DOCSLIB.ORG

HNF1A-AS1 Regulates Cell Migration, Invasion and Glycolysis Via Modulating Mir-124/MYO6 in Colorectal Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HNF1A-AS1 Regulates Cell Migration, Invasion and Glycolysis Via Modulating Mir-124/MYO6 in Colorectal Cancer Cells OncoTargets and Therapy Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH HNF1A-AS1 Regulates Cell Migration, Invasion and Glycolysis via Modulating miR-124/MYO6 in Colorectal Cancer Cells This article was published in the following Dove Press journal: OncoTargets and Therapy Xiong Guo1 Background: Accumulating evidence determined that lncRNAs play multiple roles in cell Yang Zhang 1 progression in colorectal cancer (CRC). Long noncoding RNA (lncRNA) hepatocyte nuclear Ling Liu2 factor 1 homeobox A (HNF1A)-antisense RNA 1 (AS1) has been identified to affect cell Weiming Yang1 growth and disease diagnosis in various cancers, including CRC. However, the underlying Qi Zhang 3 regulatory mechanism of HNF1A-AS1 in cell progression and glycolysis has not been fully explored in CRC. 1 Colorectal and Anal Surgical Materials and Methods: The expression of HNF1A-AS1, microRNA-124 (miR-124) and Department, Xiangya Hospital Central South University, Changsha 410008, Myosins of class VI (MYO6) was detected using reverse transcription-quantitative polymer- People’s Republic of China; ase chain reaction (RT-qPCR). The analysis of glucose consumption, lactate production and 2 Hepatobiliary and Enteric Surgery hexokinase 2 (HK2) protein level was used to assess glycolysis in cells. The protein level of Research Center, Xiangya Hospital Central South University, Changsha HK2 and MYO6 was measured with Western blot. Cell migration and invasion were 410008, People’s Republic of China; evaluated using the transwell assay. The relationship among HNF1A-AS1, miR-124 and 3Department of Hepatobiliary and Pancreatic Surgery, Xiangya Hospital MYO6 was determined via luciferase reporter and RNA immunoprecipitation (RIP) assay. Central South University, Changsha Results: In this study, we found that HNF1A-AS1 was upregulated in CRC tissues and cell ’ 410008, People s Republic of China lines. Functional experiments determined that reduction of HNF1A-AS1 or promotion of miR- 124 inhibited cell migration and invasion as well as glycolysis in CRC cells. What’ more, luciferase reporter assay manifested that miR-124 was a target of HNF1A-AS1 and MYO6 was a target mRNA of miR-124 in CRC cells. Additionally, reverse experiments showed that the effects of si-HNF1A-AS1 on colorectal cancer cells were impaired by anti-miR-124 and the effects of high miR-124 expression on CRC cells were rescued by upregulating MYO6. HNF1A- AS1 regulated MYO6 expression via targeting miR-124 in CRC cells. Conclusion: In this study, we first found that HNF1A-AS1 regulated cell migration, invasion and glycolysis via modulating miR-124/MYO6 in CRC cells. Keywords: HNF1A-AS1, miR-124, MYO6, colorectal cancer Introduction Colorectal cancer (CRC) is the third most common cancer worldwide, with high morbidity and mortality in China.1,2 Because advanced colorectal cancer still lacks effective diagnosis and treatment, it is necessary to further explore and analyze the Correspondence: Qi Zhang Department of Hepatobiliary and pathogenesis and regulation mechanism of CRC to determine effective biomarkers. Pancreatic Surgery, Xiangya Hospital At present, a large number of studies have shown that long noncoding RNAs Central South University, No. 87, Xiangya Road, Kaifu District, Changsha 410008, (lncRNAs) are important regulators in cells and are widely involved in the occur- People’s Republic of China rence and development of human diseases.3–9 LncRNAs are noncoding RNAs with Tel +86 138 7594 9431 Email [email