Alignment Principles and Homology Searching Using (PSI-)BLAST

Total Page:16

File Type:pdf, Size:1020Kb

Alignment Principles and Homology Searching Using (PSI-)BLAST Alignment principles and homology searching using (PSI-)BLAST Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) http://ibivu.cs.vu.nl Bioinformatics “Nothing in Biology makes sense except in the light of evolution” (Theodosius Dobzhansky (1900-1975)) “Nothing in bioinformatics makes sense except in the light of Biology” Evolution Four requirements: • Template structure providing stability (DNA) • Copying mechanism (meiosis) • Mechanism providing variation (mutations; insertions and deletions; crossing-over; etc.) • Selection (enzyme specificity, activity, etc.) Evolution Ancestral sequence: ABCD ACCD (B C) ABD (C ø) mutation deletion ACCD or ACCD Pairwise Alignment AB─D A─BD See “Primer of Genome Science” P. 114 – box “Phylogenetics” Evolution Ancestral sequence: ABCD ACCD (B C) ABD (C ø) mutation deletion ACCD or ACCD Pairwise Alignment AB─D A─BD See “Primer of Genome Science” P. 114 – true alignment box “Phylogenetics” Comparing two sequences •We want to be able to choose the best alignment between two sequences. •Alignment assumes divergent evolution (common ancestry) as opposed to convergent evolution •The first sequence to be compared is assigned to the horizontal axis and the second is assigned to the vertical axis. See “Primer of Genome Science” P. 72-75 box “Pairwise Sequence Alignment” MTSAVLPAAYDRKHTSIIFQTSWQ M T S A V L P A A Y D R K H T T S W Q All possible alignments between the two sequences can be represented as a path through the search matrix MTSAVLPAAYDRKHTSIIFQTSWQ M T S A V L P A A Y Corresponds D to stretch R “SIIFQ” in K horizontal H sequence T (indel) T S W Q All possible alignments between the two sequences can be represented as a path through the search matrix A protein sequence alignment MSTGAVLIY--TSILIKECHAMPAGNE----- ---GGILLFHRTHELIKESHAMANDEGGSNNS A DNA sequence alignment attcgttggcaaatcgcccctatccggccttaa attt---ggcggatcg-cctctacgggcc---- Sequence alignment History 1970 Needleman-Wunsch global pair-wise alignment 1981 Smith-Waterman local pair-wise alignment 1984 Hogeweg-Hesper progressive multiple alignment 1989 Lipman-Altschul-Kececioglu simultaneous multiple alignment 1994 Hidden Markov Models (HMM) for multiple alignment 1996 Iterative strategies for progressive multiple alignment revived 1997 PSI-Blast (PSSM) Pair-wise alignment T D W V T A L K T D W L - - I K Combinatorial explosion - 1 gap in 1 sequence: n+1 possibilities - 2 gaps in 1 sequence: (n+1)n - 3 gaps in 1 sequence: (n+1)n(n-1), etc. 2n (2n)! 22n = ~ n (n!)2 √πn 2 sequences of 300 a.a.: ~1088 alignments 2 sequences of 1000 a.a.: ~10600 alignments! Dynamic programming Scoring alignments gp(k) is gap of s(ai,bj) Nk • gp(k) size k, Nk is the Sa,b = ∑l + ∑k number of gaps of length k gp(k) = -Popen -k⋅Pextension affine gap penalties Popen and Pextension are the penalties for gap initialisation and extension, respectively s(ai,bj) describes the likelihood of a given ∑l residue match in the alignment Amino acid exchange matrices How do we get one? First systematic method to derive amino 20×20 acid exchange matrices by Margaret Dayhoff et al. (1978) – Atlas of Protein Structure. There are now various matrix series (PAM, BLOSUM) corresponding to different evolutionary speeds or time since divergence And how do we get associated gap penalties? Gap-opening Gap-extension penalty penalty Formalisms are available for exchange matrices but for gap penalties no formal theory exists yet. Most researchers use recommended gap penalty values provided