regulated genes mediating physiological role, contributing to maintenance of this cell death process is unknown.Through gene homeostasis in the immune system (Ashwell et al., expression profiling we discovered that the expression 2000; Jondal et al., 2004). As their ability to induce of thioredoxin-intereacting protein (txnip) mRNA is apoptosis in immature lymphocytes, glucocorticoids significantly induced by the glucocorticoid hormone dexa- (dexamethasone, prednisone) are among the most methasone not only in the murine T-cell lymphoma line effective agents for treatment of lymphoid malignancies WEHI7.2, but also in normal mouse thymocytes. This (Schmidt et al., 2004). However, their therapeutic use is result was confirmed by Northern blot analysis in multiple limited
    [Show full text]
  • Human Thioredoxin 2 Deficiency Impairs Mitochondrial Redox
    doi:10.1093/brain/awv350 BRAIN 2016: 139; 346–354 | 346 REPORT Human thioredoxin 2 deficiency impairs mitochondrial redox homeostasis and causes early-onset neurodegeneration Eliska Holzerova,1,2 Katharina Danhauser,3 Tobias B. Haack,1,2 Laura S. Kremer,1,2 Marlen Melcher,3 Irina Ingold,4 Sho Kobayashi,4,5 Caterina Terrile,2 Petra Wolf,2 Jo¨rg Schaper,6 Ertan Mayatepek,3 Fabian Baertling,3 Jose´ Pedro Friedmann Angeli,4 Marcus Conrad,4 Tim M. Strom,2 Thomas Meitinger1,2,7 Holger Prokisch1,2,* and Downloaded from Felix Distelmaier3,* *These authors contributed equally to this work. http://brain.oxfordjournals.org/ Thioredoxin 2 (TXN2; also known as Trx2) is a small mitochondrial redox protein essential for the control of mitochondrial reactive oxygen species homeostasis, apoptosis regulation and cell viability. Exome sequencing in a 16-year-old adolescent suffering from an infantile-onset neurodegenerative disorder with severe cerebellar atrophy, epilepsy, dystonia, optic atrophy, and peripheral neuropathy, uncovered a homozygous stop mutation in TXN2. Analysis of patient-derived fibroblasts demonstrated absence of TXN2 protein, increased reactive oxygen species levels, impaired oxidative stress defence and oxidative phosphorylation dysfunc- tion. Reconstitution of TXN2 expression restored all these parameters, indicating the causal role of TXN2 mutation in disease development. Supplementation with antioxidants effectively suppressed cellular reactive oxygen species production, improved cell by guest on March 10, 2016 viability and mitigated clinical symptoms during short-term follow-up. In conclusion, our report on a patient with TXN2 deficiency suggests an important role of reactive oxygen species homeostasis for human neuronal maintenance and energy metabolism.
    [Show full text]
  • Thioredoxin Is Involved in Endothelial Cell Extracellular Transglutaminase 2 Activation Mediated by Celiac Disease Patient Iga
    Thioredoxin Is Involved in Endothelial Cell Extracellular Transglutaminase 2 Activation Mediated by Celiac Disease Patient IgA Cristina Antonella Nadalutti1, Ilma Rita Korponay-Szabo2, Katri Kaukinen3, Zhuo Wang4, Martin Griffin4, Markku Mäki1, Katri Lindfors1* 1 Tampere Center for Child Health Research, University of Tampere and Tampere University Hospital, Tampere, Finland, 2 Celiac Disease Center, Heim Palm Children’s Hospital, Budapest and Department of Pediatrics, Medical and Health Science Center, University of Debrecen, Debrecen, Hungary, 3 School of Medicine, University of Tampere, Department of GastroenterologyandAlimentary Tract Surgery, Tampere University Hospital, Tampere, Finland; Department of Medicine, Seinäjoki Central Hospital, Finland, 4 School of Life and Health Sciences, Aston University, Birmingham, United Kingdom Abstract Purpose: To investigate the role of thioredoxin (TRX), a novel regulator of extracellular transglutaminase 2 (TG2), in celiac patients IgA (CD IgA) mediated TG2 enzymatic activation. Methods: TG2 enzymatic activity was evaluated in endothelial cells (HUVECs) under different experimental conditions by ELISA and Western blotting. Extracellular TG2 expression was studied by ELISA and immunofluorescence. TRX was analysed by Western blotting and ELISA. Serum immunoglobulins class A from healthy subjects (H IgA) were used as controls. Extracellular TG2 enzymatic activity was inhibited by R281. PX12, a TRX inhibitor, was also employed in the present study. Results: We have found that in HUVECs CD IgA is able to induce the activation of extracellular TG2 in a dose- dependent manner. Particularly, we noted that the extracellular modulation of TG2 activity mediated by CD IgA occurred only under reducing conditions, also needed to maintain antibody binding. Furthermore, CD IgA-treated HUVECs were characterized by a slightly augmented TG2 surface expression which was independent from extracellular TG2 activation.