protected] a length of more than 200 nt, as ceRNAs, which further regulated the production of submit your manuscript | www.dovepress.com OncoTargets and Therapy 2020:13 1507–1518 1507 DovePress © 2020 Guo et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php – http://doi.org/10.2147/OTT.S231249 and incorporate the Creative Commons Attribution Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php). Guo et al Dovepress downstream proteins by regulating the miRNA/mRNA Small interfering RNA (siRNA) targeting HNF1A-AS1 axis.10–13 Some lncRNAs have been reported to be differ- (si-HNF1A-AS1), siRNA scrambled control (si-NC), pc entially expressed in colorectal cancer tissues and cells, DNA-HNF1A-AS1 (HNF1A-AS1), pcDNA-MYO6 (MY but their functions have been verified.14 For example, O6), pcDNA, miR-124 mimic (miR-212-3p), miRNA nega- lncRNA DLEU1 promoted CRC cell progression through tive control (miR-NC), miR-124 inhibitor (anti-miR-212-3p) regulating KPNA3.15 Moreover, lncRNA CRNDE induced and inhibitor negative control (anti-miR-NC) were purchased cell proliferation and chemoresistance in CRC.16 lncRNA from GenePharma Co. Ltd. (Suzhou, China). These vectors BANCR has been determined to relate to CRC poor and oligos were transfected into SW620 and HCT116 cells prognosis.17 However, the regulation mechanism of using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, lncRNA in colorectal cancer has not yet been elucidated, USA) according to the manufacturer’s instructions. and further exploration and research are needed. The lncRNA HNF1A antisense RNA 1 (HNF1A-AS1), Reverse Transcription-Quantitative as an oncogene, was involved in cell progression and Polymerase Chain Reaction (RT-qPCR) metabolism in many cancers, such as lung adenocarci- Total RNA was extracted from CRC cells and tissues using noma, colorectal carcinoma, oesophageal adenocarcinoma, TRIzol reagent (Invitrogen) referring to the protocols supplied nonsmall cell lung cancer, bladder cancer and hepatocel- by the manufacturer. 1 ng of RNA was reversely transcribed lular carcinoma.18–23 Zhao et al demonstrated that induc- into cDNA using PrimeScript RT reagent kit (Takara tion of HNF1A-AS contributed to cell proliferation and Biotechnology Co., Ltd., Dalian, China). For HNF1A-AS1 metastasis through activating Wnt/β-catenin signaling and MYO6 detection, One Step SYBR PrimeScript™ pathway in osteosarcoma.24 In addition, lncRNA HNF1A- RTPCR Kit (Takara) was used to measure the relative expres- AS1 has been determined to be a novel diagnostic predic- sion of HNF1A-AS1 and MYO6. For miR-124 detection, tor for prognosis of cancers.25,26 However, the effect of TaqMan miRNA assays (Applied Biosystems, Carlsbad, CA, HNF1A-AS1 on cell glycolysis has not been explained and USA) were used to measure the relative expression of miR- the regulatory network HNF1A-AS1 remains to be further 124. All samples were performed on a CFX96 TouchTM explored and analyzed. Real-Time PCR system (Bio-Rad, Hercules, CA, USA). In the present study, we investigated the functional Glyceraldehyde phosphate dehydrogenase (GAPDH) and U6 effects of lncRNA HNF1A-AS1on the cell metabolism were employed to normalize for mRNA and miRNA, respec- and glycolysis in CRC cells, as well as the potential tively. The primer sequences were as follows: the primers for regulatory mechanism. U6: forward, 5ʹ-CTCGCTTCGGCAGCACA-3ʹ and reverse 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ. The primers for miR- Materials and Methods 124, forward, 5ʹ- GCCTAAGGCACGCGGTG-3ʹ and reverse, Tissues, Cell Culture and Transfection 5ʹ-GTCGTATCCAGTGCAGGGTCCGAGGTA − ʹ Forty pairs of CRC tissues and adjacent normal tissues TTCGCACTGGATACGACGGCATT 3 . The primers for ʹ ʹ were obtained from patients who were diagnosed at HNF1A-AS1: forward 5 -TCAAGAAATGGTGGCTAT-3 ʹ ʹ Xiangya Hospital Central South University. This experi- and reverse, 5 - GATCTGAGACTGGCTGAA-3 .Thepri- ʹ ment has been approved by the Ethics Committee of mers for MYO6: forward 5 - GATGGAGCTGCACCCTG ʹ ʹ Xiangya Hospital Central South University. Informed writ- ACA-3 and reverse, 5 - GCTCTCAATGGCGCTCTGAAG- ʹ ʹ ten consents were acquired from patients. 