Control of Microbial Sulfide Production in Low and High Temperature Oil Field with Nitrate and Perchlorate

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2017 Control of Microbial Sulfide Production in Low and High Temperature Oil Field with Nitrate and Perchlorate

Okpala, Gloria

Okpala, G. (2017). Control of Microbial Sulfide Production in Low and High Temperature Oil Field with Nitrate and Perchlorate (Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/25453 http://hdl.handle.net/11023/4226 doctoral thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Control of Microbial Sulfide Production in Low and High Temperature Oil Fields with Nitrate or Perchlorate

Gloria Ngozi Okpala

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF DOCTOR OF PHILOSOPHY

GRADUATE PROGRAM IN BIOLOGICAL SCIENCES

CALGARY, ALBERTA

OCTOBER, 2017

The activity of sulfate reducing bacteria (SRB), which produce sulfide, in low and high temperature oilfields, poses a severe challenge for oil and gas industries. Nitrate injection is used to limit the growth of SRB, through stimulation of nitrate reducing bacteria (NRB) that reduce nitrate to nitrite and subsequently to N2. Data from temperature dependent studies done in this work reveal thermophilic nitrate reducing bacteria (tNRB) isolated from low and high temperature oilfields reduce nitrate to nitrite and not further at 50°C or above. This observation is especially important for nitrate-mediated control of sulfide production in high temperature oil fields, because nitrite is a strong SRB inhibitor. To better understand how nitrate injection works in a seawater flooded high temperature reservoir, dual temperature bioreactors and multi-temperature microcosms were used in monitoring sulfate reduction by mesophilic and thermophilic NRB and

SRB. The results indicated that nitrate may be ineffective when injected into a cold zone (<45°C) and that preventing emergence of such a zone by injecting hot produced water may be an effective way to control souring with nitrate. Control of souring with perchlorate under low temperature conditions in batch incubations and bioreactors containing heavy oil was also tested. Perchlorate caused a delay in the onset of sulfate reduction in batch incubations. However, its reduction with oil was not seen in batch culture incubations or bioreactors. Chlorite was more effective at inhibiting SRB activity under these conditions. The research in this thesis thus contributes to improved management of sulfide production in oil fields.

ii Acknowledgements

My profound gratitude goes to my PhD supervisor, Dr. Gerrit Voordouw, for accepting me into his lab and for providing research support and funding throughout my entire program at the

University of Calgary. His patience, fatherly advice, encouragement, motivation, immense knowledge, and insightful comments inspired me to broaden my research horizon. I can comfortably say today that I am a better scientist. To my committee members, Dr. Lisa Gieg and

Dr. Casey Hubert, thank you for your constructive comments and priceless advice that have made this work a success. I am deeply grateful for you agreeing to serve on my PhD committee and for generously contributing your expertise that enabled the completion of this research work.

I want to thank all members of the PMRG group, past and present for their invaluable contributions. Special thanks goes to Johanna Voordouw, for always giving a listening ear, for being a mother away from home and for the numerous PCR rescues. To our lab managers Rhonda and Yin for ensuring that whatever was needed for my research was provided. This work represents a major milestone in more than three years of rigorous research which wouldn’t have been successful without the support and encouragement from family and friends. My heartfelt gratitude goes to my parents for their moral support, sacrifices, and for taking special care of my little Gem during my study. I wish to thank my siblings, Lilian, Emeka, Chinyere and Ifeanyi for their prayers and encouragement. To my daughter “Chikosolu”, for being patient with me and for your love. I greatly appreciate you.

I wish to express my gratitude to my precious friends: Mariama, Felix, Oliver, Oluyemi Falegan,

Chika, Chioma Amadi, Chidozie Agu and Christopher Okonkwo for their moral support, jokes and encouragement. Above all, I thank the Almighty God for endowing me with strength, knowledge and opportunity to undertake this study and for bringing it to a perfect conclusion

iii Dedication

To my daughter Chikosolu

iv Table of Contents

Abstract ...... ii Acknowledgements ...... iii Dedication ...... iv Table of Contents ...... v List of Tables ...... x List of Figures and Illustrations ...... xii

CHAPTER ONE: INTRODUCTION ...... 1 1.1 Background ...... 1 1.2 Research Objectives ...... 3 1.3 Organization of thesis ...... 3

CHAPTER TWO: LITERATURE REVIEW ...... 6 2.1 Waterflooding and reservoir souring...... 6 2.2 Process of high temperature reservoir souring ...... 7 2.3 Main drivers of souring in high temperature reservoirs ...... 10 2.4 Models for predicting souring in reservoirs ...... 11 2.5 Methods used in studying microbial communities from high temperature oil fields13 2.6 Thermophilic sulfate reducing microorganisms (tSRM) ...... 17 2.7 Thermophilic nitrate reducing bacteria (tNRB) ...... 18 2.8 Methods for controlling reservoir souring ...... 19 2.8.1 Biocides ...... 19 2.8.2 Nitrate injection strategy ...... 23 2.8.3 Perchlorate ...... 24 2.8.4 Other inhibitors of the sulfate reduction pathway ...... 26

CHAPTER THREE: ISOLATION OF THERMOPHILIC SULFATE AND NITRATE REDUCING BACTERIA FROM A LOW TEMPERATURE OILFIELD ...... 28 3.1 Abstract ...... 28 3.1 Introduction ...... 29 3.2 Material and methods ...... 33 3.2.1 Study site and sample collection ...... 33 3.2.2 Incubation of concentrated cell suspensions with nitrate and oil organics .....33 3.2.4 Microbial community analysis of 18PW and of derived enrichments ...... 34 3.2.5 Isolation and identification of tSRB and NRB strains ...... 36 3.3 Results ...... 37 3.3.1 Activity of tSRB in water samples from the MHGC field ...... 37 3.3.2 Temperature dependence of reduction of nitrate and nitrite by MHGC microbial consortia ...... 37 3.3.3 Microbial community composition of tSRB enriched from 18PW MHCG field sample obtained in 2014 and 2016 ...... 40 3.3.4 Nitrate reducing community composition as a function of temperature...... 43 3.3.5 Identification of isolated tSRB and NRB strains...... 43 3.3.6 Physiological properties of NRB strains ...... 44 3.4 Discussion ...... 48

v CHAPTER FOUR: EFFECT OF THERMOPHILIC NITRATE-REDUCTION ON SULFIDE PRODUCTION IN SAMPLES FROM THE HIGH TEMPERATURE TERRA NOVA RESERVOIR ...... 53 4.1 Abstract ...... 53 4.2 Introduction ...... 54 4.3 Materials and methods ...... 57 4.3.1 Sample collection and physicochemical analysis ...... 57 4.3.2 Microbial enumeration of SRB and acid-producing bacteria (APB) ...... 59 4.3.3 Activity of SRB and NRB ...... 60 4.3.4 Enrichment of thermophilic SRB and NRB consortia from field samples .....60 4.3.5 Temperature dependence of sulfate and nitrate reduction ...... 61 4.3.6 Isolation and identification of tNRB strains ...... 61 4.3.7 Effect of nitrate and nitrite on sulfate reduction by tSRB ...... 62 4.3.8 Microbial community analysis ...... 63 4.4 Results ...... 64 4.4.1 Physicochemical analyses and most probable numbers ...... 64 4.4.2 Microbial community analysis of IW1_14 and PW1_14 ...... 65 4.4.3 Thermophilic enrichments of field samples ...... 69 4.4.4 NRB enrichment at 50oC and 60oC and isolation of tNRB ...... 70 4.4.5 Enrichment of tSRB ...... 75 4.4.6 Effect of addition of nitrite or nitrate to tSRB enrichments in batch culture ..75 4.4.7 Addition of nitrate, nitrate and tNRB or nitrite to continuous cultures of tSRB76 4.5 Discussion ...... 82

CHAPTER FIVE: SOURING CONTROL BY NITRATE AND PERCHLORATE ...... 87 5.1 Abstract ...... 87 5.2 Introduction ...... 88 5.3 Material and Methods ...... 90 5.3.1 Media and enrichment of perchlorate reducers from oil field samples ...... 90 5.3.2 Corrosion potential of perchlorate and its reduction products ...... 91 5.3.3 Inhibition of sulfate reduction using oil with perchlorate and nitrate under batch culture conditions ...... 92 5.3.4 Dichloromethane (DCM) extraction and quantification of oil components using GC-MS ...... 92 5.3.5 Perchlorate reduction with alkylbenzenes by microbial communities enriched from an oil field produced water sample ...... 93 5.3.6 Control of souring with nitrate and perchlorate in oil containing bioreactors 93 5.3.7 Analytical techniques ...... 95 5.3.8 Microbial community analysis by Illumina sequencing ...... 95 5.3.8.1 Isolation and identification of perchlorate reducing bacteria (PRB) ....97 5.3.9 Growth of perchlorate reducing isolates with different electron acceptors and electron donors ...... 98 5.4 Results ...... 99 5.4.1 Activity test for chlorate and perchlorate reducers in an MHGC PW sample 99 5.4.2 Microbial growth and community composition of enrichments with nitrate or perchlorate...... 101 5.4.3 Corrosivity of perchlorate and its reduction products ...... 107 vi 5.4.4 Sulfate reduction with oil: inhibition with perchlorate and nitrate under batch culture conditions ...... 109 5.4.4.1 Microbial community compositions of batch cultures with oil ...... 113 5.4.5 Souring control in oil containing bioreactors using nitrate and perchlorate .117 5.4.6 Reduction of nitrite and chlorite by oilfield microbes using VFA or oil ...... 120 5.4.7 Use of alkylbenzenes for perchlorate reduction ...... 122 5.4.8 Effect of perchlorate and chlorite on sulfide production by D. vulgaris Hildenborough ...... 124 5.4.9 Isolation and characterization of VFA oxidizing PRB ...... 126 5.5 Discussion ...... 133

CHAPTER SIX: MICROBIAL AND CHEMICAL ANALYSIS OF SAMPLES FROM THREE NORTH SEA PLATFORMS ...... 138 6.1 Abstract ...... 138 6.2 Introduction ...... 139 6.3 Materials and Methods ...... 140 6.3.1 Sample Information ...... 140 6.3.2 Water chemistry and microbial enumeration ...... 141 6.3.3 Activity Tests ...... 144 6.3.4 Microbial community compositions ...... 144 6.3.5 Analyses of sequencing data ...... 145 6.4 Results ...... 146 6.4.1 Water chemistry ...... 146 6.4.2 Microbial community composition in produced water samples ...... 149 6.4.3 Enrichment of SRB, NRB and PRB at 0.5 and 1 M NaCl ...... 154 6.4.4 Analyses of microbial community in enrichment cultures ...... 154 6.5 Discussion ...... 161

CHAPTER SEVEN: CORROSION OF CARBON STEEL BY tSRB ENRICHED FROM OILFIELD PRODUCED WATER SAMPLES ...... 163 7.1 Abstract ...... 163 7.2 Background ...... 163 7.3 Materials and methods ...... 164 7.3.1 Preparation of coupons ...... 164 7.3.2 Culture medium and tSRB culture ...... 165 7.3.3 Corrosion tests ...... 165 7.3.4 Surface Analysis of coupons ...... 166 7.3.5 Corrosion rate determination ...... 167 7.4 Results ...... 167 7.4.1 tSRB activity in media ...... 167 7.4.2 Corrosion with 18PW_tSRB enriched from the MHGC field ...... 168 7.4.3 Surface analysis of coupon exposed to tSRB enriched from Terra Nova produced water samples ...... 171 7.3.4 Surface analysis of coupons exposed to tSRB enriched from North Sea PW samples ...... 174 7.4.4 Corrosion rates ...... 174 7.5 Discussion ...... 178

vii CHAPTER EIGHT: EFFECT OF NITROPRUSSIDE ON THERMOPHILIC SULFATE REDUCTION ...... 180 8.1 Abstract ...... 180 8.2 Introduction ...... 180 8.3 Material and Methods ...... 182 8.3.1 tSRB culture and cultivation medium ...... 182 8.3.2 Preparation and handling of SNP ...... 182 8.3.3 Effect of nitroprusside on tSRB activity and sulfide production ...... 182 8.3.4 Corrosivity of nitroprusside under sour thermophilic condition ...... 183 8.3.5 SNP-mediated control of sulfide production in a continuous culture of tSRB183 8.3.6 Effect on nitrous oxide (N2O) on sulfide production in tSRB ...... 184 8.3.7 Analytical methods ...... 184 8.4 Results and discussion ...... 185 8.4.1 Inhibition of thermophilic SRB activity in batch cultures ...... 185 8.3.2 Corrosion of carbon steel coupon during treatment of active tSRB culture with SNP 189 8.4.2 Effect of SNP on tSRB continuous culture ...... 191 8.4.3 Inhibitory effect of nitrous oxide on tSRB activity ...... 193 8.5 Conclusion ...... 195

CHAPTER NINE: CONTROL OF SOURING WITH NITRATE IN THERMOPHILIC BIOREACTORS ...... 196 9.1 Abstract ...... 196 9.2 Introduction ...... 196 9.3 Materials and methods ...... 197 9.3.1 Souring control with nitrate in dual temperature bioreactor models ...... 197 9.3.2 Evaluating the potential contribution of mSRB and tSRB to souring in dual temperature reservoir bioreactors ...... 201 9.3.3 Souring by tSRB in high temperature low pressure bioreactor ...... 201 9.4 Results ...... 202 9.4.1 Souring control with nitrate in a dual temperature bioreactors ...... 202 9.4.2 Souring in bioreactors continuously inoculated with a tSRB continuous culture from a chemostat ...... 209 9.4.3 Souring in bioreactors at a constant temperature of 60°C ...... 214 9.5 Discussion ...... 218

CHAPTER TEN: CONCLUSIONS ...... 221

REFERENCES ...... 225

APPENDIX A: SUPPLEMENTARY MATERIAL FOR CHAPTER 3: ISOLATION OF THERMOPHILIC SULFATE AND NITRATE REDUCING BACTERIA FROM A LOW TEMPERATURE OILFIELD (MHGC OILFIELD) ...... 246

APPENDIX B: SUPPLEMENTARY MATERIAL FOR CHAPTER 4: EFFECT OF THERMOPHILIC NITRATE-REDUCTION ON SULFIDE PRODUCTION IN SAMPLES FROM THE HIGH TEMPERATURE TERRA NOVA RESERVOIR248

viii APPENDIX C: SUPPLEMENTARY MATERIAL FOR CHAPTER 5: SOURING CONTROL BY NITRATE AND PERCHLORATE ...... 253

APPENDIX D: SUPPLEMENTARY MATERIAL FOR CHAPTER SIX: MICROBIAL AND CHEMICAL ANALYSIS OF SAMPLES FROM THREE NORTH SEA PLATFORMS ...... 256

ix List of Tables

Table 2.1: Common non-oxidizing biocides used in the oil and gas industry (adapted from Greene et al., 2006; Kelland, 2009)...... 21

Table 3.1: Microbial community composition as the fraction of total quality controlled (QC) pyrosequencing reads of a concentrated 2014_18PW water sample, incubated in CSBK medium with 20 mM lactate and 10 mM sulfate at 60°C...... 41

Table 3.2: Microbial community composition as the fraction of total quality controlled (QC) Illumina reads of a concentrated 2016_18PW water sample, incubated in CSBK medium with 5 mM sulfate and 10 mM lactate or propionate at 60°C...... 42

Table 3-3. Microbial community composition as the fraction of total quality controlled (QC) pyrosequencing reads of 18PW incubated in CSBK medium with 3 mM of VFA and 10 mM nitrate at different temperatures. The community composition prior to incubation (18PW) is also shown. Fractions in excess of 1% have been highlighted in gray...... 45

Table 4-1: Physicochemical analyses of injection water (IW) and produced water (PW) samples, obtained from the Terra Nova field ...... 58

Table 4-2: Microbial community compositions of samples PW1_14 (PW) and IW1_14 (IW) derived from pyrosequencing. The fractions of total reads are indicated for each taxon. Fractions in excess of 1% are indicated in bold...... 67

Table 4-3: Microbial community composition of injection water and produced water samples collected in 2015 derived from Illumina sequence data. The fractions of total reads are indicated for each taxon. Fractions in excess of 1% are indicated in bold...... 68

Table 5-1: Microbial community compositions of batch incubations. The numbers of reads are indicated together with some bioinformatic parameters. The fractions (%) of the indicated taxa are shown ...... 116

Table 5-2: Anaerobic growth tests of perchlorate reducing isolates PRB1, PRB2 and PRB4 using different electron acceptors and electron donors ...... 129

Table 5-3: 16S rRNA gene similarity and sequence distance among isolates PRB2, PRB4 and Magnetosprillum strains...... 132

Table 6-1: Description of samples received, including dates when samples were collected and received...... 147

Table 6-2: Chemical composition of samples from producing wells from a North Sea oil field received in August 2016 ...... 148

Table 6-3: Microbial community compositions of produced water samples, presented (left to right) in the same order as in the dendrogram (Figure 6-2). Fractions in excess of 1% are in bold...... 153

x Table 6-4: Microbial community compositions of NRB enriched at 30 °C, presented (left to right) in the same order as in the dendrogram (Figure 6-4). Fractions in excess of 1% are in bold...... 158

Table 6-5: tSRB community from incubation of P2_2-3 (A) and P2_3-5 (B) in CSBA medium containing 10 mM sulfate and 20 mM lactate. Fractions of sequence reads in excess of 1% are indicated in bold ...... 159

Table 9-1: Microbial community compositions of samples taken from the inlet and outlet ends of control and treated bioreactors described in Figure (9-8)...... 212

Table S3-1: Microbial community composition for area I PWs (4PW, 5PW, 9PW, 13PW and 18PW) by pyrosequencing. Averaged community composition for 7 sampling dates from week 310 to 378 (April 2013 to August 2014). The numbers are the average fraction (%) of reads ...... 246

Table S4-1: Number of quality controlled (QC) reads, number of derived operational taxonomic units (OTUs) as extrapolated by Chao and Shannon diversity index for the tSRB inoculum and derived enrichments as in Figure 5...... 248

Table S4-2: Microbial community compositions of tSRB inoculum and of tSRB grown at 55, 60 and 65 °C, as in Figure 5. Fractions in excess of 1% are in bold...... 249

Table S5-2 Microbial community compositions of VFA batch incubations of enrichments with nitrate or perchlorate...... 255

Table S6-1: Enumeration of active microbes present in produced water samples carried out on-site...... 256

xi List of Figures and Illustrations

Figure 2.1: Theoretical temperature profile as a function of distance X for the injection well for a high temperature oil field injected with cold seawater (Fida et al., 2016). The mesothermic zone (MZ, 35 to 45°C), thermogenic zone (TZ, 45 to 85°C) and abiotic zone (AZ, >80°C) are indicated. The temperature profile drawn assumes a reservoir temperature of 95°C, as for the Terra Nova field operations...... 9

Figure 3-1: Hypothetical relation of growth as a function of temperature of a psychrophilic bacterium. The optimum growth temperature (Topt = 18°C) is outside the range of in-situ temperatures experienced by the bacterium (↔)...... 30

Figure 3.2: Schematic of the MHGC field indicating source water (SW), as well as injection (IW) and production wells (PW), as explained in the text...... 32

Figure 3-3: Sulfate reduction activity observed with a concentrated 2014_18PW sample incubated at 60°C. Lactate was used as electron donor. The symbols indicate (O) sulfate and (●) hydrogen sulfide...... 38

Figure 3-4. Reduction of nitrate (◇) to nitrite ( ⃣ ) in CSBK medium with 3 mM VFA as electron donor by concentrated 18PW consortia at different temperatures. Data shown are averages of duplicate incubations. No reduction of nitrate was seen at 40 or 70°C in the absence of inoculation (not shown)...... 39

Figure 4-1: Schematic of seawater injection from the Terra Nova Floating Production Storage and Offloading (FPSO) vessel, as explained in the text. The near injection wellbore region (NIWR) has mesophilic (30-45oC), thermophilic (45-80oC) and abiotic (80-95oC) zones...... 56

Figure 4-2. Activity of tSRB and tNRB observed with 50-fold concentrated inocula of Terra Nova produced water PW1_14 and injection water IW1_14 at 60°C. Incubations were with PW1_14 with 10 mM sulfate and 20 mM lactate (A), PW1_14 with 10 mM sulfate and 3 mM VFA (B), PW1_14 with 10 mM nitrate and 3 mM VFA (C) and IW1_14 with 10 mM nitrate and 3 mM VFA (D). Data are averages of duplicate incubations...... 72

Figure 4-3. Effect of incubation temperature on nitrate reduction in cultures derived from IW5_15 at the indicated temperatures. Data are for primary enrichments (A-F), for secondary enrichments inoculated with primary enrichment (C) grown at 50oC (G, H, I) and for a pure culture isolate, identified as Marinobacter sp., obtained at 50°C (J, K, L). No growth was observed for the cultures in panels G, H, I and J, K L at 55oC or higher temperature...... 73

Figure 4-4. Effect of incubation temperature on nitrate reduction by pure culture isolate Geobacillus sp. TK004, obtained from IW1_14. Data are averages for duplicate incubations; standard deviations are shown...... 74

xii Figure 4-5: Effect of incubation temperature on growth and sulfate reduction by tSRB consortia enriched from PW1_14. The concentration of sulfate (A) and of sulfide (B), as well as the cell density as OD600 (C) are presented as a function of time. Data are averages for duplicate incubations...... 78

Figure 4-6: Inhibition of sulfate reduction by tSRB with nitrite. A tSRB consortium enriched at 60oC (Figure 4-5) was grown at this same temperature in medium with 20 mM lactate and 10 mM sulfate. The concentrations of (A) sulfide and (B) sulfate are shown as a function of time. Nitrite was injected at midlog phase () in concentrations as indicated. .. 79

Figure 4-7: Effect of addition of nitrate or of nitrate and tNRB on sulfate reduction by tSRB consortia grown at 60°C. Nitrate (A) or nitrate and tNRB (B) were added at T = 0 h (A, B) or at midlog phase of sulfate reduction at T = 45 h (C, D); 100 µl of CSBA medium was added as a control at T = 45 h (E). Data are averages for duplicate incubations...... 80

Figure 4-8: Effect of addition of nitrate, of nitrate and tNRB, or of nitrite on tSRB activity during continuous culture conditions at 60°C. The concentrations (mM) are shown as a function of time (days) for (A) sulfate and sulfide in chemostat F (CF), (B) nitrate and nitrite in CF and (C) sulfate and sulfide in chemostat B (CB). CF was injected with medium containing lactate and sulfate. This was switched to medium with lactate, sulfate and nitrate as indicated; tNRB were added as indicated (). CB was injected with medium containing lactate and sulfate with addition of 0.125, 0.250 and 1.0 mM of nitrite as indicated. Note that the time scale is not linear...... 81

Figure 4-9. Temperature range for growth of NRB and SRB from Terra Nova identified or cultivated in this study. These included mesophilic NRB, tNRB Marinobacter, tNRB Geobacillus, tSRB Desulfotomaculum and the thermophilic sulfate-reducing archaeon (tSRA) Archaeoglobus. The latter was not cultivated and its range of activity was inferred from the literature...... 86

Figure 5-1: Activity of mPRB (A, B) and mCRB (C, D) observed with an MHGC oilfield produced water sample. Incubations for mPRB activity were with 5% 18PW sample, with 10 mM perchlorate and 3 mM VFA, while those for mCRB were with 10 mM chlorate and 3 mM VFA. (A) Perchlorate concentration; (B) Concentration of VFA utilized for perchlorate reduction; (C) Chlorate and chloride concentrations (D) Concentration of VFA used for chlorate reduction. Data are averages of duplicate incubations 30°C...... 100

Figure 5-2: Nitrate reducing activity of 18PW in CSBK medium containing 10 mM nitrate and 3 mM VFA. (A) Growth as OD at 600nm; (B) nitrate and nitrite concentrations (averages duplicate cultures) and (C) microbial community composition at T= 48h and T = 336h...... 103

Figure 5-3: Growth and perchlorate reducing activity of 18PW in CSBK medium containing 10 mM perchlorate and 3 mM VFA (A) growth as OD at 600nm, (B) perchlorate concentration and (C) microbial community composition at T= 96 h and T = 336 h...... 104

xiii Figure 5-4: Time course of nitrate and perchlorate reduction in 18 PW communities incubated in CSBK medium containing 10 mM each of nitrate and perchlorate and 6 mM VFA. (A) Growth OD at 600nm (B) nitrate, nitrate and perchlorate concentrations and (C) microbial community composition at T= 48 h, 72 h, 120 h and 336 h...... 105

Figure 5-5: Medium pH as a function of time during microbial growth in medium with nitrate (MN), perchlorate (MP) or nitrate and perchlorate (MPN)...... 106

Figure 5-6: Microbial (biotic) and chemical (abiotic) corrosivity of perchlorate and its reduction products. For microbial corrosion of perchlorate, 5% perchlorate reducing culture was added to the medium. Duplicate serum bottles containing 10 mM perchlorate, chlorate and chlorite used for evaluating abiotic corrosion were photographed after 30 days of incubation on a shaker at 100 rpm at 30 °C (A). General abiotic weight loss corrosion rates with perchlorate, chlorate or chlorite and biotically with perchlorate and PRB of carbon steel beads are shown (B), values presented are means of 3 replicates. Perchlorate concentration is shown as a function of time in both biotic and abiotic incubations (C)...... 108

Figure 5-7: Inhibition of sulfide production by oil grown SRB with nitrate, perchlorate or nitrate and perchlorate. CSBK medium containing 1 mL MHGC oil (represented as O) as electron donor was inoculated with a 20-fold concentrated 18PW sample. Medium was amended with 5 mM sulfate - SO (A); 5 mM sulfate and 10 mM nitrate -SNO (B); 5 mM sulfate and 10 mM perchlorate - PSO (C); 5 mM sulfate and 10 mM each of perchlorate and nitrate – PSNO (D); and 10 mM of perchlorate only – PO (E). Data presented are means of duplicate incubations...... 111

Figure 5-8: Gas chromatography-mass spectrometry analysis of the alkylbenzenes in MHGC oil utilized for incubations of Figure 5-7 after 123 days. The amount of alkylbenzenes remaining was calculated as the ratio of the peak area of each alkylbenzene to that of mesitylene (1,3,5-trimethylbenzene). Data presented are means and error bars are for duplicate measurements...... 112

Figure 5-9: Relational tree for 16S rRNA gene libraries from incubations of CSBK medium, inoculated with 18PW and amended with 1 mL MHGC oil and sulfate (SO); sulfate and nitrate (SNO); sulfate and perchlorate (PSO); sulfate, nitrate and perchlorate (PSNO) or perchlorate only (PO). Community DNA was obtained from cells harvested at day 9, 65, 85 or 123 as indicated. The fractions of reads in Proteobacteria (A) and in other phyla (B) is shown...... 115

Figure 5-10: Effect of nitrate, perchlorate or chlorite or nitrate and perchlorate on sulfide production in low temperature oil containing bioreactors. Bioreactors were inoculated with SRB batch cultures that were pre-grown and transferred twice in CBSK medium with sulfate and MHGC oil. Bioreactors were continuously injected with CBSK medium containing 2 mM sulfate at a flowrate of 0.5 PV/day. The effluent concentrations of sulfate, sulfide, nitrate, nitrite and perchlorate are for shown untreated control columns (A), columns injected with nitrate (B), columns injected with perchlorate or chlorite (C), and columns injected with nitrate and perchlorate (D) as a function of time...... 119

xiv Figure 5-11: Comparing reduction of nitrite and chlorite by oilfield microbes with a simple or complex electron donor, VFA or oil, respectively...... 121

Figure 5-12: Effect of alkylbenzenes on perchlorate reduction. The alkylbenzenes toluene and ethylbenzene were added directly to 50 mL CSBK or to 1 mL HMN layer in 50 mL CSBK, containing 10 mM perchlorate and inoculated with 1mL of a 20-fold concentrated -18PW or 5 mL nitrate reducing chemostat cultures growing on toluene or ethylbenzene. Media inoculated with NRB chemostat cultures are labelled A-D; toluene added to aqueous layer - NTP (A), toluene in HMN layer – NTPH (B), ethylbenzene in aqueous layer – NEP (C), ethylbenzene in HMN layer– NEPH (D), Media inoculated with 18PW labelled E-H; toluene added to aqueous layer - PWT (E), toluene in HMN layer – PWTH (F), ethylbenzene in aqueous layer – PWE (G), ethylbenzene in HMN – PWHE (H). The arrow (↓) indicates the point where nitrate (A-D) or acetate (E-H) was injected into the serum bottles. Data presented are averages of duplicate incubations ...... 123

Figure 5-13: Effect of perchlorate and chlorite addition on sulfide production by DVH. Perchlorate or chlorite was added at time 0, 3, 6 or 12 h to a DVH culture growing in lactate and sulfate containing CSBK medium. Sulfide production is shown for a DVH culture treated with 2 mM perchlorate (A), or 10 mM perchlorate (B). Sulfate reduction (C) or sulfide production (D) is shown for a DVH culture treated with 5 mM chlorite. .... 125

Figure 5-14: Perchlorate reduction by PRB enrichment in CSBK medium with 5 mM perchlorate and 3 mM VFA (A) and PRB4 in CSBK medium with 10 mM perchlorate and 20 mM acetate (B). Note that the timescale in (A) in days and in (B) hours...... 128

Figure 5-15: Effect of nitrate or nitrite on perchlorate reduction by isolate PRB4. Growth of PRB4 with perchlorate (A), nitrite (B) and nitrate (C) represented controls. Perchlorate reduction by PRB4 following the addition of nitrite at time T = 0 h (D) or 6 h (E) and nitrate at T = 0 h (F) or 6 h (G). Electron donor used was 20 mM lactate...... 130

Figure 5-16: Neighbour-joining phylogenetic tree indicating the placement of isolates PRB2 and PRB4 with the genus Magnetospirillum based on the 16S rRNA gene sequence. Branching points are determined as percentage of bootstrap values based on 1000 replications with those having a cut-off at 50% shown. The scale bar of 0.05 represents the fractions of changes (%) per 100 nucleotides. The sequence of Magnetococcus marinus MC-1 (NR_074371) was used as an outgroup...... 131

Figure 6-1: Field map indicating flow direction of produced oil and water. Oil was produced via a peripheral waterflood method and collected at a single platform before transportation to shore for further processing ...... 143

Figure 6-2: Phylogenetic tree of samples from North Sea fields received in August 2016. Clades (i) to (v) representing communities with less than 25% sequence divergence are described in the text. The bar indicates 10% of sequence divergence...... 152

Figure 6-3: NRB activity tests at 30 °C with 0.5 M NaCl CSBA medium supplemented with 3mM VFA and 10 mM nitrate. Nine of ten samples (Table 6-2) were analysed except

xv P3_14 which did not have an aqueous phase. The concentration of nitrate (A), and of nitrite (B) are shown as a function of time...... 156

Figure 6-4: Phylogenetic tree microbial communities in enrichments of North Sea produced water samples at 30 0C in CSBA medium with nitrate and VFA and 0.5 M NaCl...... 157

Figure 7-1: Sulfide concentrations of tSRB cultures enriched from three different oilfields in CSBK, CSBA and ASW medium containing sulfate in the presence of carbon steel coupons over a 35-day period. The medium was supplemented with 5 mM sulfate and either 5 mM lactate and coupon (CE) or coupon only (E) as electron donor. 1 mM acetate was added as carbon source to coupon only (E) medium. Sulfide concentrations are presented as a function time for incubations with tSRB enriched from MHGC oilfield (18PW_tSRB) (A), from the Terra Nova oilfield (TN_tSRB) in (B) and from the North Sea oilfield NS_tSRB in (C)...... 169

Figure 7-2: Comparison of surface morphologies of coupons exposed to 18PW_tSRB under an CMIC/EMIC scenario (A, B, and D) and EMIC scenario (D and E). SEM images are presented in (A and D); picture of coupons incubated with SRB taken under a light microscope (B and E), Pit depth measurement of the coupon shown in B (F) and light photomicrograph of control coupon (C)...... 170

Figure 7-3: Surface analysis of coupons exposed to TN_tSRB and CSBA medium containing 5 mM sulfate and 5 mM lactate at 60°C for 35 days. SEM image of coupon (A), EDS spectral image (B), light photomicrograph of coupons after removing the corrosion products (C) and optical profilometer image and pit depth profile (D)...... 172

Figure 7-4: Surface analysis of coupons exposed to TN_tSRB and CSBA medium containing 5 mM sulfate and 1 mM acetate at 60°C for 35 days. SEM image of coupon (A), EDS spectral image (B), light photomicrograph of coupons after removing the corrosion products (C) and optical profilometer image and pit depth profile (D). The box in red in (A) shows a single bacterial cell at a magnification of 30,000 x and WD of 10.0 mm...... 173

Figure 7-7: General corrosion rates of carbon steel coupons in tSRB culture medium with 5 mM lactate, coupon and 5 mM sulfate or 1 mM acetate, coupon and 5 mM sulfate...... 177

Figure 8-1: Effect of sodium nitroprusside on sulfide production in thermophilic SRB consortia grown in CSBA medium. Sodium Nitroprusside was added to active tSRB culture at mid-log phase of sulfate reduction. Sulfate reduction (A), sulfide production (B), and lactate consumption (C) are shown. Data presented are averages of duplicate incubations; 1 mM SNP is 298 ppm ...... 187

Figure 8-2: Nitrate formation after addition of different concentrations of SNP to active tSRB cultures at mid-log phase...... 188

Figure 8-3: Change in color of tSRB culture medium after 24-h exposure to different concentrations of SNP (0, 0.025, 0.5, 0.1, 0.5, 1, 1.5 and 2 mM, as indicated) in the presence of SRB and sulfide...... 190

xvi Figure 8-4: General weight loss corrosion rates of carbon steel coupons exposed to 0 to 1 mM nitroprusside added to an active tSRB culture at mid-log phase. Data presented are the average corrosion rate (mm/yr) for three replicates...... 190

Figure 8-5: Effect of addition of SNP on tSRB activity during continuous culture conditions at 60°C. Sulfate and sulfide concentrations in the control (untreated) chemostat (A), and in the treated chemostat (B). are shown as a function of timeSNP was injected at 10, 25 and 50 ppm in the influent medium, which also contained 10 mM lactate and 5 mM sulfate. The dotted boxes indicate each SNP injection period. The chemostat had a working volume of 100 ml and a flowrate of 25 ml/d (dilution rate of 0.25 d-1)...... 192

Figure 8-6: Effect of nitrous oxide on tSRB activity. N2O (2 or 5 mM) or N2 (5 mM) was added to the headspace of a tSRB culture in CSBA with 4 mM lactate and 2 mM sulfate at t = 0. Data presented are for duplicate incubations ...... 194

Figure 9-1: Schematic diagram of thermo-jacketed bioreactors showing different inlet end lengths of bioreactor with inlet end length of 1 cm (A) and 4 cm (B). Bioreactors were injected with medium from a medium reservoir through a multi-channel peristaltic pump. The temperature of the bulk of the bioreactors was kept at 60°C using heated water from a circulating water bath (C)...... 199

Figure 9-2: Souring control in dual temperature (20-30°C and 60°C) bioreactor R1 (1 cm inlet end) with either 2 mM or 4 mM nitrate, as indicated. The red line represents sulfide and the blue line represents sulfate concentrations ...... 204

Figure 9-3: Souring control in dual temperature (20-30°C and 60°C) bioreactor R4 (4 cm inlet end), with either 2 mM or 4 mM nitrate. The red line represents sulfide and the blue line represents sulfate concentrations...... 204

Figure 9-4: NRB activity in samples from dual temperature bioreactor R1, collected from the inlet and outlet end at the end of the treatments at day 50 (Figure 9-3). Samples were used to inoculate CSBA medium containing 3 mM VFA and 10 mM nitrate. Samples from the inlet end were incubated at 30 and 60°C (A and B); samples from the outlet end were incubated at 30 and 60°C (C and D)...... 205

Figure 9-5: NRB activity in samples from dual temperature bioreactor R4, collected from the inlet and outlet end at the end of the treatments at day 53 (Figure 9-3). Samples were used to inoculate CSBA medium containing 3 mM VFA and 10 mM nitrate. Samples from the inlet end were incubated at 30 and 60°C (A and B); samples from the outlet end were incubated at 30 and 60°C (C and D)...... 206

Figure 9-6: SRB activity in samples from dual temperature bioreactor R1, collected from the inlet and outlet end at the end of the treatments. Samples were used to inoculate CSBA medium containing 3 mM VFA and 10 mM sulfate. Samples from the inlet end were incubated at 30 and 60°C (A and B); samples from the outlet end were incubated at 30 and 60°C (C and D) ...... 207

xvii Figure 9-7: SRB activity in samples from dual temperature bioreactor R4, collected from the inlet and outlet end at the end of the treatments. Samples were used to inoculate CSBA medium containing 5 mM VFA and 10 mM sulfate. Samples from the inlet end were incubated at 30 and 60°C (A and B); samples from the outlet end were outlet incubated at 30 and 60°C (C and D) ...... 208

Figure 9-8: Effect of nitrate and nitrite on sulfide production in a bioreactor with an inlet end of less than 1 cm. This bioreactor was continuously inoculated with tSRB culture from a chemostat for 10 days. CSBA medium with 2.5 or 5 mM sulfate was injected in control bioreactor (A), nitrate or nitrite was added to control sulfide production by tSRB in (B). Incubation was done using a circulatory water bath set at 60°C. The bioreactors had a thermo-jacket...... 211

Figure 9-9: Bioreactors packed with Berea sandstone as the solid matrix for growth of tSRB. Bioreactors were kept in a 60°C incubator and were inoculated with tSRB and incubated for either 7 days (A) or 21 days (B)...... 216

Figure 9-10: Time course of souring in high temperature (60°C) bioreactors packed with a 97% silica sand and 3% clay mixture. Data presented is the sulfide concentrations for each replicate bioreactor...... 217

Figure S4-1: Temperature dependence of nitrate reduction of IW1_15 (a-c) and PW1_15 (d- f) samples, collected from the Terra Nova oil field in January 2015. The medium containing 3 mM VFA and 10 mM nitrate was inoculated with 1 ml of 50-fold concentrated IW or PW. The data are averages and standard deviations for three different incubations for each temperature...... 250

Figure S4-2. Effect of incubation temperature on growth and community composition of cultures inoculated with the IW5_15 primary tNRB enrichment, obtained at 50°C. Growth (A) and community composition (B) are shown for cultures at the indicated temperatures...... 251

Figure S4-3. Sulfate reduction by tSRB enriched from PW1_14 at 70°C...... 251

Figure S4-4: Phylogenetic analysis of isolate GN001 with the genus Marinobacter based on the 16S rRNA gene sequence. evolutionary history was inferred using the Neighbor- Joining method The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the Maximum Composite Likelihood method ...... 252

Figure S5-1: Microbial community composition showing PRB consortia grown on either nitrate or per(chlorate) with VFA as electron donor. The PRB consortia used was transferred 5 times in CBSK medium with per(chlorate) and VFA...... 254

xviii List of Symbols, Abbreviations and Nomenclature

Symbol Definition

APB Acid producing bacteria API American Petroleum Institute APS Adenosine 5’-phosphosulfate ASTM American Society for Testing and Materials BTEX Benzene, toluene, ethylbenzene, and xylene CMIC Chemical microbially influenced corrosion DNA Deoxyribonucleic acid DNRA Dissimilatory nitrate reduction to ammonium dNTP 2’-deoxynucleotide 5’-triphosphates E Potential e- Electron EDS Energy dispersive spectrometry EMIC Electric microbially influenced corrosion EPS Extracellular polymeric substance FPSO Floating production storage and offloading GC Gas chromatography GC-MS Gas chromatography mass spectrometry hNRB Heterotrophic nitrate reducing bacteria HPLC High performance liquid chromatography MHGC Medicine Hat Glauconitic C mNRB Mesophilic Nitrate reducing bacteria MIC Microbially influenced corrosion NIWR Near injection wellbore region NP Nitroprusside NRB Nitrate reducing bacteria OTU Operational taxonomic unit PCR Polymerase chain reaction PW Produced water PWRI Produced water reinjection QC Quality control rpm Revolutions per minute rRNA Ribosomal ribonucleic acid SRA Sulfate reducing archaea SRB Sulfate reducing bacteria SRM Sulfate reducing microorganisms tNRB Thermophilic nitrate reducing bacteria tSRA Thermophilic sulfate reducing archae tSRB Thermophilic sulfate reducing bacteria tPRB Thermophilic perchlorate reducing bacteria USD United States dollar VFA Volatile fatty acids vol Volume

xix wt Weight

xx Chapter One: Introduction

1.1 Background

To satisfy increasing global energy demand, the oil and gas industries are continually seeking ways to secure new energy resources, whilst boosting the recovery and production of existing ones. Most of the world’s oil is produced by waterflooding, a secondary oil recovery process that allows the extraction of up to 40-60% of oil from the reservoirs. Waterflooding operations are carried out through the injection of water (particularly seawater if offshore) to re- pressurize the reservoir, displacing the oil from reservoir rock pores and pushing it the producer wells.

This secondary oil recovery process, which typically relies on water injection is relatively cheap to use and has a high oil recovery. However, its downside is souring which has huge economic implications (Gieg et al. 2011). Souring is the biogenic production of hydrogen sulfide by sulfate reducing microorganisms SRM; (Archaea, SRA or Bacteria, SRB) (Reinsel et al. 1996).

Microbial souring is the most prevalent problem observed in oil field operations where seawater or produced water reinjection (PWRI) is used for secondary oil recovery (Hubert and Voordouw

2007). For instance, in high temperature reservoirs (e.g. 110-120oC) seawater injection cools the reservoir rock surrounding the injection well. Water injection decreases the temperature in this region to within the thermal viability limits of life allowing the establishment of microorganisms.

With continued seawater injection, a thermal gradient is created within the reservoir from the injector to the producer with temperatures increasing from e.g. 30 to 80oC or higher.

The detrimental impacts of souring include an increase in the sulfide content of produced oil, corrosion of oil facility infrastructure both in the oil wells and in the processing facilities,

reservoir plugging, and toxicity to oil facility workers which is a major health and safety issue

(Bernardez et al. 2013; Al-Zuhair et al. 2008). Souring increases production costs because produced oil or gas requires more processing to decrease the sulfide content. In addition oil companies spend billions of dollars each year replacing corroded production equipment as well as in deploying corrosion inhibitors and chemical scavengers (Koch et al., 2016; Hubert and

Voordouw 2007).

Control of souring is therefore necessary for both environmental and economic reasons.

Currently, there are two main strategies used for the control and mitigation of souring. One strategy is the use of biocides to inhibit the growth of SRM and other microbes. This has a high success rate in above ground facilities and but is less effective in the reservoir (Nemati et al. 2001). Biocide application in above-ground facilities below certain threshold values can result in the acclimatization of SRM and other microbes, thereby leading to increased resistance (Vilcaez et al.

2007). Glutaraldehyde, benzalkonium chloride, and tetrakishydroxymethyl phosphonium sulfate

(THPS) are non-oxidizing biocides commonly used to eliminate microbes in oil field operations

(McGinley et al., 2009; Enzien and Yin 2011; McDonnell and Russell 1999). A second strategy, suitable for controlling reservoir souring, is the injection of nitrate to stimulate the growth of nitrate reducing bacteria (NRB) which inhibit the growth of SRM via three main mechanisms; a) biocompetitive exclusion of SRB by chemoorganotrophic NRB using the same degradable oil organics, b) sulfide oxidation by chemolithotrophic sulfide oxidizing nitrate reducing bacteria

(soNRB), and c) nitrite inhibition of dissimilatory sulfite reductase (Dsr) that catalyzes the reduction of sulfite to sulfide (Gittel et al. 2012; Callbeck et al. 2013). More recently, perchlorate

is being explored as an effective control strategy for souring (Liebensteiner et al. 2014; Gregoire et al. 2014).

1.2 Research Objectives

The overall goal of my doctoral research was to better understand nitrate-mediated control of souring under mesophilic and thermophilic conditions. This research was divided into three main objectives; which were to:

I. Identify contributor(s) to souring in seawater flooded high temperature reservoirs. The

temperature dependence of growth and activity of both SRM and NRB will aid in

determining their positioning in the near injection wellbore region (NIWR) and how this

impact souring control with nitrate.

II. Establish the contribution of tSRB to reservoir souring and MIC

III. Conduct microcosm and model reactor experiments that would replicate field application

of nitrate or perchlorate for souring control purposes.

1.3 Organization of thesis

This thesis is divided into ten chapters written in either a manuscript style (3, 4), or a traditional- thesis style (5, 6, 7, 8 and 9). The research presented in this thesis has been done primarily by me; some has been done in collaboration with colleagues.

The literature review section in Chapter 2 provides the background information for work described in this thesis.

Chapter 3 describes the isolation of thermophilic SRB and NRB from low temperature produced water samples using an inoculum concentration technique. Nitrate was found to be reduced to nitrite only at higher temperature. Co-author Dr. Tekle Fida provided the data for the temperature dependence of nitrate reduction by tNRB and isolated these. Dr. Chuan Chen established the inocula concentration method used in this study. I discovered that thermophiles inhabit and can be enriched from a low temperature reservoir and did all experiments pertaining to tSRB from this field. Part of the results presented in this chapter has been published in the following publication: Fida, T. T., Chen, C., Okpala, G., and Voordouw, G. (2016). Implications of Limited Thermophilicity of Nitrite Reduction for Control of Sulfide Production in Oil

Reservoirs. Appl. Environ. Microbiol. 82, 4190–9. doi:10.1128/AEM.00599-16.

Chapter 4 has been published in Frontiers in Microbiology and describes the temperature dependence of tSRB and tNRB obtained from a high temperature seawater flooded reservoir. The response of tSRB to nitrate reduction by tNRB or to nitrite injection under batch and continuous culture conditions is also described. Drs. Tekle Fida and Chuan Chen did some of the experiments.

Okpala, G. N., Chen, C., Fida, T. and Voordouw, G. (2017). Effect of thermophilic nitrate reduction on sulfide production in high temperature oil reservoir samples. Front. Microbiol.

8:1573. doi: 10.3389/fmicb.2017.01573.

Chapter 5 describes the efficacy of nitrate and perchlorate in mitigating souring in bioreactors mimicking low temperature reservoir conditions. The corrosivity of perchlorate and its derivatives was determined and oil field bacteria involved in perchlorate reduction were characterized.

Chapter 6 presents data for enrichment of thermophiles from North Sea produced water samples. It also includes microbial community analysis of the samples and of the enrichment cultures.

Chapter 7 describes MIC caused by tSRB from different oil fields.

Chapter 8 presents the effectiveness of sodium nitroprusside as a biocide of tSRB and as an H2S scavenger.

Chapter 9 describes bioreactors used in studying nitrate-mediated control of sulfide production under high temperature conditions.

Chapter 10 summarizes the research presented in this thesis, outlining the key findings and making recommendations for future research directions.

Chapter Two: Literature review

2.1 Waterflooding and reservoir souring.

Waterflooding is a common secondary oil recovery method, used both onshore and offshore. Seawater is generally used for flooding operations offshore (Gieg et al., 2011). Due to pollution concerns, some offshore oil operations now use produced water reinjection (PWRI), a strategy in which a mixture of seawater and produced water is re-injected into the reservoir. This decreases the volume of produced water to be disposed (Zhang et al., 2012). However, produced water can have, degradable oil organics including volatile fatty acids (VFA; acetate, propionate and butyrate), alkanes, and monoaromatics. It also has N-containing nutrients and residual sulfate.

Reservoirs flooded with seawater or produced water are thought to sour more quickly, although the rate of emergence of bio-generated hydrogen sulfide differs from one reservoir to another

(Eden et al., 1993; Zhang et al., 2012). The high sulfate content (approximately 28 mM) of seawater is a major challenge associated with using seawater for waterflooding (Cheng et al., 2017;

Gittel et al., 2012). Use of seawater increases the reservoir sulfate content from 0-0.6 mM to 22-

28 mM (Nilsen et al., 1996; Gittel et al., 2009). Other problems associated with waterflooding are the increase of readily degradable oil organics (Gieg et al., 2011) and the temperature reduction to

<45 oC in the near injection wellbore region (NIWR), due to injection of cold seawater. These factors allow both mesophilic SRB (mSRB) and thermophilic SRM (tSRM) to proliferate under the existing reservoir conditions.

2.2 Process of high temperature reservoir souring

The in situ reservoir temperature varies from one reservoir to another, as a function of depth, with a 3°C rise in temperature for every 100 m depth (Zhang et al., 2012). High temperature oil reservoirs have downhole temperatures ranging from 60-120oC before the onset of waterflooding at pressures around 4.5x104 kPa (444 atm) (Mueller and Nielsen, 1996). But with the injection of seawater, the temperature of parts of the NIWR is decreased to less than 40oC. The

NIWR can be defined as the region in which the temperature rises from that of the incoming seawater to that of the reservoir. As indicated in Figure 2.1, the NIWR consists of mesothermic, thermogenic and abiotic zones for a reservoir temperature of 95°C, as in Terra Nova. Souring in this reservoir would be caused by mesophilic SRB (mSRB) in the MZ and thermophilic SRB

(tSRB) in the thermogenic zones (TZ) (Figure 2-1).

The TZ is formed as soon as the cool injected seawater hits the reservoir, decreasing the temperature of the reservoir rock surrounding the water injector creating a thermal viability region with temperatures below 45oC (Platenkamp, 1985). The mixing of the injection water with formation water (water indigenously present in the reservoir) increases nutrient availability in this region, enabling the establishment of mSRB biofilms that reduce incoming sulfate to sulfide. As the injected waterfront moves deeper into the reservoir, thermogenic zones (TZ) with temperatures ranging from 45-80oC are formed. Some authors believe that 80oC is the upper limit for life in oil reservoir, (Wilhelm et al., 2001; Magot, 2005), whereas others have defined a hyperthermogenic zone with temperatures above 80oC (Liebensteiner et al., 2014).

Although tSRM have been identified in produced water and formation water samples from oil fields using culture dependent and culture independent approaches (Nilsen et al., 1996; 7

Rozanova et al., 2001; Lenchi et al., 2013; Gittel et al., 2009), there is little information on their actual contribution to souring in these environments. mSRB in the MZ located around the NIWR are mostly implicated as major contributors of souring in high temperature reservoirs (Rozanova et al., 2001; Sunde and Torsvik, 2005). Nonetheless, some studies have shown that production fluids retrieved from high temperature oil fields are often dominated by tSRM (Gittel et al., 2012;

Kaster et al., 2009), suggesting that the TZ may also contribute to souring.

2.3 Main drivers of souring in high temperature reservoirs

Nutrient availability

SRB can also be divided in heterotrophic and autotrophic SRB (Liamleam and

Annachhatre, 2007). The difference between these two groups is that the heterotrophic SRB couple the reduction of sulfate to the oxidation of organic compounds whereas the autotrophic SRB use

CO2 and H2 as carbon and energy sources, respectively. Seawater, although rich in sulfate, lacks the organic carbon required for microbial growth. However, organic carbon is found in high concentrations in oil reservoirs. Hence, a combination of seawater and reservoir formation water in the NIWR supplies suitable conditions and nutrients necessary for the growth and establishment of SRB and SRA. SRB can use a wide range of organic compounds as source of carbon and electrons for sulfate reduction. The most commonly known electron donors in oil reservoir fluids are the VFA (formate, acetate, propionate and butyrate), alkanes, and monoaromatics (toluene, xylene and benzene) (Gieg et al., 2011). Nitrogen and phosphorus are important nutrients required for sulfate reduction. In oil reservoirs, nitrogen is not limiting and is present in the form of ammonium ions in water and as heterocyclic aromatic nitrogen compounds in oil (Head et al.,

2003). Phosphorus, however, is often limiting in oil reservoirs because most of the phosphorus is trapped in feldspar, a phosphorus rich mineral, and is exclusively available to microbes attached to the mineral or following dissolution of the mineral (Head et al., 2003, Ehrenberg and Jakobsen

2001).

Temperature

Temperature is another important factor that impacts microbial souring of oil reservoirs.

Temperature affects metabolic activities and thus, microbial diversity of oil reservoirs (Gao et al., 10

2015; Li et al 2012 and Vigneron at ale 2017). Microbial populations differ in the MZ and TZ as a result of the temperature difference in these zones. For instance, mesophilic microbial communities grow more densely than thermophilic communities because energy metabolism is more efficient at lower temperatures (Slobodkin et al., 1999; Youssef et al., 2009).

2.4 Models for predicting souring in reservoirs

The extensive nature of souring in seawater flooded reservoirs prompted the development of models to help predict reservoir souring. In modelling reservoir souring, two key processes generation of H2S and its transport in porous media, are taken into consideration (Farhadinia,

2008). The three common models used for prediction of reservoir souring are the mixing zone, biofilm and thermal viability shell models (Johnson et al., 2017; Jordon and Walsh, 2004). Oilfield operators can incorporate these models into reservoir souring simulators to predict souring under specific reservoir conditions. Examples of reservoir simulators are SourSim® RL, Dynamic TVS,

SourMax and H2S Model (Johnson et al., 2017).