    [Show full text]
  • The Writers, Readers, and Erasers in Redox Regulation of GAPDH
    antioxidants Review The Writers, Readers, and Erasers in Redox Regulation of GAPDH Maria-Armineh Tossounian, Bruce Zhang and Ivan Gout * Department of Structural and Molecular Biology, University College London, London WC1E 6BT, UK; [email protected] (M.-A.T.); [email protected] (B.Z.) * Correspondence: [email protected] Received: 23 October 2020; Accepted: 14 December 2020; Published: 16 December 2020 Abstract: Glyceraldehyde 3–phosphate dehydrogenase (GAPDH) is a key glycolytic enzyme, which is crucial for the breakdown of glucose to provide cellular energy. Over the past decade, GAPDH has been reported to be one of the most prominent cellular targets of post-translational modifications (PTMs), which divert GAPDH toward different non-glycolytic functions. Hence, it is termed a moonlighting protein. During metabolic and oxidative stress, GAPDH is a target of different oxidative PTMs (oxPTM), e.g., sulfenylation, S-thiolation, nitrosylation, and sulfhydration. These modifications alter the enzyme’s conformation, subcellular localization, and regulatory interactions with downstream partners, which impact its glycolytic and non-glycolytic functions. In this review, we discuss the redox regulation of GAPDH by different redox writers, which introduce the oxPTM code on GAPDH to instruct a redox response; the GAPDH readers, which decipher the oxPTM code through regulatory interactions and coordinate cellular response via the formation of multi-enzyme signaling complexes; and the redox erasers, which are the reducing systems that regenerate the GAPDH catalytic activity. Human pathologies associated with the oxidation-induced dysregulation of GAPDH are also discussed, featuring the importance of the redox regulation of GAPDH in neurodegeneration and metabolic disorders.
    [Show full text]
  • The NRF2, Thioredoxin, and Glutathione System in Tumorigenesis and Anticancer Therapies
    antioxidants Review The NRF2, Thioredoxin, and Glutathione System in Tumorigenesis and Anticancer Therapies Morana Jaganjac y , Lidija Milkovic y , Suzana Borovic Sunjic and Neven Zarkovic * Laboratory for Oxidative Stress, Division of Molecular Medicine, Rudjer Boskovic Institute, Bijenicka 54, 10000 Zagreb, Croatia; [email protected] (M.J.); [email protected] (L.M.); [email protected] (S.B.S.) * Correspondence: [email protected]; Tel.: +385-1-457-1234 These authors contributed equally to this work. y Received: 27 October 2020; Accepted: 17 November 2020; Published: 19 November 2020 Abstract: Cancer remains an elusive, highly complex disease and a global burden. Constant change by acquired mutations and metabolic reprogramming contribute to the high inter- and intratumor heterogeneity of malignant cells, their selective growth advantage, and their resistance to anticancer therapies. In the modern era of integrative biomedicine, realizing that a personalized approach could benefit therapy treatments and patients’ prognosis, we should focus on cancer-driving advantageous modifications. Namely, reactive oxygen species (ROS), known to act as regulators of cellular metabolism and growth, exhibit both negative and positive activities, as do antioxidants with potential anticancer effects. Such complexity of oxidative homeostasis is sometimes overseen in the case of studies evaluating the effects of potential anticancer antioxidants. While cancer cells often produce more ROS due to their increased growth-favoring demands, numerous conventional anticancer therapies exploit this feature to ensure selective cancer cell death triggered by excessive ROS levels, also causing serious side effects. The activation of the cellular NRF2 (nuclear factor erythroid 2 like 2) pathway and induction of cytoprotective genes accompanies an increase in ROS levels.
    [Show full text]