3 . The primers for GAPDH: forward 5 -GGAGCGAGAT ʹ ʹ CRC cell lines (SW620, HT-29, HCT116 and SW480) CCCTCCAAAAT-3 and reverse, 5 -GGCTGTTGTCATAC ʹ were purchased from American Type Culture Collection TTCTCATGG-3 . (ATCC, Manassas, VA, USA). The immortalized colon cell (NCM460) was purchased from Rongbai (Shanghai, Western Blot Assay China). All cells were cultured in Dulbecco’s modified Cells were lysed with RIPA Lysis Buffer (Thermo Fisher Eagle’s medium (DMEM; Thermo Fisher Scientific, Inc., Scientific) and the protein concentrations were quantified by Waltham, MA, USA) containing 10% fetal bovine serum a bicinchoninic acid (BCA) Protein Assay Kit (Thermo Fisher (FBS, Sciencell Research, Carlsbad, CA, USA) and 1% Scientific). Protein samples were added onto sodium dodecyl penicillin at 37°C in a humidified atmosphere of 5% CO2. sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and 1508 submit your manuscript | www.dovepress.com OncoTargets and Therapy 2020:13 DovePress Dovepress Guo et al transferred to polyvinylidene difluoride (PVDF) membranes WT-Luc or MYO6-MUT-Luc. Then, these vectors were (Millipore, Bedford, MA, USA). The membranes were incu- co-transfected with miR-124 or miR-NC into SW620 bated with primary antibodies HK2 (1:2000; Santa Cruz and HCT116 cells using Lipofectamine 2000 reagent Biotechnology, Inc., Santa Cruz, CA, USA), MYO6 (1:2000 (Invitrogen). The renilla luciferase control
Load more

Recommended publications
  • Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
    [Show full text]
  • The Roles of Long Noncoding Rnas HNF1-AS1 and HNF4-AS1 in Drug
    non-coding RNA Review The Roles of Long Noncoding RNAs HNF1α-AS1 and HNF4α-AS1 in Drug Metabolism and Human Diseases Liming Chen 1, Yifan Bao 1, Suzhen Jiang 1,2 and Xiao-bo Zhong 1,* 1 Department of Pharmaceutical Sciences, School of Pharmacy, University of Connecticut, Storrs, CT 06269, USA; [email protected] (L.C.); [email protected] (Y.B.); [email protected] (S.J.) 2 School of Pharmaceutical Sciences, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 51006, China * Correspondence: [email protected]; Tel.: +01-860-486-3697 Received: 25 May 2020; Accepted: 22 June 2020; Published: 24 June 2020 Abstract: Long noncoding RNAs (lncRNAs) are RNAs with a length of over 200 nucleotides that do not have protein-coding abilities. Recent studies suggest that lncRNAs are highly involved in physiological functions and diseases. lncRNAs HNF1α-AS1 and HNF4α-AS1 are transcripts of lncRNA genes HNF1α-AS1 and HNF4α-AS1, which are antisense lncRNA genes located in the neighborhood regions of the transcription factor (TF) genes HNF1α and HNF4α, respectively. HNF1α-AS1 and HNF4α-AS1 have been reported to be involved in several important functions in human physiological activities and diseases. In the liver, HNF1α-AS1 and HNF4α-AS1 regulate the expression and function of several drug-metabolizing cytochrome P450 (P450) enzymes, which also further impact P450-mediated drug metabolism and drug toxicity. In addition, HNF1α-AS1 and HNF4α-AS1 also play important roles in the tumorigenesis, progression, invasion, and treatment outcome of several cancers. Through interacting with different molecules, including miRNAs and proteins, HNF1α-AS1 and HNF4α-AS1 can regulate their target genes in several different mechanisms including miRNA sponge, decoy, or scaffold.