The mixing model, developed by Ligthelm et al. (1999), is based on the observation that seawater contains the requisite elements (nitrogen and phosphorus) for the stimulation of biogenic sulfide production in oil reservoirs. The seawater injection water, however, does not have a lot of organic substrates that the SRM need. The formation water on the other hand, is rich in fatty acids and other soluble organic compounds due to its contact with the oil phase. As the injected seawater displaces the formation water in the reservoir, a mixing zone is formed where the flood front and the formation water are in direct contact (Jordan and Walsh, 2004). Since the mixing zone contains all the compounds and nutrients for growth, it serves as a hub for the proliferation of SRM; this 11

results in production of hydrogen sulfide which then moves with the flood front towards the production well. However, this model was criticized because hydrogen sulfide production is not observed immediately after seawater breakthrough occurs, but is usually seen after several pore volumes of injection water have been produced (Maxwell and Spark, 2005).

The biofilm model is based on the understanding that injection of seawater into high temperature oil reservoirs results in the formation of fractures through which the injected water flows preferentially, increasing the distance X of the near injection wellbore region (Figure 2-1;

NIWR) (Haghshenas et al., 2012; Sunde et al., 1993). This model assumes that SRB biofilms growing near the injector generate the hydrogen sulfide observed in the producing well and that the bulk of the reservoir serves only as a transport and adsorption zone for the sulfide produced

(Sunde and Torsvik 2005). The degree of H2S generation is dependent on biomass formed in the biofilm which in turn is controlled by the nitrogen and phosphorus content of the injection water.

The dynamic thermal viability shell model focuses on the effect of temperature and pressure on the growth and activity of microbes (Eden et al., 1993). Hence, hydrogen sulfide production by SRM will only occur in the region where the temperature and pressure is favourable for growth. The injected seawater cools the reservoir rock around the injector region by mixing with the hot formation water, thus creating a thermal viability shell. The thermal viability shell is a zone in a water flooded reservoir where the reservoir temperature is within the limits that could support the growth of either mSRM (20-45°C) or tSRM (45-80°C). As the cold seawater front advances further into the reservoir, a point is reached when the temperature equalizes to that of the reservoir Figure 2-1). This model does not account for the effect of nutrients on hydrogen sulfide

production (Haghshenas et al., 2012). It is the preferred model when starting new waterfloods in reservoirs.

Out of the three models described, the dynamic thermal viability shell model which takes into account the contributions of mesophilic and thermophilic SRB to hydrogen sulfide generation may serve as the better souring prediction tool. However, for accurate souring prediction in high temperature reservoirs, components of all three models should be considered. For instance, the availability of nutrients and organic substrates alone is not a guarantee that biogenic sulfate reduction will take place, as temperatures may be too high even for growth of the tSRM Figure 2-

1: AZ).

2.5 Methods used in studying microbial communities from high temperature oil fields

The first step in identifying SRM and other microbes from oilfields is to collect high quality samples with very few contaminants. The most common type of samples available to researchers are produced water samples collected from the production wellhead or following oil-water separation units. Although produced water samples can inform on the organisms present in the reservoir, contamination of the samples by microbes growing on the walls of the producing well is inevitable (Nazina et al., 1995).

Comparative studies to determine the effect of water flooding on microbial communities present in reservoirs have been reported. Kaster et al., (2009), analyzed the microbial communities present in produced water samples and injection water samples. Other studies have examined the differences in microbial communities present in produced water samples, which were retrieved from water flooded and non-water flooded reservoirs and from injection water samples (Lenchi 13

et al., 2013; Orphan et al., 2003, 2000). Onshore injection water samples often processed through water plants before or after biocide dosing and after de-aeration have also been examined. Few studies have reported the microbial composition of back-flowed samples (that is samples received when the flow of water into the injection well is reversed) (Cochrane et al., 1988; McKinley et al., 1988; Bødtker et al., 2009; Larsen et al., 2004; Nazina et al., 1995). The interval collection of back-flowed water samples gives a fair representation of microbial communities in the injection well and those in the NIWR (Bødtker et al., 2009). It is important, however, to note that the collection of back-flowed samples is often not feasible. McKinley et al. (1988) evaluated the microbial communities of a water flooded reservoir by back-flowing previously injected water for a period of 7 h. The authors observed that the biomass present in the first interval of backflow was similar to that of the injected water sample. But as water believed to be from the NIWR was retrieved, the biomass concentration peaked and visible microbial clumps were observed, indicating high microbial activity in this region (Bødtker et al., 2009). For some studies, pressurized water samples were collected for analysis of microbial communities to minimize the loss due to cell lysis (Kotlar et al., 2011). Samples have also been retrieved directly from oil deposits under high pressure and high temperature conditions using an oil phase single-phase reservoir sampler (Yamane et al., 2011). Following collection, the samples were slowly depressurized to minimize lysis of microbial cells prior to activity determinations and reservoir community analysis. This unique sampling procedure also prevents contamination of the samples by biofilms formed on the walls of wells and pipelines, but it is a very expensive procedure

(Wentzel et al., 2013).

Once water samples are received the physicochemical characteristics are determined, followed by microbiological analysis. The general consensus is to apply both culture-based and culture-independent approaches to determine the composition and activity of the microbes present

(Gieg et al., 2011). Microbial communities present in oil fields are diverse and the distribution of microbes in a particular reservoir is determined by selective factors imposed by existing physicochemical conditions and the production strategy applied in each field. For instance, microbial community compositions of seawater flooded hot reservoirs are determined by the temperature gradients, the sulfate concentration, and the availability of electron donors. The abundance of a given microbe at any point in time relies on the organism’s ability to thrive and survive within the prevailing environmental conditions. This means that microbial community composition is dynamic (continually changing) due to the constant flux into the environment which is very apparent in seawater flooded reservoirs (Vigneron et al, 2017; Cheng et al., 2017). The determination of microbial community composition of oil reservoirs has undergone a lot of advancement from reliance on culture based methods to culture independent methods.

Over the years, culture based methods have been used for microbial surveys in petroleum- rich environments, many of which have shown the presence of thermophilic and hyperthermophilic anaerobic microbes (Magot et al., 2000). Frequently isolated microbial groups include sulfate- reducers and fermenters (Grassia et al., 1996), methanogens, acetogens, and manganese, nitrate, and iron reducers (Greene et al., 1997; Magot et al., 2000; Slobodkin et al., 1999). Culture dependent methods rely on the ability of the microbes of interest to grow in a laboratory prepared medium under specific conditions, of pH, salinity, pressure, redox conditions and temperature, that mimic the source environment (Röling et al., 2003). This method consumes time and can only 15

detect culturable microbes, which are estimated to be approximately 1% of the total microbial population (Garland and Mills, 1991). Although this limits our understanding of the microbial diversity present in oil field environments (Dahle et al., 2008; Grassia et al., 1996; Kaster et al.,

2009), it allows insights into the physiological potential of the cultured microbes.

Microbiological surveys based on the 16S rRNA gene sequences are now being routinely used to determine the structure of bacterial and archaeal communities present in oilfield samples.

Limitations associated with this method are the biases introduced during DNA extraction procedures and the polymerase chain reaction (PCR) which may increase or decrease the frequency of a particular sequence(s) found in the 16S rRNA gene library (Li et al., 2006). Some studies have combined both the 16S rRNA gene sequence analysis and enrichment techniques to characterize microbial communities in high temperature oilfields (Bonch-Osmolovskaya et al., 2003; Nilsen et al., 1996; Orphan et al., 2000; Gittel et al, 2009). The results from these studies showed that high temperature oilfields harbour thermophilic anaerobes, most of which are fermenters, methanogens, iron reducers, sulfur and sulfate reducers.

Following more recent advancements in high throughput sequencing technologies, researchers now apply omics approaches such as metagenomics, transcriptomics, proteomics and metabolomics, to better understand the physiology and functions that specific groups of microbes may perform within a community.

2.6 Thermophilic sulfate reducing microorganisms (tSRM)

Although souring in high temperature reservoirs may be attributed to mesophilic sulfate reducers (mSRB) growing in the MZ of the NIWR (Figure 2-1), more and more tSRB are being identified from oil field samples. Deep subsurface petroleum reservoirs previously thought to be devoid of life due to extremely high temperatures associated with the depth of these reservoirs of around 2000 m, have been shown to contain diverse metabolically active thermophilic and hyperthermophilic anaerobes (Orphan et al. 2003; Slobodkin et al. 1999). Microbial community analyses of high temperature oil field samples have consistently shown that the composition of microbial communities found in injection water significantly differs from those identified in produced water samples (Gittel et al. 2012; Agrawal et al. 2014; Lenchi et al. 2013; Zhang et al.

2012). This difference in microbial community composition may mean that many of the thermophiles in the produced waters are indigenous to the oil reservoir environment. Although there is an increase in the different tSRM taxa identified from oil reservoirs with time as more studies are done, only a few these have been cultured (Orphan et al. 2000). Desulfotomaculum spp. are the most documented culturable thermophilic SRB isolated from oil field environments. They are, however, not commonly detected via molecular biology approaches probably because they can exist as spores, which maybe resistant to typical DNA extraction procedures (Wunderlin et al.,

2014; Hubert et al., 2009). Thermodesulforhabdus norvegicus and Archaeoglobus fulgidus strains were among the dominant tSRM detected by Nilsen et al. (1996) in samples from North Sea oil reservoirs using genus specific fluorescent antibodies. Beeder et al. (1995) isolated a novel acetate- oxidizing T. norvegicus, a member of the deltaproteobacterial class that grows optimally at 60 oC

and at a maximum growth temperature of 74 oC. Using 16S rRNA gene clone libraries, Li et al.

(2007) observed that 14% of the total clones from produced water sample belonged to

Thermodesulfovibrio, a gram negative tSRM.

2.7 Thermophilic nitrate reducing bacteria (tNRB)

Over the years, nitrate injection has become a cost-effective approach for souring control in both high and low temperature oil fields. The addition of nitrate to water injected into oil reservoirs stimulates the activity of nitrate reducing bacteria (NRB) of the class

Epsilonproteobacteria (members of the genera Sulfurospirillum. and Arcobacter) and of the class

Deferribacterales (Gittel et al., 2012). Thermophilic NRB from oil fields include the moderately thermophilic Denitrovibrio acetiphilus (Myhr and Torsvik 2000) and Garciella nitratireducens, which was isolated from an oil reservoir in the Gulf of Mexico (Miranda-Tello et al., 2003). These

NRB reduce nitrate to ammonium via a nitrite intermediate. Thermophilic NRB that reduce nitrate to nitrite and not further have been reported (Fida et al., 2016; Okpala et al., 2017). Fida et al.

(2016) reported the isolation of the tNRB Petrobacter strain TK002 and Geobacillus strain TK003 from a low temperature oil field, which optimally reduce nitrate to nitrite only at 55 to 70°C, respectively. Similarly, Okpala et al. (2017) isolated the moderately thermophilic (50°C)

Marinobacter strain GN001 and the thermophilic (60°C) Geobacillus strain TK004 from the Terra

Nova oilfield, which did not also reduce nitrite.

2.8 Methods for controlling reservoir souring

To mitigate the negative impacts of souring associated with oil production by water flooding processes, several control methods have been explored. The most suitable method to mitigate souring may be to use a sulfate-free injection or make up water. This may be achieved by physically removing sulfate from the injection water using a nanomembrane filtration process. The downside to using this technology is the cost of installation and maintenance, considering the volume of the injection water to be treated. Other methods explored are biocide application, use of sulfide scavengers, and nitrate injection which are discussed below.

2.8.1 Biocides

Biocides are chemical agents applied to kill or interfere with the activity of SRB in mostly above-ground oilfield operations (Rossmoore, 1994). The most commonly used non-oxidizing biocides in the oil and gas industry are glutaraldehyde, THPS, acrolein, bronopol, and quaternary ammonium salts such as benzalkonium chloride and cocodiamine (see Table 2.1 for mechanism of action and structure). Non-oxidizing organic biocides inhibit microbial growth by altering the permeability of microbial cell membranes, as well by reacting with proteins and interfering with cellular processes (Kelland, 2009). Biocides preventing the activity of SRB and other microbes in above ground facilities for control of microbiologically influenced corrosion have been extensively studied (Biggs et al., 2017; Okoro et al., 2015; Raman et al 2008). However, studies on the impact of biocide application for mitigation of reservoir souring is limited (Nemati et al., 2001). The use of biocides for souring control under laboratory conditions in bioreactors, which mimic reservoir conditions, has been studied. Reinsel et al., (1996), reported the effective control of sulfide 19

production in a thermophilic (60°C) sand packed reactor by continuous injection of glutaraldehyde.

But upon stopping the injection of biocide, souring resumed. More recently, Xue et al. (2015), demonstrated that short time (1 h) injection of a high concentration (2000 ppm) of glutaraldehyde was more effective at inhibiting souring in a sand packed column than long term (5 days) injection of a low concentration (50 ppm) under low temperature conditions, while the reverse was observed with cocodiamine.

Table 2.1: Common non-oxidizing biocides used in the oil and gas industry (adapted from Greene et al., 2006; Kelland, 2009).

Biocide Mechanism of action Acrolein • Crosslinks amino and sulfhydryl groups of proteins.

• Serves as H2S scavenger and dissolves iron sulfide Glutaraldehyde • Similar mechanism as acrolein

• Also inhibits transport processes in cells THPS (Quaternary • Mechanism of action may be via phosphonium crosslinking of proteins which compound) results in cell lysis (Kelland 2009)

• Also dissolves iron sulfide precipitate (Gilbert et al., 2002)

Benzalkonium • Is a cationic surfactant which chloride -BAC solubilizes cell membranes. (Quaternary ammonium • Can improve uptake of other antimicrobials compound) Cocodiamine • Same mechanism as BAC

Bronopol • Inactivates sulfhydryl groups of proteins through reaction with its bromine atom.

• Damages the components of electron transport chains, resulting in the formation of oxidizing radicals (BASF 2012).

Studies on the field application of biocides for control of sulfide production via batchwise injection of tetrakis(hydroxymethyl)phosphonium sulfate (THPS) was conducted in the Skjold oil production system (Larsen, 2002). Injection of THPS led to a 40% decrease in sulfide production from treated sections of the field, relative to untreated sections of the field.

Several factors may limit the success of biocide application for remediation of souring in oil reservoirs. Reservoir conditions that affect biocide efficacy include temperature, pressure, permeability, water chemistry (Kjellerup et al., 2005; Gardner and Stewart 2002), biocide inactivation through reaction with H2S , and sorption to reservoir minerals (Reinsel et al., 1996).

High temperatures could result in degradation of biocides. Yin et al. (2016) showed that glutaraldehyde became inactivated at temperatures above 75°C. A study by Zhao et al. (2009), evaluating the effect of pH and temperature on THPS degradation, showed that the stability of

THPS decreased with increases in temperature. The presence of some inorganic ions can contribute to the degradation of biocides. For instance, glutaraldehyde reacts with ammonia and amines at

60°C. Its inactivation accelerated in the presence of ammonium chloride in a produced water

(McGinley et al., 2009). Xue et al. (2015) showed that SRB activity was only inhibited when the concentration of glutaraldehyde injected into sour columns exceeded that of the ammonium (4.7 mM) present in the medium. Isothiazolone a broad-spectrum biocide used in industrial processes and known to be effective in inhibiting SRM is often inactivated in the presence of sulfides and corrosion inhibitors (Rossmoore, 2012; Williams, 2004; Odom and Singleton, 1993). In addition to these physicochemical parameters, SRB also form biofilms with other microbes on reservoir rock surfaces, which protects them from the action of biocides. Biocides can be applied either continuously or batchwise. Limitations of continuous biocide application are that this can lead to 22

the development of resistance by some SRB strains (Gieg et al., 2011). Although biocides are routinely used to prevent the proliferation of microbes, including SRB, in above-ground facilities, they may not be effective in controlling reservoir souring.

2.8.2 Nitrate injection strategy

Nitrate injection is a generally accepted strategy employed to control reservoir souring in both high and low temperature reservoirs (Liebensteiner et al., 2014). Nitrate permeates the reservoir formation more readily than biocides, stimulating the growth of NRB. The mechanisms of nitrate mediated control of reservoir souring include;

(i) The competitive depletion of carbon or energy substrates (electron donors), which are

used by SRB. Heterotrophic NRB (hNRB) couple the reduction of nitrate to the

oxidation of oil organics such VFA and oil components such alkylbenzenes, which are

also utilized by sulfate reducers. Because nitrate reduction yields more energy than

sulfate reduction, the hNRB grow more rapidly, excluding the SRB. This mechanism

works best when the concentration of oil organics is limiting, which may not be the

case in oil reservoirs (Hubert and Voordouw 2007; Grigoryan et al., 2008; Gieg et al.,

2011). In addition, hNRB can be susceptible to high sulfide concentrations because

nitrous oxide reductase responsible for the reduction of N2O to N2 is sensitive to sulfide

(Bowles et al., 2012). Hence, this mechanism may not be feasible in a heavily soured

reservoir (Gieg et al., 2011).

(ii) Oxidation of hydrogen sulfide by sulfide oxidizing nitrate reducing bacteria (soNRB).

These couple the reduction of nitrate to the oxidation of sulfide to sulfate or elemental 23

sulfur depending on the ratio of nitrate to sulfide present. At high nitrate to sulfide ratio,

nitrite, an intermediate of this redox process, accumulates with the oxidation of sulfide

to sulfate. However, at low nitrate/sulfide ratio elemental sulfur is produced, while

nitrate is reduced to N2 (Gieg et al., 2011; Hulecki et al., 2009; Greene et al., 2003).

(iii) Nitrite is a metabolic inhibitor of sulfate reduction in SRB. It inhibits the dissimilatory

sulfite reductase (Dsr) which catalyzes the reduction of sulfite to sulfide, thus

preventing sulfate reduction Some mesophilic sulfate reducers depending on the

concentration of nitrite, are able to prevent and overcome this inhibition by using a

periplasmic nitrite reductase (Nrf) which reduces nitrite to ammonium (Greene et al.,

2003; Haveman et al., 2004).

2.8.3 Perchlorate

It is known that nitrate injection can control reservoir souring. However, complete inhibition of sulfate reduction with continuous nitrate injection is problematic in low temperature fields (Voordouw et al., 2009). This is due to the establishment of zones of NRB closest to the injection well and of SRB deeper in the reservoir. Although, some studies have shown that switching from continuous to pulsed injection of nitrate can deliver nitrate further into the reservoir, thus achieving a more successful control (Voordouw et al., 2009; Callbeck et al., 2011); however, this strategy is not routinely used. Recently, the use of perchlorate as a measure to control souring in oil fields has been suggested (Liebensteiner et al., 2014; Engelbrektson et al., 2014;

Gregoire et al., 2014). It has been shown that perchlorate reductase can reduce perchlorate

- - effectively to chlorate (ClO3 ) and chlorite (ClO2 ) under anaerobic conditions. The chlorate is

− further reduced to chlorite (ClO2 ) followed by the disproportionation of chlorite to oxygen and chloride by a chlorite dismutase (Coates and Achenbach, 2004; Carlström et al., 2013). A number of mesophilic facultative perchlorate reducing bacteria (PRB) belonging to the phylum

Proteobacteria have been isolated and studied (Liebensteiner et al., 2014). PRB grow at neutral pH and some of them can reduce perchlorate under highly saline conditions. Examples of PRB include Dechloromonas agitate strain CKB and Arcobacter sp. strain CAB (Achenbach et al.,

2001; Carlström et al., 2013). To date, no PRB have been isolated from oil reservoirs. However, metagenomic database surveys have indicated that some NRB from oil field samples possess genes for perchlorate reduction (encoding Cld-like proteins). Examples of oil field NRB possessing the gene for a Cld-like protein are Geobacillus thermodenitrificans and members of the

Halobacteriaceae (Liebensteiner et al., 2014). Marangon et al. (2012) demonstrated that under anoxic conditions, the halophilic Marinobacter hydrocarbonoclasticus can reduce chlorate using their Nar-type reductase. The use of per(chlorate) to control reservoir souring is feasible because its reduction is coupled to the oxidation of acetate and other degradable oil organics (Carlström et al., 2013; Engelbrektson et al., 2014; Carlson et al., 2014; Gregoire et al., 2014; Liebensteiner et al., 2014). Inhibition of sulfate reduction by microbial per(chlorate) reduction can occur by three mechanisms (i) biocompetitive exclusion since reduction of (per)chlorate is energetically more

' − − − − favourable (Eo = +797 mV and +792 mV for the couple of ClO4 /Cl and ClO3 /Cl , respectively) than sulfate reduction (Engelbrektson et al., 2014), (ii) oxidation of hydrogen sulfide by PRB yielding elemental sulfur (Coates and Achenbach 2004; Gregoire et al., 2014; Mehta-Kolte et al.,

2017), and (iii) the direct inhibition of the central sulfate respiration pathway through the inhibition 25

of the ATP sulfurylase enzyme (Carlson et al., 2014). Perchlorate reduction at high temperature has only been demonstrated in Archaeoglobus fulgidus, a hyperthermophilic sulfate reducer.

2.8.4 Other inhibitors of the sulfate reduction pathway

Enzymes play an important role in electron transport processes. The ability of an enzyme to carry electrons can be altered by modifying the properties of the cofactors in the enzymes that mediate the electron transfer. Chelating compounds or antioxidants can be used for modifying these enzyme cofactors. Sulfate reduction is a two-step process (activation of sulfate and its subsequent reduction) that requires 3 enzymes; ATP sulfurylase, adenosine phosphosulfate reductase (APSr) and the dissimilatory sulfite reductase (Dsr). Recently dos Santos et al. (2014) identified three complexing agents: 2-[2-[bis(carboxymethyl)amino]ethyl- carboxymethyl)amino]acetic acid (EDTA), 2-[2 bis(carboxymethyl)amino]ethyl-(2- hydroxymethyl)amino]acetic acid (DETAROL), and 2-[2-(1,2- dicarboxyethylamino)ethylamino]butanedioic acid (EDDS) which binds specifically to the APSr, causing a selective inhibition of sulfate reduction by SRM. These selective inhibitors can be used to inhibit mSRM in injection water and can be combined with other souring control strategies to effectively mitigate souring.

Preface

The work presented in chapter 3 focuses on the isolation and characterization of thermophiles from a low temperature oil field and their temperature dependence. Part of this work has been published and my contributions were as follows; I first demonstrated that the MHGC harboured active thermophilic sulfate- and nitrate- reducing bacteria. I isolated a Desulfotomaculum sp from this oil field. Part of the data presented in this chapter has been published in “Fida, T.T, Chen, C., Okpala,

G., and Voordouw, G. 2016. Implications of limited thermophilicity of nitrite reduction for control of sulfide production in oil reservoirs. Applied and Environmental Microbiology 82, 4190-4199”.

I contributed 30% to the experimental data published in this paper and I contributed to the manuscript preparation and submission.

Chapter Three: Isolation of thermophilic sulfate and nitrate reducing bacteria from a low temperature oilfield

3.1 Abstract

Thermophilic sulfate- and nitrate- reducing bacteria were successfully enriched from a low temperature oilfield with an in-situ temperature of 26°C by using concentrated inocula. The tSRB enrichments were dominated by the sulfate reducers Thermodesulfobacterium, Desulfomicrobium,

Desulfotomaculum, Thermodesulfovibrio, Desulfocurvus and Coprothermobacter and the thiosulfate reducers Coprothermobacter and Anaerobaculum. The temperature dependence of nitrate reduction indicated that nitrate reduction to nitrite by tNRB was more thermophilic than the subsequent reduction of nitrite. Concentrated microbial consortia from oil fields reduced both nitrate and nitrite at 40 and 45°C, but only nitrate at and above 50°C. The upper temperature limit of nitrate reduction was 70°C. Thauera and Pseudomonas were the dominant mesophilic nitrate- reducing bacteria (mNRB), whereas Petrobacter and Geobacillus were the dominant thermophilic

NRB (tNRB) in these consortia. The mNRB Thauera sp. TK001, isolated in this study, reduced nitrate and nitrite at 40 and 45°C, but not at 50°C, whereas tNRB Petrobacter sp. TK002 and

Geobacillus sp. TK003 reduced nitrate to nitrite but did not reduce nitrite further from 50 to 70°C.

3.1 Introduction

The isolation and enrichment of thermophilic SRB from permanently cold environments such as permafrosts or arctic sediments has been described (Hubert et al., 2009; Isaksen et al.,

1994). Although these microbes may be present in significant numbers in these cold environments, they are unlikely to be active at in-situ temperatures of 0 to 10°C (de Rezende et al., 2013; Aullo et al., 2013; Robador et al., 2016). SRB pure isolates or consortia typically have optimum temperatures for growth that are above in-situ temperatures (Knoblauch et al., 1999; Isaksen et al.,

1994; Sawicka et al., 2012). For instance, psychrophilic SRB can grow over a range of temperatures which include the range of in-situ environmental temperatures, but the growth optimum is always above in-situ temperatures (Figure 3-1; Knoblach et al., 1999).

High temperature oil reservoirs that experience sea water flooding harbour microbes that grow over a range of temperatures in mesophilic (30-45°C) and thermophilic (45-85°C) zones

(Figure 2-1). In reservoirs with temperatures above 85°C, like the Terra Nova oilfield, an abiotic zone is also present (Figure 2-1: Fida et al., 2016), but life typically fluorishes in the mesophilic and thermophilic zone of the near injection wellbore region (Figure 2-1: NIWR). Souring in this type of system is inevitable because of the high sulfate concentration in seawater and the conducive environment for growth and proliferation of sulfate-reducing microorganisms (SRM). Hence remedial actions must be taken to mitigate negative impacts of souring such as corrosion and H2S toxicity (Vance and Thrasher, 2005; Hubert at al., 2005, Tang et al., 2009). Nitrate injection is commonly used to limit the growth of SRM, by stimulating the growth of mNRB and tNRB. The main mechanism for souring control is the reduction of nitrate by NRB to nitrite, a strong inhibitor of dissimilatory sulfite reductase (Dsr), 29

0.30

Topt

0.25

) 600 0.20

0.15 Growth (OD Growth

0.10

0.05

0.00 -5 0 5 10 15 20 25 30 35 40 45 Temperature (°C)

the enzyme that produces the sulfide (Greene et al., 2003; Haveman et al., 2004; Gieg et al., 2011).

However, many NRB are complete denitrifiers, which reduce nitrite further to N2 or to ammonium via dissimilatory nitrate reduction to ammonium (DNRA) (Dong et al., 2011; Eveline et al., 2015).

Thus, SRB inhibition with nitrite is often only transient.

In low temperature oilfields, such as the Medicine Hat Glauconitic C (MHGC) field with a uniform temperature of 26°C, the microbial community present will be predominantly mesophilic (Voordouw et al., 2009; Agrawal et al., 2010, Voordouw, 2011). The MHGC field is a shallow (850 m below the surface) oilfield, near Medicine Hat, Alberta from which heavy oil with an American Petroleum Institute (API) gravity of 16° is produced by water injection. Produced water re-injection (PWRI) is used for oil recovery in this field. Make-up water is needed in this strategy to replace the volume of produced oil. At the MHGC field, the effluent of a sewage treatment plant (22SW) is amended with hydrolyzed polyacrylamide and nitrate and injected in area IV. Produced water from this polymer pilot is transferred as make-up water to 1WP, the water plant of area I (Figure 3-2). Producing well 18PW from area I was used as source of samples for this study. The oil in the produced water-oil mixture is separated by treatment with demulsifier at

80°C and transferred to storage tanks. Long term monitoring of the microbial community present in a section of the field designated area I (Figure 3-2; Table S3-1) for 68 weeks indicated that the microbial community present in produced waters from this field is dominated by mesophilic microbes. Small fractions of thermophiles (Table S3-1: entries 20, 39 and 43) were identified, based on the presence of “thermo” in the phylogenetic description. On the basis of these observations, we sought to find out if tSRB and tNRB are present in the MHGC field.

Nitrate

4PW, 5PW, 9PW, 1WP 14IW (I) 13PW, 18PW

22SW PP 24IW, 26IW 25PW, 29PW, 30PW (IV)

HPAM Nitrate

Figure 3.2: Schematic of the MHGC field indicating source water (SW), as well as injection (IW) and production wells (PW), as explained in the text.

3.2 Material and methods

3.2.1 Study site and sample collection

Samples of produced water (18PW) from the MHGC oil field near Medicine Hat, Alberta,

Canada were collected in sterile 1 L Nalgene bottles filled to the brim to exclude air during transportation. Following arrival at the University of Calgary within half a day from collection, samples were immediately transferred to a Coy anaerobic hood with an atmosphere of 90% N2 and

10% CO2 (N2-CO2).

3.2.2 Incubation of concentrated cell suspensions with nitrate and oil organics

Coleville synthetic brine medium K (CSBK see section 5.3.1) with 10 mM nitrate and 3 mM VFA (3 mM each of acetate, propionate and butyrate) and an N2-CO2 headspace was used.

For cultivation of tNRB, 2014_18PW samples (20 ml) were concentrated 20-fold by centrifugation at 15,000 x g for 20 min in an Avanti JE centrifuge (Beckman Coulter). The pellets were then suspended in 1 ml of the supernatant, whereas the remaining supernatant was filtered through an 0.2 μm Nylon membrane filters (PALL Life Science, NY). The nylon filters were then added to the suspended pellets. The combined cell suspensions were added to 60 ml serum bottles closed with butyl rubber stoppers containing 19 ml of CSBK with nitrate and 3 mM VFA (3 mM each of acetate, propionate and butyrate). Duplicate samples were incubated in the dark at 40, 45,

50, 55, 60, 65, 70 and 75°C without shaking. Sterile controls without inoculation were identically treated and incubated at 40 or 70°C.

To determine tSRB activity of the water samples, 50-fold concentrated inocula from 18PW collected in August 2014 (2014_18PW) were injected into 25 mL of CSBK medium, which was 33

supplemented with 20 mM lactate and 10 mM sulfate and incubated at 60°C. A second enrichment was done with a 50-fold concentrated inoculum of 18PW collected in September, 2016

(2016_18PW) using CSBK medium, which was supplemented with 5 mM sulfate and 10 mM lactate or propionate. The concentrations of nitrate and nitrite were determined with high- performance liquid chromatography (HPLC), using a Waters 1515 HPLC instrument equipped with a Waters 2489 UV/visible detector and a IC-PAK Anion HC, 4.6- by 150-mm column

(Waters, Japan) and eluted with a sodium borate-gluconate (2%) buffer containing 12% acetonitrile and 2% butanol. Sulfate was measured with the same column using a Waters 432 conductivity detector at a flowrate of 2 ml/min. Samples for anion assays were prepared by centrifugation at 14,000 rpm for 5 min, after which 100 µl of supernatant was added to 400 µl of the prepared buffer solution in a vial. Volatile fatty acid (VFA) concentrations of field samples were analyzed with a Waters 2487 UV detector at 210 nm, with a Prevail organic acid (OA) 5u column (250 x 4.6 mm, Alltech, Guelph, ON) at a flow rate of 1.0 ml/min. Field samples (1 ml) were centrifuged and 300 µl of the supernatant was acidified in a vial with 20 µl of 1 M H3PO4 before elution with 25 mM KH2PO4 (pH 2.5).

Serial dilutions of 18PW in CSBK medium with VFA and nitrate were done to determine the most probable numbers (MPNs) of mNRB and of tNRB at 40°C and at 60°C, respectively.

3.2.4 Microbial community analysis of 18PW and of derived enrichments

DNA was extracted at the end of the incubation period. Aliquots of 500 μl of the enrichment culture were taken and centrifuged at 17,000 x g for 5 min to pellet the cells. DNA was isolated using the FastDNA Extraction Kit for Soil (MP Biomedicals), according to the manufacturer’s 34

instructions. Centrifuged samples not subjected to incubation were also analyzed. DNA was quantified with a Qubit fluorimeter (Invitrogen) using the Quant-iT dsDNA HS Assay Kit

(Invitrogen).

DNA from enrichments of 2014_18PW was processed with PCR amplification and pyrosequencing, whereas DNA from enrichments of 2016_18PW was processed with PCR amplification and Illumina sequencing. PCR amplification of 16S rRNA genes using a two-step process. The PCR reaction was carried out in duplicate with each replicate containing a 20 µl reaction volume. The amplified PCR products were pooled and cleaned using the QIAquick PCR purification kit (Qiagen) and analyzed on a 1.5% agarose gel. For the first round of PCR, non- barcoded primers (926Fi5 TCGTCGGCAGCGTCAGATGTGTATA

AGAGACAGAAACTYAAKGAATWGRCGG and 1392Ri7

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACGGGCGGTGWGTRC) were used for 25 cycles, while the barcoded primers P5-S50X-OHAF with a 29-nt 5’ sequencing adaptor

(P5, AATGATACGGCGACCACCGAGATCTACAC) and an 8-nt identifying index S50x and a

14-nt forward overhang adaptor (OHAF, TCGTCGGC AGCGTC), and reverse primer (P7-

N7XXOHAF) with a 24-nt 3’ Illumina sequencing adaptor (P7,

CAAGCAGAAGACGGCATACGAGAT), an 8-nt identifying index N7XX and a 14-nt reverse overhang adaptor (OHAF, GTCTCGTGGGCTCGG), were used in the second round PCR for 10 cycles.

For pyrosequencing, the second round PCR for 10 cycles was done using FLX titanium primers 454T_RA_X and 454T_FwB, as described in An et al. (2013). Purified 16S amplicons (20 ng each) were sequenced at the Genome Quebec and McGill University Innovation Centre, 35

Montreal, Quebec with a Genome Sequencer FLX Instrument, using a GS FLX Titanium Series

Kit XLR70 (Roche Diagnostics Corporation).

First PCR cycling conditions were 95 °C for 5 min, followed by 25 cycles of 95 °C for

45 s, 55 °C for 2 min, 72 °C for 4 min. The final incubation at 72 °C was for 10 min. The cycling conditions for the 2nd PCR reaction were of 95 °C for 3 min, followed by 10 cycles of 95 °C for

45 s, 55 °C for 2 min, 72 °C for 4 min and a final incubation at 72 °C for 10 min. The PCR products were purified and quantified for Illumina sequencing at the University of Calgary

3.2.5 Isolation and identification of tSRB and NRB strains

NRB enrichments obtained at 40 to 70°C were plated on CSBK medium with 3 mM VFA and 10 mM nitrate, solidified with 15 g/l of agar. The plates were incubated at the same temperature as used for the enrichment in jars flushed with N2-CO2. For tSRB isolation, Postgate

E agar medium with sulfate and lactate and propionate was used and incubation was done at 60°C.

Individual colonies were picked and grown in CSBK medium with 10 mM nitrate and 3 mM VFA for NRB or CBSK medium with sulfate and lactate or propionate for tSRB. The isolates were phylogenetically identified by Sanger sequencing of 1500 bp 16S rRNA gene amplicons obtained with primers 27F and 1525R at the Core DNA Services Laboratory of the University of Calgary.

Temperature dependence of selected mNRB and tNRB isolates was determined by incubating at

20, 30, 40, 45, 50, 55, 60, 65, 70 and 75°C in duplicate. Samples (1 ml) were periodically withdrawn to monitor growth as optical density at 600 nm (OD600). The concentrations of nitrate and nitrite were quantified in the supernatants obtained by centrifugation at 17,000 x g for 5 min.

3.3 Results

3.3.1 Activity of tSRB in water samples from the MHGC field

Water chemistry analyses of 18PW samples indicated that these had a pH of 7.8, a low concentration of sulfide (0.05 mM), ammonium (0.5 mM) and a salinity of 0.1 Meq of NaCl.

Sulfate, nitrate and nitrite were not detected. Using concentrated inocula tSRB activity was observed in enrichments at 60°C from 6 to 12 days of incubation for the 2014_18PW sample

(Figure 3-3). For the 2016_18PW sample, tSRB activity was observed from 4 to 20 days of incubation with both lactate and propionate as electron donor (results not shown).

3.3.2 Temperature dependence of reduction of nitrate and nitrite by MHGC microbial consortia

NRB activity was detected in medium with 20-fold concentrated inocula (Figure 3-4).

Complete reduction of 10 mM nitrate was observed within 24 and 48 h with transient formation of nitrite at 40 and 45°C respectively (Figure 3-4). At 50-65°C, nitrate was reduced to nitrite within

200 h of incubation. But at 70°C partial reduction of 7.5 mM nitrate to nitrite was observed, whereas no activity was observed at 75°C (Figure 3.4). Nitrite was not reduced further, even with extended incubation times up to 720 h. Use of either 1 or 5 mM nitrate gave the same results, indicating that the lack of nitrite reduction was not caused by nitrite toxicity (results not shown).

These data indicate that the 18PW NRB consortia had temperature limits of 70°C for reduction of nitrate to nitrite and of 50°C for subsequent reduction of nitrite. MPNs of 18PW for mNRB at

40°C and for tNRB at 60°C were 5x105 ml-1 and 45 ml-1, respectively. Hence only 1 in 10,000

NRB was a tNRB.

3.3.3 Microbial community composition of tSRB enriched from 18PW MHCG field sample obtained in 2014 and 2016

Pyrosequencing of PCR-amplified 16S rRNA genes of an enrichment with 18PW sample collected in 2014 in CSBK with 10 mM sulfate and 20 mM lactate showed that the dominant tSRB were Thermodesulfobacterium (2%) and Desulfomicrobium (13%) (Table 3.1). Some

Desulfomicrobium species are thermophilic (Thevenieau et al., 2007). Sequences affiliated to thiosulfate reducers such as Anaerobaculum and Caldanaerobacter were in low fractions of 0.1%.

About 53% of the total reads belonged to the thermophilic hydrogenotrophic methanogen

Methanothermobacter. Overall, 99.6% of sequences from this enrichment were composed of thermophiles.

In contrast to the 2014 tSRB enrichment, microbial community present in the tSRB consortia enriched from the 2016_18PW sample grown on media with either lactate or propionate, had Desulfotomaculum as the dominant sulfate reducers (Table 3-2: 25 and 6% respectively). Also present were sequences affiliated to Thermodesulfovibrio (0.5%) and and Desulfocurvus (0.6%).

Another group of sulfidogenic thermophiles present in these enrichments are known thiosulfate- reducers, which made up 41 and 53% of the lactate and propionate containing cultures respectively, these included Coprothermobacter, Anaerobaculum, and Defluviitoga (Table 3.2). The thermophilic methanogenic archaeon, Methanothermobacter together with sequences affiliated to hydrogen-producing thermophilic fermenters such as Gelria, Fervidobacterium and Thermosipho were also detected.

2014_18PW tSRB Sequence ID V41_1996 # of QC reads 3305 # OTUs 110 # Taxa 50 Shannon Index 1.36 #taxonomic term Percentage Archaea;Euryarchaeota;Methanobacteria;Methanobacteriales;Methanobacteriaceae; Methanothermobacter 52.7 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Thermotoga 28.5 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfovibrionales;Desulfomicrobiaceae; Desulfomicrobium 12.8 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Fervidobacterium 3.2 Bacteria;Thermodesulfobacteria;Thermodesulfobacteria;Thermodesulfobacteriales; Thermodesulfobacteriaceae; Thermodesulfobacterium 2.0 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanomicrobiaceae; Methanculleus 0.2 Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Thermoanaerobacteraceae; Caldanaerobacter 0.1 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfovibrionales 0.1 Bacteria;Thermodesulfobacteria;Thermodesulfobacteria;Thermodesulfobacteriales; Thermodesulfobacteriaceae 0.1 Bacteria;Synergistetes;Synergistia;Synergistales;Synergistaceae;Anaerobaculum 0.1 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae 0.1

Sequence ID V64_4106 V64_4107 # QC reads 48248 43586 # OTUs 61 62 # Taxa 56 61 Shannon Index 2.0 2.3 #Taxonomy Lactate Propionate Bacteria; 18.9 26.6 Firmicutes;Clostridia;Thermoanaerobacterales;Thermodesulfobiaceae;Coprothermobacter; Bacteria;Synergistetes;Synergistia;Synergistales;Synergistaceae;Anaerobaculum; 20.6 22.2 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae;Desulfotomaculum; 24.9 6.3 Archaea;Euryarchaeota;Methanobacteria;Methanobacteriales;Methanobacteriaceae; 16.1 9.6 Methanothermobacter; Bacteria;Firmicutes;Clostridia;Clostridiales;NATTA-B61; 5.1 7.9 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Pseudothermotoga; 4.5 6.1 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Defluviitoga; 1.8 3.9 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Fervidobacterium; 2.9 2.0 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae; 0.6 3.3 Pseudomonas; Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Thermoanaerobacteraceae;Gelria; 0.0 3.6 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Alcaligenaceae;Bordetella; 0.8 1.2 Bacteria;Aminicenantes; 0.5 1.0 Bacteria;Proteobacteria;Betaproteobacteria;Rhodocyclales;Rhodocyclaceae;Thauera; 0.0 1.4 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae; 0.5 0.6 Caenispirillum; Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Thermoanaerobacteraceae; 0.4 0.6 Thermanaeromonas; Bacteria;Synergistetes;Synergistia;Synergistales;Synergistaceae; 0.1 0.9 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Thermosipho; 0.9 0.0 Bacteria;Chloroflexi;Anaerolineae;Anaerolineales;Anaerolineaceae; 0.2 0.6 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfovibrionales;Desulfovibrionaceae; 0.1 0.6 Desulfocurvus; Bacteria;Nitrospirae;Nitrospira;Nitrospirales;Nitrospiraceae;Thermodesulfovibrio; 0.0 0.5 Bacteria;Spirochaetae;Spirochaetes;Spirochaetales;Spirochaetaceae;Spirochaeta; 0.5 0.0 Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;NA-IV;Mahella; 0.0 0.4 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Comamonadaceae; 0.0 0.3 Aquabacterium; Bacteria;Atribacteria; 0.1 0.2 Bacteria;Elusimicrobia;Elusimicrobia;NA12-31; 0.2 0.1 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae; 0.2 0.0 CandidatusRiegeria; Bacteria;Proteobacteria;Gammaproteobacteria;Alteromonadales;Shewanellaceae; 0.0 0.2 Shewanella; Total 100 100

3.3.4 Nitrate reducing community composition as a function of temperature.

Microbial community analysis indicated that mesophilic enrichments at 40 and 45°C of

18PW were dominated by Proteobacteria, whereas thermophilic enrichments at 50-70°C were dominated by Firmicutes. The dominant mesophilic genera were Thauera and Pseudomonas, whereas the dominant thermophilic genera were Geobacillus and Petrobacter (Table 3.3). The latter was prominent only at 50°C, whereas Geobacillus was strongly represented at all temperatures from 50 to 70°C (Table 3-3). In addition to Geobacillus, Anoxybacillus (Table 3-3:

60°C only) and Pseudomonas appeared as significant community members under thermophilic conditions. Proteobacteria (Pseudomonas) and Euryarchaeota (Methanoculleus, Methanolinea and Methanosaeta) dominated the 18PW community not subjected to incubation.

3.3.5 Identification of isolated tSRB and NRB strains.

The tSRB enrichments of 2016_18PW (Table 3-2) plated on Postgate E agar supplemented with lactate and sulfate and incubated at 60°C, yielded six isolates. These could grow and reduce sulfate at 60°C in CSBK medium with lactate and sulfate. Four of the isolates (GN18: A1, A2,

B1, and C1) were identified based on 16S rRNA gene analysis and had 99% sequence identity to

Desulfotomaculum thermocisternum strain DSM 10259, while isolate GN18B2 had 97% identity to Coprothermobacter PM9-2.

Plating of NRB enrichments obtained at 40 to 70°C yielded three different bacterial isolates able to grow and reduce nitrate with VFA at the temperatures of incubation. 16S rRNA gene sequence analysis indicated that isolates TK001 (40°C), TK002 (55°C) and TK003 (70°C) had

99% sequence identity to Thauera aminoaromatica S2 (Mechichi et al., 2002), 99% to Petrobacter 43

succinatimandens 4BONT (Salinas et al., 2004) and 99% to Geobacillus kaustophilus HTA426

(Takami et al., 2004; Feng et al., 2007), respectively.

3.3.6 Physiological properties of NRB strains

The temperature dependence of each isolated NRB strain was further studied. Thauera sp.

TK001 grew and reduced nitrate from 20 to 45°C (Fida et al., 2016). The optimum growth temperature for this strain was near 30°C. It did not grow or reduce nitrate at or above 50°C. Nitrite did not accumulate at any growth temperature. Petrobacter sp. TK002 grew and reduced nitrate to nitrite from 50 to 60°C, the optimum growth temperature being 55°C (Fida et al., 2016). Growth and nitrate reduction were not observed below 50°C or above 60°C. The accumulated nitrite was not reduced further. Geobacillus sp. TK003 grew and reduced nitrate to nitrite within a wider range of temperatures from 45 to 70°C with the optimum growth temperature near 60°C (Fida et al.,

2016). Similar to Petrobacter sp. TK002, the accumulated nitrite was not reduced further. Hence, based on the optimum growth temperature exhibited by each of these isolates, Thauera sp. TK001 was categorized as a mNRB, whereas Petrobacter sp. TK002 and Geobacillus sp. TK003 were tNRB, with Petrobacter sp. TK002 being a moderate tNRB. The temperature profiles for nitrate reduction of the isolated mNRB and tNRB supported the earlier observations made for 18PW enrichments. The isolated mNRB and tNRB were able to reduce nitrite at temperatures at or below

45°C, but not at temperatures at or above 50°C (Figure 3.2).

Incubation temperature 18PW 40oC 45oC 50oC 55oC 60oC 65oC 70oC Number of QC reads 8942 9374 9852 11657 19878 13016 1888 10941 Average Taxon (Kingdom; Phylum; Class; Order; Family; Genus) % % % % % % % % % Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae;Geobacillus 0.16 0 0 54.65 88.96 86.61 89.35 74.17 49.24 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae;Pseudomonas 17.68 67.16 53.88 3.64 7.71 3.77 7.79 18.05 22.46 Bacteria;Proteobacteria;Betaproteobacteria;Rhodocyclales;Rhodocyclaceae;Thauera 0.17 10.71 40.14 0.05 0.01 0.02 0.11 0.03 6.41 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanomicrobiaceae;Methanoculleus 40.01 0.18 0.39 0.58 0.52 0.51 0.21 0.99 5.42 Bacteria;Proteobacteria;Betaproteobacteria;Hydrogenophilales;Hydrogenophilaceae;Petrobacter 0 0 0 38.66 0 0 0 0.02 4.84 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanolinea 9.41 0.04 0.02 0.12 0.1 0.06 0.05 0.22 1.25 Archaea;Euryarchaeota;Methanomicrobia;Methanosarcinales;Methanosaetaceae;Methanosaeta 9.86 0.01 0 0.13 0 0 0 0.01 1.25 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Citrobacter 1.14 0.13 0.13 0.39 1.42 0.73 1.48 4.52 1.24 Bacteria;Firmicutes;Mollicutes;Acholeplasmatales;Acholeplasmataceae;Acholeplasma 0.01 8.79 0 0 0.01 0 0 0 1.10 Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae;Anoxybacillus 0 0 0 0 0 7.23 0 0 0.90 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanocalculus 4.21 0.21 0 0.05 0.06 0.06 0 0.06 0.58 Bacteria;Spirochaetes;Spirochaetes;Spirochaetales;Spirochaetaceae;Spirochaeta 0.07 3.99 0 0 0 0 0 0 0.51 Bacteria 1.31 0.08 0.04 0.27 0.51 0.32 0.32 0.67 0.44 Archaea;Euryarchaeota;Methanobacteria;Methanobacteriales;Methanobacteriaceae;Methanobacterium 1.19 1.59 0.03 0.03 0.01 0.01 0 0.02 0.36 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Novispirillum 0.55 1.27 0 0.01 0.01 0.01 0 0.07 0.24 Bacteria;Proteobacteria;Betaproteobacteria 0.01 0.41 1.44 0.01 0 0 0 0 0.23 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Candidatus_Methanoregula 1.75 0 0 0 0.01 0.03 0 0.06 0.23 Bacteria;Proteobacteria;Epsilonproteobacteria;Campylobacterales;Campylobacteraceae;Arcobacter 1.05 0.76 0 0.01 0.02 0 0 0 0.23 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae 0.16 0.41 0.95 0.1 0.03 0.01 0 0.07 0.22 Bacteria;Firmicutes;Clostridia;Clostridiales;Family_XI_Incertae_Sedis 0 0.15 1.1 0 0 0 0 0 0.16 Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae 0 0 0.06 0.64 0.1 0.34 0 0.06 0.15 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales 1.17 0 0 0 0 0 0 0 0.15

3.4 Discussion

The main outcome of this study was the isolation of thermophilic sulfate- and nitrate- reducing bacteria from the low temperature (26°C) MHGC oilfield. Using concentrated inocula

(as described also in Chapter 4) for the enrichment of thermophiles from a high temperature oilfield, was key for this success. The tSRB community enriched from the 2014_18PW sample was different from that of the 2016_18PW sample. Members of the genus Desulfomicrobium and

Thermodesulfobacterium, constituted the major SRB in the 2014_18PW enrichment. Most of the

Desulfomicrobium spp are mesophilic with D. thermophilium as the only described thermophilic species. D. thermophilum, originally isolated from a terrestrial hot spring (Thevenieau et al., 2007), has also been detected from low temperature and moderately high temperature

oilfields (Nazina et al., 2017; Nazina et al., 2013; Pavlova-Kostryukova et al., 2014). D. thermophilum an incomplete oxidizer unable to utilize acetate, propionate and butyrate in the absence of sulfate, has a growth range of 37 – 60 °C, and a Topt of 55 °C (Thevenieau et al., 2007).

The tSRB enriched from the 2016_18PW sample included mainly Desulfotomaculum,

Thermodesulfovibro and Desulfocurvus. Isolation of tSRB such as Desulfotomaculum from environments with a temperature below the minimum temperature required for growth has been reported (de Rezende et al., 2016; Hubert et al., 2009; Isaksen et al., 1994).

A striking observation in the 2016_18PW tSRB enrichment was the high proportion of potential thiosulfate reducers or fermenters, most of which can grow over a wide range of temperatures (28-65°C) (Maune and Tanner 2012; Menes and Muxi, 2002; Hania et al., 2012;

Etchebehere et al., 1998; Rees et al., 1997). This included Thermovirga (Gittel et al, 2009; Dahle and Birkeland, 2000), Gelria (Mcllroy et al., 2015; Wajdi et al., 2013), Anaerobaculum (Liang et al., 2014), Defluviitoga (Wajdi et al., 2012) and Caldanaerobacter (Fardeau et al., 2004). 48

Thiosulfate can be formed by chemical oxidation of H2S with O2 (Liang et al 2014; Cline and

Richards, 1969), by biological oxidation of sulfide (Jørgensen and Bak, 1990) or by reduction of sulfite/bisulfite (Fitz and Cypionka, 1990). Although thiosulfate concentrations were not determined in this study, its reduction may contribute to overall sulfide production, as has been reported elsewhere (Liang et al., 2014; Jørgensen, 1990). In this study, the enrichment of

Coprothermobacter sp and its subsequent isolation suggests that it is involved in sulfate reduction.

Members of the genus Coprothermobacter are commonly reported as thiosulfate reducers

(Tandishabo et al., 2012a; Etchebehere and Muxì, 2000), but their ability to reduce sulfate has also been reported (Galigano et al., 2015; Sarti et al., 2010).

The hydrogenotrophic methanogen Methanothermobacter formed a significant proportion of the microbial community of all enrichments (Table 3-1 and 3-2). This taxon is known to form syntrophic associations with thermophilic fermenters, where they scavenge hydrogen (Ho, 2014;

Sasaki et al, 2012; Gagliano et al., 2015; Guo et al., 2014) which could account for their occurrence in the tSRB enrichments.

Another observation from this study is that the reduction of nitrate to nitrite appears to have a higher temperature maximum (70°C) than the subsequent reduction of nitrite to N2 (50°C). This leads to accumulation of nitrite in the medium at 50 to 70°C. This is described in more detail in

Chapter 4. Similarly, Reinsel et al. (1996) demonstrated that tNRB consortia from a high temperature Alaskan oil field reduced nitrate to nitrite at 60°C, but did not reduce nitrite further.

This allowed control of tSRB-mediated H2S production by injection of low concentrations of nitrate in a bioreactor at 60°C. However, in the literature, tNRB pure cultures, capable of complete denitrification at high temperature, have been described (Feng et al., 2007; Molha et al., 2007).

