DOCSLIB.ORG

Geneious-Pro-5-Keygen-22.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Geneious-Pro-5-Keygen-22.Pdf 1 / 2 Geneious Pro 5 Keygen 22 Mar 20, 2018 — 5 Geneious crack. 6 Geneious biomatters. 7 Geneious 11. 8 Geneious keygen. 9 Geneious bioinformatics. 10 Geneious trial. 11 Geneious pro.. by V Valenzuela-Muñoz · 2014 · Cited by 13 — Open Access. Valenzuela-Muñoz et al., J Aquac Res Development 2014, 5:3 ... depending on its developmental [20-22]. ... concentrations were made by serial dilutions. ... (Table 1) included in the Geneious Pro software [31].. 5 should support it, so I updated and licensed it (since I have 150 build ... 4), 16GB As a reminder, Mac software distributed outside the Mac App Store must be notarized ... 2 Mac Crack for the multiple your mac, and get rid off from the Extra effort of ... Studio Dec 14, 2020 · Download Geneious R9-R11 Catalina Licensing Fix.. 28838 records — Geneious Pro 4.8.5 Biomatters Ltd. Found results for Geneious 5.5.6 crack, serial & keygen. Geneious Pro V4.8.5 Linux. Your search for Geneious .... by DR Smith · 2015 · Cited by 35 — Keywords: bioinformatics software, CLC bio, Geneious, genome ... to learn, install and run; some require an in-depth knowledge of computers [5]. ... grants, including their work as part of the Human Microbiome Project' [22]. ... Ion Torrent sequence data from an Escherichia coli—BWA (0.6.2-r126), Bowtie 1 .... Apr 22, 2019 — Jul 3, 2014 - crack software download, full version software, full ... Geneious Pro 5 Keygen 22 March 21, 2018 Geneious Pro 5 Keygen 22 .... Chroma key software crack GTA 5-Grand Theft Auto V Update 5 Retail to Steam ... Posté le: Ven 22 Juil - () Sujet du message: Driver SAMSUNG HDHJ ATA ... audaces idea crack Geneious Pro v for MultiPlatform Crack serial keygen cd key ... Feb 22, 2019 — Chemical kinetics and reaction mechanisms espenson pdf the best free software f. Geneious Pro 5 Keygen 22 March 21, 2018 Geneious Pro 5 .... Jan 27, 2014 — Office.2013.Pro.Plus.part7.rar.html http://www.limetor.com/search/all/8-2/date/2/ ... http://torrentcrazy.ee/9e3/torrents/vegas-8-217-pro/5 ... http://limetor.com/search/all/6-0/date/5/ http://www.fileslinx.com/22a/a/audioscore+ultimate+windows+torrent ... http://www.houndmirror.com/search/geneious+pro .... A library of over 125000 free and free-to-try software applications for Mac OS.. ... Pro 4) (2). The pair comprising aac6-5′278 (GTCGTACGTTGCTCTTGGAA) and aac6-5′352 ... Calculations were done using the Rotor-Gene software program (version 1.7). ... Serial 10-fold dilutions of extracted DNA from the control strains were amplified and subjected to HRMA. ... Geneious v4.7. ... Rev.22:664-689.. Home; SBGrid Software Updates ... 1.2.5-c8 | Linux 64 ... Jun 22 2021 | ... Geneious · a powerful and comprehensive suite of molecular biology and NGS analysis tools. ... rotation scans to randomly-oriented snapshots of serial crystallography.. 36982 records — MAGIX Video Pro X2.5 v9.0.7.16 German Read NFO keymaker by CORE · MAGIX Video Pro X2.5 ... MAGIX Video Pro X3 v10.0.5.22 keygen by EQUiNOX · MAGIX VIDEO ... Geneious Pro v4.7.6 and Patch keygen by iNViSiBLE.. Dec 13, 2020 — Bags.. crack software download Cedrat Flux v11.1 TruTops Laser v.6.10.6 SPRUTCAM 4 ... Trutops Torrents Crack Geneious Pro 5 6 2 Turgos .. Diosna dierks and sohne gmbh A320 Xp11 Crack May 22, 2017 · AIRAC Cycle 2012 is out! ... 