    [Show full text]
  • Homozygous Hypomorphic HNF1A Alleles Are a Novel Cause of Young-Onset Diabetes and Result in Sulphonylurea-Sensitive Diabetes
    Diabetes Care 1 Shivani Misra,1 Neelam Hassanali,2 Homozygous Hypomorphic Amanda J. Bennett,2 Agata Juszczak,2 Richard Caswell,3 Kevin Colclough,3 HNF1A Alleles Are a Novel Cause Jonathan Valabhji,4 Sian Ellard,3 of Young-Onset Diabetes and Nicholas S. Oliver,1,4 and Anna L. Gloyn2,5,6 Result in Sulphonylurea-Sensitive Diabetes https://doi.org/10.2337/dc19-1843 OBJECTIVE Heterozygous loss-of-function mutations in HNF1A cause maturity-onset diabetes of the young (MODY). Affected individuals can be treated with low-dose sulpho- nylureas. Individuals with homozygous HNF1A mutations causing MODY have not been reported. RESEARCH DESIGN AND METHODS We phenotyped a kindred with young-onset diabetes and performed molecular genetic testing, a mixed meal tolerance test, a sulphonylurea challenge, and in vitro assays to assess variant protein function. RESULTS A homozygous HNF1A variant (p.A251T) was identified in three insulin-treated 1 family members diagnosed with diabetes before 20 years of age. Those with the Diabetes, Endocrinology and Metabolism, Im- NOVEL COMMUNICATIONS IN DIABETES homozygous variant had low hs-CRP levels (0.2–0.8 mg/L), and those tested dem- perial College London, London, U.K. 2Oxford Centre for Diabetes, Endocrinology and onstrated sensitivity to sulphonylurea given at a low dose, completely transitioning off Metabolism, University of Oxford, Oxford, U.K. insulin. In silico modeling predicted a variant of unknown significance; however, in vitro 3Institute of Biomedical and Clinical Science, Uni- studies supported a modest reduction in transactivation potential (79% of that for the versity of Exeter Medical School, Exeter, U.K.
    [Show full text]
  • Transcriptome Analysis Uncovers the Diagnostic Value of Mir-192-5P/HNF1A-AS1/VIL1 Panel in Cervical Adenocarcinoma
    www.nature.com/scientificreports OPEN Transcriptome analysis uncovers the diagnostic value of miR‑192‑5p/ HNF1A‑AS1/VIL1 panel in cervical adenocarcinoma Junfen Xu1*, Jian Zou1, Luyao Wu1 & Weiguo Lu1,2* Despite the fact that the incidence of cervical squamous cell carcinoma has decreased, there is an increase in the incidence of cervical adenocarcinoma. However, our knowledge on cervical adenocarcinoma is largely unclear. Transcriptome sequencing was conducted to compare 4 cervical adenocarcinoma tissue samples with 4 normal cervical tissue samples. mRNA, lncRNA, and miRNA signatures were identifed to discriminate cervical adenocarcinoma from normal cervix. The expression of VIL1, HNF1A‑AS1, MIR194‑2HG, SSTR5‑AS1, miR‑192‑5p, and miR‑194‑5p in adenocarcinoma were statistically signifcantly higher than that in normal control samples. The Receiver Operating Characteristic (ROC) curve analysis indicated that combination of miR‑192‑5p, HNF1A‑AS1, and VIL1 yielded a better performance (AUC = 0.911) than any single molecule -and could serve as potential biomarkers for cervical adenocarcinoma. Of note, the combination model also gave better performance than TCT test for cervical adenocarcinoma diagnosis. However, there was no correlation between miR‑192‑5p or HNF1A‑AS1 and HPV16/18 E6 or E7. VIL1 was weakly correlated with HPV18 E7 expression. In summary, our study has identifed miR‑192‑5p/HNF1A‑AS1/VIL1 panel that accurately discriminates adenocarcinoma from normal cervix. Detection of this panel may provide considerable clinical value in the diagnosis of cervical adenocarcinoma. Abbreviations SCC Cervical squamous cell carcinoma NcRNA Non-coding RNA MiRNA MicroRNA LncRNA Long non-coding RNA ROC Receiver operating characteristic AUC​ Area under the ROC curve RT-qPCR Quantitative reverse-transcriptase PCR HNF1A-AS1 LncRNA HNF1A antisense RNA 1 VIL1 Villin 1 Cervical cancer ranks fourth for both cancer incidence and mortality in women worldwide 1.