Petrobacter succinatimandens 4BONT, which was recently renamed Tepidiphilus succinatimandens comb. nov (Poddar et al., 2014), is a moderate thermophile (55°C) isolated from

T a petroleum reservoir (Salinas et al., 2004). Strain 4BON reduced nitrate to nitrite and N2O using succinate as the electron donor. However, Tepidiphilus thermophilus reduced nitrate only to nitrite

(Poddar et al., 2014).

Since thermophiles were successfully enriched from the MHGC field, it is important to trace their sources. Higher numbers of tNRB as judged by MPNs were found in 18PW produced water than in 14IW injection water (Fida et al., 2016). The produced oil-water mixture is separated in a high temperature (65-75°C) oil-water separator, not indicated in Figure 3-2. If this was a primary source of thermophiles, then higher numbers of tNRB would be expected in 14IW than in

18PW. Thus, the observation of higher numbers of tNRB in 18PW indicates that the tNRB in

18PW may be derived from deeper hotter subsurface layers connected to the low temperature

MHGC reservoir, which is at 780 m below the surface.

A small fraction of the taxon Geobacillus was detected in the community composition of

18PW prior to enrichment (Table 3-3: 0.16%). Thermophiles can survive in low temperature conditions, as shown for cold environments (Hubert et al., 2009; Jones et al., 2003; Ren et al.,

2011). This has led to the suggestion that thermophiles in offshore oil fields may have originated from the low concentrations present in seawater injected to promote oil recovery (Stetter et al.,

1993; Dahle et al 2008; Basso et al, 2005; Magot et al 2000) and, conversely, that low numbers of thermophiles in cold marine sediments may have originated from seeps from hot oil fields or hydrothermal vents where they are part of the indigenous and active microbial community (Hubert et al., 2009, Magot et al 2000; Gittel et al., 2009; L’Haridon et al., 1995; Nesbø et al., 2015).

In conclusion, we have demonstrated the presence of tSRB and tNRB in the MHGC field through the use of a concentrated inocula. The results from this study showed that in the reservoir itself, these tNRB may be active when nitrate is injected at the in situ temperature of the field, since some had a wide temperature range for growth and activity. However, because their growth rate is slower at the in situ temperature than that of Thauera, a common mNRB in the field, they will be outcompeted. Hence, they will not be important nitrate reducers in the MHGC field, unless temperatures are increased above 50°C.

Likewise, the tSRB enriched at 60°C cannot grow in the reservoir at the in situ reservoir temperature and will thus not contribute to sulfide production in this field. They are likely to grow in the oil water separation unit, which typically has a temperature of 65-75°C. Growth of the identified taxa as tSRB is not expected because the produced water from production wells in Area

I (Figure 3-2) had no sulfate.

Preface

The work presented in chapter 4 focuses on the isolation and characterization of thermophiles from a high temperature oil field, temperature dependence of nitrate and sulfate reduction and the effect of nitrate and nitrite on thermophilic sulfate reduction. This work has been published in “Okpala,

G.N., Chuan, C., Fida, T., and Voordouw, G. 2017. Effect of thermophilic nitrate reduction on sulfide production in high temperature oil reservoir samples. Frontiers in

Microbiology 8, 1573”.

Chapter Four: Effect of thermophilic nitrate-reduction on sulfide production in samples from the high temperature Terra Nova reservoir

4.1 Abstract

Oil fields can experience souring, the reduction of sulfate to sulfide by sulfate-reducing microorganisms. At the Terra Nova oil field near Canada’s east coast, with a reservoir temperature of 95°C, souring was indicated by increased hydrogen sulfide in produced waters. Microbial community analysis by 16S rRNA gene sequencing showed the hyperthermophilic sulfate- reducing archaeon Archaeoglobus in Terra Nova produced waters. Growth enrichments in sulfate- containing media at 55-70°C with lactate or volatile fatty acids yielded the thermophilic sulfate- reducing bacterium (SRB) Desulfotomaculum. Enrichments at 30-45°C in nitrate-containing media indicated the presence of mesophilic nitrate-reducing bacteria (NRB), which reduce nitrate without accumulation of nitrite, likely to N2. Thermophilic NRB of the genera Marinobacter and

Geobacillus were detected and isolated at 30-50°C and 40-65°C, respectively, and only reduced nitrate to nitrite. Added nitrite strongly inhibited the isolated thermophilic SRB and thermophilic

NRB and SRB could not be maintained in co-culture. Inhibition of thermophilic SRB by nitrate in batch and continuous cultures required inoculation with thermophilic NRB. The results suggest

° that nitrate injected into Terra Nova is reduced to N2 at temperatures up to 45 C but to nitrite only in zones from 45 to 65°C. Since the hotter zones of the reservoir (65-80°C) are inhabited by thermophilic and hyperthermophilic sulfate reducers, souring at these temperatures might be prevented by nitrite production if nitrate-reducing zones of the system could be maintained at 45-

65°C.

4.2 Introduction

Oil reservoir souring, the reduction of sulfate to sulfide by sulfate-reducing microorganisms

(SRM), and its control with nitrate has been studied extensively in shallow, low temperature reservoirs, which support the growth of mesophilic microbes throughout (Voordouw et al., 2009).

Injection of water with 1 mM sulfate, amended with 2 mM nitrate, caused the emergence of sequential zones of nitrate-reduction, sulfate-reduction and methanogenesis along the water flow path. Although microbial communities in produced waters were dominated by methanogens, SRB and NRB were present and were readily activated when samples were grown under nitrate- or sulfate-reducing conditions. All three of these activities were, therefore, easily established in bioreactors or microcosms containing nitrate, sulfate and excess volatile fatty acids irrespective whether the inoculum was a field sample or a derived enrichment (Lambo et al., 2008; Voordouw et al., 2009; Callbeck et al., 2011; Chen et al., 2017). In contrast studying microbial communities derived from deep, high temperature reservoirs is much more complex, because the zones of microbial activities are superimposed on a steep gradient of increasing temperature in the near injection wellbore region (NIWR).

For instance, in the Terra Nova field, located 350 km from the east coast of Newfoundland, oil is produced from a depth of 3200-3700 m below the sea floor, where the reservoir temperature is 95°C (Haugen et al., 2007). Due to the harsh operating conditions existing in this region, the oilfield is operated through a Floating Production Storage and Offloading (FPSO) vessel from where flexible manifold pipes are connected to the subsea system (Howell et al., 2001). Following its intake, cold seawater is warmed during its downward travel, reaching 30°C upon injection in the reservoir (Figure 1). This temperature further increases in the near injection wellbore region

(NIWR), in which the temperature changes from that of the injected water to that of the bulk of 54

the reservoir (Eden et al., 1993). The NIWR thus consists of a succession of mesophilic (30-45oC), thermophilic (45-80oC) and abiotic (80-95oC) zones, assuming that microbial life in the reservoir does not extend beyond 80°C (Magot 2005; Liebensteiner et al. 2014; Fida et al. 2016). Following travel through the abiotic bulk of the reservoir (95oC), the temperature of the produced water and oil mixture will cool to 70oC, when it travels upward to the FSPO, allowing renewed growth of thermophilic but not of mesophilic microorganisms. Produced oil and water are then separated in the FPSO with cleaned but still hot produced water being discharged into the ocean (Figure 1).

A variety of mesophilic and thermophilic NRB, SRM, and fermentative bacteria, as well as methanogenic Archaea have been obtained from or detected in injected seawater and produced water from high temperature reservoirs (Beeder et al., 1995; Nilsen et al., 1996a; Nilsen et al.,

1996b; Slobodkin et al., 1999; Orphan et al., 2003; Nazina et al., 2006; Gittel et al., 2009; Gittel et al., 2012; Zhang et al., 2012a; Aüllo et al., 2013; Lenchi et al., 2013; Agrawal et al., 2014).

Their positioning in the NIWR depends on the temperature dependence of their activity. However, data on this for multiple isolates from the same field are lacking. Study of the physiology of pure cultures or enrichments has indicated that thermophilic NRB (tNRB) reduce nitrate to nitrite, but do not reduce nitrite, e.g. to di-nitrogen (N2) (Fida et al., 2016). Hence, addition of nitrate to a culture of thermophilic SRB (tSRB) in which tNRB are present would strongly inhibit tSRB activity, because nitrite is such a strong and specific SRB inhibitor (Greene et al., 2003; Haveman et a., 2004). At low temperature, mesophilic NRB can persist in cultures of mesophilic SRB in the absence of nitrate by switching to fermentative metabolism. However, coculturing of thermophilic

NRB and SRB is more difficult. For example, sulfide production by two tSRM enrichments from

North Sea fields at 60°C, harbouring Thermodesulforabdus or Archaeoglobus, was not inhibited by 10 mM nitrate, indicating absence of tNRB (Kaster et al., 2007). Both of these enrichments 55

were strongly inhibited by only 0.25 mM nitrite. Likewise, Reinsel et al. (1996), demonstrated that injecting as little as 0.71 mM nitrate inhibited sulfate reduction in souring bioreactors at 60oC due to its reduction to nitrite. However, this inhibition could be lost in bioreactors, which had been injected with sulfate only for a prolonged period of time, requiring re-inoculation with tNRB.

My objectives in researching the Terra Nova system were to determine the microbial community composition, as well as the temperature dependence of reduction of nitrate to nitrite, of nitrite to nitrogen and of sulfate to sulfide for samples of injection and produced waters, of derived enrichments and of pure cultures. This may allow mapping of the location of taxa and their activities in the temperature versus distance profile of the NIWR. Further study of cocultures of thermophilic SRB and NRB was also pursued to improve understanding of souring control in systems with a temperature gradient as in the NIWR.

4.3 Materials and methods

4.3.1 Sample collection and physicochemical analysis

Samples were collected on-board the FPSO and were sent in sealed containers. Three sets of injection water (IW) and produced water (PW) samples were received from the Terra Nova oil field in January 2014, January 2015 and May 2015. The samples were either shipped in 3 L airtight metal canisters or in 1 L Nalgene bottles, with 2 or 3 L of each sample provided (Table 4.1). The sample bottles or canisters were filled to the brim and sealed tightly to exclude air. Upon arrival, the samples were stored at room temperature in an anoxic chamber with an atmosphere of 10%

CO2 and 90% N2 (N2-CO2; Praxair, Calgary, AB). An aliquot of 200 ml of each sample was centrifuged for 15 min at 11,200 x g to pellet biomass, the pellets were frozen at -20°C for use in

DNA extraction. The salinity as molar equivalent (Meq) of NaCl was determined from the 57

Table 4-1: Physicochemical analyses of injection water (IW) and produced water (PW) samples, obtained from the Terra Nova field + Water pH NaCl Sulfate Acetate Propionate NH4 chemistry (Meq) (mM) (mM) (mM) (mM) Injection water (IW) 2014-2015 IW1_14 6.74 0.48 28 0.11 0 0.11 IW1_15 6.51 0.55 27.6 0.02 0 0.34 IW5_15 6.42 0.53 19.8 0 0 0.32 Average ± SD 6.56±0.17 0.52±0.04 25.1±4.6 0.04±0.06 0 0.26±0.13 Produced Water (PW) 2014-2015 PW1_14* 6.75 0.4 16.8 2.26 0.24 1.24 PW1_15 6.97 0.69 22.14 1.85 0.08 1.4 PWC2_5_15 6.7 0.55 13.8 0.28 0.02 0.46 PWF2_5_15 6.7 0.64 8.9 1.76 0.17 1.06 Average ± SD 6.78±0.13 0.57±0.13 15.4±5.5 1.54±0.87 0.13±0.10 1.04±0.41 *The sampling date (month_year) is indicated

conductivity measured with an Orion conductivity cell (model 013005MD). Sulfide and ammonium concentrations in the water samples were determined spectrophotometrically using the methylene blue method (Cline, 1969) and the indophenol method (Cornish Shartau et al., 2010), respectively.

Nitrate and nitrite concentrations were measured by high performance liquid chromatography (HPLC), using a Waters 600E HPLC (Waters Corp, Milford, MA), which was fitted with a Waters 2489 UV/Visible detector, set at 200 nm and an IC-PAKTM anion column HC

(150 x 4.6 mm, waters) and eluted with a sodium borate-gluconate (2%) buffer containing 12% acetonitrile and 2% butanol. Sulfate was measured with the same column using a Waters 432 conductivity detector at a flowrate of 2 ml/min. Samples for anion assays were prepared by centrifugation at 14,000 rpm for 5 min, after which 100 µl of supernatant was added to 400 µl of the prepared buffer solution in a vial. Volatile fatty acid (VFA) concentrations of field samples were analyzed with a Waters 2487 UV detector at 210 nm, with a Prevail organic acid (OA) 5u column (250 x 4.6 mm, Alltech, Guelph, ON) at a flow rate of 1.0 ml/min. Field samples (1 ml) were centrifuged and 300 µl of the supernatant was acidified in a vial with 20 µl of 1 M H3PO4 before elution with 25 mM KH2PO4 (pH 2.5).

4.3.2 Microbial enumeration of SRB and acid-producing bacteria (APB)

Most probable number (MPN) determinations were done using 48-well cell culture plates

(Shen and Voordouw, 2015) for enumerating SRB and acid-producing bacteria (APB) using media containing lactate and sulfate or glucose and phenol red, respectively. Plates were incubated at

30°C or 60°C inside an anaerobic jar for 1 month. MPNs were calculated by comparing the pattern of positive wells to a probability table for MPN tests done using triplicate series of dilutions.

4.3.3 Activity of SRB and NRB

Microbial activity tests were done by inoculating 10% (v/v) of sample in modified Coleville synthetic brine (CSB) medium A with 0.5 M NaCl. CSBA medium had the following composition

(g/L of water): NaCl, 29.3; CaCl2.2H2O, 0.15; MgCl2.5H2O, 0.4; NH4Cl, 0.25; KCl, 0.5; KH2PO4,

0.2; resazurin (1%), 2-3 drops. After autoclaving, trace elements, 1 ml; selenate-tungstate, 1 ml; 1

M NaHCO3, 30 ml were added and the pH was adjusted to 7.4-7.6 using 1 M HCl (Hubert et al.,

2003). Fifty milliliter of the CSBA medium was added to 122 ml serum bottles, which were sealed with a butyl rubber stopper, crimped with an aluminum cap and flushed with N2-CO2 gas for 5 min to exclude oxygen. Sulfate, nitrate, VFA, lactate and sulfide were added to these media in final concentrations as indicated. The media in the serum bottles were inoculated with 10% (v/v) of IW or PW samples. Following inoculation, the serum bottles were incubated at 30 or 60°C. Aliquots of 0.5 ml were taken at different time intervals to determine the concentrations of sulfide, sulfate, nitrite and nitrate. Sulfide concentrations were determined immediately after each sampling, and the remainders of the samples were frozen (-20°C) for further analysis of sulfate, nitrate and nitrite by HPLC.

4.3.4 Enrichment of thermophilic SRB and NRB consortia from field samples

To increase the probability of cultivating thermophilic SRB and NRB from the water samples, the biomass in the water samples was concentrated by either filtration or centrifugation.

For filtration, 250 mL of sample were filtered through a 0.2 µm filter, after which the biomass 60

concentrated on the surface of the filter, was inoculated into 30 mL of the filtrate or of CSBA. For centrifugation, 250 ml of PW or IW were centrifuged at 11,200 x g for 15 min. After centrifugation, the supernatant was poured off, and the pellets formed were re-suspended with 5 ml of the supernatant.

Aliquots (20 ml) of CSBA medium were dispensed into 50 ml serum bottles, and sealed with rubber stoppers and aluminum crimps. The medium was flushed with N2-CO2. To the SRB media,

20 mM lactate and 10 mM sulfate or 6 mM VFA and 10 mM sulfate were added, while to the NRB media, 20 mM lactate and 10 mM nitrate were added. The inoculated media were incubated at

° 60 C. Samples were taken periodically with an N2-CO2 flushed syringe. The nitrate, sulfate and nitrite concentrations were determined using HPLC, while sulfide was measured colorimetrically.

4.3.5 Temperature dependence of sulfate and nitrate reduction

IW and PW samples collected in 2015 were inoculated into CSBA medium containing 3 mM

VFA (3 mM each of acetate, propionate and butyrate) and 10 mM nitrate or 20 mM lactate and 10 mM sulfate. Following inoculation, the incubations were done at 30, 40, 45, 50, 55, 60, 65, and

70°C. Aliquots of 0.5 ml were withdrawn periodically from the incubations to monitor sulfide, sulfate, nitrate and nitrite concentrations.

4.3.6 Isolation and identification of tNRB strains

tNRB enrichments derived from IW1_14 grown at 60oC or derived from IW5_15 grown at 50°C were 10-fold serially diluted in CSBA medium and 100 l of the dilutions were plated on a 2% CSBA-agar medium containing 3 mM VFA and 10 mM nitrate. The plates were

o incubated at 50°C or 60 C in anaerobic jars flushed with N2-CO2. Individual colonies were 61

picked and grown in CSBA medium with 3 mM VFA and 10 mM nitrate. To identify the isolate,

DNA was extracted and 16S rRNA gene amplicons were obtained using primers 27F and 1525R. which gave 1,500-bp 16S rRNA gene amplicons (Frank et al., 2008). The resulting amplicons were identified by Sanger sequencing at the Core DNA Services Laboratory of the University of

Calgary. The 16S rRNA gene sequence of the isolate and those of reference sequences retrieved from GenBank were aligned with Clustal W (Thompson et al., 1994). A phylogenetic tree was constructed using MEGA version 6 (Tamura et al., 2013). The evolutionary history was inferred using the Neighbor-Joining algorithm (Saitou and Nei, 1987). The evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura and Kumar, 2004) and are in the units of the number of base substitutions per site. Confidence estimates of branch clusters were obtained from bootstrap tests of 1000 replicates (Felsenstein, 1985).

4.3.7 Effect of nitrate and nitrite on sulfate reduction by tSRB

To assess the inhibition of sulfide production in tSRB consortia using nitrate or nitrite, 10%

(v/v) of tSRB enrichment was grown in CSBA medium containing 20 mM lactate and 10 mM sulfate. Also, a tNRB mixed culture of Geobacillus sp. strain TK004 and TK005 (Fida et al., 2016) was prepared by inoculating glycerol stocks of each strain into CSBA medium with 0.25 M NaCl, containing 20 mM lactate and 10 mM nitrate. The effectiveness of tNRB activity in inhibiting sulfate reduction was monitored by adding tNRB and nitrate at the start (0 h) or in mid-log phase of a tSRB culture.

The effect of nitrate and nitrite on sulfate reduction by tSRB growing in continuous culture was also assessed. A continuous culture of tSRB was started by inoculating 10% of a 48-h tSRB culture into 90 mL CSBA containing 10 mM lactate and 5 mM sulfate. Once all sulfate was 62

reduced, a multichannel peristaltic pump was used to pump the same medium at a flow rate of 33 ml/d (dilution rate 0.33 d-1). To test the effect of nitrate addition on sulfate reduction, CSBA medium containing both 5 mM nitrate and 5 mM sulfate was injected into the tSRB culture in medium with sulfate only. To evaluate the effect of tNRB addition on sulfate reduction, tNRB were grown in CSBA medium containing 5 mM nitrate and 10 mM lactate. The cells were harvested at mid-log phase and washed with CSBA to remove any residual nitrate or nitrite. The cell pellets were re-suspended in CSBA medium and then inoculated into the tSRB culture. The effect of nitrite on sulfate reduction by tSRB was monitored by adding 0.125, 0.25 or 1 mM nitrite to the injection medium.

4.3.8 Microbial community analysis

DNA was isolated from 200 ml of PW and IW samples using the Fast DNA Spin Kit for Soil and the FastPrep Instrument (MP Biomedicals, Santa Ana, CA) as per the manufacturer’s instructions. The extracted DNA was quantified using a Qubit fluorometer (Invitrogen).

Pyrosequencing of 16S amplicons was done for 2014 samples, whereas Illumina Miseq sequencing was done for 2015 samples.

For pyrosequencing, PCR amplification was for 25 cycles with 16S primers 926Fw and

1392R, followed by 10 cycles with FLX titanium primers 454T_RA_X and 454T_FwB, as described in An et al. (2013). Purified 16S amplicons (20 ng each) were sequenced at the Genome

Quebec and McGill University Innovation Centre, Montreal, Quebec with a Genome Sequencer

FLX Instrument, using a GS FLX Titanium Series Kit XLR70 (Roche Diagnostics Corporation).

For Illumina Miseq sequencing, 16S rRNA genes of the extracted DNA were amplified using a two-step PCR procedure with each reaction of 50 l volume containing premade reagents 63

mixed in proportion as per the manufacturer’s instructions (Thermo- Scientific). The first PCR used 16S primers 926Fi5 and 1392Ri7 as described elsewhere (Section 6.2.4). The PCR product obtained was purified and quantified and was then used for the second PCR reaction, which used primer P5-S50X-OHAF and P7-N7XX-OHAR for 10 cycles, as described elsewhere (Section

6.2.4). The resulting purified PCR product was sequenced using the 300PE (paired-end) MiSeq protocol on an Illumina Miseq system at the Department of Geoscience, University of Calgary.

The 300PE reads were merged using PEAR 0.9.6 with a 50 bp overlap and were further processed with a 420 bp cutoff of amplicon size using MetaAmp, a 16S rRNA data analysis pipeline, developed by the Energy Bioengineering Group, Department of Geosciences, University of

Calgary. MetaAmp was also used for bioinformatic analysis (Dong et al., 2017).

All sequences have been submitted to NCBI Sequence Read Archive (SRA) under

Bioproject accession number PRJNA181037, with biosample number SAMN06645415 and

SAMN06645441.

4.4 Results

4.4.1 Physicochemical analyses and most probable numbers

The average salinity of Terra Nova injection waters was 0.520.04 Meq of NaCl, which was similar to that of produced waters (Table 4-1: 0.570.13 Meq of NaCl). The concentrations of sulfate in injection water samples (25.14.6 mM) were higher than those of produced waters,

(15.45.5 mM). PW samples had higher concentrations of acetate, propionate and ammonium than

IW samples (Table 4-1). All samples had a near neutral pH. Concentrations of nitrate, nitrite and sulfide were zero for all the samples.

The MPNs for SRB, determined by incubation at 30 or 60°C, were below the detection limit in both the IW and PW samples. IW samples had some mesophilic APB (3.6/ml; 30 °C), but no thermophilic APB (60°C). No mesophilic or thermophilic APB were detected in the PW samples. Overall these results indicate that only small numbers of bacteria, culturable on the media used, were present in the samples.

4.4.2 Microbial community analysis of IW1_14 and PW1_14

Results derived from pyrosequencing of 16S rRNA amplicons for the 2014 samples and from Illumina sequencing of 16S rRNA amplicons for the 2015 samples are presented in Tables

4-2 and 4-3, respectively. The microbial community in PW1_14 had substantial fractions of potentially thermophilic Euryarchaeota (Table 4-2), including Methanothermococcus (7.1%),

Methermicoccus (2.2%) Thermococcus (2.2%) and Archaeoglobus (1.7%). The majority of

Bacteria in the PW1_14 community were thermophiles belonging to the genera

Thermoanaerobacter (78.2%) and Thermosipho (0.7%). Members of the Deltaproteobacteria included the tSRB Desulfonauticus (0.3%; Piceno et al., 2014). The microbial community in injection water IW1_14 consisted mainly of aerobic mesophilic marine bacteria. About 33.2% of the total reads were affiliated with the genus Neptuniibacter, which reduces nitrate to nitrite at temperatures between 4 and 33 °C (Arahal et al., 2007; Gutierrez et al., 2013). Other potential hydrocarbon degraders were Thalassospira (5.7%), Alcanivorax (4.5%) and Cycloclasticus (3.0%)

(Gutierrez et al., 2013). Alcanivorax spp. are moderately halophilic alkane degraders which reduce nitrate to nitrite and N2 (Mayumi et al., 2011; McGenity et al., 2012; Nakano et al., 2009a, 2009b;

Singh et al., 2014). The nitrate-reducing Marinobacter was present at 0.5% (Table 4-2) (Li et al.,

2013; Stepanov et al., 2016). Contrary to the community in PW1_14, that of IW1_14, harboured no thermophiles (Table 4-2: entries #12, 26-31).

Few potentially thermophilic taxa were found in samples collected in 2015. These were dominated by Alpha- and Gammaproteobacteria, but lacked Euryarchaeota. IW5_15 had a high fraction of the sulfur-oxidizing Thiomicrospira (Table 4-3, entry #21, 42%), which was not found in the other samples. Most of the dominating taxa are considered mesophilic. The community in PW1_15 had small fractions of Methanothermococcus and Thermococcus (Table

4-3: entries #30 and 31).

Table 4-2: Microbial community compositions of samples PW1_14 (PW) and IW1_14 (IW) derived from pyrosequencing. The fractions of total reads are indicated for each taxon.

Fractions in excess of 1% are indicated in bold. W

# Taxonomy W

3 4

4 4

8 8

1 1

_ _

8 8

3 3

V V

1Sequence ID Proteobacteria;Alphaproteobacteria;NA__DB1-14; 0 2.1 2 Proteobacteria;Alphaproteobacteria;NA__OCS116-clade; 0 4.23 3 Proteobacteria;Alphaproteobacteria;Rhodobacterales;Rhodobacteraceae; 0 0.93 4 Proteobacteria;Alphaproteobacteria;Rhodobacterales;Rhodobacteraceae;_Roseovarius; 0 0.66 5 Proteobacteria;Alphaproteobacteria;Rhodobacterales;Rhodobacteraceae;Celeribacter; 0 5.1 6 Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Nisaea; 0 0.95 7 Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Thalassospira; 0 5.72 8 Proteobacteria;Alphaproteobacteria;Sneathiellales;Sneathiellaceae;Sneathiella; 0 0.32 9 Proteobacteria;Alphaproteobacteria;Sphingomonadales;Sphingomonadaceae;Sphingorhabdus; 0 0.34 10 Proteobacteria;AlphaproteobacteriaRhodobacterales;Rhodobacteraceae;Pseudophaeobacter; 0 0.66 11 Proteobacteria;Betaproteobacteria;Rhodocyclales;Rhodocyclaceae; 0 24.76 12 Proteobacteria;Deltaproteobacteria;Desulfovibrionales;Desulfohalobiaceae;Desulfonauticus; 0.32 0 13 Proteobacteria;Gammaproteobacteria;Alteromonadales;Alteromonadaceae;Alteromonas; 0 0.35 14 Proteobacteria;Gammaproteobacteria;Alteromonadales;Alteromonadaceae;Marinobacter; 0 0.54 15 Proteobacteria;Gammaproteobacteria;Alteromonadales;Shewanellaceae;Shewanella; 0 0.96 16 Proteobacteria;Gammaproteobacteria;Oceanospirillales;Alcanivoracaceae;Alcanivorax; 0 4.51 17 Proteobacteria;Gammaproteobacteria;Oceanospirillales;Oceanospirillaceae;Litoribacillus; 0 0.93 18 Proteobacteria;Gammaproteobacteria;Oceanospirillales;Oceanospirillaceae;Neptuniibacter; 0 33.2 19 Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae;Pseudomonas; 6.88 0.48 20 Proteobacteria;Gammaproteobacteria;Thiotrichales;Piscirickettsiaceae;Cycloclasticus; 0 3.03 21 Proteobacteria;Gammaproteobacteria;Thiotrichales;Piscirickettsiaceae;Methylophaga; 0 5.53 22 ProteobacteriaGammaproteobacteria;Alteromonadales;olwelliaceae;Colwellia; 0 0.98 23 Bacteroidetes;Flavobacteriia;Flavobacteriales;Flavobacteriaceae;Mesoflavibacter; 0 0.58 24 Bacteroidetes;Flavobacteriia;Flavobacteriales;Flavobacteriaceae;Ulvibacter; 0 2.8 25 Firmicutes;Clostridia;Clostridiales;Clostridiaceae-4;Caminicella; 0.2 0 26 Firmicutes;Clostridia;Thermoanaerobacterales;Thermoanaerobacteraceae;Thermoanaerobacter; 78.2 0 27 Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Thermosipho; 0.74 0 28 Euryarchaeota;Archaeoglobi;Archaeoglobales;Archaeoglobaceae;Archaeoglobus; 1.7 0 29 Euryarchaeota;Methanococci;Methanococcales;Methanococcaceae;Methanothermococcus; 7.08 0 30 Euryarchaeota;Methanomicrobia;Methanosarcinales;Methermicoccaceae;Methermicoccus; 2.21 0.01 31 Euryarchaeota;Thermococci;Thermococcales;Thermococcaceae;Thermococcus; 2.19 0 Total number of reads 6472 6857

4.4.3 Thermophilic enrichments of field samples

Because Terra Nova samples had few culturable bacteria, as judged by MPN assays, enrichment of tSRB and tNRB consortia was done with concentrated inocula. Injecting concentrated PW1_14 and IW1_14 in media gave the results indicated in Figure 4-2. Activity of tSRB was detected in lactate-sulfate medium after 3 to 6 days of incubation at 60oC (Figure 4-2A), whereas tSRB activity was detected in VFA-sulfate medium after 4 to 8 days of incubation (Figure

4-2B). No tSRB activity was detected in medium inoculated with concentrated IW1_14 (results not shown). tNRB activity was observed in medium with 20 mM lactate and 10 mM nitrate inoculated with concentrated IW1_14 (Figure 4-2D). Nitrate was reduced to nitrite, which was not reduced further. No tNRB activity was observed with concentrated PW1_14 (Figure 4-2C).

Nitrate-reducing enrichments using 50-fold concentrated inocula of samples PW1_15 and

IW1_15 were done at different temperatures (Figure A4-1). Nitrate was completely reduced within

24 h at 30 and 40°C (Figure S4-1A, B, C, D). Nitrite appeared transiently up to 4.8 mM in the incubation with IW1_15 at 40oC (Figure S4-1B), whereas 1.0 mM nitrite persisted in the incubation with PW1_15 at 40oC (Figure S4-1E). At 45°C nitrate was slowly reduced to nitrite in the medium inoculated with concentrated IW1_15 PW (Figure S4-1C). Reduction of 3 mM nitrate was observed with PW1_15 without production of nitrite (Figure S4-1F). Incubations at 50 to

70 °C showed no tNRB activity (results not shown). SRB activity was observed for concentrated

PW1_15 in medium with VFA and sulfate at 60 °C (results not shown).

Use of 50-fold concentrated inocula of IW5_15 indicated rapid reduction of nitrate at 40,

45 and 50oC (Figure 4-3A, B, C). Nitrite was not detected at 40 and 45oC, but persisted in the 50oC incubation (Figure 4-3C). No NRB activity was found at 55, 60 and 65oC (Figure 4-3D, E, F). No

SRB activity was found at any of these temperatures. No NRB or SRB activity was found with concentrated inocula of PW5_15 at 40 to 65oC.

Thus, significant tSRB and tNRB activity at 60oC were observed in the produced water and injection water samples collected in January of 2014, respectively. Samples collected in January and May 2015 gave tNRB activity at lower temperature (50oC). These results are in agreement with the increased presence of thermophiles in the 2014 samples, as compared to the 2015 samples, indicated by microbial community analyses (Tables 4-2 and 4-3).

4.4.4 NRB enrichment at 50oC and 60oC and isolation of tNRB

The tNRB enrichment obtained at 50oC (Figure 4-3C) was further evaluated for the effect of temperature on nitrate reduction, growth and community composition. The results in Figure 4-

3G, H, I showed that in incubations at 30, 40 and 50°C, nitrate was reduced to nitrite and no further.

Nitrate was completely reduced at 30°C within 72 h (Figure 4-3G), at 40°C within 48 h (Figure 4-

3H) and at 50oC within 24 h (Figure 4-3I). Nitrite accumulated at all three temperatures. No nitrate reduction was observed above 50°C. High cell density of these cultures was observed at 30, 40 and 50°C, but not at higher temperatures (Figure S4-2A), indicating the nitrate reducers to be moderately thermophilic NRB. Mesophilic NRB, which reduced nitrite (Figure 4-3A, B) were no longer present in this enrichment. Microbial community data for the incubations in Figure 4-3G,

H, I indicated Marinobacter spp. as the dominant NRB present at 99.6%, 68% and 99.7% respectively (Figure S4-2B). A pure culture isolate, obtained from the enrichment in Figure 4-3I and grown at 50oC, was identified as Marinobacter sp. GN001 (KY818661). Phylogenetic analysis of 16S rRNA gene sequences of Marinobacter sp., showed that the closest relative of GN001 was

Marinobacter lutaoensis, with 88% sequence identity over 1305 bp (Figure S4-4). This was 70

isolated from a coastal hot spring in Lutao, Taiwan (Shieh et al., 2003). However, when the GN001 sequence was blasted against sequences in NCBI GenBank the closest relative was Marinobacter taiwanensis (100%), which was previously isolated from submarine hot springs (Chen et al., unpublished), while Marinobacter lutaoensis was at 97%.

Growth of this isolate at temperatures ranging from 30 to 60°C, indicated that it reduced nitrate, but not nitrite, at 30, 40 and 50°C (Figure 4-3J, K, L). Nitrate was not reduced at 60°C

(results not shown). Nitrate reduction proceeded most rapidly at 40 and 50°C and more slowly at

30°C, like the enrichment in Figure 4-3G, H and I.

Pure culture tNRB isolates TK004 and TK005 were obtained from IW1_14 at 60oC. Both were identified as Geobacillus spp. by 16S rRNA gene sequencing. Nitrate reduction by TK004 as a function of temperature indicated maximal activity at 60°C, lower activity at 40 and 50oC and no activity at 30 and 70oC. Nitrate was reduced to nitrite only (Figure 4-4).

10 10 sulfide 8 8 sulfate 6 sulfide 6 4 A sulfate 4 B 2 2 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 12 10 Nitrate 10 8 8 Nitrite 6 6 Nitrate C D

Concentration (mM) Concentration 4 4 Nitrite 2 2 0 0 0 5 10 15 20 25 0 2 4 6 8 10 12 Time (days)

12 12 12 10 10 10 (C) IW 50°C 8 (A) IW 40 C 8 Nitrite 8 6 (B) IW 45°C 6 6 Nitrate 4 4 4 2 2 2 0 0 0 0 20 40 60 80 100 12 0 20 40 60 80 100 0 20 40 60 80 100 12 12 10 10 10 8 8 8 6 (D) IW 55°C 6 (F) IW 65°C Primary Primary enrichment 6 (E) IW 60°C 4 4 4 2 2 2 0 0 0 0 20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100 8 8 8 6 6 6

Concentration (mM) Concentration (I) 50°C 4 (G) 30°C 4 (H) 40°C Nitrite 4 2 2 nitrate 2 0 0 0 Secondary enrichmentSecondary 0 100 200 300 400 500 0 100 200 300 400 500 0 100 200 300 400 500 12 12 12 10 (J) 30°C 10 10 8 8 8 6 6 (K) 40°C 6 (L) 50°C 4 4 4 2 2 2 Marinobacter 0 0 0 0 20 40 60 80 0 20 40 60 80 0 20 40 60 80 Time (h)

12 12 10 10 nitrate 8 nitrate 8 nitrite o 6 nitrite 6 (C) 50 C o 4 (A) 30 C 4 2 2 0 0

) 0 50 100 150 200 0 50 100 150 200 12 12

mM 10 10 8 8 nitrate nitrate nitrite 6 o 6 o (B) 40 C nitrite (D) 60 C 4 4 2 2

0 0 Concentration ( Concentration 0 50 100 150 200 0 50 100 150 200 12 10 8 6 (E) 70oC nitrate 4 nitrite 2 0 0 50 100 150 200 Time (h)

4.4.5 Enrichment of tSRB

The temperature dependence of the rate of sulfate reduction to sulfide was determined for a tSRB consortium previously enriched from PW1_14 at 60°C (Figure 4-2A). Reduction of sulfate to sulfide was observed at 55, 60 and 65°C (Figure 4-5A, B), but not at lower temperatures.

Significant increases in biomass were also only observed at 55, 60 and 65°C (Figure 4-5C).

Reduction of sulfate to sulfide was observed at 70oC after 300 h at a very slow rate (Figure S4-3).

This finding was further supported by the community data from 55 to 65°C incubations, when compared to the inocula used for the experiment (Table S4-1 and S4-2). Bioinformatic analysis of quality controlled Illumina reads indicated that the tSRB consortium was more diverse than the

55, 60 and 65°C incubations (Table S4-1). The tSRB consortium had high fractions of the thermophiles Thermus (25%), Anoxybacillus (8.8%) and Desulfotomaculum (7.6%). However, the

55, 60 and 65°C incubations were dominated by tSRB of the genus Desulfotomaculum, which was present at 98.8, 97.2 and 95.5% respectively (Table S4-2).

4.4.6 Effect of addition of nitrite or nitrate to tSRB enrichments in batch culture

The effect of nitrite on sulfate reduction was tested at 60oC, using the 60oC tSRB enrichment of Figure 4-5, which contained mostly Desulfotomaculum (Table S4-2). Addition of nitrite at mid-log phase caused an instant drop in sulfide concentration (Figure 4-6A), due to chemical reaction of nitrite with sulfide. Addition of the lowest concentrations of 0.125 and 0.25 mM nitrite inhibited sulfide production only transiently. However, the final concentration of sulfide produced remained below that of the untreated culture (Figure 4-6A). Sulfate concentrations remained constant following addition of 0.5 or 1 mM nitrite, while some sulfate reduction was observed at lower nitrite concentrations (Figure 4-6B).

When nitrate was added it was not reduced and reduction of sulfate to sulfide was complete in 35 h (Figure 4-7A). However, when both nitrate and tNRB (a mixture of Geobacillus sp. strains

TK004 and TK005) were added at time zero reduction of nitrate to nitrite was observed from 24 h onwards. This inhibited the reduction of sulfate, which remained constant from 35 h onwards.

Sulfide concentrations decreased from 35 h onwards (Figure 4-7B); development of a yellow colour indicated the formation of polysulfides from reaction of nitrite and sulfide. The addition of nitrate and actively growing tNRB or of nitrate only to a tSRB culture at mid-log phase did not give nitrate reduction and no inhibition of sulfate reduction was observed (Figure 4-7C, D). This was because the time necessary for tNRB to grow (Figure 4-7B: 24 h), exceeded the time needed for the tSRB culture to grow to completion (Figure 4-7C, D: 5 h). Overall the results indicated that addition of tNRB and nitrate at time zero resulted in inhibition of tSRB activity due to formation of nitrite. Inhibition was not observed when only nitrate was added or when tNRB and nitrate were added at midlog phase.

4.4.7 Addition of nitrate, nitrate and tNRB or nitrite to continuous cultures of tSRB

A continuous culture (chemostat) of tSRB, inoculated with the 60°C enrichment of Figure

4-5, was fed with CSBA medium with lactate and 5 mM sulfate at a dilution rate of 0.33 day-1.

This led to the formation of about 5 mM sulfide with 1-3 mM sulfate remaining (Figure 4-8A: 0-

30 days). Nitrate (5 mM) was included in the inflowing medium from day 31 to day 41. This led to a gradual increase in the nitrate concentration in the chemostat to 4 mM from day 31 to 35

(Figure 4-8B). This indicated that nitrate was not reduced. Indeed, the reduction of sulfate to sulfide was not affected (Figure 4-8A: day 31 to 35). However, when a single dose of tNRB was added to the chemostat on day 36 (Figure 4-8A, B: ), the nitrate concentration decreased from 4 76

mM to zero from day 36 to day 41 (Figure 4-8B). The concentration of sulfide decreased from 5 to 0.2 mM, whereas the concentration of sulfate increased from 0 to 3 mM (Figure 4-8A). The development of turbidity and yellow colour indicated formation of sulfur and polysulfide (S-PS), respectively. Nitrite was not detected, likely because it reacted with sulfide to form S-PS. When the medium was switched on day 41 to medium with sulfate only (no nitrate), the tSRB did not recover as indicated by zero sulfide and 3.7 mM sulfate from day 41 to 59 (Figure 4-8A).

Addition of 0.125, 0.25 or 1 mM nitrite to the inflowing medium in another similarly run chemostat did not inhibit the reduction of sulfate of which the concentration remained at zero

(Figure 4-8C). However, sulfide concentrations dropped. Nitrite was again not detected indicating reaction of nitrite and sulfide (Figure 4- 8C). Note that the average concentration of added nitrite over the indicated time periods would be approximately half of that added to the inflowing medium

(0.062, 0.125 and 0.5 mM). The gradual addition of nitrite appeared to affect tSRB in continuous culture less than the addition of a single dose in batch culture (Figure 4-8C and Figure 4-6A).

12 10 0.25 40°C 10 45°C 8 0.2 50°C

8 ) 55°C

40°C 600 60°C 6 0.15 65°C 6 (A) 45°C (B) 40°C (C) 50°C 45°C

55°C 4 50°C 0.1 Sulfate (mM) Sulfate

4 (mM) Sulfide

60°C 55°C (OD Growth 65°C 60°C 2 2 65°C 0.05

0 0 0 0 20 40 60 80 100 120 140 160 0 20 40 60 80 100 120 140 160 0 20 40 60 80 100 120 Time (h)

Figure 4-5: Effect of incubation temperature on growth and sulfate reduction by tSRB consortia enriched from PW1_14. The concentration of sulfate (A) and of sulfide (B), as well as the cell density as OD600 (C) are presented as a function of time. Data are averages for duplicate incubations.

6 6 (A) (B)

5 5

4 0 mM NO2- 4 0.125 mM NO2- 0.25 mM NO2- 3 0.5 mM NO2-

3 1.0 mM NO2- Sulfate (mM) Sulfate

Sulfide(mM) 2 2

1 1

0 0 0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35 Time (d) Figure 4-6: Inhibition of sulfate reduction by tSRB with nitrite. A tSRB consortium enriched at 60oC (Figure 4-5) was grown at this same temperature in medium with 20 mM lactate and 10 mM sulfate. The concentrations of (A) sulfide and (B) sulfate are shown as a function of time. Nitrite was injected at midlog phase () in concentrations as indicated.

6 A 5 mM NO3 5 mM NO3 and tNRB 5 CF_sulfate 4 CF_sulfide 3 2 1 0 0 3 5 8 10 13 15 17 25 27 29 31 32 33 34 35 36 37 38 39 40 41 45 47 48 50 59 4.5 4 B 5 mM NO3 5 mM NO3 and tNRB 3.5 3 2.5 CF_Nitrite 2 CF_Nitrate 1.5 1 0.5 Concentration (mM) Concentration 0 0 3 5 8 10 13 15 17 25 27 29 31 32 33 34 35 36 37 38 39 40 41 43 45 47 48 50 59 8 7 C 0.125 mM NO2 0.25 mM NO2 1 mM NO2 6 CB_sulfate 5 CB_sulfide 4 3 2 1 0 0 3 5 8 10 13 15 17 25 27 29 31 32 33 34 35 36 37 38 39 40 41 43 45 47 48 50 Time (d)

4.5 Discussion

Oil production from Terra Nova started in 2002 with seawater injection being required soon after (Haugen et al., 2007). Souring became evident after about 8 years of seawater flooding

(Sharpe et al., 2015) and nitrate and nitrite were injected as a souring control strategy from 2014 onwards. Because of the high reservoir temperature of 95oC some regions will be abiotic and microbial growth is expected only in regions where the temperature is below 80oC (Figure 4-1). It is generally thought that most souring occurs in the NIWR, where sulfate-containing injection water comes in contact with oil. Because injected sea water has a high sulfate concentration (Table

4-1) both mesophilic SRB and thermophilic SRM may contribute to souring (Vance and Thrasher,

2005; Torsvik and Sunde, 2005). The produced sulfide then travels through the reservoir. Its appearance in produced water can take a long time (i.e. 8 years in the case of Terra Nova) due to the scavenging of sulfide by reservoir rock (Vance and Thrasher, 2005).

Uncovering the microbiology of the NIWR is thus relevant, but is challenging because only samples of injection water and of produced water are available in most cases. Reversing the flow of injection water would allow a more direct collection of samples from the NIWR, but such samples are rarely available (Bødtker et al., 2009). Microbial community data obtained for produced water samples cannot be pinpointed to a particular region of the reservoir. These samples may contain injection water microbes, which passed through the reservoir and were heat killed along the way, as well as sessile bacteria growing on the walls of pipelines transporting produced water and oil to the FPSO (Figure 4-1). Low microbial counts and activities are commonly observed in produced waters from high temperature reservoirs (Birkeland, 2005; Bonch-

Osmolovskaya et al., 2003; Kaster et al., 2007). Likewise, the seawater used as injection water may contain thermophiles from the reservoir or pipeline walls, due to the continuous discharge of 82

de-oiled, high temperature produced water (Figure 4-1). Therefore, a variety of approaches including community analysis, culturing and determination of temperature optima are needed to reconstruct the positioning of microbes and their activities in the NIWR.

Of the thermophiles detected in this study, Thermoanaerobacter spp. are fermentative bacteria, which have been frequently found in produced water samples from high temperature oil fields (Orphan et al., 2000; Pavlova-Kostryukova et al., 2014; Yeung et al., 2015). Other detected thermophiles were the fermentative bacterial taxon Thermosipho (Dahle et al., 2008; Haridon et al., 2001), the archaeal taxon Thermococcus, which is also a sulfur reducer (Gorlas et al., 2015;

Liang et al., 2014; Lin et al., 2014; Zhang et al., 2012b) and the methanogen

Methanothermococcus. These results indicate that regions in the NIWR and pipeline walls with the right temperature regime will harbor diverse metabolically active thermophilic and hyperthermophilic anaerobes (Orphan et al., 2003; Slobodkin et al., 1999) of which only a few have been cultured (Orphan et al., 2000). Gittel et al. (2009) reported that an enrichment of a sample, which had 56% Archaeoglobus sequences, had no sulfate-reducing activity. Several other studies reported inability to enrich tNRB from produced water samples from the Ekofisk oilfield.

Desulfotomaculum spp are the most documented culturable tSRB isolated from oil field environments (Aüllo et al., 2013; Nazina et al., 2006; Nilsen et al., 1996a; Nilsen et al., 1996b), but are not often detected with next generation sequencing approaches (Müller et al., 2014;

Wunderlin et al., 2014). Thermodesulforhabdus norvegicus and Archaeoglobus fulgidus strains were among the dominant tSRM detected by Nilsen et al. (1996a) in North Sea oil reservoirs and

Beeder et al. (1995) isolated a novel acetate-oxidizing T. norvegicus, which grew at temperature of up to 74 oC. Li et al. (2007) detected Thermodesulfovibrio, a Gram-negative tSRB, as a major component of a 16S rRNA gene clone library from a North Sea field. 83

Fida et al. (2016) reported the isolation of the tNRB Petrobacter sp. TK002 (optimum growth at 50oC) and Geobacillus sp TK003 (optimum growth at 65oC), which reduced nitrate to nitrite. Although some tNRB have been reported to reduce nitrate to N2 or ammonium (Greene et al., 1997; Miranda-Tello et al., 2003), reduction of nitrate to nitrite appeared to be the norm for oil field tNRB (Fida et al. 2016). The addition of nitrate often does not inhibit tSRB consortia, because these lack tNRB. Such tSRB consortia are only inhibited by nitrite or by nitrate, if tNRB are also injected (Figure 6B, Figure 7A, B). The inhibition of the tSRB consortia used in this study and in other work by low concentrations of nitrite (Kaster et al., 2007) indicates the absence of Nrf nitrite reductase in tSRB, which reduces nitrite to ammonium. Nrf protects many mesophilic SRB from inhibition by nitrite (Greene et al., 2003; Haveman et al., 2004).

Although this would suggest that injection of nitrite, which directly inhibits SRM, is preferable to the injection of nitrate this may not apply at Terra Nova, where both mesophilic and thermophilic NRB are present. Mesophilic NRB grow closest to the injection wellbore at 30 to

o 45 C (Figure 4-9). These reduce nitrate or nitrite to N2 (Figure 4-3A, B), but have not been phylogenetically characterized. These are followed by moderately thermophilic NRB of the genus

Marinobacter growing at 30 to 50oC (Figure 4-3C, G-I; Figure 4-9) and these are succeeded by tNRB of the genus Geobacillus, which grow from 40 to 65oC (Figure 4-4; Fida et al. 2016). There is no tNRB activity at 70oC or higher temperature. The activity of tSRB of the genus

Desulfotomaculum extends from 55 to 70oC (Figures 4-5 and S4-3). The observation of significant fractions of Archaeoglobus in some samples (Table 4-2: entry #28) indicates that the temperature limit for sulfate reduction may be at even higher temperature (Beeder et al., 1994; Gittel et al.,

2009). Because mesophilic SRB were not detected with cultivation or 16S rRNA gene sequencing, we assume that these were largely absent from Terra Nova, where nitrate injection may displace 84

SRB from low temperature zones. Thus, at Terra Nova sulfide may be mainly produced by tSRM living in a high temperature zone (65-80oC) from which tNRB are excluded. Preventing the temperature of the NIWR to drop below 50oC would increase the production of nitrite from injected nitrate in tNRB inhabited zones (50-65oC). Transfer of this produced nitrite into the adjacent higher temperature zone (65-80oC) will inhibit the resident tSRB, if the rate of transfer exceeds the rate of sulfide production by tSRB. These conditions were apparently not met in our continuous culture study (Figure 4-8C). Injection of hot recycled produced water to keep the temperature above 50oC will increase the transfer of nitrite into tSRB-inhabited zones and is therefore a promising strategy to control souring in high temperature oil reservoirs, as suggested previously (Fida et al., 2016).

100 tSRA Archaeoglobus (inhibited by nitrite)

tSRB Desulfotomaculum (inhibited by nitrite) tNRB Geobacillus (nitrate to nitrite)

50 tNRB Marinobacter (nitrate to nitrite)

Distance X (m) X Distance mNRB (nitrate to N2) Distance X (m) of NIWR NIWR of (m) X Distance

0 30 35 40 45 50 55 60 65 70 75 80 Temperature (°C)

Chapter Five: Souring control by nitrate and perchlorate

5.1 Abstract

Nitrate injection is a common strategy for controlling reservoir souring. However, its effectiveness in inhibiting sulfide production by sulfate reducers in low temperature reservoirs is often limited by its depth of penetration into the reservoir. Decreased effectiveness results from microbial zonation, where NRB reduce nitrate close to the injection well and SRB proliferate actively in deeper zones of the reservoir. The effectiveness of perchlorate in inhibiting SRB activity was compared with nitrate, when added singly or in combination with nitrate in oil containing medium. Nitrate inhibited sulfate reduction in batch experiments, whereas the onset of sulfate reduction in incubations with perchlorate was delayed. Perchlorate was not reduced with oil in any of the batch culture incubations. For bioreactor experiments, 50 ml sand packed glass columns with oil were inoculated with mSRB enrichment, pre-grown in oil. Treatment of these reactors with nitrate, perchlorate and chlorite was commenced once active souring (production of about 2 mM sulfide) was observed. Like in the batch experiments, nitrate (4 mM) completely inhibited sulfide production, while partial inhibition occurred at lower (1 and 2 mM) concentrations. Perchlorate injection was again not effective in inhibiting sulfide production in oil- containing bioreactor experiments. However, chlorite a possible product of perchlorate reduction completely inhibited sulfate reduction at 2 mM concentration. Combined injection of 1 or 2 mM nitrate and perchlorate had no enhanced effect on souring in columns. Perchlorate reduction with the alkylbenzenes toluene and ethylbenzene was also studied using produced water consortia as well as toluene and ethylbenzene grown nitrate reducing continuous culture consortia. The results indicated that alkylbenzenes were not used as electron donors for perchlorate reduction. Further, the inhibition of sulfate reduction by perchlorate was explored in a pure culture of Desulfovibrio

vulgaris Hildenborough (DVH) grown on lactate and sulfate. Perchlorate (2 or 10 mM) or chlorite

(5 mM) was added to the DVH culture at time T= 0, 3, 6 or 12 h. Perchlorate had no direct effect on sulfate reduction by DVH, whereas chlorite reacted with the sulfide produced and strongly inhibited DVH. Overall, chlorite was a better alternative than perchlorate in controlling low temperature reservoir souring. Nitrate remains a better option than perchlorate for control of souring in the MHGC field.

5.2 Introduction

Waterflooded low temperature reservoirs typically maintain uniform temperatures throughout the reservoir from injector to producing well. This allows for the growth of different mesophilic bacteria or archaea, depending on the electron accepting conditions present. The presence of sulfate in injection water used in such systems, would stimulate the growth of sulfate reducers, which reduce the sulfate and produce sulfide, which is termed reservoir souring. A commonly applied control measure for reservoir souring is the injection of nitrate, which is reduced by NRB first to nitrite and finally to N2. Nitrite is a metabolic inhibitor of SRB and acts by binding strongly to the dissimilatory sulfite reductase enzyme in SRB that catalyzes the last step in the sulfate reduction pathway of SRB – reduction of sulfite to sulfide. However, once nitrite is removed, SRB resume active sulfate reduction.