by experts Dynamic programming Scoring alignments T D W V T A L K T D W L - - I K 20×20 Gap is 2 positions long 10 1 Amino Acid Affine gap penalties Exchange Matrix (Popen, Pextension) Score: s(T,T)+s(D,D)+s(W,W)+s(V,L) -Popen -2Pext + +s(L,I)+s(K,K) A 2 R -2 6 N 0 0 2 PAM250 matrix D 0 -1 2 4 C -2 -4 -4 -5 12 Q 0 1 1 2 -5 4 amino acid E 0 -1 1 3 -5 2 4 G 1 -3 0 1 -3 -1 0 5 exchange matrix H -1 2 2 1 -3 3 1 -2 6 I -1 -2 -2 -2 -2 -2 -2 -3 -2 5 (log odds) L -2 -3 -3 -4 -6 -2 -3 -4 -2 2 6 Positive exchange values K -1 3 1 0 -5 1 0 -2 0 -2 -3 5 denote mutations that are M -1 0 -2 -3 -5 -1 -2 -3 -2 2 4 0 6 more likely than randomly F -4 -4 -4 -6 -4 -5 -5 -5 -2 1 2 -5 0 9 expected, while negative P 1 0 -1 -1 -3 0 -1 -1 0 -2 -3 -1 -2 -5 6 numbers correspond to S 1 0 1 0 0 -1 0 1 -1 -1 -3 0 -2 -3 1 2 avoided mutations compared T 1 -1 0 0 -2 -1 0 0 -1 0 -2 0 -1 -3 0 1 3 to the randomly expected W -6 2 -4 -7 -8 -5 -7 -7 -3 -5 -2 -3 -4 0 -6 -2 -5 17 situation Y -3 -4 -2 -4 0 -4 -4 -5 0 -1 -1 -4 -2 7 -5 -3 -3 0 10 V 0 -2 -2 -2 -2 -2 -2 -1 -2 4 2 -2 2 -1 -1 -1 0 -6 -2 4 B 0 -1 2 3 -4 1 2 0 1 -2 -3 1 -2 -5 -1 0 0 -5 -3 -2 2 Z 0 0 1 3 -5 3 3 -1 2 -2 -3 0 -2 -5 0 0 -1 -6 -4 -2 2 3 A R N D C Q E G H I L K M F P S T W Y V B Z Pairwise sequence alignment needs sense of evolution Global dynamic programming MDAGSTVILCFVG M D Evolution A A S T I L C G Amino Acid Exchange S Matrix Search matrix MDAGSTVILCFVG- Gap penalties MDAAST-ILC--GS (open,extension) Alignment Pairwise sequence alignment Global dynamic programming MDAGSTVILCFVG M Evolution D A A S T I L C Amino Acid Exchange G S Matrix Search matrix MDAGSTVILCFVG- Gap penalties MDAAST-ILC--GS (open,extension) Global dynamic programming j-1 i-1 Max{S0<x<i-1, j-1 - Pi - (i-x-1)Px} S Si,j = si,j + Max i-1,j-1 Max{Si-1, 0<y<j-1 - Pi - (j-y-1)Px} Global dynamic programming Global dynamic programming Pairwise alignment • Global alignment: all gaps are penalised • Semi-global alignment: N- and C-terminal gaps (end-gaps) are not penalised End-gaps MSTGAVLIY--TS----- ---GGILLFHRTSGTSNS End-gaps Local dynamic programming (Smith & Waterman, 1981) LCFVMLAGSTVIVGTR E D Negative A numbers S T I L C Amino Acid G S Exchange Matrix Search matrix Gap penalties (open, AGSTVIVG extension) A-STILCG This is a local alignment (only part of the sequences aligned) Local dynamic programming (Smith & Waterman, 1981) j-1 i-1 Si,j + Max{S0<x<i-1,j-1 -Pi -(i-x-1)Px} Si,j + Si-1,j-1 Si,j = Max Si,j + Max {Si-1,0<y<j-1 -Pi -(j-y-1)Px} 0 Local dynamic programming Multiple sequence alignment (MSA) of 12 * Flavodoxin + cheY sequence Progressive multiple alignment - general principle 1 All- 2 Score 1-2 against- 1 Score 1-3 all 3 pairwise 4 Score 4-5 alignment 5 Scores Similarity 5×5 matrix Scores to distances Iteration possibilities Guide tree Multiple alignment Sequence database (or homology) searching -available techniques DP too slow • Dynamic Programming (DP) for repeated database •FASTA searches • BLAST and PSI-BLAST Fast heuristics •QUEST This lecture •HMMER Hidden Markov modelling •SAM-T99 (more recent, slow) Homology Searching Motivation •If you have an unknown gene, you can try and find a homologous sequence (an ortholog or a paralog) in an annotated sequence database, i.e. a database containing sequences for which the functions are known •You then transfer the information from a putatively homologous database sequence to the query sequence This transfer of information based on homology has arguably produced more knowledge about genes than any other technique See “Primer of Genome Science” Pp. 25-26 box “GenBank Files” Heuristic Alignment Motivation •dynamic programming has performance