    [Show full text]
  • Hepatocyte Nuclear Factor 1Αsuppresses Steatosis- Associated
    The Journal of Clinical Investigation RESEARCH ARTICLE Hepatocyte nuclear factor 1α suppresses steatosis- associated liver cancer by inhibiting PPARγ transcription Cecilia Patitucci,1,2,3 Gabrielle Couchy,4 Alessia Bagattin,3,5 Tatiana Cañeque,6,7,8 Aurélien de Reyniès,9 Jean-Yves Scoazec,10 Raphaël Rodriguez,6,7,8 Marco Pontoglio,3,5 Jessica Zucman-Rossi,3,4,11,12,13 Mario Pende,1,2,3 and Ganna Panasyuk1,2,3 1Institut Necker-Enfants Malades, 2INSERM U1151/CNRS Unité Mixte de Recherche (UMR) 8253, Paris, France. 3Université Paris Descartes, Sorbonne Paris Cité, Paris, France. 4INSERM, UMR 1162, Functional Genomics of Solid Tumors, Equipe Labellisée Ligue Contre le Cancer, Paris, France. 5INSERM U1016/CNRS UMR 8104, Institut Cochin, Paris, France. 6Institut Curie, PSL Research University, Organic Synthesis and Cell Biology Group, Paris, France. 7CNRS UMR 3666, Paris, France. 8INSERM U1143, Paris, France. 9Ligue Nationale Contre le Cancer, Paris, France. 10INSERM, UMR 865, Faculté Laennec, Lyon, France. 11Hopital Europeen Georges Pompidou, Paris, France. 12University of Paris Diderot, Sorbonne Paris Cité, University Institute of Hematology, Paris, France. 13University of Paris, Sorbonne Paris Cité, Saint-Denis, France. Worldwide epidemics of metabolic diseases, including liver steatosis, are associated with an increased frequency of malignancies, showing the highest positive correlation for liver cancer. The heterogeneity of liver cancer represents a clinical challenge. In liver, the transcription factor PPARγ promotes metabolic adaptations of lipogenesis and aerobic glycolysis under the control of Akt2 activity, but the role of PPARγ in liver tumorigenesis is unknown. Here we have combined preclinical mouse models of liver cancer and genetic studies of a human liver biopsy atlas with the aim of identifying putative therapeutic targets in the context of liver steatosis and cancer.
    [Show full text]
  • Proximal Tubule Translational Profiling During Kidney Fibrosis Reveals Pro- Inflammatory and Lncrna Expression Patterns with Sexual Dimorphism
    BASIC RESEARCH www.jasn.org Proximal Tubule Translational Profiling during Kidney Fibrosis Reveals Proinflammatory and Long Noncoding RNA Expression Patterns with Sexual Dimorphism Haojia Wu,1,2 Chun-Fu Lai,1,2,3 Monica Chang-Panesso,1,2 and Benjamin D. Humphreys 1,2,4 1Division of Nephrology, Departments of 2Medicine and 4Developmental Biology, Washington University in St. Louis School of Medicine, St. Louis, Missouri; and 3Renal Division, Department of Internal Medicine, National Taiwan University Hospital, Taipai, Taiwan ABSTRACT Background Proximal tubule injury can initiate CKD, with progression rates that are approximately 50% faster in males versus females. The precise transcriptional changes in this nephron segment during fibrosis and potential differences between sexes remain undefined. Methods We generated mice with proximal tubule–specific expression of an L10a ribosomal subunit pro- tein fused with enhanced green fluorescent protein. We performed unilateral ureteral obstruction surgery on four male and three female mice to induce inflammation and fibrosis, collected proximal tubule–specific and bulk cortex mRNA at day 5 or 10, and sequenced samples to a depth of 30 million reads. We applied computational methods to identify sex-biased and shared molecular responses to fibrotic injury, including up- and downregulated long noncoding RNAs (lncRNAs) and transcriptional regulators, and used in situ hybridization to validate critical genes and pathways. Results We identified .17,000 genes in each proximal tubule group, including 145 G-protein–coupled receptors. More than 700 transcripts were differentially expressed in the proximal tubule of males versus females. The .4000 genes displaying altered expression during fibrosis were enriched for proinflam- matory and profibrotic pathways.