The efficacy of continuous injection of a low dose of nitrate in controlling low temperature reservoir souring, is sometimes limited by the depth of penetration of nitrate. Co-injection of nitrate and sulfate leads to microbial zonation; where activity of nitrate reducers is limited to the vicinity of the injector wellbore, followed by active souring occurring deeper into the reservoir

(Voordouw et al., 2009). Deeper zones of sulfate reduction may be controlled by the batchwise 88

injection of high concentrations of nitrate to push nitrate deeper into to reservoir (Callbeck et al.,

2011) or by combining nitrate injection with biocides (Xue and Voordouw, 2015).

Perchlorate, has recently been put forward as a suitable alternative to nitrate in the control of reservoir souring (Coates, 2014; Liebensteiner et al., 2014). Perchlorate, a structural analogue of sulfate, was first reported by Postgate (1952) to directly inhibit sulfate reduction in

Desulfovibrio desulfuricans when added at 10 times the concentration of sulfate in the growth medium. Since then, anaerobic reduction of perchlorate has been extensively studied and the mechanism by which it inhibits sulfate reduction has been elucidated. Perchlorate reducers can inhibit the activity of SRB, by three mechanisms. (i) In bio-competitive exclusion, they outcompete SRB for similar electron donors due to the energetically more favourable redox

− − − − o' couples of ClO4 /Cl and ClO3 /Cl ((E = +797 mV and +792 mV, respectively) (Engelbrektson et al., 2014; Liebensteiner et al., 2014). (ii) They catalyse bio-oxidization of hydrogen sulfide yielding elemental sulfur. These microbes use hydrogen sulfide as an electron donor for perchlorate or chlorate reduction (Coates and Achenbach, 2004; Gregoire et al., 2014), e.g. for chlorate:

- - + 0 - 3HS + ClO3 + 3H → 3S + Cl + 3H2O (eqn 1).

H2S is oxidized either directly by perchlorate reductase (PcrAB), couple to the reduction of perchlorate or indirectly by the abiotic reaction of H2S with chlorite or oxygen formed following perchlorate reduction (Mehta-Kolte et al., 2016).

(iii) The direct inhibition of the central sulfate respiration pathway is accomplished through the inhibition of the ATP sulfurylase enzyme in SRB. Because perchlorate is an analogue of sulfate, it inhibits the activity of the ATP-sulfurylase enzyme via both competitive and allosteric inhibition

(Carlson et al. 2014). 89

The objective here was to explore the control of sulfide production at low temperatures using nitrate and/or perchlorate.

5.3 Material and Methods

5.3.1 Media and enrichment of perchlorate reducers from oil field samples

To enrich for perchlorate and chlorate (collectively referred to as per(chlorate) reducing organisms, produced water sample 18PW from the MHGC oilfield was incubated in Coleville synthetic brine K (CSBK) medium. Enrichment cultures were grown by inoculating 5% produced water in 20 mL sterile anaerobic CSBK medium, dispensed into 50 mL bottles. CSBK medium had the following composition (g/L): NaCl, 0.05; KH2PO4, 0.32; NH4Cl, 0.21; CaCl2.2H2O, 0.54;

MgCl2.5H2O; and 0.1 KCl. After autoclaving and allowing to cool with a constant stream of N2–

CO2 gas, 1 mL of trace element solution, composed of the following in g/L of deionized water:

Na2EDTA (5.2), FeSO4.7H2O (2.1), H3BO3 (0.03), MnCl2.4H2O (0.1 g), CoCl2.6H2O (0.19 g),

NiCl2.6H2O (0.024 g), CuSO4.5H2O (0.003 g), ZnCl2 (0.068 g) and Na2MoO4.H2O (0.036 g); 1 mL selenate-tungstate solution containing (mg/L deionized water), NaOH (400), Na2Se2O3.5H2O

(6) and Na2WO4.H2O (8) and 30 mL of 1 M NaHCO3, were added and the pH was adjusted to 7.4-

7.6 using 2 N HCl. Enrichments of mesophilic nitrate, perchlorate and/or chlorate reducing bacteria (mNRB, mPRB, and mCRB) were obtained by amendment with 10 mM NaNO3, NaClO4 or NaClO3, and 3 mM each of acetate, propionate, and butyrate (VFA). Incubations were carried out at 30 °C. For time course experiments, 1 mL of sample was taken periodically using N2-CO2 flushed syringes from the enrichment cultures to measure growth (OD600), and to determine

- - - - concentrations of nitrite (NO2 ), nitrate (NO3 ), perchlorate (ClO4 ), or chlorate (ClO3 ). The pH

change during incubation was also determined using a Thermo Scientific Orion VersaStar

Advanced Electrochemistry Meter, model 370 (VWR International, Mississauga, ON).

5.3.2 Corrosion potential of perchlorate and its reduction products

The corrosion potential of perchlorate and its reduction products were evaluated under abiotic and biotic conditions. Carbon steel beads, 55.0 ± 0.3 mg, ∅ = 0.238 ± 0.001 cm, A = 0.178 cm2 (Voordouw et al., 2016), were pretreated as per the National Association of Corrosion

Engineers (NACE) protocol RP0775-2005. The beads were polished by sanding them between two sheets of 400 sized grit paper. A 2-min treatment with dibutylthiourea HCl (prepared by dissolving 10.6 g/L of dibutylthiourea in 37% (w/w) HCl and diluting with an equal volume of dH2O) was done, followed by 2 min neutralization with 1.2 M NaHCO3. The beads were then washed with water and acetone and air dried. The weight of the beads was immediately determined thrice before using them in the experiments. After incubation, the beads were again treated with acid and bicarbonate and washed as described above. The weight was again determined thrice and the average used to calculate the weight loss. The corrosion rate CR (mm/yr) was calculated as:

CR = KΔW/ATD; where K is a constant (87,600) for conversion of the corrosion rate in cm/h into mm/yr, ΔW is the weight loss (g) at the end of the incubation, D is the density of carbon steel (7.85 g/cm3, and A is the surface area of the beads (cm2) and T is the duration of incubation in h. To test for abiotic corrosion, five treated beads were added to 20 mL of sterile anaerobic CSBK medium amended with either 10 mM perchlorate, chlorate or chlorite and 3 mM VFA. For biotic corrosion,

10% (2 mL) a PRB enrichment was added to 20 mL CSBK medium amended with 10 mM perchlorate and 3 mM VFA. Bottles were incubated for 30-days at 30°C under a headspace of N2-

CO2. 91

5.3.3 Inhibition of sulfate reduction using oil with perchlorate and nitrate under batch culture conditions

Twenty milliliters of anaerobic CSBK medium was dispensed into 50 mL serum bottles and to each bottle, a 20-fold concentrated produced water sample from MHGC 18-PW was added as inoculum together with 1 mL of MHGC oil (O) as electron donor. Duplicate bottles were amended with either 5 mM sulfate (S), 5 mM sulfate and 10 mM nitrate (N), 5 mM sulfate and 10 mM perchlorate (P), 5 mM sulfate and 10 mM nitrate and 10 mM perchlorate, or 10 mM perchlorate. These incubations are hereon referred to as SO, SNO, PSO, PSNO and PO, respectively. The bottles were sealed with butyl rubber stoppers and a headspace of N2-CO2 was provided. Sterile controls containing 20 mL of CSBK medium, 1 mL of MHGC oil and electron acceptors, but no inoculum were also prepared. Samples were taken at different time points to monitor residual concentrations of sulfate, nitrate, perchlorate, and aqueous sulfide. At the end of the incubation period, the abundance of residual alkylbenzenes and alkanes present in dichloromethane (DCM) oil extracts were determined using gas chromatography−mass spectrometry (GC-MS). Extraction of oil components was done as described by Agrawal et al.

(2012). Extraction of oil components was carried out as described in section 5.3.4

5.3.4 Dichloromethane (DCM) extraction and quantification of oil components using GC-MS

Prior to DCM extraction of the oil, 50 µL each of squalene and mesitylene (used as internal standards for depletion of n-alkanes and alkylbenzenes respectively) were added to the 1 mL oil layer of each culture bottle and mixed thoroughly. Exactly 9 mL of DCM was added to each bottle and the mixture was shaken and then left to stand for 1 min to allow separation of the oil-DCM

layer from the aqueous layer. One microliter (µL) of the oil-DCM layer was injected by an autoinjector (7683B series, Agilent Technologies) into a GC (7890N series, Agilent

Technologies), connected to an MS (5975C inert XL MSD series, Agilent). The GC was equipped with an HP-1 fused silica capillary column (length 50 m, inner diameter 0.32 mm, film thickness

0.52 μm; J&W Scientific) with helium as carrier gas. The amounts of oil components utilized for the reduction of the electron acceptors were determined as the decrease in the ratio of the peak area for a given component to that of the internal standard.

5.3.5 Perchlorate reduction with alkylbenzenes by microbial communities enriched from an oil field produced water sample

The reduction of perchlorate with the alkylbenzenes toluene and ethylbenzene was evaluated. To 60 mL serum bottles, 20 mL of CBSK medium containing 10 mM perchlorate were added. Exactly 3 mM toluene or 2 mM ethylbenzene was added directly to the aqueous medium or to 1 mL of a 2,2,4,4,6,8,8-heptamethylnonane (HMN) layer (at concentrations of 60 mM and

40 mM respectively) for the reduction of perchlorate. The inoculum used was either 1 ml of a 20- fold concentrated 18-PW produced water sample from the MHGC field or 2 mL of a chemostat culture that was growing on nitrate and toluene or ethylbenzene. Perchlorate concentrations were determined as described in Section 5.3.7 below.

5.3.6 Control of souring with nitrate and perchlorate in oil containing bioreactors

Up-flow bioreactors made from 50-mL glass syringes, sealed with a layer of glass wool and polymeric mesh, were tightly packed with silica sand (Sigma-Aldrich, 50 – 70 mesh). The upper end of the bioreactor was sealed with a layer of polymeric mesh and a perforated rubber

stopper fitted with a 1 mL syringe, through which effluent from the bioreactor flowed into an effluent collector. Sterile anaerobic CSBK medium from the medium reservoir was injected through the inlet bottom end of the bioreactor using a multi-channel peristaltic pump (Gilson Inc.,

Minipuls-3). The medium was maintained anaerobically through the injection of N2-CO2 gas in the headspace. Once the columns were saturated with media, the wet weight of each column was determined to calculate its pore volume (wet weight – dry weight of the column). The columns were then flooded with 1 PV of heavy MHGC oil and again flooded with anoxic CSBK medium until no more oil was produced from the columns. The volume of oil produced was determined as described by Gassara et al. (2016). Produced oil, which was a part of an oil-water mixture, was mixed with a known volume of dichloromethane (VDCM). The volume of water (VH2O) was determined and then the volume of oil (Voil) was obtained by determining the optical density at

600 nm (OD600) of the oil-DCM phase to derive the concentration of oil (Coil) in mg/ml; OD600 was determined using a Thermo Scientific GENESY 20 spectrophotometer placed in a fume hood.

Voil was then calculated as Voil = Coil x VDCM/ρoil, where ρoil is the density of MHGC oil (0.959 g/ml). The total volume of oil produced was typically 0.5 PV, leaving 0.5 PV of residual oil. The columns were inoculated with SRB culture growing with MHGC oil and sulfate. The three way valves at the inlet and outlet ends were closed and the columns incubated for 20 days. Following incubation, injection of anoxic medium containing 2 mM sulfate was resumed at a flow rate of 0.5

PV/day. Effluent concentrations of sulfate, sulfide and other anions tested were monitored for every 1 PV.

5.3.7 Analytical techniques

Nitrate, nitrite and perchlorate were analyzed by high-pressure liquid chromatography

(HPLC), using a Waters 600E HPLC (Waters Corp, Milford, MA) which was fitted with a Waters

2489 UV/Visible detector, set at 200 nm and an IC-PAKTM anion HC column (150 x 4.6 mm,

Waters). Nitrate, nitrite, and sulfate were eluted with a sodium borate-gluconate (2%) buffer containing 12% acetonitrile and 2% butanol at a flow rate of 2 ml/min. Perchlorate was eluted using 25 mM NH4HCO3, 50% acetonitrile, pH 10 at a flowrate of 1.5 ml/min. The buffer for perchlorate elution was prepared by first dissolving 1.98 g NH4HCO3 in 450 mL MilliQ water, this was combined with 500 mL of acetonitrile and mixed thoroughly. The buffer pH was adjusted to pH 10 using NH4OH and the final volume brought to 1 L with MilliQ water. Sulfate and perchlorate were measured with the same column using a Waters 432 conductivity detector.

Samples for anion assays were prepared by centrifugation at 14,000 x g for 5 min, after which 100

µl of supernatant was added to 400 µl of the prepared buffer solution in a vial. The volatile fatty acid (VFA) concentration of samples was analyzed with a Waters 2487 UV detector at 210 nm, with a Prevail organic acid (OA) 5u column (250 x 4.6 mm, Alltech, Guelph, ON). Aliquots (1 ml) of the water samples were centrifuged and 300 µl of the supernatant was acidified in a vial with

20 µl of 1 M H3PO4 before elution with 25 mM KH2PO4 (pH 2.5) at a flow rate of 1.0 ml/min.

5.3.8 Microbial community analysis by Illumina sequencing

DNA was isolated from each incubation using the Fast DNA Spin Kit for Soil and the FastPrep

Instrument (MP Biomedicals, Santa Ana, CA) as per the manufacturer’s instructions. The extracted

DNAs were quantified, with Quant-iT™ dsDNA HS assay kit (using a Qubit fluorimeter;

Invitrogen) and were subjected to PCR amplification of 16S rRNA genes using a two-step process.

The PCR reaction was carried out in duplicate with each replicate containing a 20 µl reaction volume. The amplified PCR products were pooled and cleaned using the QIAquick PCR purification kit (Qiagen) and analyzed on a 1.5% agarose gel. For the first round of PCR, non- barcoded primers 926Fi5 and 1392Ri7 were used for 25 cycles, while the barcoded primers P5-

S50X-OHAF and P7-N7XX-OHAF were used in the second step for 10 cycles. First PCR cycling conditions were 95 °C for 5 min, followed by 25 cycles of 95 °C for 45 s, 55 °C for 2 min, 72 °C for 4 min. This was followed by a final incubation at 72 °C for 10 min. The cycling conditions for the 2nd PCR reaction consisted of 95 °C for 3 min, followed by 10 cycles of 95 °C for 45 s, 55 °C for 2 min, 72 °C for 4 min, followed by a single final incubation at 72 °C for 10 min. The final concentrated PCR products were diluted with the Qiagen elution buffer to 4 ng/µl. The 16S amplicons were sequenced using the 300PE (paired-end) MiSeq protocol using the Illumina Miseq system of the Energy Bioengineering and Geomicrobiology Group (EBG) of the University of

Calgary.

Analyses of sequencing data involved merging the 300PE reads from both ends with a minimum overlap of 50 bp and a minimum length of 450 bp as cut-offs using the PEAR 0.9.6 software. The merged reads were processed using MetaAmp, a 16S rRNA data analysis pipeline

(Dong et al., 2017), developed by the Energy Bioengineering and Geomicrobiology Group in the

Department of Geoscience at the University of Calgary (http://ebg.ucalgary.ca/metaamp). The sequencing data retrieved were clustered into operational taxonomic units (OTUs) at a taxonomic distance of 3%. Rarefaction curves and alpha diversity indices were calculated including Chao1

(Chao 1984) and Shannon’s H-index (Shannon 1948). Relational trees showing the beta diversity of the amplicon sequences were visualized using MEGA 6 (Tamura et al., 2011).

5.3.8.1 Isolation and identification of perchlorate reducing bacteria (PRB)

Perchlorate reducing enrichments obtained from sample 18PW in VFA-containing minimal medium, at 30°C were plated on CSBK-agar medium containing 3 mM VFA and 10 mM perchlorate which was solidified with 15 g/L of agar after 10-fold serial dilution. The plates were incubated at 30°C in anaerobic jars that were flushed with N2-CO2 gas. After 3 days of incubation, single colonies were picked and transferred to CSBK medium with 3 mM VFA and 10 mM perchlorate. The purity of the isolates was confirmed by plating them again on CSBK agar medium. To identify the isolates, DNA extracted from 2 ml liquid culture of each isolate was amplified using universal primers 27F and 1525R which gave 1,500-bp 16S rRNA gene amplicons

(Frank et al., 2008). The resulting amplicons were identified by Sanger sequencing at the Core

DNA Services Laboratory of the University of Calgary. 16S rRNA gene sequence of the isolates and those of reference sequences retrieved from GenBank (Magnetospirillum caucaseum SO-1

(JX502622), M. magneticum AMB-1 (NR_074248), Magnetospirillum bellicus VDY

(NR_116009), Magnetospirillum aberrantis SpK (JQ673402), Magnetospirillum gryphiswaldense

MSR-1 (NR_121771), Magnetospirillum moscoviense BB-1 (KF712468) and Magnetococcus marinus MC-1 (NR_074371) were aligned with Clustal W (Thompson et al., 1994). A phylogenetic tree was constructed using MEGA version 6 (Tamura et al., 2013). The evolutionary history was inferred using the Neighbor-Joining algorithm (Saitou and Nei, 1987). The evolutionary distances were computed using the Maximum Composite Likelihood method

(Tamura and Kumar, 2004) and in the units of the number of base substitutions per site. Confidence estimates of branch clusters were obtained from bootstrap tests of 1000 replicates (Felsenstein,

1985).

5.3.9 Growth of perchlorate reducing isolates with different electron acceptors and electron donors

Growth medium was prepared as described in section 5.3.1. The time course of growth of isolates was evaluated using 20 mL anaerobic CSBK medium containing 10 mM acetate and 5 mM perchlorate, under an N2-CO2 headspace in 50 mL serum bottles. To determine the spectrum of substrates utilized by the pure isolates, the following electron donors (10 mM), were tested with perchlorate (5 mM) as electron acceptor in duplicate: acetate, lactate, propionate, butyrate, succinate, glutarate, glucose, H2 (20% added to the headspace already containg N2-CO2 ) and Na2S

(2.5 mM). A 12-h culture of each isolate, grown on acetate (10 mM) and perchlorate (5 mM) was used as inoculum (100 µL). In addition, reduction of perchlorate (5 mM) with different organic compounds was also evaluated. This included the aromatic compounds benzene (2 mM), toluene

(2.5 mM), ethylbenzene (2 mM) and m-xylene (1 mM), as well as the alcohols ethanol (5 mM) and methanol (5 mM). An aliquot of 100 µL of actively growing culture of the isolates growing on 10 mM acetate and 5 mM perchlorate was used as inoculum. Utilization of electron acceptors other than perchlorate for growth with acetate (10 mM) was determined for each isolate. Other electron acceptors used (at a concentration of 5 mM) were chlorate, nitrate, nitrite, sulfate and sulfite. Growth was monitored by visually estimating turbidity as –, +, ++ and +++, for clear, somewhat turbid, turbid, and very turbid respectively. Concentrations of organic acids and perchlorate were determined using HPLC. The decrease in concentration of electron acceptors reduced with added acetate was also monitored at the end the experiment. The effect of nitrate or nitrite on perchlorate reduction by isolate PRB4 was determined by adding 5 mM nitrite or nitrate to the culture at time 0 or 6 h.

5.4 Results

5.4.1 Activity test for chlorate and perchlorate reducers in an MHGC PW sample

CBSK media inoculated with 5% 18PW sample from the MHGC field and incubated at 30

°C, showed per(chlorate) reducing activity (Figure 5-1A to 5-1D). Perchlorate reduction was observed after a 4-day lag phase with complete reduction occurring after 24 days of incubation

(Figure 5-1A). All three organic acids (acetate, propionate and butyrate) were used for perchlorate reduction (Figure 5-1B). This shows that acetate, propionate, and butyrate are suitable electron donors for microbial perchlorate reduction in oil fields. Chlorate reducing activity was observed after a 3-day lag period. However, 10 mM chlorate was completely reduced after 13 days of incubation (Figure 5-1C). Propionate was the better substrate for chlorate reduction. At the end of the experiment about 10.8% residual propionate was observed in the medium, whereas 42 and 40% of acetate and butyrate remained in the medium, respectively (Figure 5-1D). At 4 days of incubation butyrate appeared to be the least utilized substrate with 28% of butyrate consumed, compared to 52% and 60% of acetate and propionate consumed, respectively. Butyrate and acetate utilization ceased after 5 to 10 days of incubation (Figure 5-1D). No increase in the concentration of chloride was seen as a result of chlorate reduction (Figures 5-1C). However, this was likely due to the high chloride concentration in the medium of 80 mM.

16 4 (A) (B) 12 3 Acetate 8 2 Propionate Butyrate 1

4 (mM) Concentration Perchlorate (mM) Perchlorate 0 0 0 5 10 15 20 25 30 0 5 10 15 20 25 30

12 (C) 100 6 (D) 10 5 80 Acetate 8 4 Propionate Chlorate 60 6 3 Butyrate Chloride 40

4 2 Chloride (mM) Chloride Chlorate (mM) Chlorate 20 2 (mM) Concentration 1 0 0 0 0 5 10 15 20 0 5 10 15 20 Time (d)

100

5.4.2 Microbial growth and community composition of enrichments with nitrate or perchlorate

Cultures growing with nitrate and VFA or with perchlorate and VFA were compared. In the cultures with nitrate and VFA, 4.6 mM of nitrate was reduced with transient formation of 1.2 mM nitrite during the initial 24-h of incubation (Figure 5-2B). This rapid nitrate reduction led to an increased OD600 from 0.15 at 0-h to 0.27 at 42-h (Figure 5-2A). Subsequent incubation did not lead to changes in OD600 up to 336-h. Nitrate was completely reduced at 48 h (Figure 5-2A).

Samples for microbial community analysis were taken at 48 h, when nitrate reduction had just been completed and at 336 h, which represented a prolonged incubation under fermentative conditions. At 48 h of incubation, 85% of the microbial community was Pseudomonas sp whereas

2% of the community was Thauera sp. Both of these are known hNRB. At 336-h the fraction of

Pseudomonas sp. had decreased from 85% to 74%, whereas that of Thauera had increased from

2% to 10.5% (Figure 5-2C). Increases were also seen for the genus Petrimonas (0.01 to 1.74%) and Acholeplasma (0.15 to 1.7%).

During the experiment with perchlorate peak a OD600 of 0.50 was observed at 72 h (Figure

5-3A). Most perchlorate was reduced during this period; a slower reduction was observed from 72 to 300 h. The perchlorate reducing community was more diverse then the nitrate-reducing community. The dominant community members at 96-h (Figure 5-3C) were members of the family

Desulfuromonadales (39.2%), Mollicutes EUB33-2 (19.3%), Acholeplasma (5.0%),

Acidaminobacter (7.9%), Sphingobacteria WCHB1-69 (7.4%), Paludibacter (12.7%) and

Magnetospirillum (1%). At 336-h, members of the class Mollicutes, and Sphingobacteria (34%, and 14%, respectively), as well as the genus Acholeplasma, increased. In the media containing both nitrate and perchlorate, perchlorate reduction did not occur until nitrate reduction was complete (Figure 5-4B). Thus biphasic growth occurred with initial nitrate reducing growth from 101

0 to 48 h to OD600 = 0.27 followed by perchlorate reducing growth from 48 to 72 h (Figure 5-4A),

OD600 = 0.88 at 120-h. The microbial community compositions indicated dominance of

Pseudomonas (83% at 48-h in the initial growth phase and 86% at 72-h) and Thauera (16% at 48- h and 11.76% at 72-h). From 120-h to 336-h, other taxa of the genus Acholeplasma (10.4% to

47.2%), Sphingobacteria (4% to 13.8%), the genus Fusibacter (0.85%) and the family

Rikenellaceae (11.6%) belonging to the order Bacteroidales were observed (Figure 5-4C). No significant change in pH was observed during the experiments with pH in the range of 7.6 to 8.0

(Figure 5-5). Note that sequence ID, QC reads, numbers of operational taxonomic units (OTUs) and taxa can be found in Appendix Table S5-1.

102

1 10 (A) (B)

) 0.8 8 600 0.6 6 336h

0.4 48h 4 nitrite species (mM)

- Nitrate Growth Growth (OD 0.2 N 2

0 0 0 100 200 300 400 500 600 0 100 200 300 400 500 600 Time (h)

(C) Tenericutes;Mollicutes;EUB33-2; 100 Tenericutes;Acholeplasma; Spirochaetes;Treponema; 80 Spirochaetes;Spirochaeta; Gammaproteobacteria;Thiomicrospira; 60 Gammaproteobacteria;Pseudomonas; Betaproteobacteria;Thauera; 40 Clostridia;Syntrophomonas; Clostridia;Tissierella; 20 Sphingobacteriia;WCHB1-69; Bacteroidia;Rikenellaceae;vadinBC27 0 Bacteroidia;Proteiniphilum; MN_48h MN_336h Bacteroidia;Petrimonas;

103

1 12

(A) 10 (B) 0.8

) 96h 8 600 0.6 336h 6

0.4 Perchlorate (mM)

4 Growth Growth (OD

0.2 2

0 0 0 100 200 300 400 500 600 0 100 200 300 400 500 600

Time (h)

100 (C) Gammaproteobacteria;Thiomicrospira; Bacteroidia;Petrimonas; Clostridia;Lachnospiraceae; 80 Gammaproteobacteria;Pseudomonas; Spirochaetes;LNR_A2-18; Bacteroidia;Rikenellaceae;vadinBC27 60 Clostridia;Fusibacter; Betaproteobacteria;Thauera; Alphaproteobacteria;Magnetospirillum; 40 Clostridia;Anaerovorax; Bacteroidia;Proteiniphilum; Spirochaetes;Spirochaeta; Clostridia;Acidaminobacter; 20 Bacteroidia;Paludibacter; Sphingobacteriia;WCHB1-69; Tenericutes;Acholeplasma; 0 Deltaproteobacteria;Desulfuromonadales; Tenericutes;Mollicutes;EUB33-2; MP_96h MP_336h

104

1 120h 12 (A) (B) 0.8 10

) nitrite 72h

600 8 0.6 nitrate 48h 6 336h 0.4 Perchlorate

4 Growth Growth (OD

0.2 Concentration (mM) 2

0 0 0 100 200 300 400 500 600 0 100 200 300 400 500 600 Time (h)

(C) 100 Acholeplasma; Treponema; Spirochaeta; Spirochaetes;LNR_A2-18; 80 Thiomicrospira; Pseudomonas; Thauera; Magnetospirillum; Desulfitispora; 60 Lachnospiraceae; Anaerovorax; Fusibacter; Tissierella; 40 Acetobacterium; Dethiosulfatibacter;

% relative relative % sequence Proteiniclasticum; Christensenellaceae; 20 Sphingobacteriia;WCHB1-69; Bacteroidetes;SB-1; Rikenellaceae;vadinBC27 Proteiniphilum; Petrimonas; 0 Paludibacter; 48h 72h 120h 336h Methanocalculus;

Figure 5-4: Time course of nitrate and perchlorate reduction in 18 PW communities incubated in CSBK medium containing 10 mM each of nitrate and perchlorate and 6 mM VFA. (A) Growth OD at 600nm (B) nitrate, nitrate and perchlorate concentrations and (C) microbial community composition at T= 48 h, 72 h, 120 h and 336 h.

105

8.4 8.2 8 7.8

pH MN 7.6 MP 7.4 MPN 7.2 7 0 100 200 300 400 500 600 Time (d)

Figure 5-5: Medium pH as a function of time during microbial growth in medium with nitrate (MN), perchlorate (MP) or nitrate and perchlorate (MPN).

106

5.4.3 Corrosivity of perchlorate and its reduction products

To test the suitability of perchlorate injection for souring control purposes, the corrosiveness of perchlorate and its breakdown products were evaluated under chemical (abiotic) and biological (biotic) conditions. Incubation of carbon steel beads for 30 days in CSBK medium containing 10 mM perchlorate and 3 mM VFA without inoculum gave the lowest corrosion rates

(average 0.0023 ± 0.0016 mm yr-1), did not show any sign of pitting and the media remained clear

(Figure 5-6A and B). Corrosion rate for beads in CSBK medium containing 10 mM perchlorate inoculated with a perchlorate reducing enrichment was 5-fold higher than abiotic incubations with perchlorate (average 0.0122 ± 0.0008 mm yr-1; Figure 5-6B:). Perchlorate was completely reduced in the first five days of incubation, but not in the uninoculated media (Figure 5-6C). The medium containing 10 mM chlorate and VFA had a brownish colour at the end of the 30-day incubation period (Figure 5-6A). Tiny pits were observed on the bead surface (not shown), which had general corrosion rates of up to 0.0754 ± 0.0006 mm yr-1. Beads abiotically incubated in CSBK medium with 10 mM chlorite had increased pits covering the bead surface, causing the beads to lose their perfectly spherical shape; the general corrosion rate was 0.204 ± 0.030 mm yr-1. Hence, perchlorate was not very corrosive under abiotic or biotic conditions, whereas chlorate and chlorite were increasingly corrosive under abiotic conditions.

107

- - - Perchlorate (ClO4 ) Chlorate (ClO3 ) Chlorite (ClO2 ) (A)

12 0.25 (B) (C) 10 0.2 8 Chemabiotic Pc 0.15 6 Biobiotic Pc 0.1 4

0.05 2 Perchlorate Perchlorate (mM)

Average CR (mm/yr) Average 0 0 Perchlorate Chlorate Chlorite PRB + 0 5 10 15 20 25 Time (d) Perchlorate

108

5.4.4 Sulfate reduction with oil: inhibition with perchlorate and nitrate under batch culture conditions

The effect of nitrate, perchlorate, or nitrate and perchlorate on sulfate reduction by mSRB in 18PW inoculated CSBK medium containing 1 mL of MHGC oil as electron donor was tested under batch culture conditions. Sulfate reduction with oil as electron donor proceeded slowly with a lag phase of 24-days in the incubation amended only with sulfate (SO; Figure 5-7A). Complete reduction of 5 mM sulfate was observed after 77 days of incubation with accumulation of 3.3 mM aqueous sulfide. Whereas for the perchlorate and sulfate containing incubation, a longer sulfate reduction lag of about 65 days was observed (Figure 5-7C). In the presence of 10 mM nitrate, sulfate reduction was completely inhibited in medium containing nitrate and sulfate (SNO; Figure

5-7B). Nitrate was completely reduced after 24 days, with peak nitrite (3.5 mM) production occurring at day 9. Nitrite was further reduced to 1 mM at day 24 and this concentration persisted in the medium preventing the onset of sulfate reduction. One reason for the persistence of nitrite in the cultures may have been be the depletion of the alkylbenzenes toluene, ethylbenzene and m,p- xylene for the complete reduction of nitrite. These alkylbenzenes were depleted at the end of the incubation. In agreement with our findings, Agrawal et al. (2011), observed that in oil containing medium, sulfate reduction in the presence of nitrate only occurred following the complete reduction nitrate and nitrite.

In incubations containing sulfate or sulfate and perchlorate, all alkylbenzenes (toluene ethylbenzene and [m, p, o] -xylene) monitored were utilized for sulfate reduction, but not for perchlorate reduction (Figure 5.8). Also, no perchlorate reduction was observed in the perchlorate- only control (Figure 5-7E) and this was confirmed by the presence of alkylbenzenes in this treatment relative to the control (Figure 5.8). In incubations with all three electron acceptors

109

(nitrate, sulfate and perchlorate) sulfate reduction resumed at 100 days, 34 days after complete reduction of nitrate, despite the presence of 10 mM perchlorate.

110

10 12 (A) SO (C) PSO 8 10 8 6 Sulfide Sulfide Sulfate 6 Perchlorate 4 Sulfate 4 2 2 0 0 0 20 40 60 80 100 0 20 40 60 80 100 120 12 10 (B) SNO (D) PSNO 12 8 Sulfide 10 6 Sulfide Nitrite Perchlorate 4 8 Nitrate Sulfate 2 Sulfate 6 Nitrite

Concentration (mM) Concentration Nitrate 0 4 0 20 40 60 80 100 120 14 2 (E) PO 12 0 10 0 20 40 60 80 100 120 8 Perchlorate 6 4 2 0 0 20 40 60 80 100 120 Time (d)

111

0.08

ratio) Control 0.07 SO area SNO 0.06 PSO

(peak PSNO 0.05 PO 0.04

0.03 mesitylene

0.02

0.01

Alkylbenzene/ 0.00 Toluene Ethylbenzene m-pm,p Xylene- o Xylene

Figure 5-8: Gas chromatography-mass spectrometry analysisxylene of the alkylbenzenes in MHGC oil utilized for incubations of Figure 5-7 after 123 days. The fraction of alkylbenzenes remaining was calculated as the ratio of the peak area of each alkylbenzene to that of mesitylene (1,3,5-trimethylbenzene). Data presented are means and error bars are for duplicate measurements.

112

5.4.4.1 Microbial community compositions of batch cultures with oil

Comparison of sequences for incubations SO, SNO, PSO, PSNO and PO indicated separated clusters I and II (Figure 5-9). Cluster I consisted of sulfate, sulfate and perchlorate and perchlorate incubations, while cluster II was made up of communities in nitrate containing incubations SNO and PSNO at different time points. Cluster I had high fractions of

Deltaproteobacteria sequences from 8.2% to 12.5%, whereas cluster II had high fractions of classes Betaproteobacteria and Gammaproteobacteria (Figure 5-9A). Communities in cluster I also had higher fractions of the candidate phylum Atribacteria, Euryachaeota, Firmicutes and

Spirochaetae (Figure 5-9B). Unique to cluster-I was the candidate phylum Cloacimonetes, which is mostly found in anaerobic environments, often in close association with Firmicutes (Stolze et al., 2016). Cloacimonetes have been predicted to be syntrophic propionate degraders (Hamilton et al., 2016), that can also ferment amino acids, producing H2 and CO2 which is utilized either by hydrogenotrophic methanogens or sulfate-reducers (Stolze et al., 2016).

The nitrate containing incubations had significant fractions of Betaproteobacteria (45.6% to 83.5%) mainly of the genus Thauera (Figure 5-9A: Table 5-1, #1). The percentage of Thauera in these incubations varied with time for SNO (from 81.6% at day 9 to 54.8% at day 123) and

PSNO (54% at day 9 to 44% at day 123; Table 5-1). The members of the class

Gammaproteobacteria in these incubations were between 12.2 to 42.6% at day 9 which decreased to 1.8 and 2.5% at day 123. Pseudomonas, was the dominant genus in this class (Table 5-1, #4).

As mentioned earlier, SO, PSO and PO incubations contained taxa, which were absent from the nitrate containing incubations. These included the genus Smithella (2.8% in SO, 4.5 to 5.8% in PSO and 6.5% in PO) and Desulfomicrobium (2.4, 1.5 and 0.9%, respectively) (Table 5-1, #9 and #18). However, the SRB Desulfarculus, (1 to 3%), and Desulfobacteraceae (0.45 – 1.19%) 113

were present only in SO and PSO incubations (Table 5-1, #16 and 22). Further, Pelotomaculum sp were also identified in the SO (10.9%) and PSO (39%) incubations and their presence suggests possible involvement in sulfate reduction in these incubations. Members of this genus are commonly known as fermenters that form syntrophic partnerships with methanogens and other anaerobic organisms. Dong et al. (2017a) showed that Pelotomaculum sp could couple the reduction of sulfate to anaerobic oxidation of benzene to benzoyl-CoA. In addition, they posses all sulfate reduction genes and are capable of electron transfer mechanisms similar to Gram positive

SRB (Dong et al., 2017a). Similar to the microbial community composition of the VFA enriched perchlorate reducers presented in Figure 5-3, the PO incubation, contained sequences belonging to Sphingobacteria WCHB1-69 (11.9%) and Acholeplasma (2.62%) (Table 5-1, #2 and 12). These two were among the dominant taxa in the VFA enriched perchlorate reducing communities, but those present in the PO incubations did not catalyze perchlorate reduction.

114

(A) ProteobacteriaProteobacteria (B) Other Phyla Phylum Woesarchaeota Diapherotrites SOASO 060317 d=123d Euryarchaeota PSOB 260117 I PSO d=85d Atribacteria PSOBPSO 060317 d=123d Bacteroidetes POPOA 060317 d=123d Chlorobi SNOBSNO 260117 d=85d Chloroflexi SNOBSNO 060117 d=65d Cloacimonetes PSNOBPSNO 260117 d=85d Deferribacteres PSNOBPSNO 060117 d=65d Firmicutes II SNOSNOB 060317 d=123d PSNOPSNOB 060317 d=123 Spirochaetae SNOSNOB 091116 d=9d Synergistetes PSNOPSNOB 091116 T=9d Tenericutes Thermotogae 0 20 40 60 80 100 0 20 40 60 80 Alphaproteobacteria Betaproteobacteria Deltaproteobacteria Epsilonproteobacteria Gammaproteobacteria

115

Table 5-1: Microbial community compositions of batch incubations. The numbers of reads are indicated together with some bioinformatic parameters. The fractions (%) of the indicated taxa are shown

PSNO SNO SNO PSNO PSNO PSNO SNO SNO PO PSO PSO SO

# T=9d T=9d T=123d T=123d T=65d T=85d T=65d T=85d T=123d T=123d T=85d T=123d

V64_410 V64_41 V66_425 V66_425 V64_4 V64_4 V64_4 V64_4 V66_425 V66_425 V64_411 V66_425 Sequence ID 9 12 1 3 110 111 113 114 4 2 5 0 # of QC Reads 57231 66669 28254 31951 29220 49339 43903 56034 29865 65303 43493 27962 # OTUs 115 124 215 148 156 175 160 163 287 322 325 311 # Taxa 97 96 151 127 129 136 136 136 269 279 279 286 Shannon index 0.92 0.76 1.91 2.04 1.76 1.90 1.98 2.00 3.61 3.58 2.82 3.93 #Taxonomy 1 Bacteria;Proteobacteria;Betaproteobacteria;Rhodocyclales;Rhodocyclaceae;Thauera; 54.03 81.58 54.78 44.09 52.00 46.21 45.05 47.58 7.40 0.63 2.69 0.07 2 Bacteroidete;Sphingobacteriia;Sphingobacteriales;NAWCHB1-69; 0.54 1.71 21.56 15.37 28.58 30.72 30.65 28.17 11.21 5.91 7.08 14.18 3 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae;Pelotomaculum; 0.00 0.00 0.12 19.92 0.01 0.00 0.00 0.00 0.00 24.31 39.96 10.97 4 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadaceae;Pseudomonas; 42.55 12.14 1.89 1.43 0.69 1.23 1.46 2.13 6.41 3.12 0.60 4.50 5 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Alcaligenaceae;Bordetella; 0.98 1.90 0.63 0.67 1.85 1.36 3.08 1.83 9.88 6.01 0.00 5.00 6 Bacteria;noCandidate-division-WS6; 0.00 0.00 1.94 1.93 6.12 6.74 3.82 3.21 0.15 3.02 0.98 1.62 7 Bacteria;Chloroflexi;Anaerolineae;Anaerolineales;Anaerolineaceae; 0.02 0.04 5.35 2.08 1.72 1.76 1.54 1.52 2.99 3.64 1.40 3.69 8 Bacteria;Chlorobi;Ignavibacteria;Ignavibacteriales;NAIheB3-7; 0.00 0.01 4.61 3.86 2.46 4.09 2.24 2.60 0.08 0.03 0.01 0.08 9 Bacteria;Proteobacteria;Deltaproteobacteria;Syntrophaceae;Smithella 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 6.46 4.48 5.76 2.76 10 Bacteria;Bacteroidetes;Sphingobacteriia;Sphingobacteriales;NAB01R012; 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 6.73 6.39 0.49 1.34 11 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Mesotoga; 0.01 0.02 0.02 0.01 0.01 0.01 0.01 0.02 1.39 3.54 2.19 3.36 12 Bacteria;Tenericutes;Mollicutes;Acholeplasmatales;Acholeplasmataceae;Acholeplasma; 0.17 0.42 0.12 0.03 0.00 0.00 0.14 0.31 2.62 1.22 1.84 3.30 13 Bacteria;Microgenomates; 0.00 0.00 0.71 2.85 1.08 1.88 0.43 0.56 0.14 1.28 0.18 0.37 14 Archaea;NAWoesearchaeota-(DHVEG-6); 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 3.44 1.21 4.37 0.22 15 Bacteria;Firmicutes;Clostridia;Clostridiales;Syntrophomonadaceae;Syntrophomonas; 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 6.85 0.15 0.03 0.00 16 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfarculaceae;Desulfarculus; 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 3.08 2.58 1.05 17 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriaceae;Raoultella; 0.00 0.00 0.27 0.14 0.00 0.00 0.00 0.00 2.90 1.36 0.00 1.40 18 Bacteria;Proteobacteria;Deltaproteobacteria;;Desulfomicrobiaceae;Desulfomicrobium; 0.00 0.00 0.02 0.00 0.00 0.00 0.00 0.00 0.88 1.56 1.00 2.43 19 Bacteria;Firmicutes;Clostridia;Clostridiales;NAFamily-XIII;Anaerovorax; 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.61 1.78 1.38 1.71 20 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfovibrionaceae;Desulfocurvus; 0.07 0.18 0.01 0.01 0.16 0.11 0.45 0.21 0.07 0.27 1.23 0.81 21 Bacteria;Firmicutes;Bacilli;Lactobacillales;Streptococcaceae;Streptococcus; 0.00 0.00 0.01 0.00 0.03 0.01 0.01 0.00 2.68 0.07 0.00 0.03 22 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfobacterales;Desulfobacteraceae; 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.45 0.46 1.19

116

5.4.5 Souring control in oil containing bioreactors using nitrate and perchlorate

Eight sand packed columns containing 0.5 PV of residual MHGC oil, were set up to evaluate the control of sulfide production by SRB using nitrate, perchlorate or a combination of these. Duplicate 50 mL glass columns were used for each treatment condition, and two columns remained untreated. To ensure uniformity, all the columns were inoculated with the same SRB culture previously enriched with MHGC oil and 2 mM sulfate. Following a 20-day incubation period, these columns were flooded continuously with anaerobic CSBK medium, containing 2 mM sulfate and monitored until approximately 2 mM sulfide was produced. Once souring had been established, treatment with either nitrate or perchlorate resumed.

In the untreated control columns sulfide production was observed on day 4 (0.88 ± 0.06 mM) and reached 1.8 ± 0.11 mM on day 45 (Figure 5-10A). Sulfide production of up to 2 mM was maintained in the control bioreactors throughout the experiment (day 45 to 150). To inhibit sulfide production, a set of sour duplicate columns with mean sulfide concentration of 1.7 ± 0.15 mM was injected with CSBK medium containing 2 mM sulfate and 1 mM nitrate. Injection of 1 mM nitrate caused inhibition of sulfate reduction, with sulfide concentrations decreasing to 0.1 mM with the first 2 PV of injection medium. Sulfide production recovered with further injection of 1 mM nitrate. Increasing the nitrate concentration to 2 mM also caused only transient partial inhibition of sulfide production. However, when the nitrate concentration was increased to 4 mM, sulfide production was completely inhibited and the measured effluent sulfate concentrations reached 2 mM (Figure 5-10B). Nitrate (0.6 mM) was only detected in the bioreactor effluent in the first PV of injection with 4 mM nitrate, whereas nitrite was not detected (Figure 5-10B). When nitrate injection was stopped, sulfide recovered to 2 mM.

117

Injection of perchlorate at increasing concentrations of 1, 2 or 4 mM did not control the activity of SRB in the bioreactors as shown in Figure 5-10C. As in batch cultures incubation with oil, perchlorate was not reduced in the bioreactors and the concentration injected was fully recovered in the effluent. Since perchlorate showed no inhibition of SRB activity, chlorite was injected instead to control SRB activity (Figure 5-10C). Supplementation of 1 mM chlorite in the influent media had a small effect on sulfide production. After 5 PV of injection sulfide decreased from 1.89 mM to 1.56 mM. However, increasing the chlorite concentration to 2 mM induced complete inhibition of sulfide production by SRB in the bioreactors. Recovery of SRB activity following the cessation of the chlorite injection, required the injection of a total of 28 PV of the

CSBK medium containing 2 mM sulfate to reach 1 mM sulfide (Figure 5-10C).

Combined injection of nitrate and perchlorate was carried out also as shown in Figure 5-

10D. Addition of 1 mM nitrate to the CSBK medium, caused transient inhibition of sulfide production. Sulfide concentrations decreased from 1.79 mM to 0 mM following injection of the first 5PV of media and then recovered to 1.8 mM. Nitrate was consumed in the bioreactors and nitrite was only detected transiently in the effluent. Combining 2 mM perchlorate with 1 mM or 2 mM nitrate, did not give increased inhibition of sulfate reduction, and sulfide production was maintained at 1.8 mM (Figure 5-10D). Switching the injection medium to CSBK with 4 mM nitrate and 2 mM sulfate gave an immediate inhibition of sulfide production and increased the effluent sulfate concentrations to 1.72 mM. Sulfate reduction resumed 22-days after nitrate injection was stopped.

118

3 (A)

2.5

1.5 Sulfide data Sulfate data 1

0.5

0 0 20 40 60 80 100 120 140 160

(B) 2.5 1 mM 2 mM 4 mM - - - NO3 NO3 NO3 2

1.5 Sulfide Sulfate 1 Nitrate Nitrite 0.5

0 0 20 40 60 80 100 120 140 160

4.5 (C) 4

3.5 Sulfide data 3 Sulfate data 1 mM 2 mM 1 mM

Concentration (mM) Concentration 4 mM 2 mM 2.5 - - - - - Perchlorate ClO4 ClO4 ClO4 ClO2 ClO2 2 1.5 1 0.5 0 0 20 40 60 80 100 120 140 160 (D) - - 1 mM NO3 2 mM NO3 4 mM - 1 mM NO3 - - - 2 mM ClO4 2 mM ClO4 NO3 2.5

Sulfide data 1.5 Sulfate data 1 Perchlorate Nitrite_BPcH 0.5 Nitrate_BPcH

0 0 20 40 60 80 100 120 140 160 Time (d)

Figure 5-10: Effect of nitrate, perchlorate or chlorite or nitrate and perchlorate on sulfide production in low temperature oil containing bioreactors. Bioreactors were inoculated with SRB batch cultures that were pre-grown and transferred twice in CBSK medium with sulfate and MHGC oil. Bioreactors were continuously injected with CBSK medium containing 2 mM sulfate at a flowrate of 0.5 PV/day. The effluent concentrations of sulfate, sulfide, nitrate, nitrite and perchlorate are shown for untreated control columns (A), columns injected with nitrate (B), columns injected with perchlorate or chlorite (C), and columns injected with nitrate and perchlorate (D) as a function of time.

119

5.4.6 Reduction of nitrite and chlorite by oilfield microbes using VFA or oil

Successful control of SRB activity in the reservoir with inhibitors depends on the availability and stability of inhibitors in the aqueous phase. Nitrite and chlorite are potential products of nitrate and perchlorate reduction that inhibit SRB activity. The concentration of these inhibitors under reservoir conditions may become limiting due to their chemical lability and reaction with sulfide, or their further reduction to non-inhibitory end products. The rate of nitrite and chlorite reduction by oil field microbes was evaluated in batch experiments simulating reservoir conditions. In this study, 50 mL CSBK medium, amended with 1 mL MHGC oil or 3 mM VFA (acetate, propionate and butyrate) and 4 mM nitrite or chlorite was inoculated with 10%

18PW and incubated at 30 °C for 30 days. The results indicated that oilfield microbes rapidly reduced nitrite to N2 with VFA, while nitrite reduction with oil medium progressed more slowly over a 26-day period (Figure 5-11). Chlorite on the other hand was not reduced in the presence of

VFA or oil (Figure 5-11). Chlorite can be disproportionated to chloride and oxygen, a non-energy yielding reaction, catalyzed by chlorite dismutase (van Ginkel et al., 1996; Bender et al., 2005;

Rikken et al., 1996; Bardiya and Bae, 2011; Schaffner et al., 2015). Enzymatic disproportionation of chlorite did not occur in the incubations in Figure 5-11, so chlorite concentrations remained constant. Chlorite dismutase activity is significantly demonstrated under anaerobic conditions in the presence of perchlorate (Chaudhuri et al., 2002). Chlorite, a strong oxidant, reacts non- specifically with biomolecules resulting in cell damage or death (Mcdonnell and Russell, 1999).

The concentration of chlorite used in this study may have been toxic to the microbes present in the produced water sample. Thus, it is possible that the chlorite incubations with VFA or oil in figure

5-11 were effectively abiotic. VFA or oil components did then not react chemically with chlorite.

120

3 Nitrite_VFA Nitrite_oil 2 Chlorite_VFA

Concentration Concentration (mM) 1 Chlorite_oil

0 0 5 10 15 20 25 30

Time (d)

Figure 5-11: Comparing reduction of nitrite and chlorite by oilfield microbes with a simple or complex electron donor, VFA or oil, respectively.

121

5.4.7 Use of alkylbenzenes for perchlorate reduction

Considering that perchlorate reduction did not occur in any of the batch culture incubations nor in the bioreactor experiments with oil, the utilization of individual alkylbenzenes (toluene and ethylbenzene) as substrate/electron donor for perchlorate reduction was evaluated. To assess the reduction of perchlorate with alkylbenzenes, two different inoculum sources were used; the first inoculum was a 20-fold concentrated 18PW sample and the other inoculum was a nitrate reducing chemostat culture, continuously fed with either toluene or ethylbenzene. Alkylbenzenes used were added directly to 50 mL aqueous CSBK medium or to 1 mL of an HMN layer (to minimize toxicity) in serum bottles containing CSBK medium. A 1 mL of 20-fold concentrated 18PW or a

5 mL inoculum of a chemostat culture were then added.

The results in Figure 5-12 (A-H) show that toluene or ethylbenzene did not reduce perchlorate within 30 days of incubation, regardless of which inoculum was used. However, when incubations that were inoculated with concentrated 18PW were amended with 10 mM acetate after day 30 (Figure 5-12 E-H), perchlorate was reduced to 2 mM in all four incubations, indicating that perchlorate reducing bacteria (PRB) using acetate were present. These could not use toluene or ethylbenzene.

Similarly, in media inoculated with the chemostat cultures, pre-grown on nitrate, toluene and ethylbenzene, no reduction of perchlorate was observed. However, when 5 mM nitrate was injected into the media on day 30, rapid nitrate reduction occurred with transient nitrite accumulation, before its reduction to N2 (Figure 5-12 A-D). Hence, the chemostat cultures contained toluene and ethylbenzene oxidizing NRB, but no PRB capable of using these substrates.

122

12 (A) NTP 12 (E) PWT 10 10 8 8 6 6 4 Perchlorate 4 2 Nitrite 2 Nitrate 0 0 0 10 20 30 40 50 0 10 20 30 40 50

12 (B) NTHP 12 (F) PWHT 10 10 8

6 6 Perchlorate 4 4 Nitrite 2 2 Nitrate 0 0 0 10 20 30 40 50 0 10 20 30 40 50 12 (C) NEP 12 (G) PWE 10 10

8 8 Perchlorate (mM) Perchlorate 6 (mM) Concentration 6 4 Perchlorate 4 Nitrite 2 2 nitrate 0 0 0 10 20 30 40 50 0 10 20 30 40 50 12 12 (D) NEPH (H) PWHE 10 10

8 8

6 6

4 Perchlorate 4 nitrite 2 2 nitrate 0 0 0 10 20 30 40 50 0 10 20 30 40 50 Time (d)

Figure 5-12: Effect of alkylbenzenes on perchlorate reduction. The alkylbenzenes toluene and ethylbenzene were added directly to 50 mL CSBK or to 1 mL HMN layer in 50 mL CSBK, containing 10 mM perchlorate and inoculated with 1mL of a 20-fold concentrated - 18PW or 5 mL nitrate reducing chemostat cultures growing on toluene or ethylbenzene. Media inoculated with NRB chemostat cultures are labelled A-D; toluene added to aqueous layer - NTP (A), toluene in HMN layer – NTPH (B), ethylbenzene in aqueous layer – NEP (C), ethylbenzene in HMN layer– NEPH (D), Media inoculated with 18PW labelled E-H; toluene added to aqueous layer - PWT (E), toluene in HMN layer – PWTH (F), ethylbenzene in aqueous layer – PWE (G), ethylbenzene in HMN – PWHE (H). The arrow (↓) indicates the point where nitrate (A-D) or acetate (E-H) was injected into the serum bottles. Data presented are averages of duplicate incubations 123

5.4.8 Effect of perchlorate and chlorite on sulfide production by D. vulgaris Hildenborough

Perchlorate, a sulfate analogue, has been shown to inhibit sulfate reduction by SRB through the direct inhibition of the ATP-sulfurylase, as well as by preventing sulfate uptake (Carlson et al.,

2015). Inhibition of sulfate reduction in Desulfovibrio vulgaris Hildenborough (DVH) using perchlorate or chlorite was evaluated. Perchlorate or chlorite was added at times 0, 3, 6 or 12 h to a DVH culture growing on 4 mM lactate and 2 mM sulfate in CSBK medium. Addition of 2 or 10 mM perchlorate to the DVH culture at 0, 3, 6 or 12 h of incubation showed no direct effect on growth (not shown) or sulfide production (Figure 5-13A, B). Sulfide production in the controls (0 mM) was comparable to that in incubations treated with 2 or 10 mM perchlorate. Injection of 5 mM chlorite to the DVH culture, instantly stopped reduction of sulfate to sulfide, when injected at different time points relative to the untreated control culture (Figure 5-13C, D). Decreasing the injected chlorite concentration to 2 mM was also inhibitory to the DVH culture. Chlorite reacted with sulfide in the medium forming sulfur (So), which precipitated out of the medium.