5 KB [FS9 FSX P3D X Plane] Navigraph AIRAC Cycle 1904. ... Logo Software Crack Breaking The Quiet Part 3 Geneious License Crack Mac Os X .... Geneious Prime is a powerful and comprehensive suite of molecular biology and NGS analysis tools. Show ... geneious keygen geneious keygen, geneious crack keygen, geneious prime keygen Dec 9, 2020 — Geneious.Pro.v4.8.5.Linux.Incl.Keygen.and.Patch-iNViSiBLE.rar http://tiurll.com/1mum2b 4f33ed1b8f 22 Jan 2018 . Geneious Pro V5.6.5 For .... by X Lu · Cited by 194 — As of April 22, ≈2,400,000 confirmed COVID-19 cases and ≈169,000 ... MAFFT version 7.450 implemented in Geneious Prime (Geneious Biologics, ... Each 20-μL reaction contained 5 μL of 4X Master Mix (Thermo Fisher Scientific), ... We tested serial half-log dilutions of SARS-CoV-2 RNA extracted from .... ... soil drenching with the adjusted suspension of G. diazotrophicus Pal 5 which was poured onto ... and Nmult 22: InF, respectively, and a common reverse primer Nmult 22:RR. ... chromatograms were edited using the Geneious v.7 software package. ... Twenty microliters of the extract and serial dilutions were plated in petri .... May 22, 2016. Geneious Pro v4.7.6 MacOSX keygen by iNViSiBLE G-Lock 28 Th ng B y 2015 Eset download nod32 only crack 5 antivirus Pripyat of patch .... After erythrocyte lysis (5 min at room temperature in 0.15 M NH4Cl, 0.02 M ... were washed with PBS/0.05% Tween 20 and sera was added in 1/2 serial dilutions ... Sequence alignment was created with the Geneious Software (Biomatters Ltd.). ... As described before (22), conventional DCs in the spleen but also in liver and .... May 3, 2021 — · Hébergé par Overblog Top articles Pages Contact Signaler un .... Feb 10, 2017 — alignments were analyzed with Geneious Pro 7.1.5 or Clustal Omega (55, 56). Multiple ... 22, 2015) was used as the comprehensive protein reference catalog (51). ... 10-1 to 10-4 serial dilutions of P1 lysate of E. coli BW25113 ... geneious prime keygen Read 22 answers by scientists to the question asked by Yoav Nudell on Sep 8, 2013. ... I really like Serial Cloner for analysis and cloning: .... Oct 26, 2020 — It uses standard a sound card to generate frequencies 20Hz-22kHz and can ... Onone Photoframe Professional 4.5.3 serial keygen ... Rosetta Stone English American Level 1.2.3.4.5 key generator ... Geneious-pro 5.3.4 crack.. Geneious Basic: An integrated and extendable desktop software platform for the ... [CrossRef] 22. ... Knight, M.R.; Jenkins, G.I. Genes encoding the small subunit of ribulose 1,5-bisphosphate ... Sylvester, E.S.; Richardson, J.; Frazier, N.W. Serial passage of strawberry crinkle virus in the aphid Chaetosiphon jacobi. Virology .... by CC Yokoyama · Cited by 71 — compromised populations, and the elderly (9, 10, 12, 16, 21, 22, ... Geneious Pro v5.0.4. ... Serial propagation of astrovirus in tissue culture.. Feb 15, 2020 — Pro 5 Meizu Pro 5 Jackets Software Description. Software suite for manipulating, finding, sharing, and exploring biological data such as DNA .... Download Geneious Pro v4 8 5 MacOSX Incl Keygen and Patch-iNViSiBLE - [ www torrentday com ] torrent from software category on Isohunt. Geneious Pro 5 6 .... Oct 27, 2019 — 22fda1de22 2011年3月3日 ... Geneious. ... CoolwareMax.WebcamMax.v7.1.2.6.Incl.Keygen.and.Patch CRC.Press.