    [Show full text]
  • ORIGINAL ARTICLE Correlation Between Density of CD8 + T Cell
    Author Manuscript Published OnlineFirst on June 9, 2015; DOI: 10.1158/0008-5472.CAN-14-3051 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ORIGINAL ARTICLE Correlation between density of CD8+ T cell infiltrates in microsatellite unstable colorectal cancers and frameshift mutations: a rationale for personalized immunotherapy Running title: CD8+ cell density correlates with mutations in MSI-CRCs Pauline Maby1; David Tougeron1,2,3; Mohamad Hamieh1; Bernhard Mlecnik4,5,6; Hafid Kora1; Gabriela Bindea4,5,6; Helen K Angell4,5,6,7; Tessa Fredriksen4,5,6; Nicolas Elie8; Emilie Fauquembergue1; Aurélie Drouet1; Jérôme Leprince9; Jacques Benichou10; Jacques Mauillon11,12; Florence Le Pessot13; Richard Sesboüé1; Thierry Frébourg1,11; Jérôme Galon4,5,6; Jean-Baptiste Latouche1,11 1Inserm U1079, Institute for Research and Innovation in Biomedecine (IRIB), Rouen, France; 2Gastroenterology Department, Poitiers University Hospital, Poitiers, France; 3Laboratoire Inflammation Tissus Epithéliaux et Cytokines, EA 4331, Poitiers University, Poitiers, France; 4 Inserm U1138, Laboratory of Integrative Cancer Immunology, Paris, France; 5Université Paris Descartes, Paris, France; 6Cordeliers Research Centre, Université Pierre et Marie Curie, Paris 6, Paris, France; 7AstraZeneca Pharmaceuticals, Alderley Park, Cheshire, UK 8Imaging Core Facility, CMABIO, Caen University Hospital, Caen, France; 9Inserm U982, Institute for Research and Innovation in Biomedecine (IRIB), Rouen University, France 1 Downloaded from
    [Show full text]
  • Impact of Hypoxia on Hepatitis B Virus Replication
    i IMPACT OF HYPOXIA ON HEPATITIS B VIRUS REPLICATION NICHOLAS ROSS BAKER FRAMPTON A thesis submitted to the University of Birmingham for the degree of Doctor of Philosophy Institute of Immunology and Immunotherapy College of Medical and Dental Sciences University of Birmingham September 2017 ii University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Hepatitis B virus (HBV) is one of the world’s unconquered diseases, with 370 million chronically infected globally. HBV replicates in hepatocytes within the liver that exist under a range of oxygen tensions from 11% in the peri-portal area to 3% in the peri- central lobules. HBV transgenic mice show a zonal pattern of viral antigen with expression in the peri-central areas supporting a hypothesis that low oxygen regulates HBV replication. We investigated this hypothesis using a recently developed in vitro model system that supports HBV replication. We demonstrated that low oxygen significantly increases covalently closed circular viral DNA (cccDNA), viral promoter activity and pre-genomic RNA (pgRNA) levels, consistent with low oxygen boosting viral transcription. Hypoxia inducible factors (HIFs) regulate cellular responses to low oxygen and we investigated a role for HIF-1α or HIF-2α on viral transcription.