124

Perchlorate

2 (A) 2 mM 2 (B) 10 mM

1.5 1.5 DP0h DP0h DP3h DP3h 1 1 DP6H DP6H DP12h

Sulfide (mM) Sulfide DP12h 0.5 (mM) Sulfide 0.5 Control Control

0 0 0 10 20 30 40 50 0 10 20 30 40 50 Time (h)

5mM Chlorite 3 (C) 2.5 (D) 2.5 2 2 DC0h 1.5 DC3h 1.5 1 DC6h

1 Sulfate (mM) Sulfate Sulfide (mM) Sulfide DC12h 0.5 0.5 Control 0 0 0 10 20 30 40 50 0 10 20 30 40 50 Time (h)

125

5.4.9 Isolation and characterization of VFA oxidizing PRB

Perchlorate reducing consortia (Figure 5-14A) enriched from the MHGC oil field 18PW sample and plated on CSBK agar medium containing perchlorate and VFA, yielded isolates PRB1,

PRB2 and PRB4. This reduced perchlorate in CSBK medium. The time course for perchlorate reduction was further determined for isolate PRB4. Figure 5-14B shows that isolate PRB4, reduced perchlorate within 35 h of incubation, i.e 5-fold faster than the enrichment. Chlorate formation was not observed. The reduction of perchlorate with different organics as well as the utilization of alternate electron acceptors by the isolates were determined following 7 days of incubation at

30°C. As shown in Table 5-2, the three isolates coupled the reduction of perchlorate to oxidation of acetate propionate, lactate, butyrate, succinate and glucose but not to glutarate. Growth occurred in medium with a headspace with 20% (v/v) H2, however, perchlorate reduction occurred very slowly over a 21-day incubation period. No growth or perchlorate reduction occurred with H2S.

Of the alcohols tested, only ethanol was used for perchlorate reduction (Table 5-2). None of the alkylbenzenes tested was used for growth Chlorate accumulation was not observed during growth of the isolates with any of the electron donors utilized. PRB 1, 2 and 4 used chlorate, nitrate and nitrite as alternative electron acceptors, using acetate as electron donor. However, sulfate and sulfite were not utilized (Table 5-2).

The effect of nitrate or nitrate on perchlorate reduction showed that isolate PRB4 could simultaneously reduce perchlorate in the presence of nitrite or nitrate (Figure 5-15). Figures 5-

15A, B and C illustrate the reduction patterns exhibited by isolate PRB4 when grown in medium with perchlorate, nitrite or nitrate. Perchlorate and nitrate were completely reduced at 18 h (Figure

5-15A), chlorate (results not shown) was not detected in the medium (not shown) and transient nitrite formation was seen during nitrate reduction (Figure 5-15C). Nitrite reduction was slower in 126

isolate PRB4 than perchlorate or nitrate reduction. Nitrite consumption was complete at 48 h after an initial 12 h lag period which was 6-h more than was observed with perchlorate or nitrate. Nitrate addition at 0 h or 6 h did not inhibit of perchlorate reduction by PRB4 (Figure 5-15F-G).

Perchlorate and nitrite reduction also occurred simultaneously (Figure 5-15 D and E), but the time taken for complete perchlorate reduction increased by an extra 30 h when compared to the perchlorate only control (from 18 h to 48 h; Figure 5-15 A).

A phylogenetic tree based on near full length 16S rRNA gene sequences (1367 bp) is presented in Figure 5-16. 16S rRNA gene sequences of PRB2 and PRB4, grouped together with

Magnetospirillum moscoviense BB-1; this grouping was, supported by a bootstrap value of 92%.

The 16S gene sequence similarity between PRB2 and M. moscoviense BB-1, and PRB4 and M. moscoviense BB-1 were 93% and 92.7%, respectively (Table 5-3). PRB2 and PRB4 shared 99.2%

16S rRNA sequence similarity and clustered together with bootstrap support of 100%. Sequence similarity to other Magnetospirillum strains was between 88.1 – 90.6%.

127

12 (B) Isolate PRB4 4 (A) PRB enrichment

10 3 8

2 6

4 1 Perchlorate (mM) Perchlorate 2

0 0 0 2 4 6 8 10 12 0 10 20 30 40 50 60 Time (d) Time (h)

128

Table 5-2: Anaerobic growth tests of perchlorate reducing isolates PRB1, PRB2 and PRB4 using different electron acceptors and electron donors

Electron Concentration PRB1 PRB2 PRB4 Donors (mM) Acetate 10 + + ++ Propionate 10 +++ +++ +++ Butyrate 10 +++ +++ +++ Lactate 10 +++ +++ +++ Glutarate 10 - - - Succinate 10 +++ +++ +++ Perchlorate as Glucose 10 + + + electron H2 20% + + + acceptor H2S 5 - - - Methanol 2 - - - Ethanol 2 +++ +++ +++ Aromatic compounds Benzene 3 - - - Toluene 2.5 - - - Ethylbenzene 2 - - - m-xylene 2 - - - Electron acceptors Electron Donor: 10 mM acetate Perchlorate 5 +++ +++ +++

Chlorate 5 +++ +++ +++ Chlorite 5 - - -

Nitrate 5 +++ +++ +++ Nitrite 5 + + +

Sulfate 5 - - - Sulfite 5 - - -

129

- 7 - - 6 (A) PRB4_ClO4 (B) PRB4_NO2 6 (C) PRB4_NO3 6 5 5 5 4 4 4 3 3 3 Nitrite Perchlorate Nitrite 2 2 2 Nitrate 1 1 1 0 0 0 0 20 40 60 0 20 40 60 0 20 40 60 - - (D) PNO2 _0 h (E) PNO2 _6 h 7 6 6 5 5 4 4 Perchlorate 3 NO2 @ T=6h 3 NO2 @ T=0h 2 Perchlorate 2 1 1

Concentration Concentration (mM) 0 0 0 10 20 30 40 50 60 0 10 20 30 40 50 60 - 6 (G) PNO - _6 h 7 (F) PNO3 _0 h 3 6 5

5 4 4 Nitrite 3 Nitrite 3 Nitrate Nitrate 2 2 Perchlorate Perchlorate 1 1 0 0 0 10 20 30 40 50 60 0 10 20 30 40 50 60 Time (h)

130

Magnetospirillum sp. Lusitani (KC247689) Dechlorospirillum sp. WD (AF170352) Magnetospirillum bellicus VDY (NR 116009) Dechlorospirillum sp. DB (AY530551) Magnetospirillum sp. VITRJS5 (KM289194) Magnetospirillum aberrantis SpK (JQ673402) Magnetospirillum caucaseum SO-1 (JX502622) Magnetospirillum magneticum AMB-1 (AP007255) Magnetospirillum gryphiswaldense MSR-1 (NR 121771) Magnetospirillum moscoviense BB-1 (KF712468) Isolate PRB2 Isolate PRB4 Dechlorospirillum sp. SN1 (AY171615) Magnetococcus marinus MC-1 (NR 074371)

131

Table 5-3: 16S rRNA gene similarity and sequence distance among isolates PRB2, PRB4 and Magnetosprillum strains.

16S rRNA gene sequence similarity (%)

(KC247689)

1 (AP007255) 1

1 (NR_121771) 1

1 (JX502622) 1

1 (KF712468) 1

Isolate PRB2 Isolate PRB4 Isolate

usitani

DB (AY530551) DB

SpK(JQ673402)

WD (AF170352) WD

SO SN1(AY171615)

VDY (NR_116009) VDY

AMB

MSR VITRJS5(KM289194) Strains M. M. aberrantis SpK (JQ673402) ID 94.9 93.8 96.0 95.6 93.6 88.4 88.1 61.6 88.9 96.4 96.8 94.3 M. bellicus VDY (NR_116009) 0.029 ID 94.1 94.5 93.9 95.1 90.7 90.4 63.9 92.8 98.0 98.0 94.1 M. caucaseum SO-1 (JX502622) 0.042 0.046 ID 93.8 97.2 95.7 90.2 89.9 61.1 89.6 93.9 93.8 92.5 M. gryphiswaldense MSR-1 (NR_121771) 0.034 0.038 0.051 ID 95.8 95.3 90.6 90.3 60.6 88.6 95.9 96.4 95.7 M. magneticum AMB-1 (AP007255) 0.041 0.043 0.003 0.047 ID 93.7 88.6 88.3 60.1 87.9 95.7 95.7 94.5 M. moscoviense BB-1 (KF712468) 0.044 0.033 0.055 0.026 0.054 ID 93.0 92.7 62.3 90.5 94.9 95.0 94.5 Isolate PRB2 0.048 0.034 0.055 0.028 0.052 0.017 ID 99.2 65.1 94.2 90.1 89.9 89.7 Isolate PRB4 0.048 0.034 0.055 0.028 0.052 0.017 0.000 ID 64.9 94.0 89.7 89.6 89.3 Magnetospirillum sp. VITRJS5 (KM289194) 0.029 0.004 0.051 0.042 0.047 0.038 0.039 0.039 ID 68.4 63.3 63.3 60.5 Magnetospirillum sp. lusitani (KC247689) 0.029 0.000 0.046 0.038 0.043 0.033 0.034 0.034 0.004 ID 91.9 91.9 88.1 Dechlorospirillum sp. WD (AF170352) 0.029 0.000 0.046 0.038 0.043 0.033 0.034 0.034 0.004 0.000 ID 99.4 95.7 Dechlorospirillum sp. DB (AY530551) 0.028 0.001 0.047 0.037 0.044 0.032 0.036 0.036 0.005 0.001 0.001 ID 96.0 Dechlorospirillum sp. SN1 (AY171615) 0.051 0.042 0.061 0.043 0.058 0.032 0.036 0.036 0.046 0.042 0.042 0.041 ID 16S rRNA gene sequence distance

132

5.5 Discussion

The results from this study show that PRB could be enriched from MHGC oil field samples

(Figure 5-1A-D). However, their activity was limited by the type of electron donor available.

Per(chlorate) reducers enriched in this study coupled perchlorate reduction to acetate, propionate and butyrate oxidation but not to the oxidation of benzene or alkylbenzenes (toluene, ethylbenzene and xylenes; Figures 5-7C-D, 5-9C and 5-12A-H). Furthermore, as is evident from the biphasic growth curve, perchlorate reduction by an 18PW inoculum was found to be temporarily inhibited in the presence of nitrate, but resumed after complete reduction of nitrate. This observation shows that the MHGC field has a very active nitrate reducing community, having been exposed to nitrate treatment for over 10 years (Voordouw et al., 2009; Agrawal et al., 2011 and Callbeck et al., 2013).

The subsequent reduction of perchlorate indicates that the microbial community in this oil field harbors VFA-oxidizing perchlorate reducers that could use nitrate as an alternate electron acceptor.

However, after 5 successive transfers of the enriched per(chlorate)-reducing consortia in per(chlorate) medium, community analysis of this consortium following growth in nitrate- only media was dominated by Thauera and Pseudomonas, whereas the suspected per(chlorate) reducers declined implying that growth was not supported with nitrate addition. It is worthy to note that

Thauera sp strain TK001 isolated from the MHGC was unable to reduce per(chlorate) (results not shown).

Souring control by nitrate injection in low temperature reservoirs has been extensively studied under both laboratory and field conditions (Agrawal et al., 2011; Callbeck et al., 2011;

Grigoryan et al., 2008; Voordouw et al., 2009) The problem of microbial zonation arising from continuous injection of nitrate and sulfate is far from being resolved. This phenomenon occurs due to the formation of NRB active zones near the injector wellbore and SRB zones deeper in the 133

reservoir. Hence, research efforts are being directed towards addressing this issue. Using VFA fed low temperature reservoir-bioreactor models, Xue and Voordouw (2015) explored improving SRB inhibition through the synergistic combination of nitrate and biocide injection. This study demonstrated that pulsed injection of a high dose of cocodiamine for 1 h or continuous 5-day injection of low dose of glutaraldehyde or benzalkonium chloride with 2 mM nitrate strongly extended the SRB recovery period. However, it is yet to be ascertained if this treatment strategy can be replicated under field conditions. Electron acceptors, particularly those that selectively/competitively inhibit sulfate uptake in SRB, may be more effective than nitrate in this regard (Carlson et al., 2015a, 2015b; Liebensteiner et al., 2014). Engelbrektson et al., (2014) reported the successful inhibition of sulfide production in columns treated with 10 mM perchlorate or chlorate compared to nitrate. In this case, the electron donor used was an easily utilizable organic carbon source (1 g/L of yeast extract). The chance of this succeeding in fields such as MHGC with very low concentrations of labile organic carbon of approximately 0.1 mM acetate (Agrawal et al.,

2011) may be slim. Since the focus of this study was to evaluate how combined nitrate and perchlorate can limit SRB activity in low temperature reservoir conditions, all experiments were carried out under conditions that closely mimic the target reservoir. In the batch experiment conducted with media containing 1 mL MHGC oil, sulfate reduction was inhibited in the presence of 10 mM nitrate. This however was not the case in the perchlorate and sulfate incubations. Even though sulfate reduction was delayed, it was eventually reduced. Likewise, injection of increasing concentrations of perchlorate into sour oil columns did not decrease sulfate reduction nor did it induce any inhibitory effect. Perchlorate was not reduced either in the batch culture incubations or in the treated bioreactors. Anaerobic reduction of perchlorate may yield molecular oxygen, which is retained intracellularly, and utilized for additional energy production through the action of high 134

affinity cytochrome ccb3 oxidase, or could be used in oxygenase-dependent pathways for oxidation of hydrocarbons (Weelink at al., 2008; Carlstom et al., 2013; Melnyk and Coates, 2015; Carlstrom et al., 2015).

Activity tests using individual alkylbenzenes (toluene and ethylbenzene) showed that the

MHGC microbial community could not couple the reduction of perchlorate to the oxidation of monoaromatic hydrocarbons, possibly due to toxicity to perchlorate reducers or lack of prior in- situ exposure of the microbes to perchlorate. To alleviate this, nitrate reducing toluene or ethylbenzene chemostat consortia were tested, but these were unable to reduce perchlorate. So far only Dechloromonas aromatica strain RCB has been shown to oxidize benzene, toluene, ethylbenzene and xylene under perchlorate reducing conditions (Chakraborty et al., 2005). Other reported monoaromatic hydrocarbon degraders do so under nitrate reducing conditions (Meyer-

Cifuentes et al., 2017; Chakraborty et al., 2005).

Members of the Tenericutes, particularly the genus Acholeplasma, were enriched in the perchlorate containing VFA incubations suggesting the possibility that they could be potential perchlorate reducers. Some of them are known to reduce nitrate (Cherry et al., 2013; et al.,

Engelbrekston et al., 2014; Cheng et al., 2016). Acholeplasma spp. have frequently been enriched from different environments, such as oilfields (Fida et al., 2016) and marine sediments (Masui et al., 2008; Imachi et al., 2011), and have also been described as scavengers of dead bacterial cells due to their limited biosynthetic capabilities (Hanajima et al., 2015). There is a chance that their observed enrichment following the decrease of perchlorate is due to their scavenging properties.

Another finding from this study was the dominance of Desulfuromonadales during early stages of perchlorate reduction with organic acids. This is similar to other studies where up to a

135

300-fold increase in this taxon has been reported (Carlstrom et al., 2016). However, this taxon was absent from our oil incubations.

Microbial community data from the oil batch culture experiments showed that the enriched microbial community is dependent on the electron acceptor present. Microbial diversity in the nitrate containing incubations was lower compared to the other incubations, but once nitrate was consumed, the diversity increased. Thauera and Pseudomonas were present in over 50% of the nitrate containing and 4% of the perchlorate containing incubation during early times of monitoring. Thauera is occasionally enriched in perchlorate reducing communities (Anupama et al., 2015, Wan et al., 2016), but to date no Thauera sp. has been shown to reduce perchlorate in pure culture. The inability of pure isolate Thauera sp TK001 from the MHGC field to reduce perchlorate was confirmed in this study (results not shown).

Perchlorate or perchlorate and sulfate containing incubations had similar microbial communities as found in the sulfate only incubations. These incubations had high fractions of sequences affiliated to the family Peptococcaceae, specifically Pelotomaculum, pointing to their possible contribution to sulfate reduction. The involvement of this previously classified non- sulfate reducing, synthrophic propionate-oxidizing bacterium, belonging to Desulfotomaculum subcluster 1h, in the anaerobic benzene degradation coupled to sulfate reduction, was demonstrated by Laban et al. (2009). It was recently verified using metagenomic approach, that

Pelotomaculum candidate BPL possesses all the genes for the complete sulfate reduction pathway and that these were expressed during growth with benzene (Dong et al., 2017).

Three perchlorate reducers were successfully isolated and identified as belonging the genus

Magnetospirillum based on the 16S rRNA sequences. So far, only four members of this genus, M. bellicus VDY and Magnetospirillum sp. WD, Magnetospirillum sp SN1 and Magnetospirillum sp. 136

VITRJS5 have been shown to reduce perchlorate (Coates et al., 1999; Michaelidou et al., 2000;

Thrash et al., 2010; Jacob et al., 2017).

Isolates PRB 1, 2 and 4, like, Magnetospirillum strains SN1, VDY and WD, reduced perchlorate with short chain organic acids, H2 and ethanol. During growth with perchlorate, strain

VDY transiently accumulated chlorate in the culture medium. However, this was not observed for the isolates obtained here. Other electron donors tested but not utilized for perchlorate reduction were H2S, methanol, and the aromatic hydrocarbons tested. Contrary to our findings, Meyer-

Cifuentes et al., (2017) reported a Magnetospirillum sp strain 15-1, which utilized up to 0.5 mM toluene under nitrate reducing conditions, but not with perchlorate. Isolates PRB1, 2 and 4 could reduce chlorate, nitrate and nitrite as alternate electron acceptors, like Magnetospirillum bellicus strain VDY (Thrash et al., 2010). The phylogenetic analysis of strains PRB2 and PRB4 showed that they were most similar to M. moscoviense BB-1, but possess very similar metabolic characteristics to M. bellicus VDY and strain WD. Nitrate or nitrite reduction occurred concurrently with perchlorate reduction in isolate PRB4, differentiating PRB4 from VDY and WD.

Most perchlorate reducers, preferentially reduce nitrate over perchlorate (Chaudhuri et al., 2002;

Bardiya et al., 2008; Carlstrom et al., 2013).

In summary, it appears that the MHGC field does contain PRB. These are unable to use oil hydrocarbons or sulfide preventing perchlorate to act as a souring control agent, like nitrate.

Chlorite is a strong souring control agent, which directly reacts with sulfide. It also acts as an oxidizing biocide and has corrosive properties towards carbon steel. Hence, souring preventing properties of perchlorate or its reduction products do not appear to be superior to those of nitrate as related to the` MHGC field.

137

Chapter Six: Microbial and chemical analysis of samples from three North Sea platforms

6.1 Abstract

Microbial diversity of ten oil field produced water samples from high temperature oil reservoirs in the North Sea and that of enrichment cultures of these samples were investigated. The produced water samples had high salinities (0.9-1.6 Meq of NaCl). Sulfate was detected in only five of the samples, while acetate, propionate and ammonium were present in all of the samples.

No sulfate-, nitrate- or perchlorate-reducing activities were observed in medium with 1 M NaCl at

60oC. Incubations with 0.5 M NaCl gave NRB activity at 30oC, but not at 60oC. tSRB activity was detected for two samples. 16S rRNA gene amplicon sequencing of water samples and enrichment cultures detected sequences of the thermophilic sulfate reducers Desulfotomaculum and

Archaeoglobus and of the thermophilic methanogen Methanothermococcus, as well as of halophilic Halomonas and Marinobacter. The absence of thermophilic taxa, the lack of growth of thermophiles and the high watercut suggests that some wells may have cooled due to prolonged seawater injection.

138

6.2 Introduction

Water flooding is a common method used in producing oil from reservoirs. In offshore production processes, seawater is used for this secondary oil recovery method (Myhr, et al., 2002;

Gao et al., 2015). Seawater injection changes the physicochemical conditions and microbial populations in the near injection wellbore region (NIWR) of high temperature reservoirs, through the lowering of reservoir temperature, the constant supply of microbes and by increasing reservoir sulfate concentrations (Bødtker et al., 2009, Okpala, et al., 2017). These factors create favorable conditions for the proliferation of both mesophilic and thermophilic microbes including sulfate- reducing microorganisms (SRM). SRM are the main culprits of souring, that is the biological production of sulfide during sulfate respiration in oil field production systems. Sulfide production in reservoirs, causes dire economic challenges to field operators due to its toxicity, corrosivity and the devaluation of produced oil as a result of increased sulfide or sulfur content (Gittel et al., 2009;

Callbeck et al., 2011). Reservoir souring can be mitigated by nitrate injection. Biocide injection to eliminate any form of microbial life is less common. Nitrate injection encourages the growth of nitrate-reducing or sulfide-oxidizing nitrate reducing bacteria (soNRB or hNRB). Nitrite produced from nitrate reduction, inhibits dissimilatory sulfite reductase (Dsr), required for the reduction of sulfite to sulfide.

Microbial communities present in both waterflooded and non-waterflooded reservoirs are under continuous investigation (Orphan et al., 2000; Kaster et al., 2009; Bodteker et al., 2009; Ren, et al., 2011; Lenchi et al., 2013; Kobayashi et al., 2012; Gao et al., 2015). Monitoring microbial populations in sour reservoirs is essential in determining the effectiveness of various treatment strategies are or why certain treatment strategies don’t work (Agrawal et al., 2011; Voordouw et al., 2009; Duncan et al., 2009; Gittel et al., 2009). Both culture-dependent and culture-independent 139

approaches have been applied in studying oil field microbes. Culture dependent methods give insights into the physiology of oil field microbes. However, only the few microbes that are culturable can be studied using these methods (Bødtker, et al., 2008; Gittel et al., 2009). With the advancement in molecular biology and sequencing techniques, microbial community composition can be efficiently determined and their metabolic potential can be inferred. Using quantitative

PCR, 16S rRNA gene sequencing and comparative metagenomics, Vigneron et al., (2017) carried out an in-depth study on how seawater flooding affected microbial communities in 32 production wells in Halfdan oilfield in the North Sea over 15 years of its operational lifetime. The study revealed huge shifts in microbial communities across different wells. This observed variability in microbial community composition was linked to the microbial control methods used.

In this study, the diversity of microbial communities present in ten produced water samples from a North Sea oilfield was analysed, as well as that from enrichment cultures of these water samples.

6.3 Materials and Methods

6.3.1 Sample Information

The reservoir from which the samples were obtained is an Upper Palaeocene formation that is split into two lithological sequences; a sandy sequence that contains most of the oil and a lower interbedded sandstone and shale sequence. A total of ten produced water samples were collected from the 12th to the 23rd of June, 2016 from three North Sea oil production facility platforms. The samples were collected in 1 L Nalgene bottles from wellhead sampling points on the flow line (Figure 6-1). Sample containers were filled to the brim to exclude air and sealed tightly. Samples were received at the University of Calgary on August 2, 2016. Once in the lab,

140

the samples were mixed gently to avoid mixing the oil and water layers and 50 mL of the water layers was taken immediately for water chemistry analysis. An aliquot of 200 ml of the aqueous phase of each sample was centrifuged to pellet biomass, the pellets were frozen at -20°C for use in

DNA extraction. Sample P3_14 had no aqueous layer, hence 200 ml of supernatant derived from

P3_10, P3_12 and P3_16 was used to extract this sample for DNA analysis. 200 ml of oil from

P3_14 was added to 200 ml of supernatant fluid and mixed vigorously for 2 minutes and this was repeated every hour for 5 hours after which the sample was left to stand for 24 hours before water samples were collected and centrifuged for DNA extraction. The remaining samples were kept at room temperature in the anaerobic hood with an N2-CO2 atmosphere.

6.3.2 Water chemistry and microbial enumeration

Water chemistry analyses included determination of pH, salinity, nitrate, nitrite, sulfate, sulfide, volatile fatty acids (acetate and propionate), and ammonium. The pH was determined with an Orion pH meter (Model 370), while conductivity as molar equivalent (Meq) of NaCl was measured with an Orion conductivity cell (model 013005MD) to determine salinity. Sulfide concentrations in the water samples were measured using N, N–dimethyl-p-phenylenediamine

(Trüper and Schlegel, 1964), while ammonium concentrations were determined using the indophenol method (Cornish Shartau et al., 2010). Nitrate, nitrite and sulfate were analyzed with high performance liquid chromatography (HPLC), using a Waters 600E HPLC (Water Corp,

Milford, MA), which was fitted with a Waters 2489 UV/Visible detector, set at 200 nm and an IC-

PAKTM anion column HC (150 x 4.6 mm, waters), and eluted with a borate-gluconate buffer.

Sulfate, was measured with the same column using a Waters 432 conductivity detector. Volatile fatty acids (VFA) concentrations of the water samples were analyzed with a Prevail organic acid 141

(OA) 5u column (250 x 4.6 mm, Alltech, Guelph, ON), using a Waters 2487 UV detector at 210 nm. The elution buffer was 25 mM KH2PO4 (pH 2.5) at a flowrate of 1.0 ml/min.

MPN enumeration of viable thermophilic SRB, general heterotrophic bacteria (GHB), acid producing GHB (tAPGHB), hyperthermophilic SRB (htSRB); hyperthermophilic GHB (htGHB) and (htAPGHB) was carried out by the platform operator using commercially available medium and incubation for tSRB, tGHB and tAPGHB was done at 60oC, while that for htSRB, htGHB and htAPGHB was at 80oC is reported in appendix Table A6-1.

142

onshore

Platform 1 P1_1-1

P1_2-2

P1_4-2

Platform 2 P2_2-3

P2_3-5 P2_4-4

Platform 3

P3_10 P3_12 P3_14 P3_16

143

6.3.3 Activity Tests

Microbial activity tests were done by inoculating 1 ml of 20-fold concentrated produced water samples in modified Coleville synthetic brine (CSBA) medium (Hubert et al., 2003) at salt concentrations of 0.5 M or 1 M NaCl was prepared. CSBA medium had the following composition

(g/L): CaCl2.2H2O, 0.15; MgCl2.5H2O, 0.4; NH4Cl, 0.25; KCl, 0.5; KH2PO4, 0.2. After autoclaving, trace elements, (1 mL), selenate-tungstate, (1 mL) and 1 M NaHCO3, (30 ml) were added and the pH was adjusted to 7.4-7.6 using 1 M HCl. Twenty mL of CSBA medium were added to 60 mL serum bottles, which were sealed with butyl rubber stoppers, crimped with aluminum caps and flushed with N2-CO2 for 5 min to exclude oxygen. Enrichments of tSRB were amended with 10 mM Na2SO4 and either 10 mM lactate or 3 mM each of acetate, propionate and butyrate (VFA). Medium for enrichment of tNRB and mNRB was supplemented with 3 mM VFA and 10 mM nitrate. For thermophilic perchlorate-reducers (tPRB) the CSBA medium was amended with 3 mM VFA and 10 mM perchlorate. Thermophilic and mesophilic enrichments were incubated at 60 °C and 30 °C, respectively. Aliquots of 0.5 ml were taken at different time intervals to determine concentrations of sulfide, sulfate, nitrite, nitrate, and perchlorate. Sulfide concentrations were determined immediately after each sampling, and the remainders of the samples were frozen (-20 °C) for further analysis.

6.3.4 Microbial community compositions

DNA was isolated from 200 ml of PW samples using the Fast DNA Spin Kit for Soil and the FastPrep Instrument (MP Biomedicals, Santa Ana, CA) as per the manufacturer’s instructions. The extracted DNAs were quantified using a Qubit fluorimeter, with the Quant-iT™ dsDNA HS assay kit (Invitrogen) and were subjected to PCR amplification of 16S rRNA genes

144

using a two-step process. The PCR reaction was carried out in duplicate with each replicate containing a 20 µl reaction volume. The amplified PCR products were pooled and cleaned using the QIAquick PCR purification kit (Qiagen) and analyzed on a 1.5% agarose gel. For the first round of PCR, non-barcoded primers (926Fi5 TCGTCGGCAGCGTCAGATGTGTATA

AGAGACAGAAACTYAAKGAATWGRCGG and 1392Ri7

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACGGGCGGTGWGTRC) were used for 25 cycles, while the barcoded primers P5-S50X-OHAF with a 29-nt 5’ sequencing adaptor

(P5, AATGATACGGCGACCACCGAGATCTACAC) and an 8-nt identifying index S50x and a

14-nt forward overhang adaptor (OHAF, TCGTCGGC AGCGTC), and reverse primer (P7-

N7XXOHAF) with a 24-nt 3’ Illumina sequencing adaptor (P7,

CAAGCAGAAGACGGCATACGAGAT), an 8-nt identifying index N7XX and a 14-nt reverse overhang adaptor (OHAF, GTCTCGTGGGCTCGG), were used in the second round PCR for 10 cycles. First PCR cycling conditions were 95 °C for 5 min, followed by 25 cycles of 95 °C for 45 s, 55 °C for 2 min, 72 °C for 4 min. The final incubation at 72 °C was for 10 min. The cycling conditions for the 2nd PCR reaction were of 95 °C for 3 min, followed by 10 cycles of 95 °C for

45 s, 55 °C for 2 min, 72 °C for 4 min and a final incubation at 72 °C for 10 min. The PCR products were purified and quantified for Illumina sequencing at the University of Calgary

6.3.5 Analyses of sequencing data

Single 300 PE reads were merged using the PEAR 0.9.6 software from both ends with a minimum overlap of 50 bp and minimum length of 420 bp as cutoffs. The merged reads were processed using MetaAmp, a 16S rRNA data analysis pipeline (Dong et al., 2017). The sequencing data retrieved were clustered into operational taxonomic units (OTUs) at a taxonomic distance of 145

3%. Rarefaction curves and alpha diversity indices were calculated including the Chao1 and

Shannon’s H indexes. The relational tree showing beta diversity of the amplicons was visualized using MEGA (Tamura et al., 2011).

6.4 Results

6.4.1 Water chemistry

The results of water chemistry of the produced water samples are presented in Table 6-2.

The water samples had a pH close to neutral and a salinity concentrations ranging from 0.9 to 1.56

Meq of NaCl (Table 6-2). The sulfate concentration in the produced water sample from well P1_1-

1 was high (19.9 mM) compared to other samples collected from platform 1 (Table 6-2). No sulfate was detected in water samples from P3_10, P3_12 and P3_16. Sulfide concentrations were very low ranging from 0 in P2_2-3 to 0.09 mM in P3_16 (Table 6-2). The long storage and shipping times will have contributed to these low values (Table 6-1: 40-51 days). On site measurements of sulfide indicated that samples collected from platform 2 (P2) had sulfide concentrations of 100-

120 ppm corresponding to 3 – 4 mM (Table S6-1). Acetate concentrations in water samples from all platforms ranged from 1 mM to 4 mM, Propionate concentrations in all the produced water samples were below 0.5 mM (Table 6-2). Produced water samples from the 3 platforms had no detectable nitrate or nitrite. Higher ammonium concentrations (3.2 to 4.9 mM) were observed in samples from platform 1, than in samples from platform 2 (1.9 to 3.2 mM) and platform 3 (1.9 to

2.2 mM) (Table 6-2).

Results for enumeration of viable microbes, showed no or only low numbers

(hyper)thermophilic bacteria of all the water samples tested (Table S6-1). Samples from platform

2 which had high onsite sulfide concentrations, had low numbers of tSRB.

146

Table 6-1: Description of samples received, including dates when samples were collected and received.

147

Table 6-2: Chemical composition of samples from producing wells from a North Sea oil field received in August 2016

Sample ID Temp (°C) pH Salinity Sulfide Sulfate (mM) Acetate Propionate NH4+

(Meq of (mM) (mM) (mM)

NaCl)

P1 1-1 60 6.57 ± 0.03 0.90 ± 0.002 0.01 ± 0.03 19.9 ± 0.76 1.02 ± 0.004 0.10 ± 0.01 4.87± 0.05

P1 2-2 76 6.66 ± 0.10 1.21 ± 0.002 0.00 3.41 ± 0.05 2.71 ± 0.25 0.39 ± 0.04 3.2 ± 0.05

P1 4-2 68 6.85 ± 0.01 1.28 ± 0.001 0.07 ± 0.002 0.52 ± 0.001 3.84 ± 0.17 0.41 ± 0.02 3.70 ± 0.18

P2 2-3 72 6.38 ± 0.03 1.52 ± 0.01 0.08 ± 0.01 0.00 2.55 ± 0.12 0.150 ± 0.22 1.90 ± 0.00

P2 3-5 62 6.82 ± 0.05 1.27 ± 0.001 0.00 4.43 ± 0.18 2.13 ± 0.01 0.16 ± 0.01 2.54 ± 0.03

P2 4-4 55 6.54 ± 0.02 1.28 ± 0.003 0.008 ± 0.002 0.35 ± 0.05 3.37 ± 0.25 0.32 ± 0.05 3.19 ± 0.01

P3 slot 10 95 6.51 ± 0.004 1.56 ± 0.003 0.072 ± 0.01 0.00 3.26 ± 0.11 0.29 ± 0.01 2.13 ±0.23

P3 slot 12 72 6.55 ± 0.001 1.48 ± 0.004 0.07 ± 0.02 0.00 3.24 ± 0.09 0.28 ± 0.003 1.86 ± 0.14

P3 slot 14 62 ND ND ND ND ND ND ND

P3 slot 16 83 6.58 ± 0.01 1.50±0.01 0.09 ± 0.01 0.00 2.90 ± 0.01 0.26 ± 0.02 2.24 ± 0.16

* ND- not determined because this sample did not contain any water

148

6.4.2 Microbial community composition in produced water samples

To assess the microbial community composition of North Sea samples, 16S rRNA amplicon sequencing of DNA extracted from the water samples was conducted. The samples gave high quality reads following 16S rRNA amplicons sequencing (Table 6-3: 36,708 to 55,198 reads).

The microbial community in produced water samples P1_2-2, P2_4-4, P3_10 and P3_16 had 104,

70, 106 and 87 OTUs respectively, with a corresponding Shannon index of 1.7, 1.7, 2.1 to 2.1.

Produced water samples P1_1-1, P3_12 and P3_14 had low Shannon indices of 0.3, 0.2 and 0.7, respectively (Table 6-3). The low values for these diversity indices could be due to the dominance of Marinobacter sp in these samples (94.7, 96.8 and 85.6%).

From the phylogenetic tree (dendrogram) shown in Figure 6-2 the microbial communities were clustered in five clades with most clades having samples from the same platform. The clades were designated as (i) P3_16 and P3_10, (ii) P3_14 and P3_12, (iii) P2_4-4 and P2_2-3, (iv)

P2_3_5 and P1_2-2, and (v) P1_4-2 and P1_1-1. Clade I (P3_16 and P3_10) was dominated by the phyla Firmicutes (45% to 47%), Bacteroidetes (1.4% to 2%) and Actinobacteria (2.4% and

2.5%) respectively. Water samples P3_16 and P3_10 contained Alpha-, Beta-, and

Gammaproteobacteria in the range of 33 to 35%, 10 to 12% and 15% respectively. Sequences belonging to the Firmicutes in clade I were mainly those of the Gram positive SRB

Desulfotomaculum (46 – 47%; Table 6-3). Whereas Cryobacterium, an obligate psychrophile, was the only sequence belonging to the phylum Actinobacteria (Sun et al., 2015). Within the class

Alphaproteobacteria the marine bacterium Caulobacter (17 and 16%), Sphingomonas (8.5%) and

Methylobacterium (~4%) were main components. There were no archaeal sequences found in the produced water samples from platform 3.

149

Samples P3_12 and P3_14 clustered in clade (ii) contained sequences affiliated to the

Gammaproteobacteria, which were dominated by Marinobacter (97% and 86%) and

Betaproteobacteria Bordetella (7 and 2%) .

Clade (iii) consisted of communities from samples P2_4-4 and P2_2-3 obtained from platform 2. P2_4-4 had sequences belonging to the hyperthermophilic sulfate reducing

Euryarchaeota Archaeoglobus (6%). Also, sample P2_4-4 contained sequences of

Alphaproteobacteria, Mesorhizobium (4%), Betaproteobacteria, Bordetella (14%), and

Gammaproteobacteria, Marinobacter and Halomonas (25% and 4% respectively). The microbial communities in sample P2_2-3 had sequences closely related to the soNRB Epsilonproteobacteria

Arcobacter (32%) in addition to members of Gammaproteobacteria Halomonas (13%) and

Marinobacter (6%).

Microbial communities from sample P2_3-5 from platform 2 were clustered with P1_2-2 from platform 1 in clade (iv). Both samples had communities dominated by Bordetella (64-52%) and Mesorhizobium (25%-16%) with smaller fractions of Desulfotomaculum (2.4%-7.3%) and the thermophilic sulfate-reducing archaeon (SRA) Archaeoglobus. Sample P1_2_2 also had 10% of the thermophilic methanogen Methanothermococcus.

Clade (v) represented samples P1_4-2 and P1_1-1 from platform 1. Microbial communities from these water samples closely resembled those in clade (ii) with high Marinobacter (68%-

95%), Bordetella (19%-3.8%) and Mesorhizobium (5% and 0.9%).

Desulfotomaculum, Archaeoglobus, and Methanothermococcus are all anaerobic thermophiles that would be expected in a hot oil field environment. Halomonas, Halomonadaceae and Marinobacter are halophiles, typically found in saline environments. Bordetella,

150

Mesorhizobium, Methylobacterium, Caulobacter are facultative bacteria with hydrocarbon degrading activity, which may have grown during the long storage and transportation time.

151

152

Table 6-3: Microbial community compositions of produced water samples, presented (left to right) in the same order as in the dendrogram (Figure 6-2). Fractions in excess of 1% are in bold.

P3_16 P3_10 P3_14 P3_12 P2_4_4 P2_2_3 P2_3_5 P1_2_2 P1_4_2 P1_1_1

V59_3629 V59_3632 V59_3631 V59_3630 V59_3628 V59_3626 V59_3627 V59_3624 V59_3625 V59_3623

ID Sequence # QC Reads 36708 42412 54637 50037 47325 37016 47822 41793 55198 50063 # OTUs 87 106 63 34 70 43 91 104 106 49 # Taxa 82 104 58 25 57 38 78 90 97 31 Shannon index 2.1 2.1 0.7 0.2 1.7 1.4 1.1 1.7 1.2 0.3 Temperature 83 °C 95 °C 62 °C 72 °C 55 °C 72 °C 62 °C 76 °C 68 °C 60 °C Taxon (kingdom, phylum, class, genus) Bacteria; Firmicutes; Clostridia; Desulfotomaculum; 45.84 46.92 2.33 0.04 0.67 0.05 2.41 7.29 1.01 0.03 Archaea; Euryarchaeota;Archaeoglobi; Archaeoglobus; 0.00 0.00 0.00 0.01 6.07 0.00 0.53 2.72 0.04 0.00 Archaea; Euryarchaeota; Methanococci; Methanothermococcus; 0.00 0.00 0.00 0.00 0.18 0.06 0.00 10.37 0.23 0.00 Bacteria; Actinobacteria; Cryobacterium; 2.15 2.15 0.10 0.00 0.03 0.00 0.13 0.32 0.06 0.01 Bacteria; Proteobacteria; Alphaproteobacteria;Caulobacter; 17.22 16.36 0.81 0.02 0.23 0.01 0.74 2.63 0.36 0.03 Bacteria; Proteobacteria; Alphaproteobacteria; Bradyrhizobiaceae; 1.17 1.12 0.06 0.00 0.01 0.00 0.06 0.18 0.43 0.00 Bacteria; Proteobacteria; Alphaproteobacteria; Methylobacterium; 4.65 3.82 0.20 0.00 0.04 0.01 0.17 0.62 0.07 0.00 Bacteria; Proteobacteria; Alphaproteobacteria; Mesorhizobium; 0.25 0.25 2.16 0.67 4.20 0.35 24.99 16.12 5.31 0.87 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobium; 1.72 1.32 0.13 0.01 0.05 0.01 0.44 0.45 0.11 0.03 Bacteria; Proteobacteria; Alphaproteobacteria;Sphingomonas; 8.49 8.48 0.47 0.01 0.11 0.01 0.41 1.27 0.19 0.00 Bacteria; Proteobacteria; Betaproteobacteria; Bordetella; 0.99 0.53 6.90 2.17 13.91 1.79 63.73 51.65 18.97 3.78 Bacteria; Proteobacteria; Betaproteobacteria; Bordetella; Burkholderia; 1.38 0.83 0.06 0.00 0.02 0.00 0.04 0.17 0.03 0.00 Bacteria; Proteobacteria; Betaproteobacteria; Bordetella; Aquabacterium; 4.35 4.17 0.18 0.00 0.04 0.00 0.14 0.68 0.07 0.00 Bacteria; Proteobacteria; Betaproteobacteria; Bordetella; Roseateles; 3.48 3.50 0.12 0.01 0.02 0.00 0.11 0.37 0.04 0.00 Bacteria; Proteobacteria; Epsilonproteobacteria; Arcobacter; 0.00 0.01 0.01 0.00 0.01 31.79 0.01 0.00 0.00 0.00 Bacteria; Proteobacteria; Gammaproteobacteria; 0.05 0.07 0.01 0.01 43.20 43.81 0.04 0.01 0.01 0.01 Bacteria; Proteobacteria; Gammaproteobacteria; Marinobacter; 0.69 0.25 85.65 96.84 25.31 5.58 0.09 0.28 68.01 94.72 Bacteria; Proteobacteria; Gammaproteobacteria; Halomonadaceae; 0.00 0.00 0.00 0.00 0.95 3.60 0.00 0.00 0.00 0.00 Bacteria; Proteobacteria; Gammaproteobacteria; Halomonas; 0.00 0.00 0.01 0.00 3.96 12.55 0.00 0.00 0.00 0.00 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonas; 0.04 0.01 0.22 0.05 0.43 0.04 3.51 2.38 0.64 0.05 unknown; 1.83 3.51 0.02 0.00 0.01 0.00 0.04 0.22 0.01 0.00 Total 94.30 93.31 99.45 99.83 99.45 99.66 97.60 97.73 95.58 99.56

153

6.4.3 Enrichment of SRB, NRB and PRB at 0.5 and 1 M NaCl

To demonstrate the metabolic capabilities of microbes in the produced water samples, experiments were setup towards enriching mNRB, tNRB, tPRB, mSRB and tSRB from the water samples at 0.5 M and 1 M NaCl. Enrichment incubation at the average salinity (~1 M NaCl) of the produced water samples showed no tSRB, tNRB or tPRB at 60˚C after a 6-week incubation period. tSRB activity was observed at 0.5 M NaCl at 60°C in samples P2_2-3 and P2_3-5 from platform

2, which had high field sulfide concentrations (Table S6-1). Enrichments in 0.5 M NaCl of tPRB at 50 ˚C and 55 ˚C (not shown) and of tNRB at 50 and 60 ˚C, showed no activity (not shown).

Enrichments with CSBA medium containing 0.5 M NaCl at 30 ˚C, gave mNRB activities. Nitrate reduction and nitrite accumulation was observed for all samples P1_4-2 (Figure 6-3). Nitrite accumulation was transient, except for P1_4-2, which did not show nitrite reduction (Figure 6-

5B).

6.4.4 Analyses of microbial community in enrichment cultures

Enrichment cultures of nitrate reducing bacteria, grown at 30 °C, were subjected to 16S rRNA gene sequencing. Sequence analysis indicated that the class Gammaproteobacteria was enriched from all the produced water samples (Figure 6-4). Within this class, Marinobacter was enriched in all the mNRB incubations, while Halomonas was enriched in seven of the nine incubations. Arcobacter previously detected only in sample P2_2-3, was now observed in high fractions in all the enrichments except in incubations with sample P3_12 and P4_4 (Table 6-4). In addition to the three dominant genera enriched from almost all the produced water samples, incubations P2_2-3 and P3_10 contained sequences of Caulobacter (1.4 and 22.8%); Dietzia was enriched in P3_12 and P3_10 (1.1 and 10%); while Geotoga (1 and 2%) was found only in

154

enrichments with P1_4-2 and P1_1-1 (Table 6-4). Sequences of the obligate anaerobic halophile

Halanaerobium were found in enrichments with 0.5 M NaCl with sample N4-2A (18%) and N3-

12 (0.4%). An et al. (2017) demonstrated the enrichment of Halanaerobium in medium with NaCl concentrations of up to 2.5 M.

In enrichments with sulfate containing CSBA medium inoculated with P2_2-3 and incubated at 60 °C, Archaeoglobus sequences (67%) were identified (Table 6-5A). This enrichment also contained a low abundance of Desulfotomaculum (0.1%) and other moderate thermophiles Petrotoga (9%) and Geotoga (0.3%), the NRB Halomonas, Marinobacter and

Pseudomonas (5.6%, 3.5% and 7.2% respectively) and Arcobacter (1.3%). The tSRB enrichment, obtained with P2_3-5 had a high fraction of the tSRB Desulfotomaculum (33%) and the

Deltaproteobacteria Desulfocurvus (0.6%) (Table 6-5B). Twenty five percent of the sequences detected in the enrichment culture of P2_3-5 was Petrotoga. Hence, thermophilic enrichments containing tSRM were successfully obtained. The enrichment with P2_2-3 was dominated by the tSRA Archaeoglobus, whereas that with P2_3-5 was dominated by the tSRB Desulfotomaculum.

155

12 A B 10 10 P1 1-1 8 P1 2-2 8 P1 4-2 6 6 P2 2-3

P2 3-5 Nitrite (mM) Nitrite Nitrate (mM) Nitrate 4 4 P2 4-4 P3-10 2 2 P3-12 P3-16 0 0 0 2 4 6 8 10 0 2 4 6 8 10 Time (d)

Figure 6-3: NRB activity tests at 30 °C with 0.5 M NaCl CSBA medium supplemented with 3mM VFA and 10 mM nitrate. Nine of ten samples (Table 6-2) were analysed except P3_14 which did not have an aqueous phase. The concentration of nitrate (A), and of nitrite (B) are shown as a function of time

156

Other Phyla Proteobacteria P2_4-4 30N4_4A Armatimonadetes 30N3_12AP3_12 Cyanobacteria P1_430N4_2A-2 Deferribacteres Planctomycetes P2_330N3_5A-5 Thermotogae 30N3_16A P3_16 Deinococcus-Thermus P2_230N2_3A-3 Acidobacteria P1_230N2_2A-2 Actinobacteria P1_130N1_1A-1 Bacteroidetes Chloroflexi 30N3_10A P3_10 Firmicutes 0 20 40 60 80 100 0 5 10 15 20 25

Alphaproteobacteria Betaproteobacteria Deltaroteobacteria Gammaproteobacteria Epsilonproteobacteria

Figure 6-4: Phylogenetic tree microbial communities in enrichments of North Sea produced water samples at 30 0C in CSBA medium with nitrate and VFA and 0.5 M NaCl.

157

Table 6-4: Microbial community compositions of NRB enriched at 30 °C, presented (left to right) in the same order as in the dendrogram (Figure 6-4). Fractions in excess of 1% are in bold.

P3_10 P1_1-1 P1_2-2 P2_2-3 P3_16 P2_3-5 P1_4-2 P3_12 P2_4-4

V60_3703 V60_3697 V60_3698 V60_3700 V60_3705 V60_3701 V60_3699 V60_3704 V60_3702

ID Sequence # of QC Reads 28525 82108 76393 67498 74523 74486 70037 74515 69275 # OTUs 109 21 71 65 97 38 74 71 21 # Taxa 109 19 62 63 49 36 44 60 19 Shannnon index 2.83 0.90 0.61 0.73 0.71 0.86 1.41 0.56 1.28 Taxon (phylum, class,genus) 1 Proteobacteria; Epsilonproteobacteria; Arcobacter; 11.3 2.5 16.4 82.1 78.5 56.7 38.0 0.0 0.1 2 Proteobacteria; Gammaproteobacteria; Halomonas; 0.4 0.0 1.0 12.0 11.3 39.2 2.2 0.0 37.5 3 Proteobacteria; Gammaproteobacteria; Marinobacter; 6.0 50.5 81.3 1.3 9.6 3.6 38.9 96.9 61.5 4 Proteobacteria; Alphaproteobacteria; Caulobacter; 22.8 0.0 0.4 1.4 0.2 0.1 0.1 0.4 0.0 5 Proteobacteria; Alphaproteobacteria; Sphingomonas; 11.0 0.0 0.2 0.7 0.1 0.1 0.0 0.2 0.0 6 Actinobacteria; Dietzia; 9.8 0.0 0.0 0.2 0.1 0.0 0.0 1.1 0.0 7 Proteobacteria; Betaproteobacteria; Aquabacterium; 5.5 0.0 0.1 0.3 0.1 0.0 0.0 0.1 0.0 8 Proteobacteria; Betaproteobacteria; Roseateles; 4.0 0.0 0.1 0.3 0.0 0.0 0.0 0.1 0.0 9 Proteobacteria; Alphaproteobacteria; Methylobacterium; 6.2 0.0 0.1 0.3 0.0 0.0 0.0 0.1 0.0 10 Actinobacteria; Cryobacterium; 3.4 0.0 0.1 0.2 0.0 0.0 0.0 0.1 0.0 11 Proteobacteria; Deltaproteobacteria; Geoalkalibacter; 0.0 44.8 0.0 0.0 0.0 0.0 0.0 0.0 0.0 12 Firmicutes; Clostridia; Halanaerobium; 0.0 0.2 0.0 0.0 0.0 0.0 18.3 0.4 0.0 13 Bacteroidetes; Flavobacteriia; 0.0 0.0 0.0 0.0 0.0 0.0 1.1 0.0 0.0 14 unknown; 4.1 0.0 0.0 0.1 0.0 0.0 0.0 0.0 0.0 15 Thermotogae; Geotoga; 0.0 1.9 0.0 0.0 0.0 0.0 1.2 0.0 0.0 Total 84.4 99.9 99.6 99.0 99.8 99.8 99.8 99.4 99.0 158

Table 6-5: tSRB community from incubation of P2_2-3 (A) and P2_3-5 (B) in CSBA medium containing 10 mM sulfate and 20 mM lactate. Fractions of sequence reads in excess of 1% are indicated in bold

Table 6-5A Table 6-5B

Sample P2_2-3 Sample P2_3-5 Sequence ID V63_4014 Sequence ID V64_4105 # of QC Reads 52733 # of QC Reads 47663 # OTUs 89 # OTUs 21 # Taxa 89 # Taxa 21 Shannnon index 1.4 Shannnon index 1.32 # Taxon (phylum, class, genus) # Taxon (phylum, class,genus) 1 Actinobacteria; Actinobacteria; Propionibacterium; 0.28 1 Actinobacteria; Actinobacteria; Propionibacterium; 0.03 2 Actinobacteria; Actinobacteria; Rhodococcus; 0.10 2 Candidate-division-OP3; 0.01 3 Bacteroidetes; Bacteroidia; Proteiniphilum; 0.085 3 Firmicutes; Clostridia; Desulfotomaculum; 32.55 4 Bacteroidetes; Flavobacteriia; Flavobacteriaceae; 0.14 4 Firmicutes; Clostridia; Halanaerobium; 0.024 5 Deferribacteres; Deferribacteres; Flexistipes; 0.26 5 Proteobacteria; Alphaproteobacteria; Mesorhizobium; 0.54 6 Euryarchaeota; Archaeoglobi; Archaeoglobus; 66.82 6 Proteobacteria; Betaproteobacteria; Bordetella; 5.37 7 Euryarchaeota; Methanobacteria; Methanobacterium; 0.12 7 Proteobacteria; Betaproteobacteria; Burkholderia; 0.04 8 Euryarchaeota; Methanococci; Methanothermococcus; 0.62 8 Proteobacteria; Betaproteobacteria; Ralstonia; 0.24 9 Euryarchaeota; Methanomicrobia; Methanocorpusculum; 0.25 9 Proteobacteria; Betaproteobacteria; Thauera; 0.03 10 Firmicutes; Clostridia; Acetobacterium; 2.15 10 Proteobacteria; Deltaproteobacteria; Desulfocurvus; 0.64 11 Firmicutes; Clostridia; Desulfotomaculum; 0.07 11 Proteobacteria; Gammaproteobacteria; Escherichia- 12 Firmicutes; Clostridia; Halanaerobium; 1.07 Shigella; 0.02 12 13 Proteobacteria; Alphaproteobacteria; Methylobacterium; 0.085 Proteobacteria; Gammaproteobacteria; Halomonas; 34.89 13 14 Proteobacteria; Gammaproteobacteria; Halomonas; 5.59 Thermotogae; Thermotogae; Petrotoga; 25.58 15 Proteobacteria; Gammaproteobacteria; Marinobacter; 3.51 16 Proteobacteria; Gammaproteobacteria; Pseudomonas; 7.22 17 Proteobacteria; Epsilonproteobacteria; Arcobacter; 1.33

159

18 Thermotogae; Petrotoga; 9.37 19 Thermotogae; Thermotogae; Geotoga; 0.27

160

6.5 Discussion

Microbial communities in produced water samples of ten oil producing wells from 3 offshore platforms in a North Sea oil field were characterized in this study. The water samples had high salinities of average 1 Meq of NaCl. Ammonium concentrations of 2 to 4 mM were detected in the water samples and could be from either chemical or biological sources.