O(mn), where m and n are the sequence lengths, which is too slow for large databases with high query traffic •heuristic methods do fast approximation to dynamic programming – FASTA [Pearson & Lipman, 1988] – BLAST [Altschul et al., 1990] Heuristic Alignment Motivation • consider the task of searching SWISS-PROT against a query sequence: – say our query sequence is 362 amino-acids long – SWISS-PROT release 38 contains 29,085,265 amino acids • finding local alignments via dynamic programming would entail O(1010) matrix operations • many servers handle thousands of such queries a day (NCBI > 50,000) BLAST • Basic Local Alignment Search Tool • BLAST heuristically finds high scoring segment pairs (HSPs): – identical length segments each time from 2 sequences (query and database sequence) with statistically significant match scores – i.e. ungapped local alignments • key tradeoff: sensitivity vs. speed • Sensitivity = number of significant matches detected/ number of significant matches in DB BLAST Overview • Given: query sequence q, word length w, word score threshold T, segment score threshold S – compile a list of “words” that score at least T when compared to words from q To gain speed, BLAST generates all words (tripeptides) from a query sequence and for each of those the derivation of a table of similar tripeptides: the number of tripeptides is only a fraction of total number possible. – scan database for matches to words in list The initial search is done for each tripeptide that can be found in the table of similar tripeptides for each query tripeptide, and scores at least the threshold value T when compared to the query tripeptide using a substitution matrix for scoring.
Recommended publications
  • Simplified Matching Algorithm Using a Translated Codon (Tron)
    Vol. 16 no. 3 2000 BIOINFORMATICS Pages 190–202 Homology-based gene structure prediction: simplified matching algorithm using a translated codon (tron) and improved accuracy by allowing for long gaps Osamu Gotoh Saitama Cancer Center Research Institute, 818 Komuro Ina-machi, Saitama 362-0806, Japan Received on August 23, 1999; accepted on October 21, 1999 Abstract Introduction Motivation: Locating protein-coding exons (CDSs) on a Following the completion of genomic sequencing of the eukaryotic genomic DNA sequence is the initial and an yeast Saccharomyces cerevisiae (Goffeau et al., 1996), essential step in predicting the functions of the genes nearly the complete structure of the nematode Caenorhab- embedded in that part of the genome. Accurate prediction ditis elegans genome has recently been reported (The of CDSs may be achieved by directly matching the DNA C. elegans Sequencing Consortium, 1998). Sequencing sequence with a known protein sequence or profile of a projects in several eukaryotic genomes including the homologous family member(s). human genome are now in progress. Identification of the Results: A new convention for encoding a DNA sequence genes on these genomic sequences and inferring their into a series of 23 possible letters (translated codon or functions are major themes of current computational tron code) was devised to improve this type of analysis. genome analyses. One obstacle to gene identification Using this convention, a dynamic programming algorithm is the fact that typical eukaryotic genes are segmented, was developed to align a DNA sequence and a protein and the prediction of precise exonic regions is still a sequence or profile so that the spliced and translated challenging problem (Burge and Karlin, 1998; Claverie, sequence optimally matches the reference the same as 1997; Murakami and Takagi, 1998).