    [Show full text]
  • BMAL1 and Modulates Tissue-Specific Circadian Networks
    Nuclear receptor HNF4A transrepresses CLOCK: BMAL1 and modulates tissue-specific circadian networks Meng Qua, Tomas Duffyb, Tsuyoshi Hirotac, and Steve A. Kaya,1 aKeck School of Medicine, University of Southern California, Los Angeles, CA 90089; bDepartment of Molecular Medicine, The Scripps Research Institute, La Jolla, CA 92037; and cInstitute of Transformative Bio-Molecules, Nagoya University, 464-8602 Nagoya, Japan Contributed by Steve A. Kay, November 6, 2018 (sent for review September 24, 2018; reviewed by Carla B. Green and John B. Hogenesch) Either expression level or transcriptional activity of various nuclear NRs canonically function as ligand-activated transcription receptors (NRs) have been demonstrated to be under circadian factors that regulate the expression of their target genes to control. With a few exceptions, little is known about the roles of affect physiological pathways (19). The importance of NRs in NRs as direct regulators of the circadian circuitry. Here we show maintaining optimal physiological homeostasis is illustrated in that the nuclear receptor HNF4A strongly transrepresses the their identification as potential targets for therapeutic drug transcriptional activity of the CLOCK:BMAL1 heterodimer. We development to combat a diverse array of diseases, including define a central role for HNF4A in maintaining cell-autonomous reproductive disorders, inflammation, cancer, diabetes, car- circadian oscillations in a tissue-specific manner in liver and colon diovascular disease, and obesity (20). Various NRs have been cells. Not only transcript level but also genome-wide chromosome implicated as targets of the circadian clock, which may con- binding of HNF4A is rhythmically regulated in the mouse liver. tribute to the circadian regulation of nutrient and energy me- ChIP-seq analyses revealed cooccupancy of HNF4A and CLOCK: tabolism.
    [Show full text]
  • Spectrum of HNF1A Somatic Mutations in Hepatocellular
    ORIGINAL ARTICLE Spectrum of HNF1A Somatic Mutations in Hepatocellular Adenoma Differs From That in Patients With MODY3 and Suggests Genotoxic Damage Emmanuelle Jeannot,1,2 Lucille Mellottee,1 Paulette Bioulac-Sage,3 Charles Balabaud,3 Jean-Yves Scoazec,4 Jeanne Tran Van Nhieu,5 Yannick Bacq,6 Sophie Michalak,7 David Buob,8 Groupe d’e´tude Ge´ne´tique des Tumeurs He´patiques (INSERM Network), Pierre Laurent-Puig,9 Ivan Rusyn,2 and Jessica Zucman-Rossi1 OBJECTIVE—Maturity onset diabetes of the young type 3 (MODY3) is a consequence of heterozygous germline mutation in HNF1A. A subtype of hepatocellular adenoma (HCA) is also epatocellular adenoma (HCA) is a rare, benign, caused by biallelic somatic HNF1A mutations (H-HCA), and rare liver tumor frequently associated with oral con- HCA may be related to MODY3. To better understand a relation- traception (1,2). HCA usually manifests as a ship between the development of MODY3 and HCA, we com- single tumor, but in some cases, several adeno- pared both germline and somatic spectra of HNF1A mutations. H mas are detected in the same patient; when Ͼ10 nodules RESEARCH DESIGN AND METHODS—We compared 151 are identified in the liver it is called liver adenomatosis (3). somatic HNF1A mutations in HCA with 364 germline mutations Recently, by the analysis of a large series of patients with described in MODY3. We searched for genotoxic and oxidative HCAs, we established a new molecular classification of stress features in HCA and surrounding liver tissue. these tumors. Adenomas were classified according to the RESULTS—A spectrum of HNF1A somatic mutations signifi- genotype of the tumors, such as the finding of mutations in cantly differed from the germline changes in MODY3.