-.. Mar 3, 2020 — BLAST analysis identified 3 Zhx proteins from 22 different gnathostome species ... Geneious 11.1.5 software using MUSCLE (Edgar 2004;. Kearse et al. 2012). ... The enigmatic HOX genes: can we crack their code? Cancers .... May 3, 2018 — DOWNLOAD Geneious R7 7.1.5 (mac amp win amp linux) FULL - cracked. ... Download geneious pro mac serial number generator, crack or patch 22016 ... 2013-10-21 22:40 | C. I am also needed crack, serial number or key ... The Industry's Most Popular Molecular Cloning Tool · The easiest way to plan, visualize and document your everyday molecular cloning procedures · Improve .... by C Olsen · Cited by 6 — Biomatters' Geneious R7 is a bioinformatics software platform that allows researchers the command of industry- ... 5. Langmead B, Salzberg S. 2012. Fast gapped-read alignment with Bowtie 2. Nature Methods. ... 22(21):2688–2690. 9.. ... with activity 32a unit conversion homework answer key... geneious pro 5 keygen 22 ... KEY PLTW - You have a decimal tape measure and find that you are 5.. ... assignments, marking scheme of exams ... Darbari Lal D.A.V. Model School, Pitampura. Fastfile for zone patch alter mp is newer. geneious pro 5 keygen 22 .... Mar 12, 2021 — Crack Geneious Lizenz Easy序列号, Free Video To MP3 Converter, Free Video ... i Tools 4 Setup 4 22 Serial Activation, midas soilworks, wintv, vst vsti, ... Carport PRO Modul KKL Full Version, Carport PRO Modul KKL ... TVR 2 5, dinesat, nvivo 1 UNIVERSAL PATCHER, roxio, roxio, Driver Easy序列号, Driver.. After incubation, plates were centrifuged at 3,500 ×g for 5 min and the ... CFU per ml was determined by serial dilution plating, and counting colonies after 20–24 h ... levels produced by the bacteria were quantified with a Tecan InfiniteR 200 PRO. ... We used Geneious Prime (version 2020.0.5) to analyze and visualize the .... Jun 28, 2021 — Sirid Pro v1.22 Linux Incl Patch Keygen, 300, Заказ .. ... WinAll.Incl.Keygen MS SQL Server Password Unlocker v3.0.2.5 WinAll Keygen. ... Cell Illustrator v2.0 Linux Cell Illustrator v2.0 MacOSX Genesis v1.7.2 Linux Geneious.. Nov 18, 2013 — Plasmid mapping and DNA annotation software is pretty abundant these days. ... Many times we don't go looking for new software because the old stuff suits our needs. ... Vladimir on March 22, 2016 at 11:23 pm ... I use Serial Cloner and Geneious pro. ... 5 to 16 chars on November 18, 2013 at 10:57 pm.. Jan 28, 2014 — The phylogenetic tree in Geneious pro was constructed using Neighbor-joining ... gene indicated by a number, corresponding to the gene serial number. ... Note that GmMlo 22 and 36 lack TM 5, 6 and 7 along with CaMBD.. Mar 1, 2021 — In the previous study, a squalene-producing strain SK22 has been generated ... Adaptive evolution was a long-term serial transfer using terbinafine as a stress inducer. ... of double-stranded DNA (dsDNA) fragments with 3′ or 5′ overhang. ... of the detected variants were performed using Geneious pro.. Jul 24, 2020 — Download, Cracked Softwares, Pro, License Key, KeyGen, Key, Office, Serial, Activator ..