The mesophilic nitrate-reducing bacterium Marinobacter was the most common in the microbial communities of the different produced water samples, the NRB Arcobacter, Halomonas and Pseudomonas were present in 2 or 3 produced water samples. The enrichment of these nitrate reducers at 30 °C and not at higher temperatures, indicates that they were active at the lower temperature end of the NIWR and not in the thermogenic zones. It is also possible that these organisms may be inhabiting the cooler zones of the producing wells.

SRM sequences affiliated to Desulfotomaculum and Archaeoglobus were found to be above 1% in 6 and 2 of the produced water samples, respectively. However, upon enrichment at

60°C, only P2_2-3 and P2_3-5 showed tSRB activity. Both Desulfotomaculum and Archaeoglobus were enriched in incubations with P2_2-3, while P2_3-5 gave only Desulfotomaculum as well as

Desulfocurvus. These two produced water samples used for these enrichments also had high field sulfide concentrations. This implies that the potential for corrosion at these sites is high. Some

Marinobacter spp are moderate thermophiles, which reduce nitrate to nitrite and no further

(Okpala et al., 2017; Handley and Lloyd, 2013). Nitrite when present in high concentrations in the absence of sulfide prevents the corrosion on a metal surface, through the formation of a passivating layer of iron (III) oxide (Lee et al., 2012). However, in the presence of sulfide, the presence of nitrite leads to the formation of sulfur or polysulfides, which are more corrosive than sulfide.

161

The high sulfide concentration in producing wells P2_2-3 and P2_3-5 (Table S6-1) suggests that the tSRB in the water samples were active in the reservoir. This was confirmed in the enrichment cultures. These tSRB enrichments also had significant fractions of Petrotoga, which are thermophilic fermentative bacteria, reducing thiosulfate and sulfite to sulfide (Kaster et al., 2009; Blumer-Schuete et al., 2008; Miranda-Tello et al., 2004).

Producing wells from platforms 1 and 2 had high sediment and water content, with only 3 to 10% of produced oil. This could account for the increase in the mesophilic Gamma- and

Epsilonproteobacteria seen in the sequences of both the produced water samples and enrichment cultures. Long term flooding of reservoirs with cold seawater leads to a decrease in in-situ temperatures and can result in extensive shifts in microbial community composition (Vigneron et al., 2017). Although this may explain the lack of thermophilic taxa and thermophilic activities, the distinct water chemistry (1 Meq of NaCl and no sulfate) does not support the idea of seawater breakthrough as this typically has 0.5 Meq of NaCl and 20 – 30 mM sulfate. This NaCl concentration may be due to the dissolution of halides in the reservoir.

162

Chapter Seven: Corrosion of carbon steel by tSRB enriched from oilfield produced water samples

7.1 Abstract

This study compares the type of corrosion induced on carbon steel by three tSRB consortia enriched from different oilfields in the presence or absence of organic substrates. Examination of

SEM micrographs of coupons retrieved from incubations with lactate showed extensive populations of bacterial cells mixed with corrosion products. Coupons in medium with no organic electron donor, had few bacterial cells found only in FeS rich regions on the coupons. Higher corrosion rates corresponded to increased numbers of localized pits formed. Some tSRB were observed to attach to the metal surface with filaments, which may be used in the uptake of electrons for sulfate reduction.

7.2 Background

Corrosion is a prevalent problem confronting the oil and gas industry. Fifty-nine percent of total pipeline failures in the oil and gas production and transportation industry is attributed to corrosion

(Alberta Energy Regulator, 2013). This poses serious economic implications, as billions of dollars are spent annually to remedy damages resulting from pipeline failures (Duncan et al., 2009).

Corrosion is generally viewed as a naturally occurring attack on or degradation of material, driven by reaction with its environment. Corrosion in pipelines is influenced either by chemical, physical or biological factors. The majority of oil and gas pipelines are made up of carbon steel, which is an alloy of iron, containing a smaller fraction (e.g. 2%) of carbon. The corrosion of iron is an electrochemical process in which the oxidation of metallic iron to ferrous ion at the anode is

163

coupled to the reduction of an electron acceptor (oxidant) at the cathode in order to balance net charges (Beech and Sunner 2007).

Fe0 ↔ Fe2+ + 2e- [E°’ = -0.47 V]

Under anoxic conditions, corrosion in pipelines is in part attributed to the activity of microbes and their metabolites, with sulfate reducers implicated as the main culprits (Dinh et al., 2004). Sulfate reducing bacteria (SRB) acquire energy for growth through the reduction of sulfate to hydrogen sulfide using electrons derived from the oxidation of organic molecules and molecular hydrogen.

SRB can cause corrosion by using/uptaking electrons directly from iron for the reduction of sulfate in a process referred to as EMIC – electrical microbially induced corrosion (Enning and Garrelfs

2014). This type of corrosion, results in severe damage of iron with reported corrosion rates of up to 0.7 mm/yr reported under laboratory conditions.

0 2- - 4 Fe + SO4 + 3 HCO3 + 5H+ → FeS + 3 FeCO3 + 4 H2O

SRB can also cause corrosion indirectly through the corrosive metabolite hydrogen sulfide which reacts with iron. This indirect mechanism is referred to as CMIC – chemical microbially induced corrosion.

H2S + Feº → H2 + FeS

The purpose of the experiments described in this chapter was to determine the contribution of tSRB to the biocorrosion of carbon steel in the presence or absence of organic carbon.

7.3 Materials and methods

7.3.1 Preparation of coupons

Carbon steel coupons (ASTM 366; 1 x 1 x 0.1 cm), with chemical composition (wt%): C

0.15% max, Mn 0.06% max, P 0.035% max, S 0.04 % and balance Fe were used for this study.

164

The coupons were polished with emery paper progressively from coarse to fine (240, 400, 800,

2400 grit). The coupons were degreased with acetone and dried under a stream of N2. The weight of each coupon was determined, and the coupons were stored under anaerobic conditions prior to use.

7.3.2 Culture medium and tSRB culture

The tSRB cultures used for this corrosion study were enriched from three different oilfield produced water samples. One of the tSRB culture designated 18PW_tSRB was enriched from produced water (18PW) sample retrieved from a low temperature oilfield (MHGC) at 60°C (see chapter 3). The other two tSRB cultures used were enriched at 60°C from produced water samples from the Terra Nova oilfield (TN_tSRB) and North Sea oilfield (NS_tSRB), both of which are high temperature oilfields.

The medium used for the corrosion tests was the same as those used for the tSRB enrichment. CSBK medium was used for cultivation of 18PW_tSRB, CSBA for TN_tSRB and artificial seawater medium for NS_tSRB. Composition of CSBK can be found in chapter 5 and

CSBA in chapter four. The artificial seawater (ASW) medium used contained the following in grams per litre; 26.0 NaCl, 5.6 MgCl2, 1.4 CaCl2, 2.03 (10 mM) MgSO4.7H2O, 0.25 NH4Cl2, 0.2

KH2PO4, 0.72 KCl, 0.2. All the medium bottles had an N2-CO2 headspace.

7.3.3 Corrosion tests

To determine the type of MIC caused by the tSRB cultures, each of the tSRB growth media mentioned above, was supplemented with 5 mM sulfate and 5 mM lactate to simulate an

CMIC/EMIC (CE) condition or type corrosion where the added lactate is sufficient to reduce 2.5

165

- 2- + - - mM sulfate (2CH3CHOHCOO + SO4 + H → 2CH3COO + 2CO2 + HS + 2H2O), after which

0 0 2- - the SRB may switch to use Fe as electron donor for sulfate reduction (4 Fe + SO4 + 3 HCO3 +

+ 5 H → FeS + 3 FeCO3 + 4 H2O). Whereas to create an EMIC (E) scenario, the medium is supplemented with 5 mM sulfate and 1 mM acetate. The acetate is added as carbon source, while

Fe0 is for sulfate reduction. Media containing lactate or acetate with 18PW_tSRB is designated

CE_18PW_tSRB or E_18PW_tSRB respectively, with TN_tSRB; CE_TN_tSRB or E_TN_tSRB respectively, with NS_tSRB; CE_ NS_tSRB or E_ NS_tSRB respectively.

Prior to starting the corrosion tests, the cleaned coupons were placed in sterile 120 mL serum bottles and 50 mL medium were added. The medium was inoculated with 5 mL of the tSRB culture and serum bottles were closed with butyl rubber stopper and aluminium crimps. The culture was incubated at 60°C for 35 days. Samples were withdrawn periodically for measurement of sulfide and sulfate. All incubations were done in duplicates.

7.3.4 Surface Analysis of coupons

At the end of the 35 days incubation period, surface morphology of the corrosion products and SRB on the coupons, were analyzed using scanning electron microscopy (SEM) and elemental maps were obtained through an Energy Dispersive Spectroscopy (EDS) coupled with the SEM.

The coupons were removed from the culture bottles and rinsed gently with phosphate buffered saline and were exposed to 2% glutaraldehyde solution for 8 h and serially dehydrated with an ethanol gradient (at 30%, 50%, 70%, 90% and 100% for 10 min each). The coupons were then dried under a stream of N2 and visualized using FEI Quanta 250 FEG variable pressure/environmental field emission SEM equipped with an Everhart Thornley Detector (ETD) for high-vacuum secondary electron imaging and a two-segment semiconductor Backscatter 166

Electron Detector (BSE) at the Instrumentation Facility for Analytical Electron Microscopy

(IFFAEM) at the University of Calgary.

Corrosion deposits were removed from the coupon surface using the NACE RP0775-2005 protocol which involved exposing coupons for 2 min to dibutylthiourea-HCl solution, sodium bicarbonate solution, deionized water and a final acetone wash. The coupons were air dried before pit depth measurement. The surface and pit depth profile of the coupons were determined using an optical profilometer (Zyoscope).

7.3.5 Corrosion rate determination

After incubation, the coupons were cleaned and the final weight of each coupon was determined and this was used in determining the weight loss.

The corrosion rate (CR) in mm/yr, was calculated from the weight loss data using the formula;

훥푊 퐶표푟푟표푠푖표푛 푅푎푡푒 = 퐾 ∗ ( ) 퐷 ∗ 퐴 ∗ 푇

Where K is a constant = 87,600, ∆W is the weight loss (g) at end of incubation (initial weight – final weight), D is the density of carbon steel (7.85 g/cm3), A is the surface area of each coupon

(cm2) and T is the incubation time (h).

7.4 Results

7.4.1 tSRB activity in media

The type of MIC induced by three tSRB cultures enriched from one low and two high temperature oil field produced water samples, was studied in medium used to either induce CMIC

(CE; 5 mM lactate, 5 mM sulfate) or EMIC (E; 1 mM acetate, 5 mM sulfate).

167

The results in Figure 7-1 indicate that the three tSRB consortia used reduced sulfate with production of sulfide. Sulfide concentrations in the lactate-sulfate medium inoculated with

18PW_tSRB and TN_tSRB was higher than that inoculated with NS_tSRB (3.5 and 2.7 mM, respectively). In incubations containing acetate and sulfate, sulfide produced was maximally 2 mM. Sulfide production in CE medium was more than in E medium in A and B, but not in (C), which represented incubation with NS_tSRB. Sulfide was not detected in any of the uninoculated controls.

7.4.2 Corrosion with 18PW_tSRB enriched from the MHGC field

The SEM image of coupons in media containing lactate-sulfate or acetate-sulfate after 35 days of incubation at 60°C are shown in Figure 7-2A and 7-2D. As can be seen from the SEM micrograph in Figure 7-2A, coupons exposed to lactate and sulfate (CE_18PW_tSRB), revealed the presence of bacterial cells distributed over the coupon. The cells observed included straight rods and some rods with swollen midsections. This swelling may be due to presence of central or oval spores, a characteristic of Desulfotomaculum spp (Aullo et al., 2013). The cells adhered to corrosion products and exopolymeric substance (EPS) formed on the coupons. The EDS results showed that the corrosion products formed were rich in Sulfur species, which is indicative of an iron sulfide film. On removal of the corrosion products from this coupon (Figure 7-2B), several pits were seen on the coupon surface with an average pit depth of 2.5 µm. A SEM image of coupon in the medium with acetate and sulfate had few bacterial cells most of which were found underneath crusts or embedded in corrosion products. The EDS analysis showed that the cells were predominantly present in sulfide rich regions. Images of the cleaned coupon surface (Figure 7-2D) showed pits formed due to metal loss. Coupons in the control media had no pits (Figure 7-2C). 168

MHGC (18PW_tSRB) Terra Nova (TN_tSRB) North Sea (NS_tSRB) CE_TN_tSRB 4 (A) 4 (B) 4 CE_NS_tSRB (C) CE_18PW_tSRB CE_control CE_Control CE_Control E_TN-tSRB E_NS_tSRB 3 E_18PW_tSRB 3 E_control 3 E_control E_control 2 2 2

Sulfide Sulfide (mM) 1 1 1

0 0 0 0 10 20 30 40 0 10 20 30 40 0 10 20 30 40 Time (d)

tSRB enriched from low temp oilfield (Desulfotomaculum) tSRB enriched from high temp oilfield (B) Desulfotomaculum; (C) Archaeoglobus

169

7.4.3 Surface analysis of coupon exposed to tSRB enriched from Terra Nova produced water samples

SEM analysis of coupons exposed to TN_tSRB culture in media containing lactate and sulfate, showed the presence of extensive corrosion products on the coupon surface. Rod-shaped cells which appeared singly or in pairs were found on the surface or on the corrosion products

(Figure 7-3A). EDS analysis revealed that the corrosion products are S-enriched with some phosphorus-rich islands (Figure 7-3B). Several pits of size up to 2.6 µm were observed after coupons were cleaned (Figure 7-3C and 7-3D).

For coupons in media with 5 mM sulfate and 1 mM acetate as carbon source, bacterial cells were found in sulfide rich regions. The cells occurred singly or in chains and possessed tiny filaments or pili-like structures protruding from the cells and attaching to the metal surface (Figure

7-4A). These cells are different from the cells observed in the lactate medium which had no filaments. EDS analysis indicated phosphorus rich crystals surrounded by FeS (Figure 7-4B). The coupons surface was covered by pits which were about 7 µm deep (Figure 7-4D).

171

172

(A) (B)

173

7.3.4 Surface analysis of coupons exposed to tSRB enriched from North Sea PW samples

For coupons exposed to lactate-sulfate in the presence of NS_tSRB, SEM analysis showed bacterial cells intermingled with the corrosion deposits on the metal surface. (Figure 7-5A).

Spherical phosphate rich nodules were detected with EDS and the corrosion products were mainly

FeS, which covered the metal surface (Figure 7-5B). Removal of corrosion deposits from coupon surface revealed pits that were about 7 µm deep (Figure 7-5C and 7-5D). Coupons exposed to the acetate-sulfate showed that bacterial cells were abundant in sulfide-rich regions under exposed corrosion deposits that had peeled off the metal surface. Some of the bacterial cells were also interspersed with the corrosion products (Figure 7-6A). Corrosion products included magnesium rich spindles and FeS (Figure 7-6B). Localized pits were also observed on the coupon surface

(Figure 7-6C) and pit depth was up to 13 µm (Figure 7-6D).

7.4.4 Corrosion rates

General corrosion rates of coupons exposed to the three different tSRB cultures containing either lactate-sulfate or acetate-sulfate incubated with carbon steel coupons at 60°C are shown in Figure

7-7. In the case of 18PW_tSRB and TN_tSRB consortia, higher corrosion rates were observed in medium containing 1 mM acetate, whereas in medium containing lactate, the corrosion rates were lower. These increased corrosion rates corresponded to the number of pits found on the surface of the coupons. However, in media with NS_tSRB cultures there was little difference in the corrosion rates with the lactate media and with the acetate medium (0.016 and 0.015 mm/yr, respectively).

The tSRB enrichments from Terra Nova with acetate and sulfate, were the most corrosive with a general corrosion rate of 0.09 mm/yr over 35 days of incubation.

174

(A) (B)

CE_NS_tSRB

Figure 7-5: Surface analysis of coupons exposed to NS_tSRB and CSBA medium containing 5 mM sulfate and 5 mM lactate at 60°C for 35 days. SEM image of coupon (A), EDS spectral image (B), light photomicrograph of coupons after removing the corrosion products (C) and optical profilometer image and pit depth profile (D)

175

(A)(A) (B)

Figure 7-6: Surface analysis of coupons exposed to NS_tSRB and CSBA medium containing 5 mM sulfate and 1 mM acetate at 60°C for 35 days. SEM image of coupon (A), EDS spectral (B), photomicrograph of coupons after removing the corrosion products and optical profilometer image and pit depth profile (D).

176

0.105

0.090

0.075

0.060

0.045

Corrosion rate (mm/yr) rate Corrosion 0.030

0.015

0.000 18PW_tSRB 18PW_tSRB TN_tSRB TN_tSRB NS_tSRB NS_tSRB (CE) (E) (CE) (E) (CE) (E)

Figure 7-7: General corrosion rates of carbon steel coupons in tSRB culture medium with 5 mM lactate, coupon and 5 mM sulfate or 1 mM acetate, coupon and 5 mM sulfate.

177

7.5 Discussion

Three tSRB consortia enriched from produced water samples from MHGC, Terra Nova and North Sea oilfields were evaluated for their ability to cause corrosion of carbon steel coupons in the presence or absence of organic substrates. Community analysis of these enrichment identified Desulfotomaculum spp as one of the tSRB common to these enrichments, but present in different proportions (see Chapters 3, 4 and 6). The tSRB enriched from MHGC (18PW_tSRB) contained 24% Desulfotomaculum, the Terra Nova enrichment (TN_tSRB) had 97%, and the

North Sea sample (NS_tSRB) had 0.07% Desulfotomaculum and 66% Archaeoglobus (Chapters

3, 4, and 6). Most of the Desulfotomaculum spp are incomplete oxidizers, meaning that they do not utilize acetate for sulfate reduction, except for a few that can completely oxidize organic substrates to CO2 (Aullo et al., 2013). From previous experiments, these consortia have been observed to accumulate acetate as the end product of lactate oxidation during growth and sulfate reduction. Hence, in this study 1 mM acetate was added as a source of carbon to the medium, when the coupon (Fe0) was electron donor. The results presented here, indicated that each of the tSRB consortia reduced sulfate to sulfide with lactate. Sulfide production in the medium with 1 mM acetate was also seen. This suggested that the tSRB consortia may have reduced sulfate using electrons directly from Fe0, possibly explaining the increased corrosion rates observed for coupons incubated in the acetate containing medium.

The increase in corrosion rates of coupons with 18PW_tSRB (MHGC) lactate to acetate medium was 42%, while for TN_tSRB (Terra Nova) it was 65% (Figure 7-7). SEM analysis of coupons showed that incubations with lactate always has lots of bacterial cells interspersed with or deposited on the corrosion products indicating that the growth rate with lactate was faster than the rates at which FeS was precipitated (Sherar et al., 2011). These cultures also had FeS film 178

covering the entire metal surface as indicated with EDS. For coupons in acetate medium, fewer cells were seen and most of them seemed to be in direct contact with the metal surface or completely encrusted by corrosion products and mainly in areas rich in FeS characteristic of EMIC.

Another interesting observation in each of the media with acetate was presence of ruptured crusts of corrosion deposits with re-exposed metal surfaces beneath in which tSRB was found. Formation of an FeS film over a metal surface protects the metal from further corrosion, however if the FeS is removed and the metal surface re-exposed increased localized corrosion occurs (Enning and

Garrelfs 2014).

In the acetate medium inoculated with the TN_tSRB from Terra Nova the SEM micrograph showed cells that contact the metal surface by fibrils or filaments and have sulfide crusts deposited on the cells surface. The presence of such structures suggests that these bacteria may be using these to capture electrons directly from the coupon surface. This type of structures has also been observed in iron reducers such as Geobacter sulfurreducens and Shewanella oneidensis (Sherar et al 2011; Reguera et al., 2005; Gorby et al., 2006). The corrosion rates calculated for the coupons in this incubation was the highest at 0.09 mm/yr for a 35-day incubation period. The implications of these observations are that tSRB could significantly contribute to corrosion in pipelines or other topside facilities in the field even in the absence of organic substrates, provided sulfate is present.

179

Chapter Eight: Effect of nitroprusside on thermophilic sulfate reduction

8.1 Abstract

The effect of sodium nitroprusside (SNP: : Na2[Fe(CN)5NO]) on the activity of thermophilic sulfate reducers derived from a seawater flooded reservoir was evaluated. The activity of tSRB was completely inhibited at SNP concentrations of 0.05 mM (15 ppm) in tSRB batch cultures.

Below this concentration, complete sulfate reduction in tSRB cultures was measured at 835 h of incubation. SNP also efficiently reacted with sulfide. Treatment of a tSRB culture with 0.025 to

1.5 mM SNP decreased the sulfide concentration in the culture medium by 25% to 69%, respectively. In continuous culture, 0.17 mM of SNP was required to completely inhibit tSRB activity. This result demonstrates that SNP could be used to mitigate souring in seawater flooded reservoirs. Corrosion studies showed that SNP is corrosive to carbon steel coupons. However, this corrosion effect is concentration dependent and would not be an issue at the low concentrations of

SNP recommended for souring control purposes.

8.2 Introduction

Biogenic sulfide production, a hallmark of the growth and activity of SRM presents a huge challenge to the petroleum industry. Sulfide production should be controlled because of its toxic and nature, corrosion of pipelines, and thus negative impact on oil and gas quality (Greene et al.,

2006; Thrasher and Vance, 2005; Xue and Voordouw, 2015). Reservoir souring of oilfields is commonly mitigated through the application of nitrate, whereas souring of above-ground facilities is mostly treated with biocides and sulfide scavengers. Inhibition of SRB activity in reservoirs through biocide application may be constrained by poor permeability, and/or sorption of biocide

180

to reservoir minerals (Kjellerup et al. 2005; Gardner and Stewart 2002; Reinsel et al. 1996).

Common biocides used in above-ground operation in oilfields are non-oxidizing organic biocides including glutaraldehyde, bronopol, formaldehyde, cocodiamine, tetrakishydroxymethyl phosphonium sulfate and benzalkonium chloride. Biocide application comes with its own disadvantages, which includes cost of application and toxicity to non-target organisms as a potential unintended environmental consequence (Fraise, 2002; Whitham and Gilbert, 1993).

Continuous application may also lead to development of biocide resistant strains (Telang et al.,

1998). Furthermore, application of some biocides can give corrosion problems when dosed at very high concentrations (Sharma et al., 2017).

Based on this, the search for easily degradable (“green”) effective biocides for souring control purposes is essential. A biocide which fits this description is sodium nitroprusside

Na2[Fe(CN)5NO.2H2O]; MW 298g/mol. Although commonly reported as a vasodilating drug for treating hypertension (Varon and Marik, 2008; Koslyk et al., 2015; Lim and Zaphiriou, 2016),

SNP has also been used for its bactericidal properties in controlling food spoilage organisms such as Clostridium sporogenes and Bacillus subtilis (Joannou et al., 1998; Moore, et al., 2004). In addition, SNP through its release of NO, has been reported to be effective in the dispersal of both single and multi-species biofilms (Barraud et al., 2006; Barraud et al., 2009; Chua et al., 2014). It also reacts chemically with H2S (Filipovic et al., 2013). The potential application of SNP in controlling activity of sulfate reducers and elimination of sulfide in low temperature sour systems was demonstrated in recent work in our laboratory. Studies on its efficiency at higher temperature are lacking. Therefore, this work focused on the effect on SNP on sulfate reduction and possible corrosivity at high temperature.

181

8.3 Material and Methods

8.3.1 tSRB culture and cultivation medium

A thermophilic sulfate reducing culture previously enriched from Terra Nova field produced water sample (see Table 4-1: PW1_14) was used. This oil field is located offshore

Newfoundland, Canada and has an in-situ temperature of 95 °C. Modified bicarbonate-buffered, sulfide-reduced Coleville synthetic brine (CSB) medium A, composed of (g/L): NaCl, 29.3;

CaCl2.2H2O, 0.15; MgCl2.5H2O, 0.4; NH4Cl, 0.25; KCl, 0.5; KH2PO4, 0.2; resazurin (1%), 2-3 drops, trace elements and selenate-tungstate, 1 ml each (added separately after autoclaving the medium) was used, with a final pH adjusted to 7.4-7.6 using 2 M HCl (Hubert et al., 2003). Twenty mL aliquots of CSBA medium were dispensed into 60 mL serum bottles with an N2-CO2 headspace. The serum bottles were sealed with butyl rubber septa and aluminum crimps.

Incubations were done in duplicates.

8.3.2 Preparation and handling of SNP

Due to the photosensitivity of SNP was prepared fresh before the start of each experiment by dissolution in anaerobic water under N2 – CO2. All incubations with SNP were done in the dark and extra caution was taken by wrapping serum bottles with aluminum foil.

8.3.3 Effect of nitroprusside on tSRB activity and sulfide production

To evaluate the effect of nitroprusside concentration on tSRB activity at 60 °C, 400 ml

CSBA medium with 20 mM lactate and about 8 mM sulfate was used in a 500 mL bottle capped with a butyl rubber stopper. The medium was inoculated with 5% v/v of a tSRB culture and monitored for sulfide production until mid-log phase, when half of the sulfate had been reduced.

Twenty millilters of the tSRB culture was then transferred with a syringe into sealed 60 ml serum

182

bottles with N2-CO2 headspace before the addition of nitroprusside at concentrations of 0, 0.025,

0.05, 0.1, 0.2, 0.5, 1 and 1.5 mM. Incubation was done in the dark at 60 °C to prevent photodegradation of SNP. The concentrations of sulfate, sulfide, and lactate were monitored over time.

8.3.4 Corrosivity of nitroprusside under sour thermophilic condition

To test the corrosivity of SNP in the presence sulfide (mimicking a sour thermophilic system) towards carbon steel coupons, a 5% tSRB culture was inoculated into 400 mL of CSBA medium containing 10 mM lactate and 5 mM sulfate with a headspace of N2-CO2 and was grown to mid-log phase. Aliquots of 5 mL of this active tSRB culture were transferred into 120 mL serum bottles containing 50 mL medium and a polished carbon steel coupon (ASTM 366, 2 x 1 x 0.1 cm). Different concentrations of SNP (0, 0.025, 0.05, 0.1, 0.2, 0.5 and 1 mM) were then added at midlog phase and triplicate serum bottles were incubated at 60 °C on a shaker at 100 rpm in the dark for 30 days. Weight loss corrosion rates were measured at the end of the incubation using the formula shown in chapter 7 (section 7.3.5) .

8.3.5 SNP-mediated control of sulfide production in a continuous culture of tSRB

The ability of SNP to inhibit sulfide production in a tSRB continuous culture was done to mimic sea waterflooded high temperature reservoirs with continuous sulfate and organic carbon supply. A continuous culture of tSRB was obtained by inoculating 10 mL of a 24-h tSRB culture into 90 mL CSBA medium, supplemented with 10 mM lactate and 5 mM sulfate. The cultures were incubated in a sand bath on a heated magnetic stir plate (stirred at 200 rpm) at 60 °C. Once all sulfate was reduced, a multichannel peristaltic pump was used to pump the same medium at a

183

flow rate of 25 ml/d corresponding to a dilution rate 0.25 d-1. Duplicate tSRB chemostat cultures were treated with SNP (10, 25 and 50 ppm) as soon as constant sulfide production was observed.

Medium bottles and inlet tubing where wrapped with aluminum foil to prevent photodegradation of nitroprusside. Sulfide and sulfate concentrations were determined from samples withdrawn directly from the chemostat effluent via a 3-way valve of the chemostat.

8.3.6 Effect on nitrous oxide (N2O) on sulfide production in tSRB

When exposed to light, SNP releases nitric oxide (NO). It also produces N2O upon reaction with H2S. Nitrite is a known metabolic inhibitor of SRB, and other oxides of nitrogen such as N2O may be inhibitory to SRB. To test this, anaerobic CSBA medium with 4 mM lactate and 2 mM sulfate dispensed in 50 mL volumes in to 120 mL serum bottles was inoculated with 10% tSRB chemostat cultures growing on lactate and sulfate. The bottles were sealed with butyl rubber stoppers and aluminum crimps and N2O gas was added to the headspace at 2 or 5 mM concentrations. For the controls, 2 or 5 mM N2 was added. Uninoculated cultures served as sterile controls. Sulfide production in all incubations was monitored over time.

8.3.7 Analytical methods

The concentration of residual sulfate and lactate were determined for 0.5 mL samples withdrawn from each culture medium and centrifuged at 17,000 g for 5 min. The supernatants were used for high-pressure liquid chromatography (HPLC), using a Waters 1515 HPLC instrument equipped Waters 432 conductivity detector (for sulfate) and an IC-PAK Anion HC,

4.6- by 150-mm columns (Waters, Japan), Waters 2487 UV detector (for lactate) at 210 nm, with

184

a Prevail organic acid (OA) 5µ column (250 x 4.6 mm, Alltech, Guelph, ON) at a flow rate of 1.0 ml/min mobile phase.

8.4 Results and discussion

8.4.1 Inhibition of thermophilic SRB activity in batch cultures

To determine the suitability of SNP to inhibit tSRB activity at 60 oC, different concentrations were injected into actively growing tSRB cultures at mid-log phase. The results showed that SNP had a strong inhibitory effect on tSRB activity at concentrations above 0.05 mM

(Figure 8-1A-C). However, at lower SNP concentrations (0.025 and 0.05 mM), this inhibitory effect was transient and sulfate reduction proceeded with complete reduction of sulfate to sulfide seen at 835 h for 0.025 mM SNP (Figure 8-1A and B). Sulfide concentration dropped in all the tSRB cultures treated immediately following the addition of SNP (25% with 0.025 mM; 33% with

0.05 mM; 33% with 0.1 mM; 37% with 0.2 mM; 46% with 0.5 mM; 59% with 1.0 mM and 68.9% with 1.5 mM), because of chemical reaction of SNP with sulfide. This chemical reaction continued for a prolonged period of time in some cases e.g., with 0.2 mM SNP the sulfide concentration dropped from 3 to 1 mM over 700 h. At high temperatures, sulfide partitions more into the gas phase such that when aqueous phase sulfide is being consumed more of the gas phase sulfide is re- dissolves into the aqueous phase (Groysman, 2014) and this would also contribute to the measured sulfide in incubations treated with low concentrations of SNP. The oxidation of lactate was also inhibited similarly as the reduction of sulfate to sulfide (Figure 8-1C). The inhibitory effects of

SNP are due to release of nitric or nitrous oxide in the growth medium. Besides nitrite, both nitric oxide and nitrous oxide may be potentially toxic to sulfate reducers (Carlson et al., 2015; Londry and Suflita, 1999). Nitric oxide release from SNP occurs either when SNP solution is exposed to

185

light (Vesey and Batistoni, 1977; Filipovic et al., 2013) or when it reacts with thiol groups to form

S-nitrosothiols (Joannou et al., 1998; Filipovic et al., 2013). Nitrous oxide is formed from through a series of complex reactions which occur when SNP reacts with H2S. SNP reacts rapidly with H2S

3- to form [(CN)5FeN(O)SH] , which further reacts with sulfide to form disulfide and the

3- intermediate [CN5Fe(HNO)] (Filipovic et al., 2013; Quiroga et al., 2011). The disulfide formed

3- is oxidized to polysulfides that in turn react with the intermediate [CN5Fe(HNO) ], forming a thiocyanate adduct and HNO. Further dimerization of HNO gives rise to N2O formation. Nitrate is formed as part of this reaction sequence, as shown in Figure 8-2.

The reaction of SNP with sulfide also led to changes in the colour of the medium from

‘prussian blue’ as soon as the SNP contacted the sulfide to a brownish colour after 24 h of incubation (Figure 8-3). Similar colour changes have been described for reaction of SNP with sulfide by Filipovic et al., (2013). The reaction of SNP with sulfide allows its use in oilfields, where extensive souring has already occurred to mitigate the negative toxic effect of sulfide.

186

10 (A) 0 mM 9 0.025 mM 8 0.05 mM 7 0.1 mM 6 0.2 mM 5 0.5 mM 4 1.0 mM 1.5 mM 3 2

Sulfate concentration (mM) concentration Sulfate 1 0 0 100 200 300 400 500 600 700 800 900

5 (B)

1 Sulfide concentration (mM) Sulfide concentration 0 0 100 200 300 400 500 600 700 800 900

20 (C) 0 mM 0.025 mM 0.05 mM 15 0.1 mM 0.2 mM 0.5 mM 10 1.0 mM 1.5 mM

(mM) concentration Lactate 0 0 100 200 300 400 500 600 700 800 900 Time (h)

187

nitrate released 0.025 mM 0.4 0.05 mM 0.1 mM 0.2 mM 0.3 0.5 mM 1.0 mM 1.5 mM 0.2

0.1 Nitrate concentration (mM) concentration Nitrate 0 0 100 200 300 400 500 600 700 800 900 Time (h)

Figure 8-2: Nitrate formation after addition of different concentrations of SNP to active tSRB cultures at mid-log phase.

188

8.3.2 Corrosion of carbon steel coupon during treatment of active tSRB culture with SNP

The corrosivity of SNP when applied to a sour thermophilic system was also assessed. The results show that SNP is corrosive to carbon steel when added at concentrations above 0.1 mM

(Figure 8-4). At SNP concentration of 0.025 mM the corrosion rate was 0.004 mm/yr, whereas the untreated tSRB culture which had a general corrosion rate of 0.0018 mm/yr. This SNP concentration (0.025 mM), was not inhibitory to the tSRB but was sufficient to react with some of the sulfide. However, corrosion rates increased up to 0.008 and 0.012 mm/yr when 0.5 and 1.0 mM SNP was added to the tSRB culture. The reaction of SNP with sulfide results in the formation of polysulfides and nitrite which may have caused the increased corrosion. Lower corrosion rates

(0.025 and 0.002 mm/yr) that were comparable to untreated tSRB culture were seen for cultures treated with 0.05 and 0.1 mM SNP, suggesting that these SNP concentrations were ideal for eliminating the pre-formed sulfide, as well as inhibiting the activity of tSRB, thus preventing further sulfate reduction (Figure 8-1A; 8-4).

189

1.5 mM 1.0 mM 0.5 mM 0.2 mM 0.1 mM 0.05 mM 0.025 mM

Figure 8-3: Change in color of tSRB culture medium after 24-h exposure to different concentrations of SNP (0, 0.025, 0.5, 0.1, 0.5, 1, 1.5 and 2 mM, as indicated) in the presence of SRB and sulfide.

0.014

0.012

0.01

0.008

0.006

0.004 Corrosion Rate (mm/year) Rate Corrosion 0.002

0 0 0.025 0.05 0.1 0.2 0.5 1 Concentration of Nitroprusside (mM) Figure 8-4: General weight loss corrosion rates of carbon steel coupons exposed to 0 to 1 mM nitroprusside added to an active tSRB culture at mid-log phase. Data presented are the average corrosion rate (mm/yr) for three replicates.

190

8.4.2 Effect of SNP on tSRB continuous culture

A tSRB continuous culture was used as a model system to test the effectiveness of SNP in eliminating tSRB activity and sulfide production in systems exposed to a constant influx of electron donors and acceptors, like in an oil/ produced water transporting pipeline or seawater flooded reservoir. In the control chemostat, approximately 4.5 mM of sulfide was constantly produced during the experimental period (Figure 8-5A). Whereas in the treated chemostat, injection of 10 ppm (0.03 mM) into the chemostat influent medium had a small effect on tSRB activity with the injected SNP reacting with about 0.24 mM sulfide (Figure 8-5B). Increasing the

SNP concentration to 25 ppm (0.08 mM) caused an additional 24% decrease in sulfide concentration and increased the sulfate concentration to 1 mM. It appears that at these lower concentrations (10 and 25 ppm), the tSRB consortium either become acclimated to SNP or perhaps the SNP added was used only for reacting with sulfide and was not available to act on the tSRB population. Addition of 50 ppm (0.17 mM) SNP, permanently inhibited tSRB activity, with sulfide and sulfate concentrations reaching 0 and 5 mM, respectively. When compared with the batch cultures, increased concentrations of SNP were required to inhibit tSRB activity; 0.05 mM for batch cultures and approximately 0.2 mM for continuous cultures. However, note that over the course of the treatment periods shown the SNP concentration in the bioreactors increased gradually to the value of the in the influent medium (0.017, 0.04 and 0.17 mM). Hence, the actual inhibitory concentration in continuous cultures at 0.25 d-1 were lower than 0.17 mM.

191

6 (A) 5

3 Control_sulfate Control_sulfide 2

0 0 10 20 30 40 50 60 70

6 10 ppm 25 ppm 50 ppm SNP SNP SNP (B)

5 Concentration (mM) Concentration 4

3 sulfate_SNP Sulfide_SNP 2

0 0 10 20 30 40 50 60 70 Time (d)

192

8.4.3 Inhibitory effect of nitrous oxide on tSRB activity

Because previous studies in our lab showed the accumulation of N2O in the headspace of mSRB cultures treated with SNP, the effect of adding N2O to the headspace of tSRB cultures was tested. The results showed that addition of 2 or 5 mM N2O to the headspace of a tSRB culture at t

=0 inhibited sulfide production, compared to the control with injected N2 (Figure 8-6). Rapid sulfide production after a 2-day lag phase was observed in the tSRB culture with injected N2. This indicates that denitrification products other than nitrite are also inhibitory to tSRB. Although not tested, addition of N2O to an actively growing tSRB, may have similar outcomes as nitrite (Kaster et al., 2007; Okpala et al., 2017). Percheron et al. (1998), while studying the nitrate and nitrite reduction in sulfide-rich environments, observed that sulfate reduction in a laboratory scale digester did not proceed until all the gaseous denitrification products of nitrate has been depleted.

Further studies by Londry and Suflita (1999), showed that during denitrification, nitrous oxide accumulation raised medium redox potential, which prevented sulfate reduction. Joannou et al.,

(1999) found that SNP oxidizes thiols of the S-layer proteins in the cell wall of Clostridium sporogens, which results in loss of structural intergrity and eventual cell death. This would indicate that SNP is not selective in action as no particular thiol is targeted. As mentioned ealier, reaction of SNP with thiols releases NO, which also contributes to tSRB inhibition.

193

1.6

1.2 Uninoculated

2 2mM mM N20 N2O 0.8 5 5mMmM N20 N2O 5 5mMmM N2 N

0.4 2 Sulfide concentration (mM) concentration Sulfide

0 0 2 4 6 8 10 12 14 Time (d)

194

8.5 Conclusion

In conclusion, SNP was effective at controlling tSRB activity, in addition to eliminating

H2S from the tSRB medium. This indicates that SNP maintains its biocidal property and can thus be used in high temperature oilfields for souring control purposes. The findings from this study also showed that SNP is corrosive to carbon steel when added at high concentrations. But at the low concentrations of 0.05 to 0.1 mM of SNP required to mitigate souring, corrosivity is minimal and field application of SNP will be a cost-effective means of tackling reservoir souring issues.

195

Chapter Nine: Control of souring with nitrate in thermophilic bioreactors

9.1 Abstract

The effect of nitrate in high temperature bioreactors simulating a waterflooded system was evaluated. These bioreactors had a colder (20-30°C) mesophilic inlet region and a hotter (60°C) bulk and outlet region. Injection of medium with excess VFA as well as with nitrate and sulfate indicated that mNRB and mSRB were responsible for the reduction of nitrate and sulfate in these bioreactors. Studies with bioreactors with a very short mesophilic region indicated that tSRB of the genus Desulfotomaculum could be maintained initially. Souring in bioreactors kept in a constant temperature incubator at 60°C injected with medium with lactate and sulfate could be maintained for up to 60 days, although system upsets indicated by decreasing sulfide and increasing sulfate concentrations were evident. Overall it appeared that thermophilic continuous cultures (Chapter 4) are more easy to maintain than thermophilic bioreactors.

9.2 Introduction

Control of souring is a priority for oil companies, due to the hazards associated with sulfide production in oil production systems. Biological souring in oilfields can be avoided if sulfate is excluded from the production system, but this is almost impossible particularly for offshore oil production where high sulfate seawater is used for secondary oil recovery.

Injection of cold seawater into hot reservoirs generates a low to high temperature profile in the NIWR (Figure 2-1) and enables the growth of mSRM and tSRM that use organic substrates in the reservoir to reduce the sulfate in the seawater to sulfide. Nitrate is injected as a mitigation strategy for inhibiting SRM activity in both low and high temperature oilfields. Nitrate injection

196

in low temperature fields, has been shown to affect sulfide production transiently (Voordouw et al., 2009). Only a few studies of souring control with nitrate at high temperatures have been reported. Reinsel et al. (1996) showed that injection of nitrate together with a tNRB enrichment led to complete inhibition of sulfide production in a high temperature (60°C) bioreactor. Kaster et al. (2007) showed that nitrite strongly inhibited tSRB activity in a high temperature bioreactor.

These studies demonstrated that souring caused by tSRB in bioreactors can be mitigated with nitrate injection if an active tNRB community is present, or with nitrite even in the absence of tNRB. However, these studies were not representative of waterflooded high temperature reservoirs, where both low and high temperature regions exist along the water flow path. Hence laboratory studies using bioreactors that have zones with different temperatures must be done.

Rizk et al. (1998) used a high pressure, temperature gradient bioreactor to study the effect of desulfated seawater injection on sulfide production and corrosion. The bioreactor had a temperature profile from 24°C at the bottom inlet to 74°C at the top outlet.

In this study, I determined the effect of nitrate on sulfate reduction in upflow bioreactors with a cold (30°C) inlet and hot (60°C) outlet region. In order to determine whether souring in such a system is caused predominantly by mSRB or by tSRB or both.

9.3 Materials and methods

9.3.1 Souring control with nitrate in dual temperature bioreactor models

Packing the bioreactors

To create a bioreactor with a temperature profile from 23-30°C at the bottom inlet to 60°C for the bulk and outlet, a thermo-jacketed glass bioreactor with an inlet end not covered by the thermo-jacket was used (Figure 9-1). This design mimics a water flooded high temperature

197

reservoir system, with temperatures from the inlet end increasing to ensure the growth of both mesophilic and thermophilic microbial communities. Two variations of this bioreactor design were used, one with a 1 cm and one with a 4 cm inlet region (Figure 9-1 A and B). A circulating water bath was used to provide a uniform high temperature in the bulk of the reactor, by supplying heated water maintained at 60oC (Figure 9-1C). To pack the bioreactor, the inlet port was first plugged with sterile polymeric mesh and glass wool at the inlet of the column to retain the sand grains within the column, before tightly packing with silica sand of mesh size 50-70. The outlet end was plugged with butyl stoppers and three way valves were connected to both ends of the columns.

Anaerobic CSBA medium with 2 mM sulfate and 3 mM VFA or 4 mM lactate was fed into the bioreactor with the aid of a multichannel peristaltic pump, through tubing connected to the inlet 3- way valve, while effluent from the bioreactor was collected from the outlet tubing. The bioreactors had an inner diameter of 1.1 cm and a calculated total volume of 10.5 and 13.3 ml for A and B

(Figure 9-1), respectively. Calculated pore volumes for the columes were 5.2 and 6.7 mL.

198

(A) (B)

(C)

outlet end

11 cm Sand Sand Thermo -jacket

1cm Circulating Multi-channel water bath peristaltic pump Inlet end 4cm

199

Inoculating the bioreactors

The bioreactors were inoculated with tSRB consortia enriched from PW_1_2014 from the

Terra Nova oilfield (see Chapter 4 section 4.2.4 for enrichment procedure). Washed cells of a 72- h tSRB culture grown on CSBA medium with 3 mM VFA (acetate, propionate and butyrate) and

2 mM sulfate, was harvested and used for a single inoculation of the bioreactors. Once inoculated, the 3-way valves connected to the inlet and outlet ends of the bioreactors were closed off and the bioreactors were incubated for 10 days without flow. Alternatively, the bioreactors were continuously inoculated with effluent from tSRB chemostat cultures established as described in

Chapter 4 (section 4.2.7) together with the injection of 5 mM sulfate and 10 mM lactate using a

Y-connector. This led to a 3-fold dilution in concentration to approximately 1.67 mM sulfate and

3.33 mM lactate. After 10 days at 33 mL/day, the bioreactor was then incubated without flow for

24 hr and injection of medium only containing 2.5 mM sulfate and 5 mM lactate was then resumed at a flowrate of 1 PV/day (16 ml/d).

Once constant production of 2 mM sulfide was established in the bioreactors, the control bioreactors were continued to be injected with CSBA medium containing 2.5 mM sulfate and 3 mM VFA or 5 mM lactate, whereas 2–4 mM nitrate or nitrite was added to the CSBA medium with sulfate and VFA or lactate in the treated bioreactors. The effluent of these bioreactors was monitored for sulfate, sulfide, nitrate, and nitrite, using chemical (sulfide) and HPLC methods as described before.

200

9.3.2 Evaluating the potential contribution of mSRB and tSRB to souring in dual temperature reservoir bioreactors

To determine the relative contribution of mSRB and tSRB to souring in the bioreactor system described above, influent and effluent samples were collected and used as inocula in batch cultures. Aliquots of 20 mL anaerobic CSBA medium were dispensed in 60 ml serum bottles with an N2-CO2 headspace. The bottles were sealed with butyl rubber stoppers and crimped with aluminum rings. The CSBA medium was supplemented with either 6 mM VFA and 10 mM sulfate or 3 mM VFA and 10 mM nitrate and inoculated with either 0.5 ml of sample collected from the outlet end or the inlet end of the bioreactors. Incubation was done at 30 or 60oC to monitor for the presence of mSRB, mNRB, tNRB and tSRB. DNA was extracted from the incubations and

Illumina sequencing was done as described in Section 4.3.8.

9.3.3 Souring by tSRB in high temperature low pressure bioreactor

Fifty milliliter glass syringes were packed as described above and placed in a 60°C constant temperature oven to have a high temperature throughout. The packing material used was either

Berea sandstone (mesh size 60-100) or a mixture of silica sand (94, 97 or 100%) and clay

(kaolinite: 6, 3 or 0%). After inoculation with tSRB cell pellets re-suspended in CSBA medium with 10 mM lactate and 5 mM sulfate, the bioreactors with Berea sandstone were incubated at

60°C in an incubator for either 7, 14 or 21 days before flow was resumed.

Triplicate bioreactors packed with silica sand only or with mixtures of silica sand and clay, were inoculated with tSRB culture from the chemostat and incubated for 7 days. After incubation, flow was resumed through the columns using hot CSBA medium (60°C) containing 10 mM lactate

201

and 5 mM sulfate at a flowrate of 0.25 PV/d (6.25 mL/d). Effluent concentrations of sulfate and sulfide were monitored as described in Section 4.3.1.

9.4 Results

9.4.1 Souring control with nitrate in a dual temperature bioreactors

Souring was established in bioreactors with different inlet end lengths (R1=1 cm; R4 = 4 cm), simulating a waterflooded high temperature oil reservoir with temperature gradients from 30 to 60°C, inoculated once with tSRB consortia grown on VFA and sulfate. In bioreactor R1 (Figure

9-2), sulfate (2 mM) was completely reduced and 1.75 mM of sulfide was produced after 20 days of resuming media flow in the bioreactor. Injection of CSBA with 2 mM nitrate and 2 mM sulfate, led to a partial inhibition of sulfate reduction. The sulfide concentrations decreased from 1.38 mM on day 23 to 0.75 mM on day 34, while the sulfate concentration increased from 0 mM on day 23 to 1.2 mM on day 30. Injection of CSBA with only 2 mM sulfate and no nitrate resumed on day

34 and sulfate was again completely reduced by day 41, while the sulfide concentration increased to 1.4 – 1.5 mM. The bioreactor was then treated with 4 mM nitrate on day 43, which caused the sulfide concentration to drop to 0.40 mM, while the sulfate concentration increased to 1 mM. No nitrate or nitrite breakthrough was observed in the bioreactor effluent indicating complete reduction of nitrate to nitrogen. Sulfide recovery was found to be immediate once nitrate injection was stopped. In bioreactor R4 (Figure 9-3) complete souring was observed with 2 mM sulfide formed from 2 mM sulfate. The injection of 2 mM nitrate to did not inhibit sulfate reduction and no nitrate or nitrite were measured in the effluent. However, injection of 4 mM nitrate induced partial souring control. Complete souring resumed once nitrate injection was stopped (Figure 9-

3).

202

To evaluate the contribution of mNRB and tNRB to souring control in the bioreactor experiment above, inlet and outlet samples from bioreactors R1 and R4 were inoculated into 20 ml CSBA medium containing 3 mM VFA and 10 mM nitrate and incubated at 30 or 60°C. The results shown in Figure 9-4, indicate that no tNRB activity was present in either the inlet or the outlet ends of bioreactor R1 (Figure 9-4B and 9-4D). Incubations at 30oC showed mNRB activity in both the inlet and outlet ends (Figure 9-4A and 9-4C). Similarly, in bioreactor R4, no tNRB activity was detected at 60°C in either the inlet or the outlet ends (Figure 9-5B and 9-5D), but both had mNRB at 30°C (Figure 9-5A and C). This suggests that only mNRB was stimulated during nitrate injection and the inhibition of sulfide production observed in the R1 and R4 bioreactors was due to mNRB activity only.

To determine the contributions of mSRB and tSRB to souring in bioreactors R1 and R4, inlet and outlet samples from both reactors were inoculated into a sulfate and lactate containing

CSBA medium. Bioreactor R1 inlet and outlet samples incubated at 30°C had mSRB activity

(Figure 9-6A and 9-6C), while no tSRB activity was seen at 60°C (Figure 9-6B and 9-6D). Similar results were observed for R4 influent and effluent samples (Fig 9-4A-D). Hence, overall the results with these dual temperature bioreactors indicated that both NRB and SRB activities were due to mesophilic bacteria only. Making the mesophilic region larger (4 cm) allows complete reduction of 2 mM nitrate, followed by complete reduction of 2 mM sulfate (Figure 9-3). Making the mesophilic region smaller (1 cm) allowed, complete reduction of 2 mM nitrate, and this is followed by incomplete reduction of 2 mM sulfate (Figure 9-2).

203

CSBA-SN CSBA-SN R1 (2mM) CSBA-S (4mM) CSBA-S 2.5

1.5

0.5 Concentration (mM) Concentration 0 0 10 20 30 40 50 60 Time (days) SULFATE SULFIDE

204

12 12 o (A) R1 inlet end 30oC (B)R1 inlet end 60 C 10 10 8 8 6 6 Nitrite 4 4 Nitrate 2 2 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 12 12 o (C) R1 outlet end 30oC (D) R1 outlet end 60 C

10 10 Concentration Concentration (mM) 8 8 6 6 4 4 2 2 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 Time (d)

205

12 (A) R4 inlet 30°C 12 (B) R4 inlet 60°C 10 10 8 8 6 6 Nitrite 4 4 Nitrate 2 2 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 12 12 (C) R4 outlet 30°C (D) R4 outlet 60°C 10 10 8 8 6 6 4 4 2 2 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12

206

12 (A) R1 inlet 30°C 10 (B) R1 inlet 60°C 10 8 8 6 6 Sulfide 4 4 Sulfate 2 2 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 14

12 10 (C) R1 outlet 30°C (D) R1 outlet 60°C 10 8 8 6 6 4 4 2 2

0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 14

207

12 (B) R4 influent 60°C (A) R4 influent 30°C 10 10 8 8 6 6 Sulfide 4 4 Sulfate 2 2

0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 14

12 10 (D) R4 effluent 60°C (C) R4 effluent 30°C 10

Concentration Concentration (mM) 8 8 6 6 4 4 2 2 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 14 Time (d)

Figure 9-7: SRB activity in samples from dual temperature bioreactor R4, collected from the inlet and outlet end at the end of the treatments. Samples were used to inoculate CSBA medium containing 5 mM VFA and 10 mM sulfate. Samples from the inlet end were incubated at 30 and 60°C (A and B); samples from the outlet end were outlet incubated at 30 and 60°C (C and D)

208

9.4.2 Souring in bioreactors continuously inoculated with a tSRB continuous culture from a chemostat

Since sulfate- and nitrate- reduction in bioreactors R1 and R4 were mainly due to the activity of mSRB and not the tSRB initially inoculated, a new bioreactor, with a shorter inlet region

(0.2 cm) and a different inoculation strategy was used in this second study. These bioreactors were continuously inoculated with a tSRB continuous culture growing at 60°C, and injected together with fresh CSBA medium for 10 days to stimulate formation of a tSRB biofilm layer in the bioreactor solid matrix.