    [Show full text]
  • Mexican Carriers of the HNF1A P.E508K Variant Do Not Experience
    1726 Diabetes Care Volume 41, August 2018 Mexican Carriers of the HNF1A Alexandro J. Martagon,´ 1,2 Omar Yaxmehen Bello-Chavolla,1,3 p.E508K Variant Do Not Olimpia Arellano-Campos,1 Paloma Almeda-Valdes,´ 1,4 Experience an Enhanced Response Geoffrey A. Walford,5,6,7 Ivette Cruz-Bautista,1,4 to Sulfonylureas Donaj´ı V.Gomez-Velasco,´ 1 RoopaMehta,1,4 Liliana Munoz-Hern~ andez,´ 1 1 Diabetes Care 2018;41:1726–1731 | https://doi.org/10.2337/dc18-0384 Magdalena Sevilla-Gonzalez,´ Tannia L. Viveros-Ruiz,1 Mar´ıa Luisa Ordonez-S~ anchez,´ 8 Rosario Rodr´ıguez-Guillen,8 Jose C. Florez,5,6,7 Mar´ıa Teresa Tusie-Luna,´ 8 and Carlos A. Aguilar-Salinas,1,2,4 on behalf of the Slim Initiative in Genomic Medicine for the Americas (SIGMA) Type 2 Diabetes OBJECTIVE Consortium* To assess whether an ethnic-specific variant (p.E508K) in the maturity-onset dia- betes of the young (MODY) gene hepatocyte nuclear factor-1a (HNF1A) found in 1Unidad de Investigacion´ de Enfermedades Mexicans is associated with higher sensitivity to sulfonylureas, as documented Metabolicas,´ Instituto Nacional de Ciencias in patients with MODY3. Medicas´ y Nutricion,´ Ciudad de Mexico,´ Mexico´ 2Tecnologico´ de Monterrey, Escuela de Medicina RESEARCH DESIGN AND METHODS y Ciencias de la Salud, Monterrey, Nuevo Leon,´ Mexico´ We recruited 96 participants (46 variant carriers and 50 age- and sex-matched 3 – Plan de Estudios Combinados en Medicina, noncarriers). Response to glipizide (one 2.5 5.0-mg dose), metformin (four 500-mg Facultad de Medicina, Universidad Nacional doses), and an oral glucose challenge was evaluated using a previously validated Autonoma´ de Mexico,´ Ciudad de Mexico,´ Mexico´ protocol.
    [Show full text]
  • Integrated Computational Approach to the Analysis of RNA-Seq Data Reveals New Transcriptional Regulators of Psoriasis
    OPEN Experimental & Molecular Medicine (2016) 48, e268; doi:10.1038/emm.2016.97 & 2016 KSBMB. All rights reserved 2092-6413/16 www.nature.com/emm ORIGINAL ARTICLE Integrated computational approach to the analysis of RNA-seq data reveals new transcriptional regulators of psoriasis Alena Zolotarenko1, Evgeny Chekalin1, Alexandre Mesentsev1, Ludmila Kiseleva2, Elena Gribanova2, Rohini Mehta3, Ancha Baranova3,4,5,6, Tatiana V Tatarinova6,7,8, Eleonora S Piruzian1 and Sergey Bruskin1,5 Psoriasis is a common inflammatory skin disease with complex etiology and chronic progression. To provide novel insights into the regulatory molecular mechanisms of the disease, we performed RNA sequencing analysis of 14 pairs of skin samples collected from patients with psoriasis. Subsequent pathway analysis and extraction of the transcriptional regulators governing psoriasis-associated pathways was executed using a combination of the MetaCore Interactome enrichment tool and the cisExpress algorithm, followed by comparison to a set of previously described psoriasis response elements. A comparative approach allowed us to identify 42 core transcriptional regulators of the disease associated with inflammation (NFκB, IRF9, JUN, FOS, SRF), the activity of T cells in psoriatic lesions (STAT6, FOXP3, NFATC2, GATA3, TCF7, RUNX1), the hyper- proliferation and migration of keratinocytes (JUN, FOS, NFIB, TFAP2A, TFAP2C) and lipid metabolism (TFAP2, RARA, VDR). In addition to the core regulators, we identified 38 transcription factors previously not associated with the disease that can clarify the pathogenesis of psoriasis. To illustrate these findings, we analyzed the regulatory role of one of the identified transcription factors (TFs), FOXA1. Using ChIP-seq and RNA-seq data, we concluded that the atypical expression of the FOXA1 TF is an important player in the disease as it inhibits the maturation of naive T cells into the (CD4+FOXA1+CD47+CD69+PD-L1(hi) FOXP3 − ) regulatory T cell subpopulation, therefore contributing to the development of psoriatic skin lesions.
    [Show full text]