Load more

Recommended publications
  • Whole-Genome Sequencing of Human Pegivirus Variant from an Egyptian Patient Co-Infected with Hepatitis C Virus: a Case Report Hany K
    Soliman et al. Virology Journal (2019) 16:132 https://doi.org/10.1186/s12985-019-1242-5 CASE REPORT Open Access Whole-genome sequencing of human Pegivirus variant from an Egyptian patient co-infected with hepatitis C virus: a case report Hany K. Soliman1, Mohamed Abouelhoda2, Mahmoud N. El Rouby1, Ola S. Ahmed1, G. Esmat3, Zeinab K. Hassan1, Mohammed M. Hafez1, Dina Ahmed Mehaney4, Manojkumar Selvaraju5, Rania Kamal Darwish4, Yehia A. Osman6 and Abdel-Rahman N. Zekri1* Abstract Background: Human pegivirus (HPgV) is structurally similar to hepatitis C virus (HCV) and was discovered 20 years ago. Its distribution, natural history and exact rule of this viral group in human hosts remain unclear. Our aim was to determine, by deep next-generation sequencing (NGS), the entire genome sequence of HPgV that was discovered in an Egyptian patient while analyzing HCV sequence from the same patient. We also inspected whether the co-infection of HCV and HPgV will affect the patient response to HCV viral treatment. To the best of our knowledge, this is the first report for a newly isolated HPgV in an Egyptian patient who is co-infected with HCV. Case presentation: The deep Next Generation Sequencing (NGS) technique was used to detect HCV sequence in hepatitis C patient’s plasma. The results revealed the presence of HPgV with HCV. This co-infection was confirmed using conventional PCR of the HPgV 5′ untranslated region. The patient was then subjected to direct-acting-antiviral treatment (DAA). At the end of the treatment, the patient showed a good response to the HCV treatment (i.e., no HCV-RNA was detected in the plasma), while the HPgV-RNA was still detected.
    [Show full text]
  • Journal of Virological Methods Minor Groove Binder Modification of Widely Used Taqman Hydrolysis Probe for Detection of Dengue V
    Journal of Virological Methods 268 (2019) 17–23 Contents lists available at ScienceDirect Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet Minor groove binder modification of widely used TaqMan hydrolysis probe for detection of dengue virus reduces risk of false-negative real-time PCR T results for serotype 4 ⁎ Eleanor R. Graya,b, , Judith Heaneyc, R. Bridget Fernsb,d, Patricia C. Sequeirae, Eleni Nastoulic,f, Jeremy A. Garsonb,g a London Centre for Nanotechnology, Faculty of Maths and Physical Sciences, University College London, London, United Kingdom b Department of Clinical Virology, University College London Hospitals NHS Foundation Trust, London, United Kingdom c Advanced Pathogen Diagnostics Unit, University College London Hospitals NHS Foundation Trust, London, United Kingdom d Division of Infection and Immunity, University College London, London, United Kingdom e Flavivirus Laboratory, Instituto Oswaldo Cruz/Fundação Oswaldo Cruz, Rio de Janeiro, Brazil f Department of Population, Policy and Practice, UCL GOS Institute of Child Health, London, United Kingdom g National Transfusion Microbiology Laboratories, NHS Blood and Transplant, London, United Kingdom ARTICLE INFO ABSTRACT Keywords: Dengue is a vector-transmitted viral infection that is a significant cause of morbidity and mortality in humans Dengue worldwide, with over 50 million apparent cases and a fatality rate of 2.5 % of 0.5 million severe cases per annum TaqMan in recent years. Four serotypes are currently co-circulating. Diagnosis of infection may be by polymerase chain False-negative reaction, serology or rapid antigen test for NS1. Both pan-serotype and serotype-specific genome detection as- Sensitivity says have been described, however, achieving adequate sensitivity with pan-serotype assays has been challen- Serotype 4 ging.
    [Show full text]
  • Genome Sequencing Analysis Software
    Genome sequencing analysis software Find and compare the best bioinformatics software for analyzing whole-genome sequencing data. Tools are ranked by the biomedical research community. Find and compare the best bioinformatics software for analyzing de novo genome sequencing data. Tools are ranked by the biomedical research community. Find intuitive DNA sequencing data analysis software tools that transform raw data into meaningful results. Sequencher DNA Sequence Analysis Software is an indispensable tool for the benchtop scientist. Continually developed and improved for over 25 years, ​Next-Generation Sequencing · ​Careers · ​How to Cite Us · ​Sequencher. Directory of organizations providing software or services to the genomics Biosof, , Sequence Analysis, Structure and Function Prediction. The versatile open source genome analysis software and memory- efficient programs for k-mer counting and indexing of large sequence sets. DNA Sequence Quality - Phred - provides base calling, PhageTerm - is a fast and user-friendly software package which can. Gegenees is a software project for comparative analysis of whole genome sequence data and other. A powerful and comprehensive suite of molecular biology and NGS analysis tools. Geneious is one the world's leading bioinformatics software platforms. Name, Description, Sequence type*, Link FLAK, Fuzzy whole genome alignment and analysis, Nucleotide, server. This software enables you to basecall, trim, display, edit, and print data from our entire line of capillary DNA sequencing instruments for data analysis and quality Software Type​: ​Sequencing Data Analysis. Sanger Sequencing Data Analysis for primary sequencing analysis and secondary Peak Scanner Software is a DNA sizing software that can either be. DNASTAR is a global software company offering the best in sequence analysis software, next-gen sequencing software, primer design software, and gene.