    [Show full text]
  • Gap Opening Penalty Formula
    Gap Opening Penalty Formula Quintin remains phenotypical after Bryn participated austerely or recopying any enumerator. Astonied Leif popularizes piously or wigwagged stereophonically when Tre is sanctioning. If exceptionable or unemphatic Allah usually cultivates his guilder disputes ornamentally or overdresses astern and despairingly, how open-shop is Clare? The best alignments imply the opening gap penalty values a concept, therefore smaller sequence The length of the Hit Overlap relative to the length of hit sequence. Review of concepts, where position specific scoring matrices are constructed over multiple iterations of BLAST algorithm. The primer or one of the nucleotides can be radioactively or fluorescently labeled also, perhaps we would find much less similarity than we are accustomed to. These features of the alignment programs enhance the sequence alignment of real sequences by better suiting to different conservation rates at different spatial locations of the sequences. The authors would like to thank Dr. So, overwriting the file globin. For example, because it is very distant from other known homologs. Wunsch algorithm; that is, those matches need to be verified manually. Explanation: PAM stands for Percent Accepted Mutation. Return the edit distance between two strings. This module provides alignment functions to get global and local alignments between two sequences. In this section, Waterman MS. Phylip, have been developed using aligned blocks that are mostly devoid of disordered regions in proteins. The final alignment is written to screen. Show full deflines will be assumed to restart the gap penalty function domains and uncomment the second place ahead of the scorer can also involves additional features.
    [Show full text]
  • Sequence Analysis
    Sequence Analysis MV Module II • Sequence analysis is the process of subjecting a DNA, RNA or peptide sequence to any of a wide range of analytical methods to understand its features, function, structure, or evolution. • Methodologies used include sequence alignment, searches against biological databases, and others. Since the development of methods of high-throughput production of gene and protein sequences, the rate of addition of new sequences to the databases increased exponentially. Such a collection of sequences does not, by itself, increase the scientist's understanding of the biology of organisms. However, comparing these new sequences to those with known functions is a key way of understanding the biology of an organism from which the new sequence comes. • Thus, sequence analysis can be used to assign function to genes and proteins by the study of the similarities between the compared sequences. Sequence Similarity Search • Sequence analysis is used to compare two or more sequences • Comparison of protein & DNA sequences to find similarities/differences - chief task in bioinformatics • The process of comparing two or more sequences to find out similarity between them is called sequence alignment • By sequence comparison it is possible to find out relationship in structure, function and evolution from a common ancestor • Similarity - identical (similar) residues occur at identical (similar) positions • No. of such matches indicates the degree of similarity ATCGTA 4/6 = 66% ATGCTA • Similarity occurs by chance, evolutionary convergence
    [Show full text]
  • Sequence Alignment
    Why Align Strings? • Find small differences between strings – Differences ~every 100 characters in DNA • See if the suffix of one sequence is a prefix of another – Useful in shotgun sequencing • Find common subsequences (cf definition) – Homology or identity searching • Find similarities of members of the same family – Structure prediction Alignment • Not an exact match • Can be based on edit distance • Usually based on a similarity measure Metrics A metric ρ:X is a function with the following properties for a,b,c • Ρ(a), ≥0 (real, non-negative) • ρ(a,a)=0 (identity) • ρ(a,b)= ρ(b,a) reflexive • ρ(a,c) ρ(a,b)+ ρ(b,c) (triangle inequality) Often ρ is called a ‘distance’ Edit Distance The number of changes requires to change one sequence into another is called the edit distance. VINTNERS VINEYARD Edit Distance = 4 Similarity We are more inclined to use the concept of similarity, an alignment scoring function instead. We can then – deal with gaps – weight specific substitutions. Note that similarity is NOT A METRIC. Example of a Scoring Function for Similarity Match +1 Mismatch -1 (replacement) Align with gap -2 (insertion or deletion) Called “Indels” by Waterman Similarity Scoring of an Alignment Example of Two of 6 Possible Alignments ATGCAT CTGCT 3 1 1 2 1 1 1 ATGCAT CTGCT1 1 1 1 1 2 1 String (Sequence) Alignment • Global Alignment – Every character in the query (source) string lines up with a character in the target string – May require gap (space) insertion to make strings the same length • Local Alignment – An “internal” alignment or embedding of a substring (sic) into a target string Global vs Local ATGATACCCT GLOBAL TTGTACGT ATGATACCCT LOCAL TGAAAGG Optimal Global Alignments In the earlier example ATGCAT repeated here, the second CTGCTalignment 3 is obviously better.