In the control bioreactor shown in Figure 9-8, injection of 2.5 mM sulfate and 5 mM lactate resulted in production of 2.3 mM sulfide. When the sulfate concentration in the CSBA medium was increased to 5 mM and the lactate concentration to 10 mM on day 49, an increase in the sulfide concentration to 3.9 and 4.3 mM on day 59 on day 65 was observed. From day 65 onwards, the sulfide concentration detected in the effluent decreased to 1.6 mM, with occasional spikes to 3.8,

3.9 and 4.8 mM observed at days 78, 100 and 112, respectively (Figure 9-8A).

Sulfide production in the bioreactor treated with 2.5 mM nitrate from day 20 to 46 was only partially inhibited, and neither nitrate nor nitrite were detected in the effluent, indicating that the injected nitrate was completely reduced in the bioreactor. Due to the fluctuations in sulfide concentration following the increase in sulfate from 2.5 to 5 mM, the bioreactor was treated with

2 mM nitrate. This caused the effluent sulfide concentration to decrease from 3.8 to 1.8 mM. The sulfate concentration was zero within this treatment period. Injection of 2 to 4 mM nitrite had no effect on sulfide production (Figure 9-8).

Microbial community analysis of the control bioreactor 20 days after resuming the injection of CSBA medium containing 2.5 mM sulfate and 5 mM lactate showed that

209

Desulfotomaculum (66%) was the dominant tSRB colonizing the inlet end of the column (Table

9-1). Also present were sequences belonging to Pseudomonas (4%), Bordetella (16%) and

Thermococcus (2%). However, following 123 days of injection of CSBA medium with lactate and sulfate. The fraction of Desulfotomaculum decreased in the inlet end to 6%, while fractions of

Desulfomicrobium increased to 77%. This indicates a shift from tSRB (Desulfotomaculum) to mSRB (Desulfomicrobium), although some Desulfomicrobium species have been shown to be thermophilic (Section 3.3.3).

At 123 days, the inlet end of the bioreactor treated with nitrate and nitrite was colonized by the SRB Desulfomicrobium (62%), by Pseudomonas (28%) and by Halomonas (4%). Whereas

Marinobacterium (54%), Desulfomicrobium (11%), Pseudomonas (4%), and Halomonas (4%) dominated the outlet end (Table 9-1).

210

5 mM 5 (A) 2- SO4 4

2 Sulfide Sulfate 1

0 0 20 40 60 80 100 120 140 Time (d)

6 (B) 5 mM 2 mM 2 mM 4 mM SO 2- - - - 5 2.5 mM 4 NO3 NO2 NO2 - Concentration (mM) Concentration NO3 4

0 0 20 40 60 80 100 120 140 Time (d)

211

Table 9-1: Microbial community compositions of samples taken from the inlet and outlet ends of control and treated bioreactors described in Figure (9-8).

Sequence ID V66_4240 V66_4233 V66_4234 V66_4235 V66_4236 # QC reads 42734 55270 55855 63636 57605 # OTUs 94 47 91 72 99 # Taxa 92 34 68 57 61 Shannon Index 1.26 0.78 1.95 1.09 1.81 Day 20 Day 123 Day 123 Day 123 Day 123 Control Control Control Treated Treated #Taxonomy inlet Inlet outlet inlet outlet Bacteria;Proteobacteria;Deltaproteobacteria;Desulfovibrionales;Desulfomicrobiaceae;Desulfomicrobium; 0.02 76.59 10.31 61.56 11.32 Bacteria;Proteobacteria;Gammaproteobacteria;Oceanospirillales;Oceanospirillaceae;Marinobacterium; 0.00 0.01 51.79 0.01 54.47 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae;Desulfotomaculum; 66.16 5.90 1.72 0.22 0.09 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae;Pseudomonas; 4.22 15.16 3.14 28.02 4.38 Bacteria;Spirochaetae;Spirochaetes;Spirochaetales;Spirochaetaceae;Sphaerochaeta; 0.00 0.83 6.47 2.69 8.02 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Alcaligenaceae;Bordetella; 16.09 0.11 0.53 0.18 0.31 Bacteria;Proteobacteria;Gammaproteobacteria;Oceanospirillales;Halomonadaceae;Halomonas; 0.01 0.00 4.78 4.14 3.59 Bacteria;Firmicutes;Clostridia;Clostridiales;NA__Family-XI;Tissierella; 0.00 0.00 5.02 0.00 2.32 Bacteria;Proteobacteria;Gammaproteobacteria;Thiotrichales;Piscirickettsiaceae;Thiomicrospira; 0.00 0.00 4.08 0.02 2.65 Bacteria;Firmicutes;Clostridia;Clostridiales;NA__Clostridiaceae-1;Proteiniclasticum; 0.00 0.44 0.54 1.00 3.57 Bacteria;Bacteroidetes;Sphingobacteriia;Sphingobacteriales;NA__WCHB1-69; 0.01 0.00 2.29 0.49 1.78 Bacteria;Bacteroidetes;Bacteroidia;Bacteroidales;NA__ML635J-40-aquatic-group; 0.00 0.00 2.51 0.00 1.66 Bacteria;Tenericutes;Mollicutes;Acholeplasmatales;Acholeplasmataceae;Acholeplasma; 0.00 0.65 1.65 0.35 1.37 Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae; 4.02 0.00 0.00 0.00 0.00 Bacteria;Firmicutes;Clostridia;Clostridiales;NA__P.-palm-C-A-51; 0.00 0.00 1.55 0.66 1.57 Bacteria;Actinobacteria;Actinobacteria;Corynebacteriales;Dietziaceae;Dietzia; 3.48 0.00 0.00 0.00 0.00 Archaea;Euryarchaeota;Thermococci;Thermococcales;Thermococcaceae;Thermococcus; 2.03 0.15 0.07 0.17 0.14 Bacteria;Proteobacteria;Alphaproteobacteria;Rhizobiales;Phyllobacteriaceae;Mesorhizobium; 1.44 0.01 0.04 0.01 0.04 Bacteria;Proteobacteria;Epsilonproteobacteria;Campylobacterales;Campylobacteraceae;Arcobacter; 0.01 0.00 0.60 0.16 0.47

212

Bacteria;Proteobacteria;Gammaproteobacteria; 0.01 0.00 0.83 0.00 0.31 Bacteria;Spirochaetae;Spirochaetes;Spirochaetales;Spirochaetaceae;NA__Spirochaeta-2; 0.00 0.00 0.49 0.00 0.59 Bacteria;Firmicutes;Bacilli;Bacillales;Bacillaceae;Anaerobacillus; 0.00 0.00 0.55 0.00 0.48 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Caenispirillum; 0.00 0.00 0.27 0.00 0.27 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodobacterales;Rhodobacteraceae;Nesiotobacter; 0.00 0.00 0.20 0.00 0.17

213

9.4.3 Souring in bioreactors at a constant temperature of 60°C

The ability of tSRB to actively reduce sulfate in bioreactors packed with either crushed

Berea sandstone or silica sand mixed with clay was evaluated. These were placed in a constant temperature incubator of 60°C. After tSRB inoculation and subsequent incubation at 60°C for 7 or

21 days, visible microbial activity was observed by blackening of the solid matrix as an indication that sulfide was being produced in the bioreactor packed with Berea sandstone (Figure 9-9). When

CSBA medium with lactate and sulfate was injected into the bioreactor, sulfide was detected in the effluent after 1 PV, but the initial blackening observed during the batch incubation began to fade out. This bioreactor was injected for 1 month at a flowrate of 0.25 PV/d. This experiment was repeated using the Berea sandstone that was washed with deionized water and baked overnight in an oven at 180°C, but the outcome was the same.

For thermophilic bioreactors packed with silica sand or a mixture of silica sand and clay

(94 and 6%), tSRB activity was observed during the 7-day incubation period, but just as in the bioreactor with Berea sand stone. The tSRB activity was lost as soon as fresh CSBA medium was injected into the columns. These bioreactors were re-inoculated with tSRB cultures and incubated the columns without flow of media for 3, 10 or 14 days, but tSRB activity, could not be maintained during medium injection.

The only bioreactors that showed tSRB activity after 7 – 10 days of incubation at 60°C and subsequent medium injection were the bioreactors packed with 97% silica sand and 3% clay

(Figure 9-10). Within the first 7 days of injection of CSBA medium with 5 mM sulfate and 10 mM lactate the sulfate concentration dropped from 5 mM to 0 mM and remained so until day 33. The sulfide concentration increased from 0 to 2.9 mM during this period. This was less than 5 mM

214

sulfate that was reduced. After day 31 the sulfide concentration decreased, whereas the sulfate concentration increased, indicating instability of thermophilic sulfate reduction (Figure 9-10).

215

A B

216

5 (A) Sulfate A 4 Sulfate B

3 Sulfate C

0 0 10 20 30 40 50 60 70 80 5

Concentration (mM) Concentration (B) Sulfide A 4 Sulfide B Sulfide C 3

0 0 10 20 30 40 50 60 70 80 Time (d)

217

9.5 Discussion

This study evaluated souring control with nitrate in bioreactors that had both a mesophilic zone (MZ) and a thermophilic zone (TZ), similar to seawater flooded high temperature reservoirs.

Results from these bioreactors suggested that even though the bioreactors were inoculated with a tSRB culture, the activity of mSRB and other mesophiles in the MZ increased as a function of time. The shift in microbial community composition of the inlet of the control bioreactor from 20 to 123 days described in Table 9-1 supports this observation. mSRB form more biomass and grow faster than tSRB. Hence the injected sulfate, lactate and nutrients needed for growth were mostly consumed at the inlet end of the bioreactors, preventing growth of tSRB.

Nitrate and nitrite injection into the bioreactors only partially inhibited sulfate reduction, because the mNRB at the MZ were very active and could reduced nitrate all the way to N2. It should be noted that this depended on the length of the cold region. When this was only 1 cm

(bioreactor R1) more effective inhibition of souring was observed than when this was 4 cm

(bioreactor R4). In addition to this, most mSRB have nitrite reductase Nrf which protects them against low concentrations of nitrite (Greene et al., 2003).

Souring was not successfully established in three of the completely thermophilic (60°C) bioreactors that were packed with Berea sandstone or silica sand even though microbial activity was observed when the bioreactors were shut in or incubated without flow. This may be because the tSRB growing in the bioreactors were loosely attached to the sand particles and as soon as flow was resumed, the cells were washed out from the sand surface. In this case, injection of medium at a lower flowrate than 0.25PV/day may be more successful

Addition of 3% clay to silica sand, enhanced microbial activity, indicating that SRB consortia formed biofilms that were firmly attached to the sand-clay matrix or surface. This could 218

be because of the reduction of pore spaces between the silica sand particles, which increased the overall surface area for bacterial attachment. Laanbroek and Geerligs (1983), reported that adhesion of Desulfotobacter postgatei on to calcium- or iron- saturated illite had a positive effect on growth and sulfate reduction. The presence of clay particles can either inhibit or enhance microbial growth through the binding of nutrients, pH buffering or adsorption of toxic metals.

These can also be a source of electron acceptors such as iron, and a support material for microbial growth (Chaerun and Tazaki, 2003; Courvoisier and Dukan, 2009; Kostka et al., 2002; Rong et al., 2007, Ma et al, 2017). Only about 50 to 60% of the sulfide formed by tSRB in these bioreactors was measured in the effluent. Sulfide may be lost due interactions of sulfide with iron minerals contained in the clay and sand mixture. The inhibition in sulfate reduction seen after day 36 may be due to toxicity caused by sulfide accumulating in the bioreactor. Sulfide concentrations of 16-

20 mM have been reported to be inhibitory to SRB (Reis et al., 1992; O’Flaherty et al., 1998).

Utgikar et al., (2001), showed that the sulfide produced by SRB protects them from the toxic effects of metals. However, accumulation of metal sulfides in the vicinity of a cell or on the cell surface, hinders the SRB from accessing sulfate and organic substrates which it requires for growth. Another possible reason for the inhibition in the sulfate reduction observed in completely thermophilic bioreactors could be because of increased pore water salinity. Clay minerals with high cation exchange capacity such as bentonite and montmorillonite can offer protection to bacterial cell against NaCl toxicity, while kaolinite which has low exchange capacity is not efficient in doing so (Cameron et al., 1984).

For future work with high temperature bioreactors, the medium NaCl concentrations could be decreased to between 0.1 to 0.25 M, and the sulfate concentration could be decreased to 2 mM.

These changes could also be accompanied with a decrease in flowrate of medium through the 219

reactor. These modifications could contribute to long term sustenance of tSRB activity in these bioreactors.

220

Chapter Ten: Conclusions

The focus of this thesis was to better understand nitrate-mediated control of souring under mesophilic and thermophilic conditions. The main objectives guiding the scope of this work were to: i) identify key contributor(s) to souring in seawater flooded high temperature reservoirs, ii) examine the temperature dependence of growth and activity of both SRB and NRB with the aim of determining their positioning in the NIWR and how this impacts souring control with nitrate, iii) establish the contribution of tSRB to reservoir souring and MIC and

(iv) conduct microcosm and model reactor experiments that would replicate field application of nitrate or perchlorate for souring control purposes. The methods used and results obtained are summarized below.

Injection of cold seawater into hot reservoirs generates a low to high temperature profile in the NIWR, which creates a complex microbial community structure, because the zones of microbial activities are superimposed on a gradient of increasing temperature in the near injection wellbore region (NIWR). The focus of most studies on controlling souring in such a system has been to get a snapshot of the microbial community present, and determine whether community members are active. This has enabled the isolation and detection of a variety of mesophilic, thermophilic and hyperthermophilic SRM and NRB from high temperature reservoirs. Studies determining the effect of nitrate injection on high temperature reservoir souring do not consider the temperature profile that exists in such systems. The study of souring control in high temperature bioreactors with uniform temperature, gives a one directional outcome and is not representative of in situ reservoir conditions.

The data presented in Chapter 3 describe the isolation and enrichment of thermophilic SRB and NRB from a low temperature oilfield with an in-situ temperature of 26°C by using 221

concentrated inocula. Results showed that this low temperature oilfield, harbored tSRB which may not be active at the in situ temperature but may become problematic in certain top side processing units with elevated temperatures provided other nutritional requirements for growth are provided.

The tSRB enriched include; Thermodesulfobacterium, Desulfomicrobium, Desulfotomaculum,

Thermodesulfovibrio, Desulfocurvus and Coprothermobacter and the thiosulfate reducers

Coprothermobacter and Anaerobaculum.

The temperature dependence of nitrate reduction with samples from low and high temperature fields (chapters 3, 4 and 9) indicated that nitrate reduction to nitrite by tNRB was more thermophilic (40-70°C) than the subsequent reduction of nitrite (up to 50°C). At 50°C or above nitrite was not reduced, irrespective of where the tNRB were isolated from. This implies that in the Terra Nova oil field, having a temperature profile 30 to 95oC, if nitrate is injected for souring control, it is reduced to N2 in the mesophilic zone. However, since nitrite reduction is limited by temperature, oilfield operators can re-inject hot produced water to create an NIWR with temperatures starting from 50 oC. This would allow reduction of nitrate to nitrite only and would strongly inhibit tSRB.

Nitrate injection for controlling low temperature reservoir souring is often limited by its depth of penetration in the reservoir. Data in Chapter 5 compared the effectiveness of perchlorate to nitrate as an alternative control method for reservoir souring. Inhibition of SRB activity in heavy oil containing medium using perchlorate showed that reduction of perchlorate was substrate dependent. Perchlorate was not reduced with heavy oil or any alkylbenzenes in any of the batch culture incubations or in bioreactors. However, it was rapidly reduced by reservoir microorganisms of the genus Magnetospirillum with volatile fatty acids. Because sulfide-oxidizing PRB were absent, this implies that injection of perchlorate for control of sulfide production in reservoirs with 222

limited VFA, would not work. Instead, the injection of chlorite a possible product of perchlorate reduction completely inhibited sulfate reduction at 2 mM concentrations in oil bioreactors. Overall, chlorite was a better alternative than perchlorate in controlling low temperature reservoir souring and nitrate remains a better option than perchlorate for the MHGC field.

In chapter 6, the microbial community compositions of ten oil field produced water samples from high temperature oil reservoirs in the North Sea and that of enrichment cultures of these samples were compared. The community compositions observed seem to be shaped by the long-term seawater injection and changing water chemistry tilting more towards mesophiles with high salt tolerance. The produced water samples had high salinities from 0.9-1.6 Meq of NaCl.

Sulfate was detected in only five of the samples, while acetate, propionate and ammonium were present in all of the samples. No sulfate-, nitrate- or perchlorate-reducing activities were observed in medium with 1 M NaCl at 60 oC. Incubations with 0.5 M NaCl gave NRB activity at 30 oC, but not at 60 oC. tSRB activity was detected for two samples. 16S rRNA amplicon sequencing of water samples and enrichment cultures detected sequences of tSRM Desulfotomaculum and

Archaeoglobus and of the thermophilic methanogen Methanothermococcus, as well as of halophilic Halomonas and Marinobacter. The absence of thermophilic taxa, the lack of growth of thermophiles and the high water cut suggests that some wells may have cooled due to prolonged seawater injection.

In chapter 7, corrosion of carbon steel by three tSRB consortia enriched from different oilfields in the presence or absence of organic substrates was investigated. This work highlighted that tSRB can cause corrosion in the presence and absence of organic substrates. The rates at which they induce corrosion in the absence of organic substrates, can be higher than the presence of

223

organic substrates suggesting EMIC-like corrosion mechanisms. Pili-like structures observed on the cell surface under these conditions may help in direct electron transfer.

In chapter 8, the use of nitroprusside as a novel biocide for tSRB inhibition and sulfide elimination was evaluated. The activity of tSRB was completely inhibited at SNP concentrations of 0.05 mM in tSRB batch cultures. This indicates that SNP maintains its biocidal property and can thus be used in high temperature oilfields for souring control purposes.

In chapter 9, dual temperature and uniform high (60°C) temperature bioreactors were used to mimic the effect of nitrate injection in seawater flooded reservoirs. The results confirmed that nitrate-mediated control of souring is more difficult with an increasing size of the cold zone.

Overall, the research in this thesis has contributed to an improved understanding of nitrate- mediated control of souring with nitrate. Future work may focus on more extensive studies of dual temperature bioreactors, as models for high temperature water flooded oil fields.

224

References

Achenbach, L. A., Bruce, R. A., Michaelidou, U. and Coates, J. D. (2001). Dechloromonas agitata gen. nov., sp. nov. and Dechlorosoma suillum gen. nov., sp. nov., two novel environmentally dominant (per)chlorate-reducing bacteria and their phylogenetic position. Int. J. Syst. Evol. Microbiol. 51, 527–533. Agrawal, A., An, D., Cavallaro, A., and Voordouw, G. (2014) Souring in low-temperature surface facilities of two high-temperature Argentinian oil fields. Appl. Microbiol. Biotechnol. 98:8017–29. Agrawal, A., Vanbroekhoven, K., and Lal, B. (2010). Diversity of culturable sulfidogenic bacteria in two oil–water separation tanks in the north-eastern oil fields of India. Anaerobe 16: 12–18. Alberta Energy Regulator (AER). (2013) Rep. 2013-B Pipeline Perform. Alberta, 1990-2012. Al-zuhair, S., El-naas, M.H., and Al-Hassani, H. (2008) Sulfate inhibition effect on sulfate reducing bacteria. J. Biochem. Technol. 1:39–44. An, D., Caffrey, S. M., Soh, J., Agrawal, A., Brown, D., Budwill, K., Dong X, Dunfield P.F., Foght J., Gieg L.M., and Hallam, S.J. (2013). Metagenomics of hydrocarbon resource environments indicates aerobic taxa and genes to be unexpectedly common. Environ. Sci. Technol. 47:10708–17. Anupama, V. N. Prajeesh, P. V. G., Anju, S., Priya, P. and Krishnakumar, B. (2015) Diversity of bacteria, archaea and protozoa in a perchlorate treating bioreactor. Microbiological Research, 177: 8-14. Arahal, D. R., Lekunberri, I., Gonzá lez, J. M., Pascual, J., Pujalte, M. J., Pedró s-Alió, C., and Pinhassi, J. (2007) Neptuniibacter caesariensis gen. nov., sp. nov., a novel marine genome- sequenced gammaproteobacterium. Int. J. Syst. Evol. Microbiol. 57: 1000–1006. Aüllo, T., Ranchou-Peyruse, A., Ollivier, B., and Magot, M. (2013) Desulfotomaculum spp. and related gram-positive sulfate-reducing bacteria in deep subsurface environments. Front. Microbiol. 4:362. Bardiya, N., and Bae, J. H. (2011) Dissimilatory perchlorate reduction: A review. Microbiol. Res. 166: 237–254. Barraud N, Hassett D.J, Hwang S-H, Rice, S.A, Kjelleberg S, Webb J.S. (2006) Involvement of nitric oxide in biofilm dispersal of Pseudomonas aeruginosa. Journal of Bacteriology, 188: 7344-7353. Barraud, N., Storey, M.V., Moore, Z.P., Webb, J.S., Rice, S.A., and Kjelleberg, S. (2009) Nitric oxide-mediated dispersal in single- and multi-species biofilms of clinically and industrially relevant microorganisms. Microb. Biotechnol. 2:370–8. Basso, O., Lascourrèges, J., Jarry, M., and Magot, M. (2005) The effect of cleaning and disinfecting the sampling well on the microbial communities of deep subsurface water samples. Environ Microbiol 7:13-21. Beech, I.B. and Sunner, J. (2004) Biocorrosion: Towards understanding interactions between 225

biofilms and metals. Curr. Opin. Biotechnol. 15: 181–186. Beeder, J., Torsvik, T., and Lien, T. (1995) Thermodesulforhabdus norvegicus gen. nov., sp. nov., a novel thermophilic sulfate-reducing bacterium from oil field water. Arch. Microbiol. 164:331–336. Bender, K.S., Shang, C., Chakraborty, R., Belchik, S.M., Coates, J.D. and Achenbach, L.A. (2005). Identification, characterization, and classification of genes encoding perchlorate reductase J Bacteriol, 187:5090-5096. Bernardez, L.A., de Andrade Lima, L.R.P., de Jesus, E.B., Ramos, C.L.S. and Almeida, P.F., (2013). A kinetic study on bacterial sulfate reduction. Bioprocess Biosyst. Eng. 36: 1861–9. Birkeland, N.K. (2005) “Sulfate-Reducing Bacteria and Archaea,” in Petroleum Microbiology (American Society of Microbiology), pp. 35–54. Blumer-Schuette SE, Kataeva I, Westpheling J, Adams MW, Kelly RM. (2008). Extremely thermophilic microorganisms for biomass conversion: status and prospects. Energy Biotechnol Environ Biotechnol, 19: 210–217. Bødtker, G., Lysnes, K., Torsvik, T., Bjørnestad, E., and Sunde, E. (2009). Microbial analysis of backflowed injection water from a nitrate-treated North Sea oil reservoir. J. Ind. Microbiol. Biotechnol. 36:439–450. Bødtker, G.T. Thorstenson, B.L.P. Lillebø, B.E. Thorbjørnsen, R.H. Ulvøen, E. Sunde, and Torsvik, T. (2008). The effect of long-term nitrate treatment on SRB activity, corrosion rate and bacterial community composition in offshore water injection systems. J. Ind. Microbiol. Biotechnol. 35: 1625–1636. Bonch-Osmolovskaya, E.A., Miroshnichenko, M.L., Lebedinsky, A. V., Chernyh, N.A., Nazina, T.N., Ivoilov, V.S., Belyaev, S.S., Boulygina, E.S., Lysov, Y.P., Perov, A.N., Mirzabekov, A.D., Hippe, H., Stackebrandt, E., L’Haridon, S., Jeanthon, C., (2003) Radioisotopic, Culture-Based, and Oligonucleotide Microchip Analyses of Thermophilic Microbial Communities in a Continental High-Temperature Petroleum Reservoir. Appl. Environ. Microbiol. 69: 6143–6151. Bowles, M.W., Nigro, L.M. Teske, A.P. and Joye, S.B. (2012) Denitrification and environmental factors influencing nitrate removal in Guaymas basin hydrothermally altered sediment. Frontiers Microbiology, 3. Callbeck, C. C., Agrawal, A., and Voordouw, G. (2013). Acetate production from oil under sulfate-reducing conditions in bioreactors injected with sulfate and nitrate. Appl. Environ. Microbiol. 79: 5059–5068. Callbeck, C. M., Dong, X., Chatterjee, I., Agrawal, A., Caffrey, S. M., Sensen, C. W., and Voordouw G. (2011) Microbial community succession in a bioreactor modeling a souring low-temperature oil reservoir subjected to nitrate injection. Appl. Microbiol. Biotechnol. 91: 799–810. Cameron, F.J., Jones, M.V., and Edwards, C. (1984) Effects of salinity on bacterial iron oxidation. Current Microbiology. 10:353-356.

226

Canganella, F. and Wiegel, J. (2014) Anaerobic thermophiles. Life, 4:77–104. Carlson, H.K., Kuehl, J. V, Hazra, A.B., Justice, N.B., Stoeva, M.K., Sczesnak, A., Mullan, M.R., Iavarone, A.T., Engelbrektson, A., Price, M.N., Deutschbauer, A.M., Arkin, A.P., and Coates, J.D. (2015) Mechanisms of direct inhibition of the respiratory sulfate- reduction pathway by (per)chlorate and nitrate. ISME J. 9: 1295–1305. Carlstrom, C. I., Lucas, L. N., Rohde, R. A., Haratian, A., Engelbrektson, A.L., and Coates, J. D. (2016) Characterization of an anaerobic marine microbial community exposed to combined fluxes of perchlorate and salinity. App. Microbiol. Biotechnol. 100: 9719-9732. Carlström, C.I. Wang, O., Melnyk, R. A., Bauer, S., Lee, J., Engelbrekston, A. & Coates, J.D., (2013) Physiological and genetic description of dissimilatory perchlorate reduction by the novel marine bacterium Arcobacter sp. strain CAB. mBio, 4(3):e00217–13. Chaerun, S.K., and Tazaki, K. (2003) Effect of Kaolinite on microbial growth in high concentration of heavy oil. Clay Science, 12:187-196. Chaerun, S.K., and Tazaki, K. (2005) How kaolinite plays an essential role in remediating oil polluted seawater. Clay Minerals 40:481–491. Chaerun, S.K., Tazaki, K., Asada, R., and Kogure, K. (2005) Interaction between clay minerals and hydrocarbon-utilizing indigenous microorganisms in high concentrations of heavy oil: implications for bioremediation. Clay Minerals 40:105–114. Chaudhuri, S.K., O’Connor, S.M., Gustavson, R.L., Achenbach, L.A., and Coates, J.D. (2002) Environmental factors that control microbial perchlorate reduction. Appl. Environ. Microbiol. 68: 4425–30. Chayabutra, C. and Ju, L. K. (2000) Degradation of n-hexadecane and its metabolites by Pseudomonas aeruginosa under microaerobic and anaerobic denitrifying conditions. Appl Environ Microbiol, 66:493-498. Chen, C., Shen, Y., An, D., and Voordouw, G. (2017) Use of Acetate, Propionate, and Butyrate for Reduction of Nitrate and Sulfate and Methanogenesis in Microcosms and Bioreactors Simulating an Oil Reservoir. Appl. Environ. Microbiol. 83(7): e02983-16. Cheng, Y., Hubbard, C.G., Li, L., Bouskill, N., Molins, S., Zheng, L., Sonnenthal, E., Conrad, M.E., Engelbrekston, A., Coates, J.D. and Ajo-Franklin, J.B. (2016) Reactive transport model of sulfur cycling as impacted by perchlorate and nitrate treatments. Environmental Science and Technology, 50:7010-7018. Chua, S.L., Liu, Y., Kuok, J., Yam, H., Chen, Y., Vejborg, R.M., Tan, B.G., Kjelleberg, S., Tolker-Nielsen, T., Givskov, M., and Yang, L. (2014) Dispersed cells represent a distinct stage in the transition from bacterial biofilm to planktonic lifestyles. Nat. Commun. 5:5462. Clark, I.C., Melnyk, R.A., Engelbrektson, A., Coates, J.D., 2013. Structure and evolution of chlorate reduction composite transposons. mBio 4(4): e00379-13. Cline J.D., and Richards F.A. (1969) Oxygenation of hydrogen sulfide in seawater at constant salinity, temperature and pH. Environ. Sci. Technol. 3:838–843.

227

Coates, J. D., Michaelidou, U., Bruce, R. A., O’connor, S. M., Crespi, J. N. and Achenbach, L. A. (1999). Ubiquity and diversity of dissimilatory (per)chlorate-reducing bacteria. Appl. Environ. Microbiol. 65:5234–5241. Coates, J.D., and Achenbach, L.A. (2004) Microbial perchlorate reduction: rocket-fueled metabolism. Nat. Rev. Microbiol. 2:569–80. Coates, J.D. (2014). Microbial metabolism of chlorine oxyanions as a control of biogenic hydrogen sulfide production. US Patent PCT/US2012/040273, April 9, 2014. Cochrane, W.J., Jones, P.S., Sanders, P.F., Holt, D.M., and Mosley, M.J. (1988) Studies on the Thermophilic Sulfate-Reducing Bacteria from a Souring North Sea Oil Field, in: SPE European Petroleum Conference. Society of Petroleum Engineers, Houston, pp. 301–316. Cornish Shartau, S.L., Yurkiw, M., Lin, S., Grigoryan, A. a., Lambo, A., Park, H.-S., Lomans, B.P., van der Biezen, E., Jetten, M.S., and Voordouw, G. (2010) Ammonium Concentrations in Produced Waters from a Mesothermic Oil Field Subjected to Nitrate Injection Decrease through Formation of Denitrifying Biomass and Anammox Activity. Appl. Environ. Microbiol. 76:4977–4987. Dahle, H., Garshol, F., Madsen, M., and Birkeland, N.K. (2008) Microbial community structure analysis of produced water from a high-temperature North Sea oil-field. Antonie Van Leeuwenhoek 93, 37–49. de Rezende, J.R., Hubert, C.R., Roy, H., Kjeldsen, K., and Jorgensen, B. B. (2016) Estimating the Abundance of Endospores of Sulfate-Reducing Bacteria in Environmental Samples by Inducing Germination and Exponential Growth. Geomicrobiology Journal, 34(4), 338-345, Dinh, H.T., Kuever, J., Mußmann, M., Hassel, A.W., Stratmann, M., and Widdel, F. (2004) Iron corrosion by novel anaerobic microorganisms. Nature 427: 829–832. Dong, X., Droge, J., von Toerne, C., Marozava, S., McHardy, A.C., and Meckenstock, R.U. (2017a). Reconstructing metabolic pathways of a member of the genus Pelotomaculum suggesting its potential to oxidize benzene to carbon dioxide with direct reduction of sulfate. FEMS Microbiol. Ecol. 93(3). Dong, X., Kleiner, M., Sharp, C.E., Thorson, E., Li, C., Liu, D., and Strous, M. (2017b) Fast and simple analysis of MiSeq amplicon sequencing data with MetaAmp. bioRxiv, 131631. Dos Santos, E.S., de Souza, L.C.V., de Assis, P.N., Almeida, P.F., Ramos-de-Souza, E. (2014) Novel potential inhibitors for adenylylsulfate reductase to control souring of water in oil industries. J. Biomol. Struct. Dyn. 32:1780–1792. Duncan, K. E., Gieg, L.M., Parisi, V. A., Tanner, R. S., Tringe, S. G., Bristow, J., and Suflita JM. (2009) Biocorrosive thermophilic microbial communities in Alaskan North Slope oil facilities. Environ Sci Technol 43:7977–7984. Eden, B., Laycock, P. J., and Fielder, M. (1993).Oilfield Reservoir Souring. Health and Safety Executive - Offshore Technology Report OTH 92 385.

228

Ehrenberg, S. N. and Jakobsen, K. G. (2001). Plagioclase dissolution related to biodegradation of oil in Brent Group sandstones (Middle Jurassic) of Gullfaks Field, Northern North Sea. Sedimentol. 48, 703−721. Engelbrektson, A., Hubbard, C.G., Tom, L.M., Boussina, A., Jin, Y.T., Wong, H., Piceno, Y.M., Carlson, H.K., Conrad, M.E., Anderson, G., and Coates, J.D. (2014) Inhibition of microbial sulfate reduction in a flow-through column system by (per)chlorate treatment. Front. Microbiol. 5:315. Enning, D. and Garrelfs, J. (2014) Corrosion of iron by sulfate-reducing bacteria: New views of an old problem. Appl. Environ. Microbiol. 80: 1226–1236. Enzien, M., and Yin, B. (2011) New Biocide Formulations for Oil and Gas Injection Waters with Improved Environmental Footprint. In Offshore Technology Conference, 2-5 May 2011. Houston, Texas, USA, pp. 1–7. Etchebehere, C. and Muxí, L. (2000) Thiosulfate reduction and alanine production in glucose fermentation by members of the genus Coprothermobacter. Antonie Van Leeuwenhoek, 77:3217. Fardeau, M., Salinas, M., L’Haridon, S., Jeanthon, C., Verhe, F., Cayol, J., Patel, B. K., Garcia, J. and Ollivier, B. (2004) Isolation from oil reservoirs of novel thermophilic anaerobes phylogenetically related to Thermoanaerobacter subterraneus: reassignment of T. subterraneus, Thermoanaerobacter yonseiensis, Thermoanaerobacter tengcongensis and Carboxydibrachium pacificum to Caldanaerobacter subterraneus gen. nov., sp. nov., comb. nov. as four novel subspecies. Intl. J. Syst. and Evol. Microbiol. 54:467-474. Farhadinia, M.A., Bryant, S.L., Sepehrnoori, K., and Delshad, M., (2008) Development and Implementation of a Multi-Dimensional Reservoir Souring Module in a Chemical Flooding Simulator. UTCHEMpp. 1–14. Felsenstein J., (1985) Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39:783-791. Feng, L., Wang, W., Cheng, J. S., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X. Q., Han, W. Q., Peng, X., Liu, R. L. and Wang, L. (2007) Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. PNAS 104:5602-5607. Fida, T.T., Chen, C., Okpala, G., and Voordouw, G. (2016) Implications of Limited Thermophilicity of Nitrite Reduction for Control of Sulfide Production in Oil Reservoirs. Appl. Environ. Microbiol. 82: 4190–9. Filipovic, MR, Eberhardt, M, Prokopovic, V, Mijuskovic, A, Orescanin-Dusic, Z, Reeh P., and Ivanovic-Burmazovic I., (2013) Beyond H2S and NO Interplay: Hydrogen Sulfide and Nitroprusside React Directly to Give Nitroxyl (HNO). A New Pharmacological Source of HNO. Journal of Medicinal Chemistry, 56:1499-1508. Fitz, R.M., and Cypionka, H. (1990) Formation of thiosulfate and trithionate during sulfite reduction by washed cells of Desulfovibrio desulfuricans. Arch. Microbiol., 154: 400-406.

229

Fraise, A.P. (2002) Biocide abuse and antimicrobial resistance- a cause for concern? J Antimicrob Chemother, 49: 11-12. Garland J.L. and Mills A.L. (1991): Classification and characterization of heterothrophic microbial communities on the basis of patterns of community-level sole-carbon-source utilization. Appl. Environ. Microbiol., 57: 2351–2359 Gagliano, M.C., Braguglia, C.M., Petruccioli, M. and Rossetti, S. (2015) Ecology and biotechnological potential of the thermophilic fermentative Coprothermobacter spp. FEMS Microbiology Ecology, 91(5):1-12. Gao, P.K., Li, G, Q., Tian, H. M., Wang, Y. S., Sun, H.W., and Ma, T. (2015) Differences in microbial community composition between injection and produced water samles of water flooding petroleum reservoirs. Biogeosciences, 12:3403-3414. Gardner, L.R., and Stewart, P.S. (2002) Action of glutaraldehyde and nitrite against sulfate- reducing bacterial biofilms. J. Ind. Microbiol. Biotechnol. 29: 354–60. Gieg, L.M., Davidova, I.A., Duncan, K.E., and Suflita, J.M. (2010) Methanogenesis, sulfate reduction and crude oil biodegradation in hot Alaskan oilfields. Environ. Microbiol. 12: 3074–3086. Gieg, L.M., Jack, T.R., and Foght, J.M. (2011) Biological souring and mitigation in oil reservoirs. Appl. Microbiol. Biotechnol. 92: 263–282. Gilbert, P.D. Grech, J.M., Talbot, R.E., Veale, M.A., and Hernandez, K.A. (2002). Tetrakishydromethylphosphonium sulfate (THPS), for dissolving iron sulfides downhole and topside - A study of the chemistry influencing dissolution. In NACE Corrosion Conference. pp. 1–14. Gittel, A., Kofoed, M. V. W., Sørensen, K. B., Ingvorsen, K., and Schramm, A. (2012) Succession of Deferribacteres and Epsilonproteobacteria through a nitrate-treated high- temperature oil production facility. Syst. Appl. Microbiol. 35:165–74. Gittel, A., Sørensen, K. B., Skovhus, T. L., Ingvorsen, K., and Schramm, A. (2009). Prokaryotic community structure and sulfate reducer activity in water from high-temperature oil reservoirs with and without nitrate treatment. Appl. Environ. Microbiol. 75:7086–96. Gorby, Y.A., Yanina, S., McLean, J. S.,Rosso, K.M., Moyles, D., Dohnalkova, A., Beveridge, T.J., Chang, I.S., Kim, B.H., Kim, K.S., Culley, D.E., Reed, S.D., Romine, M.F., Saffarini, D.A., Hill, E.A., Shi, L., Elias, D.A., Kennedy, D.W., Pinchuk, G., Watanabe, K., Ishil, S., Logan, B., Nealson, K.H. and Fredrickson, J.K. (2006). Proc. Natl. Acad. Csi. USA 103: 11358-11363. Gorlas, A., Marguet, E., Gill, S., Geslin, C., Guigner, J.-M., Guyot, F., Forterre, P. (2015) Sulfur vesicles from Thermococcales: A possible role in sulfur detoxifying mechanisms. Biochimie 118:356–64. Grassia, G.S., McLean, K.M., Glénat, P., Bauld, J., Sheehy, A.J., 1996. A systematic survey for thermophilic fermentative bacteria and archaea in high temperature petroleum reservoirs. FEMS Microbiol. Ecol. 21:47–58.

230

Greene, A.C., Patel, B.K.C., and Sheehy, A.J. (1997). Deferribacter thermophilus gen. nov., sp. nov., a Novel Thermophilic Manganese- and Iron-Reducing Bacterium Isolated from a Petroleum Reservoir. Int. J. Syst. Bacteriol. 47:505–509. Greene, A., Patel, B., and Yacob, S. (2009). Geoalkalibacter subterraneus sp. nov., an anaerobic Fe(III) and Mn(IV) reducing bacterium from a petroleum reservoir, and emended descriptions of the family Desulfuromonadaceae and the genus Geoalkalibacter. International Journal of Systematic and Evolutionary Microbiology. 59:781–785. Greene, A.C., Patel, B.K.C., Sheehy, A.J., (1997) Manganese- and Iron-Reducing Bacterium Isolated from a Petroleum Reservoir. Strain 47:505–509. Greene, E. A., Brunelle, V., Jenneman, G. E., and Voordouw, G. (2006). Synergistic inhibition of microbial sulfide production by combinations of the metabolic inhibitor nitrite and biocides. Appl. Environ. Microbiol. 72:7897–901. Greene, E. A., Hubert, C., Nemati, M., Jenneman, G. E., and Voordouw, G. (2003). Nitrite reductase activity of sulphate-reducing bacteria prevents their inhibition by nitrate- reducing, sulphide- oxidizing bacteria. Environ. Microbiol. 5:607–617. Greene, E.A. Brunella, V., Jenneman, G.E., and Voordouw, G. (2006). Synergistic inhibition of microbial sulfide production by combinations of the metabolic inhibitor nitrite and biocides. Applied and Environmental Microbiology, 72(12):7897–901. Gregoire, P., Engelbrektson, A., Hubbard, C.G., Metlagel, Z., Csencsits, R., Aue,r M., Conrad, M.E., Thieme, J., Northrup, P., Coates, J.D. (2014). Control of sulfidogenesis through bio- oxidation of H2S coupled to (per)chlorate reduction. Environ. Microbiol. Rep. 6(6):558– 564. Grigoryan, A., Cornish, S.L, Buziak, B., Lin, S., Cavllaro, A., Arensdorf, J.J., and Voordouw, G. (2008) Competitive oxidation of volatile fatty acids by sulfate- and nitrate-reducing bacteria from an oil field in Argentina. Applied and Environmental Microbiology, 74(14):4324–35. Groysman, A. (2014) Corrosion in systems for transportation and storage of petroleum products and biofuels. Springer, Dordrecht. Groysman, A. (2017). Corrosion Problems and Solutions in Oil Refining and Petrochemical Industry, Topics in Safety, Risk, Reliability and Quality 32, DOI 10.1007/978-3-319- 45256-2. Guo, X., Wang, C., Sun, F., Zhu, W., and Wu, W. (2014). A comparison of microbial characteristics between the thermophilic and mesophilic anaerobic digesters exposed to elevated food waste loadings. Bioresource Technol., 152:420–428. Gutierrez, T., Singleton, D.R., Berry, D., Yang, T., Aitken, M.D., and Teske, A. (2013) Hydrocarbon-degrading bacteria enriched by the Deepwater Horizon oil spill identified by cultivation and DNA-SIP. ISME J. 7:2091–2104.

231

Haghshenas, M., Sepehrnoori, K., Bryant, S.L., Farhadinia, M.A. (2012) Modeling and Simulation of Nitrate Injection for Reservoir Souring Remediation. SPE Journal, 17(03):817-27 Hamilton, T.L., Bovee, R. J., Sattin, S. R., Mohr, W., Gilhooly, W. P., Lyons, T. W., Pearson, A., Macalady, J.L. (2016). Carbon and Sulfur Cycling below the Chemocline in a Meromictic Lake and the Identification of a Novel Taxonomic Lineage in the FCB Superphylum, Candidatus Aegiribacteria. Front. Microbiol. 7:598. Hanajima, D., Aoyagi, T. and Hori, T. (2015). Survival of free-living Acholeplasma in aerated pig manure slurry revealed by 13C-labeled bacterial biomass probing. Front. Microbiol. 6:1206. Handley, K.M., and Llioyd, J.R. (2013) Biogeochemical implications of the ubiquitous colonization of marine habitats and redox gradients by Marinobacter species. Front. Microbiol. 4:136. Haridon, S., Miroshnichenko, M. L., Hippe, H., Fardeau, M.-L., Bonch-osmolovskaya, E. A., Stackebrandt, E., and Jeanthon, C. (2001) Thermosipho geolei sp . nov ., a thermophilic bacterium isolated from a continental. Int. J. Syst. Evol. Microbiol. 51:1327–1334. Haugen, E., Hydro, N., Costello, J., Wilcox, L., Albrechtsons, E., and Kelly, I. (2007). SPE 109587 Reservoir Management Challenges of the Terra Nova Offshore Field : Lessons Learned After Five Years of Production. SPE SPE 109587. Haveman, S. A., Greene, E. A., Stilwell, C. P., Voordouw, J. K., and Voordouw, G. (2004)+ Physiological and gene expression analysis of inhibition of Desulfovibrio vulgaris hildenborough by nitrite. J. Bacteriol. 186:7944–50. Head, I.M., Jones, D.M., and Larter, S.R. (2003) Biological activity in the deep subsurface and the origin of heavy oil. Nature, 426(6964):344–52. Ho, D. P., Jensen, P. D., and Batstone, D.J. (2014) Effects of temperature and hydraulic retention time on acetotrophic pathways and performance in high-rate sludge digestion. Environ Sci Technol., 48:6468–6476. Howell, G.B., Duggal, A.S., and Lever, G.V. (2001) The Terra Nova FPSO Turret Mooring System. in Offshore Technology Conference, 30 April-3 May, Houston, Texas. doi:10.4043/13020-MS. Hubert, C., Nemati, M., Jenneman, G., and Voordouw, G. (2003) Containment of biogenic sulfide production in continuous up-flow packed-bed bioreactors with nitrate or nitrite. Biotechnol. Prog. 19:338–45. Hubert, C., and Voordouw, G. (2007) Oil field souring control by nitrate-reducing Sulfurospirillum spp. that outcompete sulfate-reducing bacteria for organic electron donors. Appl. Environ. Microbiol. 73:2644–2652. Hulecki, J.C., Foght, J.M., Gray, M.R., and Fedorak, P.M. (2009) Sulfide persistence in oil field waters amended with nitrate and acetate. Journal of Industrial Microbiology & Biotechnology, 36(12):1499–511.

232

Iino, T., Nakagawa, T., Mori, K., Harayama, S., and Suzuki, K.I. (2008) Calditerrivibrio nitroreducens gen. nov., sp. nov., a thermophilic, nitrate-reducing bacterium isolated from a terrestrial hot spring in Japan. Int. J. Syst. Evol. Microbiol. 58:1675–9. Imachi, H., Aoi, K., Tasumi, E., Saito, Y., Yamanaka, Y., Saito, Y., Yamaguchi, T., Tomaru, H., Takeuchi, R., Morono, Y., Inagaki, F. (2011) Cultivation of methanogenic community from subseafloor sediments using a continuous-flow bioreactor. ISME J. 5:1913–1925. Isaksen, M., Bak, F., and Jorgensen, B.B. (1994). Thermophilic sulfate reducing bacteria in cold marine sediment. FEMS Microbiol. Ecol. 14:1-8. Jiménez, N., Viñas, M., Guiu-Aragonés, C., Bayona, J.M., Albaiges, A.J., and Solanas, A.M. (2011) Polyphasic approach for assessing changes in an autochthonous marine bacterial community in the presence of Prestige fuel oil and its biodegradation potential. Appl Microbiol Biotechnol. 91: 823. Joannou, C.L., Cui, X-Y., Rogers, N., Vielotte, N., Torres-Martinez, C.L, Vugman, N.V., Hughes, M.N., Cammack, R. (1998) Characterization of the bactericidal effects of sodium nitroprusside and other pentacyanonitrosyl complexes on the food spoilage bacterium Clostridium sporogenes. Applied and Environmental Microbiology, 64:3195-3201. Johnson, R. J. Folwell, B. D., Wirekoh, A., Frenzel, M. and Skovhus, T.L. (2017). Reservoir Souring – Latest developments for application and mitigation. Journal of Biotechnology, 256:57-67. Jones, B., Renaut, R.W., and Rosen, M.R. (2003) Silicified microbes in a geyser mound: The enigma of low-temperature cyanobacteria in a high-temperature setting. Palaios 18:87-109. Jordan, L.C., and Walsh, J.M. (2004) Selection of an Active Souring Management Solution for a Gulf of Mexico Waterflood. Corros. 2004 1–11. Jørgensen B.B. (1990) A thiosulfate shunt in the sulfur cycle of marine sediments. Science 249:152. Kaster, K.M., Grigoriyan, A., Jenneman, G., and Voordouw, G. (2007) Effect of nitrate and nitrite on sulfide production by two thermophilic, sulfate-reducing enrichments from an oil field in the North Sea. Appl. Microbiol. Biotechnol. 75:195–203. Kaster, K.M., Bonaunet, K., Berland, H., Kjeilen-Eilertsen, G., Brakstad, O.G. (2009) Characterisation of culture-independent and -dependent microbial communities in a high- temperature offshore chalk petroleum reservoir. Antonie Van Leeuwenhoek, 96:423–39. Kaster, K.M., Grigoryan, A., Jenneman, G., and Voordouw, G. (2007) Effect of nitrate and nitrite on sulfide production by two thermophilic, sulfate-reducing enrichments from an oil field in the North Sea. Applied Microbiology and Biotechnology, 75(1):195–203. Kelland, M.A. (2009) Production Chemicals for the Oil and Gas Industry, Boca Raton, FL: CRC Press. Khelifi, N., Amin Ali, O., Roche, P., Grossi, V., Brochier-Armanet, C., Valette, O., Ollivier, B., Dolla, A., and Hirschler-Réa, A. (2014) Anaerobic oxidation of long-chain n-alkanes by

233

the hyperthermophilic sulfate-reducing archaeon, Archaeoglobus fulgidus. ISME J. 8:2153–2166. Kjellerup, B.V., Veeh, R.H., Sumithraratne, P., Thomsen, T.R., Buckingham-Meyer, K., Frølund, B., and Sturman, P. (2005) Monitoring of microbial souring in chemically treated, produced-water biofilm systems using molecular techniques. J. Ind. Microbiol. Biotechnol. 32:163–170. Kobayashi, H., Endo, K., Sakata, S., Mayumi, D., Kawaguchi, H., Ikarashi, M., Miyagawa, Y., Maeda, H., and Sato, K. (2012) Phylogenetic diversity of microbial communities associated with the crude-oil, large-insoluble-particle and formation-water components of the reservoir fluid from a non-flooded high-temperature petroleum reservoir. J. Biosci. Bioeng. 113(2), 204-210. Koch, G., Varney, J., Thompson, N., Moghissi, O., Gould, M. and Payer, J. (2016). International measures of prevention, application, and economics of corrosion technologies study. NACE International, Houston, Texas, USA Koslyk, J.L., Ducci, R.D., Novak, E.M., Zetola, V.F., Lange, M.C. (2015) Sodium nitroprusside: low price and safe drug to control BP during thrombolysis in AIS. Arq Neuropsiquiatr 73: 755-758. Kostka, J.E., Dalton, D.D., Skelton, H., Dollhopf, S., and Stucki, J.W. (2002) Growth of iron(III)- reducing bacteria on clay minerals as the sole electron acceptor and comparison of growth yields on a variety of oxidized iron forms. Applied and Environmental Microbiology 68(12):6256–6262. Kotlar, H.K., Lewin, A., Johansen, J., Throne-Holst, M., Haverkamp, T., Markussen, S., Winnberg, A., Ringrose, P., Aakvik, T., Ryeng, E., Jakobsen, K., Drabløs, F., and Valla, S. (2011) High coverage sequencing of DNA from microorganisms living in an oil reservoir 2.5 kilometres subsurface. Environ. Microbiol. Rep. 3:674–681. L’haridon, S., Reysenbach, A. L., Glenat, P., Prieur, D., and Jeanthon, C. (1995) Hot subterranean biosphere in a continental oil-reservoir. Nature 377:223-224. Lambo, A. J., Noke, K., Larter, S. R., and Voordouw, G. (2008) Competitive, microbially- mediated reduction of nitrate with sulfide and aromatic oil components in a low- temperature, western Canadian oil reservoir. Environ. Sci. Technol. 42: 8941–8946. Larsen, J., Rod, M.H., Zwolle, S., Olie, M., and og Gas, A.S. (2004) Prevention of reservoir souring in the Halfdan field by Nitrate injection. Corrosion 2004 Paper No., 1–16. Lee, D.Y., Kim, W.C., and Kim, J.G. (2012) Effect of nitrite concentration on the corrosion behaviour of carbon steel pipelines in synthetic tap water. Corros. Sci. 64: 105–114. Lenchi, N., Inceoğlu, O., Kebbouche-Gana, S., Gana, M. L., Llirós, M., Servais, P., and García- Armisen, T. (2013). Diversity of Microbial Communities in Production and Injection Waters of Algerian Oilfields Revealed by 16S rRNA Gene Amplicon 454 Pyrosequencing. PLoS One 8: e66588.