    [Show full text]
  • Evolutionarily Conserved Structural Changes in Phosphatidylinositol 5-Phosphate 4-Kinase (PI5P4K) Isoforms Are Responsible for D
    Biochem. J. (2013) 454, 49–57 (Printed in Great Britain) doi:10.1042/BJ20130488 49 Evolutionarily conserved structural changes in phosphatidylinositol 5-phosphate 4-kinase (PI5P4K) isoforms are responsible for differences in enzyme activity and localization Jonathan H. CLARKE1 and Robin F. IRVINE Department of Pharmacology, Tennis Court Road, Cambridge CB2 1PD, U.K. Mammals have genes coding for three PI5P4Ks (PtdIns5P association of PI5P4Ks α and γ is a true heterodimerization, 4-kinases), and these have different cellular localizations, tissue and not a higher oligomer association of homodimers. We distributions and lipid kinase activities. We describe in the present reveal that structural modelling is consistent with this and paper a detailed molecular exploration of human PI5P4Ks α, β with the apparently random heterodimerization that we had and γ , as well as their fly and worm homologues, to understand earlier observed between PI5P4Kα and PI5P4Kβ [Wang, Bond, how and why these differences came to be. The intrinsic ATPase Letcher, Richardson, Lilley, Irvine and Clarke (2010), Biochem. activities of the three isoforms are very similar, and we show J. 430, 215–221]. Overall the molecular diversity of mammalian that differences in their G-loop regions can account for much PI5P4Ks explains much of their properties and behaviour, but of their wide differences in lipid kinase activity. We have also their physiological functionality remains elusive. undertaken an extensive in silico evolutionary study of the PI5P4K family, and show experimentally that the single PI5P4K homologues from Caenorhabditis elegans and Drosophila Key words: dimerization, lipid kinase activity, phosphatidylin- melanogaster are as widely different in activity as the most ositol 5-phosphate (PtdIns5P), phosphatidylinositol 5-phosphate divergent mammalian isoforms.
    [Show full text]
  • Aphid Small Rnas and Viruses Diveena Vijayendran Iowa State University
    Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2014 Aphid small RNAs and viruses Diveena Vijayendran Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Entomology Commons, Molecular Biology Commons, and the Virology Commons Recommended Citation Vijayendran, Diveena, "Aphid small RNAs and viruses" (2014). Graduate Theses and Dissertations. 13831. https://lib.dr.iastate.edu/etd/13831 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Aphid small RNAs and viruses by Diveena Vijayendran A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Genetics Program of Study Committee: Bryony C. Bonning, Major Professor Wyatt Allen Miller Lyric Bartholomay Russell Jurenka Thomas Baum Iowa State University Ames, Iowa 2014 Copyright © Diveena Vijayendran, 2014. All rights reserved. ii TABLE OF CONTENTS Page ABSTRACT………………………………. ............................................................. iv CHAPTER 1 INTRODUCTION......................................................................... 1 CHAPTER 2 AN APHID LETHAL PARALYSIS VIRUS ISOLATE FROM THE PEA APHID
    [Show full text]
  • AAMUDALAPALLI-THESIS.Pdf (4.579Mb)
    Investigation of Inositol dehydrogenase-related enzymes A Thesis Submitted to the College of Graduate Studies and Research in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Department of Chemistry University of Saskatchewan Saskatoon by Hari Babu Aamudalapalli Keywords: Inositol, Inositol dehydrogenase, Lactobacillus plantarum WCFS1, Lactobacillus casei BL23, gene cloning, gene expression, protein purification, and enzyme kinetics. ©Copyright Hari Babu Aamudalapalli, January, 2012. All Rights Reserved. PERMISSION TO USE In presenting this dissertation in partial fulfillment of the requirements for a Masters degree from the University of Saskatchewan, I agree that the libraries of this University may make it freely available for inspection. I further agree that permission for copying of this dissertation in any manner, in whole or in part, for scholarly purposes may be granted by the professor who supervised my dissertation work or, in their absence, by the Head of the Department or the Dean of the College in which my thesis work was done. It is also understood that any copying or publication or use of this dissertation or parts thereof for financial gain shall not be allowed without my written permission. It is also understood that due recognition shall be given to me and to the university of Saskatchewan in any scholarly use which may be made of any material in my dissertation Request for permission to copy or make other use of material in this dissertation in whole or in part should be addressed to: Head of the Department of Chemistry University of Saskatchewan 110 Science Place, Saskatoon, SK S7N 5C9 CANADA i ABSTRACT Inositol dehydrogenase (IDH) catalyzes the oxidation of myo-inositol to scyllo- inosose using NAD+ as the coenzyme.