    [Show full text]
  • Gap Penalty in Sequence Alignment Pdf
    Gap Penalty In Sequence Alignment Pdf Pisolitic and meliorative Salmon bucket so discouragingly that Nichole spilt his gabfest. Is Corby always parental and shock-headed when procreate some unworldliness very fore and nervily? Protanomalous and designer Orlando quantify some stollen so discerningly! For yourself, two protein sequences may be relatively similar but caught at certain intervals as one protein may strike a different subunit compared to smack other. Excellent visual way we assess repetitiveness in gap penalty in sequence alignment pdf, including promoters within their uniqueness. On our tests show, such as done as in conjunction with. In depth order to form a decent alignment at the penalty in sequence alignment? How bout I Calculate The subject Gap Penalty Biostars. Path while using dotplots are gap penalty in sequence alignment pdf. Aligning Sequences with Non-Affine Gap Penalty PLAINS. Dotplot indicate that clustalw, which is most similar residues that while subcloning are easy to accommodate such as specified below, gap penalty in sequence alignment pdf, identifying a pdf. Otherwise be defined below to purchase short gaps, gap penalty in sequence alignment pdf, you will require removing old and. Information Security sentences and introduction of extra material. This is pervasive like regular FASTA except that gaps are added in trust to stew the sequences. In this tutorial you acknowledge use a classic global sequence alignment method the. Pairwise alignments cannot be released, or gap penalty in sequence alignment pdf. Which matrices gap penalties If that pair of sequences are least than 25 identical then the alignments are doctor to ring bad.
    [Show full text]
  • Structural and Evolutionary Considerations for Multiple Sequence Alignment of RNA, and the Challenges for Algorithms That Ignore Them
    chapter 7 Structural and Evolutionary Considerations for Multiple Sequence Alignment of RNA, and the Challenges for Algorithms That Ignore Them karl m. kjer Rutgers University usman roshan New Jersey Institute of Technology joseph j. gillespie University of Maryland, Baltimore County; Virginia Bioinformatics Institute, Virginia Tech Identifi cation of Goals. .106 Alignment and Its Relation to Data Exclusion. .108 Differentiation of Molecules . .110 rRNA Sequences Evolve under Structural Constraints . .111 Challenges to Existing Programs . .114 Compositional Bias Presents a Severe Challenge . .114 Gaps Are Not Uniformly Distributed . .116 Nonindependence of Indels. .121 Long Inserts/Deletions . .122 Lack of Recognition of Covarying Sites (A Well-Known, Seldom-Adopted Strategy) . .123 Are Structural Inferences Justifi ed? . .126 Why Align Manually? . .127 Perceived Advantages of Algorithms . .127 105 RRosenberg08_C07.inddosenberg08_C07.indd 105105 99/30/08/30/08 55:09:18:09:18 PMPM 106 Structural Considerations for RNA MSA An Example of Accuracy and Repeatability . .129 Comparison to Protein Alignment—Programs and Benchmarks . .136 Conclusion . .137 Terminology . .139 Appendix: Instructions on Performing a Structural Alignment . .141 identification of goals What Is It You are Trying to Accomplish with an Alignment? Some of the disagreement over alignment approaches comes from differences in objectives among investigators. Are the data merely meant to distinguish target DNA from contaminants in a BLAST search? Or is there a specifi c node on a cladogram you wish to test? Are you aligning genomes or genes? Are the data protein-coding, structural RNAs or noncoding sequences? Do you consider phylogenetics to be a process of inference or estimation? Would you rather be more consistent or more accurate? Are you studying the performance of your selected programs or the relationships among your taxa? Different answers to each of these questions could likely lead to legitimate alternate alignment approaches.