234

Li, D., Midgley, D., Ross, J., Oytam, Y., Abell, G., Volk, H., Daud, W., and Hendry, P. (2012). Microbial biodiversity in a Malaysian oil field and a systematic comparison with oil reservoirs worldwide. Archives of Microbiology, 194:513-523. Li, H., Yang, S.-Z., Mu, B.-Z., Rong, Z.-F., and Zhang, J. (2006) Molecular analysis of the bacterial community in a continental high-temperature and water-flooded petroleum reservoir. FEMS Microbiol. Lett. 257:92–98. Li, R., Zi, X., Wang, X., Zhang, X., Gao, H., and Hu, N. (2013). Marinobacter hydrocarbonoclasticus NY-4, a novel denitrifying, moderately halophilic marine bacterium. Springerplus 2:346. Liamleam, W., and Annachhatre, A.P. (2007) Electron donors for biological sulfate reduction. Biotechnology Advances, 25(5):452–63. Liang, R., Grizzle, R. S., Duncan, K. E., McInerney, M.J. and Suflita, J.M. (2014) Roles of thermophilic thiosulfate-reducing bacteria and methanogenic archaea in the biocorrosion of pipelines. Front. Microbiol. 5: 89. Liebensteiner, M.G., Tsesmetzis, N., Stams, A.J.M., and Lomans, B.P. (2014) Microbial redox processes in deep subsurface environments and the potential application of (per)chlorate in oil reservoirs. Front. Microbiol. 5: 428. Liebensteiner, M.G., Pinkse, M.W.H., Schaap, P.J., Stams, A.J.M., Lomans, B.P. (2013) Archaeal (per)chlorate reduction at high temperature: an interplay of biotic and abiotic reactions. Science 340: 85–7. Ligthelm, D.J., deBoer, R.B., Brint, J.F., and Schulte, W.M. (1991) Reservoir Souring: An analytical model for H2S generation and transportation in an oil reservoir owing to bacterial activity. Paper SPE 23141 presented at the Offshore Europe, Aberdeen, United Kingdom, 3‐6 September. DOI: 10.2118/23141‐MS. Lim, H.S., and Zaphiriou, A. (2016) Sodium nitroprusside in patients with mixed pulmonary hypertension and left heart disease: Hemodynamic predictors of response and prognostic implications. Journal of Cardiac Failure 22:117-124. Lin, J., Hao, B., Cao, G., Wang, J., Feng, Y., Tan, X., and Wang, W. (2014). A study on the microbial community structure in oil reservoirs developed by water flooding. J. Pet. Sci. Eng. 122: 354–359. Londry, K., and Suflita, J. (1999) Use of nitrate to control sulfide generation by sulfate-reducing bacteria associated with oily waste. J. Ind. Microbiol. Biotechnol. 22:582–589. Ma, W., Peng, D., Walker, S.L., Cao, B., Gao, C., Huang, Q., and Cai, P. (2017) Bacillus subtilis biofilm development in the presence of soil clay minerals and iron oxides. Biofilms and Microbiomes, 3(4). Machel, H.G. (2001) Bacterial and thermochemical sulfate reduction in diagenetic settings - old and new insights. Sediment. Geol. 140:143–175.

235

Magot, M. (2005) “Indigenous Microbial Communities in Oil Fields,” in Petroleum Microbiology (American Society of Microbiology), 21–34. doi:10.1128/9781555817589.ch2. Magot, M., Ollivier, B., and Patel, B.K.C. (2000) Microbiology of petroleum reservoirs. Antonie Van Leeuwenhoek 77:103–116. Masui, N., Morono, Y., and Inagaki, F. (2008) Microbiological assessment of circulation mud fluids during the first operation of riser drilling by the deep-earth research vessel Chikyu. Geomicrobiol. J. 25:274–282. Maune, M.W., and Tanner R.S. (2012) Description of Anaerobaculum hydrogeniformans sp. nov., an anaerobe that produces hydrogen from glucose, and emended description of the genus Anaerobaculum. Int. J. Syst. Evol. Microbiol. 62:832–838. Maxwell, S., and Spark, I. (2005) Souring of reservoirs by bacterial activity during seawater waterflooding. SPE 93231, SPE Int. Symp. Oilf. Chem. 1–9. Mayumi, D., Mochimaru, H., Yoshioka, H., Sakata, S., Maeda, H., Miyagawa, Y., and Kamagata, Y. (2011) Evidence for syntrophic acetate oxidation coupled to hydrogenotrophic methanogenesis in the high-temperature petroleum reservoir of Yabase oil field (Japan). Environ. Microbiol. 13:1995–2006. Mcdonnell, G., and Russell, A.D. (1999) Antiseptics and disinfectants: Activity, action, and resistance. Clinical Microbiology Reviews, 12(1):147–179. McGenity, T.J., Folwell, B.D., McKew, B.A., and Sanni, G.O. (2012) Marine crude-oil biodegradation: a central role for interspecies interactions. Aquat. Biosyst. 8:10. McGinley, H., Enzien, M.V., Jenneman, G.E., and Harris, J.B. (2011) Studies on the Chemical Stability of Glutaraldehyde in Produced Water. In: Paper SPE -141449-MS. SPE International Symposium on Oilfield Chemistry. Society of Petroleum Engineers, The Woodlands, Texas, USA. Mcginley, H.R., Enzien, M. V, Hancock, G., Gonsior, S., and Miksztal, M. (2009) Glutaraldehyde: An understanding of its ecotoxicity profile and environmental chemistry, in: Paper 09405. Corrosion/09. NACE International, Atlanta, GA, pp. 1–8. McIlroy, S.J., Saunders, A.M., Albertsen, M., Nierychlo, M., McIlroy, B., Hansen, A.A., Karst, S.M., Nielsen, J.L., and Nielsen P.H. (2015) MiDAS: the field guide to the microbes of activated sludge. Database, Vol. 2015. McKinley, V.L., Costerton, J.W., and White, D.C. (1988) Microbial biomass, activity, and community structure of water and particulates retrieved by backflow from a waterflood injection well. Appl. Environ. Microbiol. 54:1383–1393. Mehta-Kolte, M.G., Loutey, D., Wang, O., Youngblut, M.D., Hubbard, C.G., Wetmore, K.M., Conrad, M.E. Coates, J.D. (2017). Mechanism of H2S oxidation by the dissimilatory perchlorate reducing microorganism Azospira suillum PS. mBio 8:e02023-16. Menes, R.J., and Muxí L. (2002) Anaerobaculum mobile sp. nov., a novel anaerobic, moderately thermophilic, peptide-fermenting bacterium that uses crotonate as an electron acceptor, and

236

emended description of the genus Anaerobaculum. Int. J. Syst. Evol. Microbiol. 52: 157– 164. Menon, P., and Voordouw, G. (2016) Impact of light oil toxicity on sulfide production by acetate-oxidizing, sulfate-reducing bacteria. Int. Biodeterior. Biodegradation. Miranda-Tello E., Fardeau M.L., Thomas P., Ramirez, F., Casalot, L., Cayol, J.L., Garcia, J.L., and Ollivier, B, (2004) Petrotoga mexicana sp nov., a novel thermophilic, anaerobic and xylanolytic bacterium isolated from an oil-producing well in the Gulf of Mexico. Int J Syst Evol Microbiol 54:169–174. Miranda-Tello, E., Fardeau, M., Sepulveda, J. Fernandez, L., Cayol, J., Thomas, P. and Ollivier, B. (2003) Garciella nitratireducens gen. nov., sp. nov., an anaerobic, thermophilic, nitrate- and thiosulfate-reducing bacterium isolated from an oilfield separator in the Gulf of Mexico. International Journal of Systematic and Evolutionary Microbiology, 53(5):1509– 14. Molha, D., Hack, C. and Marchant R. (2007) The complete denitrification pathway of Geobacillus thermoleovorans. BMC Syst Biol 1:21. Moore, C.M., Nakano, M.M., Wang, T., Ye, R.W., and Helmann, J.D. (2004) Response of Bacillus subtilis to nitric oxide and the nitrosating agent sodium nitroprusside. J Bacteriol 186:4655-4664. Mueller, R., and Nielsen, P.H. (1996) Characterisation of thermophilic consortia from two souring oil reservoirs. Appl. Environm. Microbiol., 62(9):3083–3087. Müller, A. L., de Rezende, J. R., Hubert, C. R. J., Kjeldsen, K. U., Lagkouvardos, I., Berry, D., Jørgensen, B.B., and Loy, A. (2014) Endospores of thermophilic bacteria as tracers of microbial dispersal by ocean currents. ISME J. 8: 1153–1165. Myhr, S., Lillebø, B.L.P., Sunde E., Beeder J., Torsvik T. (2002) Inhibition of microbial H2S production in an oil reservoir model column by nitrate injection. Appl. Microbiol. Biotechnol. 58:400–408. Myhr, S., and Torsvik, T. (2000) Denitrovibrio acetiphilus, a novel genus and species of dissimilatory nitrate-reducing bacterium isolated from an oil reservoir model column. International Journal of Systematic and Evolutionary Microbiology, 50(4):611–1619. Nakano, M., Okunishi, S., Tanaka, R., and Maeda, H. (2009a) Denitrifying Activity and Homologous Enzyme Analysis of Alcanivorax dieselolei Strain N1203. Biocontrol Sci. 14: 97–105. Nazina, T.N., Pavlova, N.K., Tatarkin, Y.V., Shestakova, N.M., Babich, T.L., Sokolova, D.S., Ivoilov, V.S., Khisametdinov, M.R. Ibatullin, R.R., Tourova, T.P. Belyae, S.S. and Ivanov, M.V. (2013) Microorganisms of the carbonate petroleum reservoir 302 of the Romashkinskoe oilfield and their biotechnological potential. Microbiology 82:190–200. Nazina, T.N., Shestakova, N.M., Semenova, E.M., Korshunova, A.V., Kostrukova, N.K., Tourova, T.P., Min, L., Feng, Q., and Poltaraus, A.B. (2017). Diversity of metabolically

237

active bacteria in water-flooded high-temperature heavy oil reservoir. Front. Microbiol. 8:707. Nazina, T.N., Shestakova, N.M., Grigoryan, A.A., Mikhailova, E.M., Tourova, T.P., Poltaraus, A.B., Feng, C., Ni, F., and Belyaev, S.S. (2006). Phylogenetic diversity and activity of anaerobic microorganisms of high-temperature horizons of the Dagang oil field (P. R. China). Microbiology 75:55–65. Nazina, T.N., Ivanova, A.E., Borzenkov, I. a., Belyaev, S.S., Ivanov, M. V. (1995) Occurrence and geochemical activity of microorganisms in high‐temperature, water‐flooded oil fields of Kazakhstan and Western Siberia. Geomicrobiol. J. 13:181–192. Nemati, M., Jenneman, G.E., and Voordouw, G. (2001). Mechanistic study of microbial control of hydrogen sulfide production in oil reservoirs. Biotechnol. Bioeng. 74:424–434. Nerenberg, R., Kawagoshi, Y., and Rittmann, B.E. (2006) Kinetics of a hydrogen-oxidizing, perchlorate-reducing bacterium. Water Res 40: 3290–3296. Nesbø, C.L., Bradnan, D.M., Adebusuyi, A., Dlutek, M., Petrus, A.K., Foght, J., Doolittle, W.F., Noll, K.M. (2012) Mesotoga prima gen. nov., sp. nov., the first described mesophilic species of the Thermotogales. Extremophiles. 16:387–393. Nesbø, C.L., Kumaraswamy, R., Dlutek, M., Doolittle, W.F., and Foght, J. (2010) Searching for mesophilic Thermotogales bacteria: “Mesotogas” in the wild. Appl. Environ. Microbiol. 76:4896–4900. Nesbo, C.L., Dahle, H., Haverkamp, T.H., Birkeland, N.K., Sokolova, T., Kublanov, I., and Zhaxybayeva, O. (2015) Evidence for extensive gene flow and Thermotoga subpopulations in subsurface and marine environments. ISME J 9:1532-1542. Nielsen, J.L., and Nielsen, P.H. (2015) MiDAS: the field guide to the microbes of activated sludge. Database, Vol. 2015. Nilsen, R. K., Beeder, J., and Thorstenson, T., and Torsvik, T. (1996a). Distribution of thermophilic marine sulfate reducers in north sea oil field waters and oil reservoirs. Applied and environmental microbiology, 62(5):1793-1798. Nilsen, R. K., Torsvik, T., and Lien, T. (1996b). Desulfotomaculum thermocisternum sp. nov., a Sulfate Reducer Isolated from a Hot North Sea Oil Reservoir. Int. J. Syst. Bacteriol. 46: 397–402. Nozawa-Inoue, M., Jien, M., Yang, K., Rolston, D.E., Hristova, K.R. and Scow, K.M. (2011) Effect of nitrate, acetate, and hydrogen on native perchlorate-reducing microbial communities and their activity in vadose soil. FEMS Microbiology Ecology, 76:278–288. Okoro, C.C. (2015) The Biocidal Efficacy of Tetrakis-hydroxymethyl Phosphonium Sulfate (THPS) Based Biocides on Oil Pipeline PigRuns Liquid Biofilms. Petroleum Science and Technology, 33:13-14. Okpala, G.N., Chuan, C., Fida, T., and Voordouw, G. (2017). Effect of thermophilic nitrate reduction on sulfide production in high temperature oil reservoir samples. Front. Microbiol. 8:1573.

238

Orphan, V.J., Goffredi, S.K., Delong, E.F., and Boles, J.R. (2003) Geochemical influence on diversity and microbial processes in high temperature oil reservoirs. Geomicrobiol. J. 20:295–311. Orphan, V.J., Taylor, L.T., Hafenbradl, D., and Delong, E.F. (2000) Culture-Dependent and Culture-Independent Characterization of Microbial Assemblages Associated with High- Temperature Petroleum Reservoirs. Appl. Environ. Microbiol. 66(2): 700-711. Otaki, H., Everroad, R.C., Matsuura, K., and Haruta, S. (2012) Production and consumption of hydrogen in hot spring microbial mats dominated by a filamentous anoxygenic photosynthetic bacterium. Microbes Environ. 27(3):293–299. Pavlova-Kostryukova, N.K., Tourova, T.P., Poltaraus, A.B., Feng, Q., and Nazina, T.N. (2014) Microbial diversity in formation water and enrichment cultures from the Gangxi bed of the Dagang terrigenous oilfield (PRC). Microbiology 83:616–633. Pavlova-Kostryukova, N.K., Tourova, T.P., Poltaraus, A.B., Feng, Q., and Nazina, T.N. (2014) Microbial diversity in formation water and enrichment cultures from the Gangxi bed of the Dagang terrigenous oilfield (PRC). Microbiology, 83(5):616-633. Percheron, G., Michaud, S., Bernet, N., and Moletta, R. (1998) Nitrate and nitrite reduction of a sulfide rich environment. J. Chem. Technol. Biotechnol., 72:213-220. Piceno, Y.M., Reid, F.C., Tom, L. ., Conrad, M.E., Bill, M., Hubbard, C.G., Fouke, B.W., Graff, C.J., Han, J., Stringfellow, W.T., and Hanlon, J.S. (2014). Microbial Physiology and Metabolism Temperature and injection water source influence microbial community structure in four Alaskan North Slope hydrocarbon reservoirs. Front. Microbiol. 5:409. Plugge, C.M., Balk, M., Zoetendal, E.G., and Stams, A.J.M. (2002). Gelria glutamica gen. nov., sp. nov., a thermophilic, obligately syntrophic, glutamate-degrading anaerobe. Intl. J. systematic and Evolutionary Microbiology. 52:401-407. Poddar, A., Lepcha, R.T., and Das, S.K. (2014). Taxonomic study of the genus Tepidiphilus: transfer of Petrobacter succinatimandens to the genus Tepidiphilus as Tepidiphilus succinatimandens comb. nov., emended description of the genus Tepidiphilus and description of Tepidiphilus thermophilus sp. nov., isolated from a terrestrial hot spring. Int J Syst Evol Microbiol., 64:228-235. Quiroga, S.L., Almaraz, A.E., Amorebieta, V.T., Perissinotti, L.L., Olabe, J.A. (2011) Addition and redox reactivity of hydrogen sulfides (H2S/HS (-)) with nitroprusside: new chemistry of nitrososulfide ligands. Chemistry 17:4145-4156. Rabus, R., Hansen, T.A., and Widdel, F. (2006) Dissimilatory Sulfate and Sulfur-Reducing Prokaryotes, in: Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.-H., Stackebrandt, E. (Eds.), The Prokaryotes. Springer Science, New York, pp. 659–768. Raman, V., Tamilselvi, S. Rajendran, N. (2008) Evaluation of effective biocides for SRB to control microbiologically influenced corrosion. Materials and Corrosion, 59(4):329-334.

239

Rees, G.N., Patel, B.K.C., Grassia, G.S., and Sheehy, A.J. (1997). Anaerobaculum thermoterrenum gen. ov., sp. nov., a novel, thermophilic bacterium which ferments citrate. Int. J. Syst. Bacteriol. 47:150–154. Reguera, G., McCarthy, K.D., Mehta, T., Nicoll, J.S., Tuominen, M.T. and Lovely, D. R. (2005). Extracellular electron transfer via nanowires, Nature, 435:1098-1101. Reinsel, M.A., Sears, J.T., Stewart, P.S., McInerney, M.J., and Mclnerney, M.J. (1996). Control of microbial souring by nitrate, nitrite or glutaraldehyde injection in a sandstone column. J. Ind. Microbiol. 17:128–136. Reis, M.A.M., Almeida, J.S., Lemos, P.C. and Carrondo, M.J.T. (1992), Effect of hydrogen sulfide on growth of sulfate reducing bacteria. Biotechnol. Bioeng., 40: 593–600. Ren, H.Y., Zhang, X.J., Song, Z.Y., Rupert,W., Gao, G.J., Guo, S.X., and Zhao, L.P. (2011). Comparison of microbial community compositions of injection and production well samples in a long term water-flooded petroleum reservoir, Plos One, 68:e23258. Rikken, G.B., Kroon, A.G.M. and van Ginkel, C.G. (1996). Transformation of (per)chlorate into chloride by a newly isolated bacterium: reduction and dismutation. Appl Microbiol Biotechnol, 45:420-426. Röling, W.F.M., Head, I.M., and Larter, S.R. (2003). The microbiology of hydrocarbon degradation in subsurface petroleum reservoirs: perspectives and prospects. Res. Microbiol. 154:321–328. Rong, X., Huang, Q., and Chen, W. (2007) Microcalorimetric investigation on the metabolic activity of Bacillus thuringiensis as influenced by kaolinite, montmorillonite and goethite. Applied Clay Science, 38:97–103. Rossmoore, H.W. (1995) Handbook of Biocide and Preservative Use. Blackie Academic & Professional; Glasgow, United Kingdom. Rossmoore, H.W. (1994) Handbook of Biocide and Preservative Use. First Edition. H. W. Rossmoore, ed., Springer Science. Rozanova, E.P., Borzenkov, I.A., Tarasov, A.L., Suntsova, L.A., Dong, C.L., Belaev, S.S., and Ivanov, M.V. (2001) Microbiological Processes in a High-Temperature Oil Field. Microbiology, 70(1):102–110. Rueter, P., Rabus, R., Wilkest, H., Aeckersberg, F., Rainey, F.A., Jannasch, H.W., and Widdel, F. (1994) Anaerobic oxidation of hydrocarbons in crude oil by new types of sulphate- reducing bacteria. Nature, 372(6505):455-458. Saitou, N., and Nei, M. (1987) The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406-425. Salinas, M.B., Fardeau, M.L., Cayol, J.L., Casalot, L., Patel, B.K., Thomas, P., Garcia, J.L., and Ollivier, B. (2004) Petrobacter succinatimandens gen. nov., sp. nov., a moderately thermophilic, nitrate-reducing bacterium isolated from an Australian oil well. Int J Syst Evol Microbiol 54:645-649.

240

Sarti, A., Pozzi, E., Chinalia, F.A., Ono, A., and Foresti, E. (2010). Microbial processes and bacterial populations associated to anaerobic treatment of sulfate-rich wastewater. Process Biochem., 45:164–170. Sasaki, D., Morita, M., Sasaki, K., Watanabe, A., and Ohmura, N. (2012). Acceleration of cellulose degradation and shift of product via methanogenic coculture of a cellulolytic bacterium with a hydrogenotrophic methanogen. J Biosci Bioeng., 114: 435–439. Satter, A. and Iqbal, G.M. (2015) Reservoir Engineering: The fundamentals, simulation, and management of conventional and unconventional recoveries. Elsevier Science, Oxford, UK. Schaffner, I., Hofbauer, S., Krutzler, M., Pirker, K.F., Furtmüller, P.G., and Obinger, C. (2015) Mechanism of chlorite degradation to chloride and dioxygen by the enzyme chlorite dismutase. Arch. Biochem. Biophys. 574:18–26. Sharma, M., An, D., Liu, T., Pinnock, T., Cheng, F., and Voordouw, G. (2017) Biocide-mediated corrosion of coiled tubing. PLoS ONE 12(7):e0181934. Sharpe, E., Barua, R., Brateteig, A., and Bath, Z. (2015) Case study: Laser-based gas detection technology and dispersion modelling used to eliminate false almarms and improve safety performance on Terra Nova FPSO. in Global Summit on Process Safety. 2015 AIChE Spring Meeting & 11th Global Congress on Process Safety, 49th Annual Loss Prevention Symposium (LPS), held on 26-30 April 2015, Austin, Texas, USA. Shen, Y., and Voordouw, G. (2015) “Primers for dsr Genes and Most Probable Number Method for Detection of Sulfate-Reducing Bacteria in Oil Reservoirs,” in Hydrocarbon and Lipid Microbiology Protocols, eds. T. J. McGenity, K. N. Timmis, and B. Nogales (Berlin, Heidelberg: Springer-Verlag), 35–43. Sherar, B.W.A., Power, I.M., Keech, P.G., Mitlin, S., Southan, G. and Shoesmith, D.W. (2011). Characterizing the effect of carbon steel exposure in sulfide containing solutions to microbiall induced corrosion. Corrosion Sci. 53: 955-960 Sherry, A., Gray, N.D., Ditchfield, A.K., Aitken, C.M., Jones, D.M., Röling, W.F. M., Hallmann, C., Larter, S.R., Bowler, B.F.J., and Head, I.M. (2013). Anaerobic biodegradation of crude oil under sulphate-reducing conditions leads to only modest enrichment of recognized sulphate-reducing taxa. Int. Biodeter. Biodegr. 81:105–113. Shock, E.L. (1988) Organic acid metastability in sedimentary basins. Geology 16:886–890. Singh, A.K., Sherry, A., Gray, N.D., Jones, D.M., Bowler, B.F.J., and Head, I.M. (2014). Kinetic parameters for nutrient enhanced crude oil biodegradation in intertidal marine sediments. Front. Microbiol. 5:160. Slobodkin, A., Zavarzina, D., and Sokolova, T. (1999) Dissimilatory Reduction of Inorganic Electron Acceptors by Thermophilic Anaerobic Prokaryotes. Mikrobiologiia, 68(5):522– 542.

241

Sonne-Hansen, J., Westermann, P., Ahring, B.K. (1999) Kinetics of sulfate and hydrogen uptake by the thermophilic sulfate- reducing bacteria Thermodesulfobacterium sp. strain JSP and Thermodesulfovibrio sp. strain R1Ha3. Appl. Environ. Microbiol. 65:1304–1307. Stepanov, V. G., Xiao, Y., Lopez, A. J., Roberts, D. J., and Fox, G. E. (2016) Draft Genome Sequence of Marinobacter sp. Strain P4B1, an Electrogenic Perchlorate-Reducing Strain Isolated from a Long-Term Mixed Enrichment Culture of Marine Bacteria. Genome Announc. 4:e01617-15. Stetter, K.O., Huber, R., Blöchl, E., Kurr, M., Eden, R.D., Fielder, M., Cash, H., and Vance, I., (1993) Hyperthermophilic archaea are thriving in deep North Sea and Alaskan oil reservoirs. Nature, 365(6448):743-745. Stolze, Y., Bremges, A., Rumming, M., Henke, C., Maus, I., Puhler, A., Sczyrba, A., and Schlüter, A. (2016) Identification and genome reconstruction of abundant distinct taxa in microbiomes from one thermophilic and three mesophilic production-scale biogas plants. Biotechnol. Biofuels 9:1–18. Sun, W., Dong, Y., Gao, P., Fu, M., Ta, K., and Li, J. (2015). Microbial communities inhabiting oil-contaminated soils from two major oilfields in Northern China: Implications for active petroleum degrading capacity. Journal of Microbiology, 53(6):371-378. Sunde, E., and Torsvik, T. (2005) Microbial control of hydrogen sulfide production in oil reservoirs. In Petroleum Microbiology (eds) Ollivier, B. and Magot, M. ASM Press, Washington, USA. pp 201-213. Sunde, E., Lillebø, B.-L.P., Bødtker, G., Torsvik, T., and Tore, T. (2004) H2S inhibition by nitrate injection on the gullfaks field. NACE Corros. Annu. Conf. Expo. 1–14. Sunde, E., Thorstenson, T. (1993) Field-related mathematical model to predict and reduce reservoir souring. In: SPE International Symposium on Oilfield Chemistry. Paper SPE 25197. Society for Petroleum Engineers, Houston, USA. Takami, H., Takaki, Y., Chee, G-J., Nishi, S., Shimamura, S., Suzuki, H., Matsui, S., Uchiyama, I. (2004) Thermoadaptation trait revealed by the genome sequence of thermophilic Geobacillus kaustophilus. Nucleic Acids Res 32:6292-6303. Takai, K. (2003) Deferribacter desulfuricans sp. nov., a novel sulfur-, nitrate- and arsenate- reducing thermophile isolated from a deep-sea hydrothermal vent. Int. J. Syst. Evol. Microbiol. 53:839–846. Tamura, K., Nei, M., and Kumar, S. (2004) Prospects for inferring very large phylogenies by using the neighbor-joining method. PNAS 101:11030-11035. Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30:2725- 2729. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731–2739.

242

Tandishabo, K., Iga, Y., Tamaki, H., Nakamura, K., and Takamizawa, K. (2012). Characterization of a novel Coprothermobacter sp. strain IT3 isolated from an anaerobic digester–hydrogen production and peptidase profiles at higher temperature. J. Environ. Conserv. Eng, 41:753-761. Telang, A.J., Ebert, S., Foght, J.M., Westlake, D.W.S., and Voordouw, G. (1998) Effects of two diamine biocides on the microbial community from an oil field. Can J Microbiol 44: 1060- 1065. Thevenieau, F., Fardeau, M., Oillivier, B., Joulian, C., and Baena, S. (2007) Desulfomi crobium thermophilum sp. nov., a novel thermophilic sulphate-reducing bacterium isolated from a terrestrial hot spring in Colombia. Extremphiles, 11:295-303. Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680. Thrasher, D.R., and Vance, I. (2005). “Reservoir Souring: Mechanisms and Prevention,” in Petroleum Microbiology (American Society of Microbiology), 123–142. doi:10.1128/9781555817589.ch7. Torsvik, T., and Sunde, E. (2005). “Microbial Control of Hydrogen Sulfide Production in Oil Reservoirs,” in Petroleum Microbiology (American Society of Microbiology), 201–213. doi:10.1128/9781555817589.ch10. Trüper, H.G., and Schlegel, H.G. (1964) Sulphur metabolism in Thiorhodaceae. Quantitative measurement of growing cells of Chromatium okenii. Antonie van Leeuwenhoek 30: 225 – 238. Utgikar, V. P., Harmon, S. M., Chaudhary, N., Tabak, H. H., Govind, R. and Haines, J. R. (2001). Inhibition of sulfate-reducing bacteria by metal sulfide formation in bioremediation of acid mine drainage. Environmental Toxicology, 17(1):40-48. van Ginkel, C.G., Rikken, G.B., Kroon, A.G.M. and Kengen, S.W.M. (1996). Purification and characterization of chlorite dismutase: a novel oxygen-generating enzyme. Arch. Microbiol. 166:321-326. Vandera, E., and Koukkou, A.I. (2017) Bacterial community response of hydrocarbon contamination in soils and marine sediments: A critical review of case studies. In Microbial Ecotoxicology. Cravo-Laureau, C., Cagonon, T., Lauga, B. and Duran, R. (eds). Springer Nature, Switerland. Pg 185-226. Varon, J., and Marik, P.E. (2008) Perioperative hypertension management. Vascular Health and Risk Management, 4(3):615-627. Vesey, C.J., and Batistoni, G.A. (1977) The determination and stability of sodium nitroprusside in aqueous solutions. J. Clin. Pharm. Ther. 2:105–117. Vieira, M.J., Pacheco, A.P., Pinho, I.A., and Melo, L.F. (2001) The effect of clay particles on the activity of suspended autotrophic nitrifying bacteria and on the performance of air-lift reactors. Environmental Technology, 22:123-135.

243

Vigneron, A., Alsop, E.B., Lomans, B., Kyrpides, N.C., Head, I. M., and Tsesmetzis, N. (2017). Succession in the petroleum reservoir microbiome through an oil field production lifecycle. ISME J, 11(9):2141–2154. Vilcaez, J., Miyazawa, S., Suto, K., and Inoue, C. (2007) Numerical Evaluation of Biocide Treatment against Sulfate Reducing Bacteria in Oilfield Water Pipelines. Journal of the Japan Petroleum Institute, 50(4):pp.208–217. Voordouw, G., Grigoryan, A.A., Lambo, A., Lin, S., Park, H.S., Jack, T.R., Coombe, D., Clay, B., Zhang, F., Ertmoed, R., and Miner, K. (2009) Sulfide remediation by pulsed injection of nitrate into a low temperature Canadian heavy oil reservoir. Environ. Sci. Technol. 43:9512–9518. Voordouw, G., Menon, P., Pinnock, T., Sharma, M., Shen, Y., Venturelli, A., Voordouw, J. and Sexton, A. (2016) Use of Homogeneously-Sized Carbon Steel Ball Bearings to Study Microbially-Influenced Corrosion in Oil Field Samples. Frontiers in microbiology, 7. Wadji, H.B., Godbane, R., Postec, A., Hamdi, M., Ollivier, B. and Fardeau, M. (2012). Defluviitoga tunisiensis gen. nov., sp. nov., a thermophilic bacterium isolated from a mesothermic and anaerobic whey digester. International Journal of Systematic and Evolutionary Microbiology, 62:1377–1382. Waller, A.S., Cox, E.E., and Edwards, E.A. (2004) Perchlorate-reducing microorganisms isolated from contaminated sites. Environ Microbiol 6:517–527. Wan, D., Liu, Y., Niu, Z., Xiao, S., and Li, D. (2016) Perchlorate reduction by hydrogen autotrophic bacteria and microbial community analysis using high-throughput sequencing Biodegradation 27(1), 47-57. Wentzel, A., Lewin, A., Cervantes, F.J., Valla, S., and Kotlar, H.K. (2013) Deep subsurface oil reservoirs as poly-extreme habitats for microbial life. A current review, in: Seckback, J., Oren, A., Stan-Lotter, H. (Eds.), Polyextremophiles: Life under Multiple Forms of Stress. Springer Science+Business Media, Dordrecht, pp. 439–466. Whitham, T.S., and Gilbert, P,D. (1993) Evaluation of a model biofilm for the ranking of biocide performance against sulphate-reducing bacteria. J Appl Bacteriol 75: 529-535. Wilhelms, A., Larter, S. R., Head, I., Farrimond, P., di-Primio, R. Zwach, C. (2001). Biodegradation of oil in uplifted basins prevented by deep-burial sterilization. Nature,411:1034-1037. Williams, T.M. (2004) Isothiazolone biocides in water treatment applications. In: NACE- 04083.Corrosion 2004. NACE International New Orleans, Louisiana. Wong, D., Suflita, J.M., McKinley, J.P., and Krumholz, L.R. (2004) Impact of clay minerals on sulfate-reducing activity in aquifers. Microbial Ecology, 47:80–86. Wunderlin, T., Junier, T., Roussel-Delif, L., Jeanneret, N., and Junier, P. (2014). Endospore- enriched sequencing approach reveals unprecedented diversity of Firmicutes in sediments. Environ. Microbiol. Rep. 6:631–639.

244

Xue, Y., and Voordouw, G. (2015) Control of Microbial Sulfide Production with Biocides and Nitrate in Oil Reservoir Simulating Bioreactors. Front. Microbiol. 6. Yamane, K., Hattori, Y., Ohtagaki, H., and Fujiwara, K. (2011) Microbial diversity with dominance of 16S rRNA gene sequences with high GC contents at 74 and 98 °C subsurface crude oil deposits in Japan. FEMS Microbiol. Ecol. 76:220–235. Yeung, C.W., Lee, K., Cobanli, S., King, T., Bugden, J., Whyte, L.G., and Greer, C.W. (2015) Characterization of the microbial community structure and the physicochemical properties of produced water and seawater from the Hibernia oil production platform. Environmental Science and Pollution Research, 22(22):17697-17715. Yin, B., Williams, T., Koehler, T., Morris, B., and Manna, K. (2016) Targeted microbial control for hydrocarbon reservoir: Identify new biocide offerings for souring control using thermophile testing capabilities. International Biodeterioration & Biodegradation. Yoshinaga, M.Y., Gagen, E.J., Wörmer, L., Broda, N.K., Meador, T.B., Wendt, J., Thomm, M., and Hinrichs, K.U. (2015) Methanothermobacter thermautotrophicus modulates its membrane lipids in response to hydrogen and nutrient availability. Front. Microbiol. 6:5. Youssef, N., Elshahed, M.S., and McInerney, M.J. (2009) Microbial Processes in Oil Fields. Culprits, Problems, and Opportunities 1st ed., Elesvier Inc. Zhang, F., She, Y., Chai, L., Banat, I.M., Zhang, X., Shu, F., Yu, L., and Hou, D. (2012) Microbial diversity in long-term water-flooded oil reservoirs with different in situ temperatures in China. Scientific Reports, 2:1–10. Zhang, Y., Zhao, Z., Chen, C.T. A., Tang, K., Su, J., and Jiao, N. (2012b). Sulfur Metabolizing Microbes Dominate Microbial Communities in Andesite-Hosted Shallow-Sea Hydrothermal Systems. PLoS One 7:e44593.

245

Appendix A: Supplementary material for Chapter 3: Isolation of thermophilic sulfate and

nitrate reducing bacteria from a low temperature oilfield (MHGC Oilfield)

Microbial Community composition for area I PWs by pyrosequencing ## Taxon (Domain;Phylum;class;order;family;genus) (%) 1 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanomicrobiaceae;Methanoculleus; 54.601 2 Archaea;Euryarchaeota;Methanomicrobia;Methanosarcinales;Methanosaetaceae;Methanosaeta; 11.411 3 Archaea;Euryarchaeota;Methanobacteria;Methanobacteriales;Methanobacteriaceae;Methanobacterium; 7.318 4 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanoregulaceae;Methanolinea; 4.054 5 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanomicrobiales-Incertae- 2.957 Sedis;Methanocalculus; 6 Bacteria;Candidate-division-OP3; 2.397 7 Bacteria;Microgenomates; 1.754 8 Bacteria;Firmicutes;Clostridia;Clostridiales;Peptococcaceae; 1.540 9 Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae;Pseudomonas; 1.346 10 Bacteria;Parcubacteria; 1.130 11 Archaea;Woesearchaeota-(DHVEG-6); 0.943 12 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanomicrobiaceae;Methanofollis; 0.942 13 Archaea;Euryarchaeota;Methanomicrobia;Methanosarcinales;Methanosarcinaceae;Methanolobus; 0.874 14 Bacteria;Proteobacteria;Betaproteobacteria;Rhodocyclales;Rhodocyclaceae;Thauera; 0.860 15 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanoregulaceae;Methanoregula; 0.772 16 Bacteria;Atribacteria; 0.739 17 Bacteria;Proteobacteria;Deltaproteobacteria;Syntrophobacterales;Syntrophaceae;Smithella; 0.642 18 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfuromonadales;Desulfuromonadaceae;Pelobacter; 0.439 19 Bacteria;Proteobacteria;Gammaproteobacteria;Alteromonadales;Shewanellaceae;Shewanella; 0.338 20 Archaea;Euryarchaeota;Thermoplasmata;Kazan-3A-21; 0.335 21 Bacteria;Spirochaetae;Spirochaetes;Spirochaetales;Spirochaetaceae; 0.271 22 Archaea;Euryarchaeota;Methanomicrobia;Methanosarcinales;Methanosarcinaceae;Methanosarcina; 0.270 23 Bacteria;Proteobacteria;Epsilonproteobacteria;Campylobacterales;Campylobacteraceae;Arcobacter; 0.238 24 Bacteria;Synergistetes;Synergistia;Synergistales;Synergistaceae;Thermovirga; 0.184 25 Bacteria;Chloroflexi;Dehalococcoidia;GIF9; 0.183 26 Bacteria;Firmicutes;Clostridia;Clostridiales;Eubacteriaceae;Acetobacterium; 0.173 27 Bacteria;Bacteroidetes;Sphingobacteriia;Sphingobacteriales;WCHB1-69; 0.169 28 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanocorpusculaceae; 0.136 Methanocorpusculum; 29 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfovibrionales;Desulfomicrobiaceae;Desulfomicrobium; 0.135 30 Bacteria; 0.117 31 Archaea;Euryarchaeota;Methanomicrobia;Methanomicrobiales;Methanospirillaceae;Methanospirillum; 0.111 32 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfovibrionales;Desulfovibrionaceae;Desulfovibrio; 0.100 33 Bacteria;Chloroflexi;Anaerolineae;Anaerolineales;Anaerolineaceae; 0.094 34 Bacteria;Candidate-division-WS6; 0.085 35 Bacteria;Deferribacteres;Deferribacteres;Deferribacterales;Deferribacteraceae;Denitrovibrio; 0.084 246

36 Bacteria;Aminicenantes; 0.071 37 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfuromonadales; 0.067 38 Bacteria;Spirochaetae;Spirochaetes;Spirochaetales;PL-11B10; 0.064 39 Bacteria;Thermotogae;Thermotogae;Thermotogales;Thermotogaceae;Mesotoga; 0.059 40 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Burkholderiaceae;Ralstonia; 0.058 41 Bacteria;Bacteroidetes;Bacteroidia;Bacteroidales;Porphyromonadaceae;Proteiniphilum; 0.056 42 Bacteria;Proteobacteria;Deltaproteobacteria;Syntrophobacterales;Syntrophaceae;Syntrophus; 0.052 43 Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Thermoanaerobacteraceae;Gelria; 0.052 44 Bacteria;Proteobacteria;Epsilonproteobacteria;Campylobacterales;Campylobacteraceae;Sulfurospirillum; 0.051 45 Bacteria;Proteobacteria;Deltaproteobacteria;Syntrophobacterales;Syntrophaceae; 0.047 46 Bacteria;Lentisphaerae;Lentisphaeria;Victivallales;Victivallaceae;Victivallis; 0.040 47 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfuromonadales;Desulfuromonadaceae;Desulfuromonas 0.036 ; 48 Bacteria;Proteobacteria;Alphaproteobacteria;Rhizobiales;Rhizobiaceae; 0.034 49 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfuromonadales;Desulfuromonadaceae; 0.031 50 Bacteria;Tenericutes;Mollicutes;Acholeplasmatales;Acholeplasmataceae;Acholeplasma; 0.029 51 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Comamonadaceae;Polaromonas; 0.028 52 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfobacterales;Desulfobulbaceae;Desulfobulbus; 0.021 53 Bacteria;Nitrospirae;Nitrospira;Nitrospirales;4-29; 0.019 54 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Comamonadaceae; 0.013 55 Bacteria;Proteobacteria;Alphaproteobacteria;Rhodospirillales;Rhodospirillaceae;Magnetospirillum; 0.012 56 Bacteria;Deferribacteres;Deferribacteres;Deferribacterales;Deferribacteraceae; 0.009 57 Bacteria;Bacteroidetes;Sphingobacteriia;Sphingobacteriales;Chitinophagaceae;Sediminibacterium; 0.008 58 Bacteria;Proteobacteria;Alphaproteobacteria;Caulobacterales;Caulobacteraceae;Caulobacter; 0.006 59 Bacteria;Proteobacteria;Epsilonproteobacteria;Campylobacterales;Helicobacteraceae;Sulfurimonas; 0.004 60 Bacteria;Proteobacteria;Gammaproteobacteria;Xanthomonadales;Xanthomonadaceae;Thermomonas; 0.004 61 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfuromonadales;Geobacteraceae;Geobacter; 0.003 62 Bacteria;Proteobacteria;Deltaproteobacteria;Desulfobacterales;Desulfobulbaceae;Desulfocapsa; 0.002 63 Bacteria;Bacteroidetes;Flavobacteriia;Flavobacteriales;Flavobacteriaceae;Cloacibacterium; 0.002 64 Bacteria;Proteobacteria;Betaproteobacteria; 0.001 65 Bacteria;Bacteroidetes;Flavobacteriia;Flavobacteriales;Flavobacteriaceae;Flavobacterium; 0.001 66 Bacteria;Bacteroidetes;Flavobacteriia;Flavobacteriales;Flavobacteriaceae; 0.001 67 Bacteria;Proteobacteria;Alphaproteobacteria;Sphingomonadales;Sphingomonadaceae;Novosphingobium; 0.001 68 Bacteria;Proteobacteria;Alphaproteobacteria;Rhizobiales;Methylobacteriaceae;Methylobacterium; 0.001 69 Bacteria;Proteobacteria;Alphaproteobacteria;Sphingomonadales;Sphingomonadaceae;Sphingomonas; 0.001 70 Bacteria;Proteobacteria;Betaproteobacteria;Burkholderiales;Comamonadaceae;Aquabacterium; 0.001 71 Bacteria;Proteobacteria;Gammaproteobacteria;Alteromonadales;Alteromonadaceae;Marinobacter; 0.001

Average number of reads 6346

247

Appendix B: Supplementary material for Chapter 4: Effect of thermophilic nitrate- reduction on sulfide production in samples from the high temperature Terra Nova reservoir

Sample Raw reads QC_reads OTUs_chao Shannon tSRB_inoculum 83330 29245 292 3.30 55°C 83364 26896 29 0.11 60°C 68412 19974 44 0.23 65°C 65892 17579 39 0.32

248

Table S4-2: Microbial community compositions of tSRB inoculum and of tSRB grown at 55, 60 and 65 °C, as in Figure 5. Fractions in excess of 1% are in bold. #Taxon (Phylum, class, genus) tSRB_inoculum 55°C 60°C 65°C Proteobacteria; Alphaproteobacteria; Bradyrhizobiaceae 0 0.04 0.01 0.05 Proteobacteria; Alphaproteobacteria; Caulobacter 0.08 0.23 0.34 0.43 Proteobacteria; Betaproteobacteria; Aquabacterium 0.12 0.13 0.32 0.75 Proteobacteria; Betaproteobacteria; Burkholderia 0.07 0.11 0.21 0.39 Proteobacteria; Betaproteobacteria; Roseateles 0.05 0.07 0.06 0.4 Proteobacteria; Betaproteobacteria; Thauera 14.92 0.01 0.01 0.25 Proteobacteria; Deltaproteobacteria; Desulfovibrio 3.03 0 0 0 Proteobacteria; Gammaproteobacteria; Acidibacter 0.01 0.02 0.07 0.12 Proteobacteria; Gammaproteobacteria; Acinetobacter 0.12 0.02 0.05 0.13 Proteobacteria; Gammaproteobacteria; Marinobacter 2 0 0 0 Proteobacteria; Gammaproteobacteria; Pseudomonas 5.41 0.35 0.76 1.13 Proteobacteria; Gammaproteobacteria; Shewanella 1.83 0 0 0 Actinobacteria; Microbacteriaceae 0.03 0.05 0.09 0.13 Actinobacteria; Propionibacterium 0.53 0.04 0.16 0.05 Bacteroidetes; Sphingobacteriia; Sediminibacterium 0.03 0.04 0.15 0.09 Deinococcus-Thermus; Deinococci; Thermus 25.31 0 0.01 0 Firmicutes; Bacilli; Anoxybacillus 8.82 0 0 0 Firmicutes; Bacilli; Staphylococcus 0.1 0 0.13 0.05 Firmicutes; Clostridia; Desulfitispora 2.51 0 0 0 Firmicutes; Clostridia; Desulfotomaculum 7.56 98.76 97.17 95.47 Euryarchaeota; Methanomicrobia; Methanoculleus 2.7 0 0 0

249

Figure S4-1: Temperature dependence of nitrate reduction of IW1_15 (a-c) and PW1_15 (d-f) samples, collected from the Terra Nova oil field in January 2015. The medium containing 3 mM VFA and 10 mM nitrate was inoculated with 1 ml of 50-fold concentrated IW or PW. The data are averages and standard deviations for three different incubations for each temperature.

250

10 9 8 Sulfate 7 6 Sulfide 5 4 3

2 Concentration Concentration (mM) 1 0 0 100 200 300 400 500 600 Time (h)

Figure S4-3. Sulfate reduction by tSRB enriched from PW1_14 at 70°C.

251

Marinobacter excellens strain KMM 3809 (AY180101) Marinobacter vinifirmus ASCOS9 3 (KT448600) Marinobacter marinus SW-45 (AF479689) Marinobacter daepoensis SW-156 (AY517633) Marinobacter hydrocarbonoclasticus ATCC 27132 (AB021372) Marinobacter persicus M9B (HQ433441) Marinobacter oulmenensis (FJ897726) Marinobacter koreensis DD-M3 (DQ325514) Marinobacter santoriniensis NKSG1 (APAT01000001) Marinobacter pelagius HS225 (DQ458821) Marinobacter szutsaonensis NTU-104 (EU164778) Marinobacter xestospongiae UST090418-1611 (HQ203044) Marinobacter mobilis CN46 (EU293412) Marinobacter zhejiangensis CN74 (EU293413) GN001 Marinobacter lutaoensis (AF288157) Marinobacter antarcticus ZS2-30 (FJ196022) Marinobacter maritimus CK47T (AJ704395) Marinobacter psychrophilus 20041 (DQ060402) Marinobacter lipolyticus SM19 (ASAD01000031) Marinobacter goseongensis En6 (EF660754) Marinobacter guineae LMG 24048 (AM503093) Marinobacter sedimentalis R65T (AJ609270) Marinobacter adhaerens HP15 (CP001978) Marinobacter flavimaris SW-145 (AY517632) Marinobacter salarius R9SW1 (KJ547705) Marinobacter salinaria CP-1 (LC009417) Marinobacter salsuginis SD-14B (EF028328) Marinobacter gudaonensis SL014B61A (DQ414419) Marinobacter lacisalsi FP2.5 (EU047505) Marinobacter segnicrescens SS011B1-4 (EF157832) Marinobacter bryozoanae 50-11T (AJ609271) Marinobacter salicampi ISL-40 (EF486354) Marinobacter daqiaonensis YCSA40 (FJ984869) Magnetospirillum aberrantis SpK (JQ673402)

Figure S4-4: Phylogenetic analysis of isolate GN001 with the genus Marinobacter based on the 16S rRNA gene sequence. evolutionary history was inferred using the Neighbor-Joining method The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the Maximum Composite Likelihood method

252

Appendix C: Supplementary material for Chapter 5: Souring control by nitrate and perchlorate

Table S5-1: Number of quality controlled (QC) reads, number of derived operational taxonomic units (OTUs), extrapolated number of OTUs (OTUs_chao) and Shannon diversity index for the time course nitrate and perchlorate incubations. Sequence ID # of QC Reads # OTUs # Taxa Shannon index MN_48h V50-2784 14573 54 39 0.18 MN_336h V50-2785 22400 62 56 1.13 MP_96h V50-2778 14964 78 69 1.93 MP_336h V50-2781 11118 52 51 2.06 MPN_48h V50-2770 19381 36 27 0.51 MPN_72h V50-2771 16136 36 30 0.49 MPN_120h V50-2772 33522 44 40 1.32 MPN_336 V50-2773 14325 66 49 1.87

253

254

Table S5-2 Microbial community compositions of VFA batch incubations of enrichments with nitrate or perchlorate.

#Taxonomy MN_48h MN_336h MP_96h MP_336h MPN_48h MPN_72h MPN_120h MPN_336h Methanomicrobia;Methanocalculus; 0.01 0.06 0.00 0.00 0.01 0.00 0.00 0.02 Bacteroidia;Paludibacter; 0.01 0.00 12.74 8.92 0.00 0.00 0.13 0.29 Bacteroidia;Petrimonas; 0.01 1.74 0.03 0.00 0.01 0.01 0.11 0.23 Bacteroidia;Proteiniphilum; 0.01 0.25 1.61 1.46 0.02 0.01 0.32 0.40 Bacteroidia;Rikenellaceae;vadinBC27 0.02 0.39 0.24 0.16 0.02 0.04 0.12 11.56 Bacteroidetes;SB-1; 0.00 0.00 0.03 0.07 0.00 0.00 0.01 0.18 Sphingobacteriia;WCHB1-69; 0.08 2.57 7.40 14.28 0.22 0.27 4.03 13.81 Clostridia;Christensenellaceae; 0.00 0.04 0.01 0.08 0.02 0.13 0.38 2.00 Clostridia;Proteiniclasticum; 0.01 0.00 0.03 0.00 0.00 0.00 0.02 0.00 Clostridia;Dethiosulfatibacter; 0.00 0.06 0.00 0.01 0.00 0.00 0.13 0.74 Clostridia;Acetobacterium; 0.00 0.00 0.03 0.04 0.03 0.03 0.06 0.37 Clostridia;Tissierella; 0.10 0.19 0.03 0.00 0.07 0.05 0.26 0.20 Clostridia;Acidaminobacter; 0.00 0.00 7.91 4.10 0.00 0.00 0.00 0.00 Clostridia;Fusibacter; 0.01 0.01 0.24 0.23 0.01 0.06 0.85 0.46 Clostridia;Anaerovorax; 0.00 0.71 0.16 1.92 0.02 0.13 1.55 0.71 Clostridia;Lachnospiraceae; 0.04 0.09 0.06 0.16 0.00 0.01 0.08 0.00 Clostridia;Desulfitispora; 0.01 0.07 0.02 0.00 0.01 0.01 0.06 0.48 Clostridia;Syntrophomonas; 0.06 3.72 0.01 0.00 0.00 0.00 0.00 0.00 Alphaproteobacteria;Magnetospirillum; 0.00 0.00 0.84 0.91 0.03 0.04 0.28 0.02 Betaproteobacteria;Thauera; 2.06 10.53 1.12 0.59 16.04 11.76 21.22 0.72 Deltaproteobacteria;Desulfuromonadales; 0.01 0.00 39.21 2.21 0.00 0.00 0.00 0.00 Gammaproteobacteria;Shewanella; 0.03 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Gammaproteobacteria;Pseudomonas; 96.99 73.82 0.14 0.11 83.15 86.44 58.53 2.18 Gammaproteobacteria;Thiomicrospira; 0.04 0.02 0.01 0.01 0.01 0.00 0.01 0.01 Spirochaetes;LNR_A2-18; 0.00 0.00 0.01 0.34 0.00 0.00 0.00 1.53 Spirochaetes;Spirochaeta; 0.19 3.16 2.82 5.24 0.12 0.34 1.22 16.32 Spirochaetes;Treponema; 0.00 0.08 0.01 0.07 0.00 0.00 0.00 0.02 Tenericutes;Acholeplasma; 0.15 1.70 4.97 23.05 0.16 0.56 10.42 47.23 Tenericutes;Mollicutes;EUB33-2; 0.00 0.28 19.26 34.00 0.00 0.00 0.00 0.00

255

Appendix D: Supplementary Material for Chapter Six: Microbial and chemical analysis of samples from three North Sea

platforms

Table S6-1: Enumeration of active microbes present in produced water samples carried out on-site.

Well Temp pH H2S tAPGHB htAPGHB (˚C) (ppm) tSRB (60°C) tGHB (60°C) (60°C) htSRB (80°C) htGHB (80°C) (80°C) cells per mL cells per mL cells per mL cells per mL cells per mL cells per mL P1_1-1 60 7 < 2.5 < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ P1_2-2 76 7 < 2.5 < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ < 0.3 x 10⁰ 9.5 x 10⁰ < 0.3 x 10⁰ P1_4-2 68 7 < 2.5 < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ P2_2-3 72 7 100 P2_3-5 62 7 120 P2_4-4 55 7 118 < 0.3 x 10⁰ 9.5 x 10⁰ < 0.3 x 10⁰ 0.4 x 10⁰ 2.5 x 100 < 0.3 x 10⁰ P3-10 95 7 < 2.5 < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ < 0.3 x 10⁰ 2.5 x 102 < 0.3 x 10⁰ P3-12 72 7 < 2.5 < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ P3-14 32 7 < 2.5 < 0.3 x 10⁰ 2.5 x 102 < 0.3 x 10⁰ NA NA NA P3-16 83 7 < 2.5 < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ < 0.3 x 10⁰ 2.5 x 10⁰ < 0.3 x 10⁰ t- thermophilic; ht- hyperthermophilic SRB- sulfate reducing bacteria; GHB- general heterotrophic bacteria; APGHB- acid producing general heterotrophic bacteria

256