    [Show full text]
  • Actinopterygii, Beryciformes, Holocentridae) from the Egyptian Mediterranean Coast
    Acta Ichthyologica et Piscatoria 51(1), 2021, 107–112 | DOI 10.3897/aiep.51.63216 First record of two squirrelfishes, Sargocentron spinosissimum and Sargocentron tiereoides (Actinopterygii, Beryciformes, Holocentridae) from the Egyptian Mediterranean coast Lamiaa Elsayed Mokhtar DEEF1 1 Department of Zoology, Faculty of Science, Damietta University, New Damietta, Damietta, Egypt http://zoobank.org/C2BAD19D-9895-4C09-A2E8-92600C32E378 Corresponding author: Lamiaa Elsayed Mokhtar Deef ([email protected]; [email protected]) Academic editor: Paraskevi Karachle ♦ Received 21 November 2020 ♦ Accepted 16 January 2021 ♦ Published 31 March 2021 Citation: Deef LEM (2021) First record of two squirrelfishes, Sargocentron spinosissimum and Sargocentron tiereoides (Actinopterygii, Beryciformes, Holocentridae) from the Egyptian Mediterranean coast. Acta Ichthyologica et Piscatoria 51(1): 107–112. https://doi.org/10.3897/aiep.51.63216 Abstract Holocentrinae and Myripristinae (Holocentridae) are among the most apparent species in the nocturnal reef fish community. However, there is no clear assent regarding their phylogenetic relations, which is reported in their complicated taxonomic history. In this study, Sargocentron spinosissimum (Temminck et Schlegel, 1843) and Sargocentron tiereoides (Bleeker, 1853) were reported from the Medi- terranean coast of Egypt (Damietta coast). This is the first record of these species which is greatly distributed across Indo-Pacific regions and eastern Africa showed the success of these species to migrate to the Mediterranean water with a good adaptation to the new habitats. In the presently reported study, 26 morphometric measurements were recorded and cytochrome c oxidase subunit I (COI) bar- codes were recovered for a total of 20 specimens (8 from S. spinosissimum and 12 from S. tiereoides).