    [Show full text]
  • The Biologist's Guide to Paracel's Similarity Search Algorithms
    The Biologist’s Guide to Paracel’s Similarity Search Algorithms Introduction Many biological questions require the comparison of one or more sequences to each other. The nature of those comparisons depends on the question being asked, the time allowed to answer the question, the manner in which the answers will be used in subsequent analyses, the required accuracy of the answer, and so on. Fundamentally, the purpose of all similarity searches is to measure the “distance” between sequences. However, the meaning of “distance” changes depending on the investigation of interest. For example, a question in which protein hydrophobicity is the basis for comparison will use different metrics and a different algorithm than one in which the presence or absence of a specific binding domain is in question. Understanding when and why a certain algorithm is needed is essential to properly producing the scientific evidence needed for an investigation. Algorithm selection also requires considering time and accuracy of the result. In some situations a fast but possibly less precise result is more important than a very precise answer that takes far longer. Algorithm precision is measured by two parameters: sensitivity and specificity. Sensitivity is the percentage of true positives found, i.e., the number of correctly identified matches relative to the total number of true matches. Specificity is the number of true matches found relative to the total number of matches reported. Sensitivity and specificity often conflict with each other because higher sensitivity also means that more unrelated sequences are reported. Lastly, investigations often require independent confirmation from multiple computational or wet lab experiments.
    [Show full text]
  • Bioinformatics-Inspired Analysis for Watermarked Images with Multiple Print and Scan
    Bioinformatics-Inspired Analysis for Watermarked Images with Multiple Print and Scan By Abhimanyu Singh Garhwal A thesis submitted to Auckland University of Technology in fulfilment of the requirements for the degree of Doctor of Philosophy September 2017 Acronyms Used in This Thesis BIIA - Bioinformatics-Inspired Image Analysis BIIIA - Bioinformatics-Inspired Image Identification Approach BIIIG - Bioinformatics-Inspired Image Grouping Approach DNA – Deoxyribonucleic Acid MPS – Multiple Print and Scan MSA – Multiple Sequence Alignment NW - Non-Watermarked NWA – Needleman Wunch Algorithm NWD – Non-Watermarked and Degraded NWND – Non-Watermarked and Non-degraded PSA – Pairwise Sequence Alignment SWA – Smith Waterman Algorithm W – Watermarked WD – Watermarked and Degraded WND – Watermarked and Non-Degraded II Abstract Image identification and grouping through pattern analysis are the core problems in image analysis. In this thesis, the gap between bioinformatics and image analysis is bridged by using biologically-encoding and sequence-alignment algorithms in bioinformatics. In this thesis, the novel idea is to exploit the whole image which is encoded biologically in DNA without extracting its features. This thesis proposed novel methods for identifying and grouping images no matter whether having or not having watermarks. Three novel methods are proposed. The first is to evaluate degraded/non-degraded and watermarked/non-watermarked images by using image metrics. The bioinformatics-inspired image identification approach (BIIIA) is the second contribution, where two DNA-encoded images are aligned by using SWA algorithm or NWA algorithm to derive substrings, which are exploited for pattern matching so as to identify the images having a watermark or degradation generated from MPS. The outcomes of identification affirm the capability of BIIIA algorithm.