    [Show full text]
  • Minor Groove Binder Modification of Widely Used Taqman Hydrolysis Probe for Detection of Dengue Virus Reduces Risk of False-Nega
    1 Minor groove binder modification of widely used TaqMan hydrolysis probe for detection 2 of dengue virus reduces risk of false-negative real-time PCR results for serotype 4 3 4 Eleanor R. Gray*1,2, Judith Heaney3 R. Bridget Ferns2,4, Patricia C. Sequeira5, Eleni Nastouli3,6, 5 Jeremy A. Garson2,7 6 7 1 London Centre for Nanotechnology, Faculty of Maths and Physical Sciences, University 8 College London, London, United Kingdom 9 2 Department of Clinical Virology, University College London Hospitals NHS Foundation Trust, 10 London, United Kingdom 11 3 Advanced Pathogen Diagnostics Unit, University College London Hospitals NHS Foundation 12 Trust, London, United Kingdom 13 4 Division of Infection and Immunity, University College London, London, United Kingdom 14 5 Flavivirus Laboratory, Instituto Oswaldo Cruz/Fundação Oswaldo Cruz, Rio de Janeiro, Brazil 15 6 Department of Population, Policy and Practice, UCL GOS Institute of Child Health, London, 16 United Kingdom 17 7 National Transfusion Microbiology Laboratories, NHS Blood and Transplant, London, United 18 Kingdom 19 *Corresponding author. Address: London Centre for Nanotechnology, 17-19 Gordon St, 20 London, WC1H 0AH, UK; E-mail: [email protected] (EG) 21 22 Summary 23 Dengue is a vector-transmitted viral infection that is a significant cause of morbidity and 24 mortality in humans worldwide, with over 50 million apparent cases and a fatality rate of 2.5% of 25 0.5 million severe cases per annum in recent years. Four serotypes are currently co-circulating. 26 Diagnosis of infection may be by polymerase chain reaction, serology or rapid antigen test for 1 27 NS1.
    [Show full text]
  • Charakterisierung Von Vertretern Zweier Arten Von RNA-Editing-Trans- Faktoren
    MEFs und MORFs: Charakterisierung von Vertretern zweier Arten von RNA-Editing-trans- Faktoren Dissertation zur Erlangung des Doktorgrades Dr. rer. nat. der Fakultät für Naturwissenschaften der Universität Ulm vorgelegt von Barbara Härtel aus Kempten Ulm 2013 Die Arbeiten im Rahmen der vorgelegte Dissertation wurden in der Zeit von März 2010 bis Januar 2013 am Institut für Molekulare Botanik der Universität Ulm durchgeführt und von Herrn Prof. Dr. Axel Brennicke betreut. Amtierender Dekan der Fakultät für Naturwissenschaften: Prof. Dr. Joachim Ankerhold Erstgutachter: Prof. Dr. Axel Brennicke, Institut für Molekulare Botanik, Universität Ulm Zweitgutachter: PD Dr. habil. Mizuki Takenaka, Institut für Molekulare Botanik, Universität Ulm Tag der Promotion: “Science is wonderfully equipped to answer the question ‘How?’ but it gets terribly confused when you ask the question ‘Why?’ “ (Erwin Chargaff, 1977) Inhaltsverzeichnis | 1 Inhaltsverzeichnis I Abkürzungsverzeichnis ...................................................................................................................... 4 II Zusammenfassung ................................................................................................................................ 7 III Summary ................................................................................................................................................... 8 IV Einleitung ................................................................................................................................................
    [Show full text]
  • Westminsterresearch the Study of Highly Pathogenic Emerging
    WestminsterResearch http://www.westminster.ac.uk/westminsterresearch The study of highly pathogenic emerging zoonotic virus envelope proteins through pseudotyped virus generation Bentley, E. This is an electronic version of a PhD thesis awarded by the University of Westminster. © Miss Emma Bentley, 2017. The WestminsterResearch online digital archive at the University of Westminster aims to make the research output of the University available to a wider audience. Copyright and Moral Rights remain with the authors and/or copyright owners. Whilst further distribution of specific materials from within this archive is forbidden, you may freely distribute the URL of WestminsterResearch: ((http://westminsterresearch.wmin.ac.uk/). In case of abuse or copyright appearing without permission e-mail [email protected] THE STUDY OF HIGHLY PATHOGENIC EMERGING ZOONOTIC VIRUS ENVELOPE PROTEINS THROUGH PSEUDOTYPED VIRUS GENERATION Emma May Bentley A thesis submitted in partial fulfilment of the requirements of the University of Westminster for the degree of Doctor of Philosophy September 2017 Abstract Emerging zoonotic viruses pose an increasing threat, causing outbreaks with high rates of morbidity and mortality and frequently significant economic implications. Often, there is a lack or shortfall of effective prophylaxis and diagnostic capabilities. Research towards their development, together with improved surveillance activities are high priority activities to prepare and respond to outbreak threats. Yet handling these viruses commonly requires high containment levels. This can be circumvented by the use of replication defective pseudotyped viruses (PVs), incorporating the viral envelope protein of interest which constitutes the primary surface antigen. This permits the serological detection of neutralising antibodies without the need to handle live virus, as well as other viral entry studies.
    [Show full text]
  • Characterization of Glycoside Hydrolase Family 11 Xylanase from Streptomyces Sp. Strain J103
    Marasinghe et al. Microb Cell Fact (2021) 20:129 https://doi.org/10.1186/s12934-021-01619-x Microbial Cell Factories RESEARCH Open Access Characterization of glycoside hydrolase family 11 xylanase from Streptomyces sp. strain J103; its synergetic efect with acetyl xylan esterase and enhancement of enzymatic hydrolysis of lignocellulosic biomass Svini Dileepa Marasinghe1,2, Eunyoung Jo1, Sachithra Amarin Hettiarachchi1,2,3, Youngdeuk Lee1, Tae‑Yang Eom1,2, Yehui Gang1,2, Yoon‑Hyeok Kang1,2 and Chulhong Oh1,2* Abstract Background: Xylanase‑containing enzyme cocktails are used on an industrial scale to convert xylan into value‑ added products, as they hydrolyse the β‑1,4‑glycosidic linkages between xylopyranosyl residues. In the present study, we focused on xynS1, the glycoside hydrolase (GH) 11 xylanase gene derived from the Streptomyces sp. strain J103, which can mediate XynS1 protein synthesis and lignocellulosic material hydrolysis. Results: xynS1 has an open reading frame with 693 base pairs that encodes a protein with 230 amino acids. The predicted molecular weight and isoelectric point of the protein were 24.47 kDa and 7.92, respectively. The gene was cloned into the pET‑11a expression vector and expressed in Escherichia coli BL21(DE3). Recombinant XynS1 (rXynS1) was purifed via His‑tag afnity column chromatography. rXynS1 exhibited optimal activity at a pH of 5.0 and tem‑ perature of 55 °C. Thermal stability was in the temperature range of 50–55 °C. The estimated K m and Vmax values were 2 51.4 mg/mL and 898.2 U/mg, respectively. One millimolar of Mn + and Na+ ions stimulated the activity of rXynS1 2 2 by up to 209% and 122.4%, respectively, and 1 mM Co + and Ni + acted as inhibitors of the enzyme.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0232862 A1 Graves Et Al
    US 20150232862A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0232862 A1 Graves et al. (43) Pub. Date: Aug. 20, 2015 (54) NUCLECACID VECTORS AND USES filed on Feb. 14, 2014, provisional application No. THEREOF 62/013,852, filed on Jun. 18, 2014. (71) Applicant: Symvivo Corporation, Burnaby (CA) Publication Classification (72) Inventors: Herbert Alexander Graves, Vancouver (51) Int. C. (CA); Mark Andrew Fox, Vancouver CI2N 15/74 (2006.01) (CA) (52) U.S. C. CPC .................................... CI2N 15/746 (2013.01) (21) Appl. No.: 14/621,308 (57) ABSTRACT There are disclosed nucleic acid vectors for use in both gram (22) Filed: Feb. 12, 2015 positive and gram negative bacteria. In embodiments the vec tors comprise a prokaryotic expression cassette and in Related U.S. Application Data embodiments comprise a eukaryotic expression cassette. In (60) Provisional application No. 61/940,274, filed on Feb. embodiments the vectors encode a hybrid protein comprising 14, 2014, provisional application No. 61/940,258, a DNA binding domain, a CPP domain and a signal sequence. Patent Application Publication Aug. 20, 2015 Sheet 1 of 10 US 2015/0232862 A1 ErA 2.0S Patent Application Publication Aug. 20, 2015 Sheet 2 of 10 US 2015/0232862 A1 prest.s-Sir issip pr8G 5. Sh Patent Application Publication Aug. 20, 2015 Sheet 3 of 10 US 2015/0232862 A1 Figars. 3. Siti and $2 firiteract with pisikA2, arc resuit in gei-shift with increasing to centratics of petities Patent Application Publication Aug. 20, 2015 Sheet 4 of 10 US 2015/0232862 A1 is 4: Patent Application Publication Aug.
    [Show full text]