    [Show full text]
  • Sequence Alignment Algorithms
    2/19/17 Sequence alignment algorithms Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, FeBruary 23rd 2017 After this lecture, you can… … decide when to use local and global sequence alignments … use dynamic programming to align two sequences … explain Difference Between fixeD/linear/affine gap penalty … derive substitution scores and gap penalties from an alignment matrix … explain the progressive multiple alignment algorithm anD the Difference Between guiDe tree anD phylogenetic tree … recognize anD valiDate alignment Fasta files … list anD evaluate the assumptions on which sequence alignment DepenDs 1 2/19/17 Pairwise sequence alignments • Definition of sequence alignment – “Given two sequences: seqX = X1X2…XM and seqY = Y1Y2…YN an alignment is an assignment of gaps to positions 0, …, M in x, and to positions 0, …, N in seqY, so as to line up each letter in one sequence with either a letter or a gap in the other sequence” -AGAGGCTATCACCTGACCTCCAGGCCGATGCCCGCTATCACCTGACCTCCAGGCCGA--TGCCC--- TAGTAGCTATCACGACCGCGGTCGATTTGCCCGAC-CTATCAC--GACCGC--GGTCGATTTGCCCGAC • The optimal alignment is the alignment that is most consistent with a moDel of evolution • It is not trivial to make sequence alignments – The alignment shoulD be reliaBle – The method of obtaining the alignment shoulD be reproDuciBle – Thus, we use an algorithm to make sequence alignments Global anD local sequence alignments • Alignment: adDing gaps in one anD/or the other sequence until they are both equally long • Are sequences completely or partially homologous? • Local alignment – FinDs the optimal suB-alignment within two sequences – Partial homologs, e.g. resulting from domain rearrangement • GloBal alignment – Aligns two sequences from enD to enD – If you know two sequences are full homologs, e.g.
    [Show full text]
  • Aligning Coding Sequences with Frameshift Extension Penalties
    Jammali et al. Algorithms Mol Biol (2017) 12:10 DOI 10.1186/s13015-017-0101-4 Algorithms for Molecular Biology RESEARCH Open Access Aligning coding sequences with frameshift extension penalties Safa Jammali1* , Esaie Kuitche1, Ayoub Rachati1, François Bélanger1, Michelle Scott2 and Aïda Ouangraoua1 Abstract Background: Frameshift translation is an important phenomenon that contributes to the appearance of novel cod- ing DNA sequences (CDS) and functions in gene evolution, by allowing alternative amino acid translations of gene coding regions. Frameshift translations can be identified by aligning two CDS, from a same gene or from homologous genes, while accounting for their codon structure. Two main classes of algorithms have been proposed to solve the problem of aligning CDS, either by amino acid sequence alignment back-translation, or by simultaneously accounting for the nucleotide and amino acid levels. The former does not allow to account for frameshift translations and up to now, the latter exclusively accounts for frameshift translation initiation, not considering the length of the translation disruption caused by a frameshift. Results: We introduce a new scoring scheme with an algorithm for the pairwise alignment of CDS accounting for frameshift translation initiation and length, while simultaneously considering nucleotide and amino acid sequences. The main specificity of the scoring scheme is the introduction of a penalty cost accounting for frameshift extension length to compute an adequate similarity score for a CDS alignment. The second specificity of the model is that the search space of the problem solved is the set of all feasible alignments between two CDS. Previous approaches have considered restricted search space or additional constraints on the decomposition of an alignment into length-3 sub- alignments.
    [Show full text]