A Specific 15-Bp TATA Box Promoter Element Is Required for Expression of a Herpes Simplex Virus Type 1 Late Gene

Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

A specific 15-bp TATA box promoter element is required for expression of a herpes simplex virus type 1 late gene

Fred L. Homa, 1,4 Joseph C. Glorioso, 2,3 and Myron Levine 1,s 1Department of Human Genetics, 2Unit for Laboratory Animal Medicine, 3Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Michigan 48109-0618 USA

The herpes simplex virus type 1 (HSV-1) glycoprotein C (gC) gene is a true late or ~/2 gene in that its expression shows a strict requirement for viral DNA replication. Elements required for regulated expression of this gene were previously shown to consist of the gC TATA box, transcription start site and a large portion of the leader sequence of the gC gene. In this paper we show that transcription of the gC gene requires a 15-bp sequence, GGGTATAAATTCCGG, which contains the gC TATA box. This sequence contains specific promoter elements because replacement of this sequence with either the TATA box of the HSV-1 early thymidine kinase (tk) gene or two random TATA-Iike elements results in a transcriptionally inactive gC gene. In addition, we show that temporal expression of HSV 13 and ~/genes at early and late times during infection are controlled by separate and distinct regulatory elements; regulatory signals distal to the TATA box are needed for early expression, whereas a gC-like TATA box is needed for late expression. These signals were identified by construction of a chimeric HSV gene that contained the distal control signals of the ~ tk gene fused upstream of the TATA sequence of the ~/2 gC gene. When RNA was isolated at various times postinfection from cells infected with a virus whose genome contained this chimeric tk-gC gene, synthesis of gC mRNA showed both early and late kinetics. [Key Words: Herpes simplex virus type 1; glycoprotein C promoter; temporal gene expression; TATA box; recombinant viruses; deletion mutants] Received September 25, 1987; revised version accepted November 23, 1987.

Herpes simplex virus type 1 (HSV-1) has a double- sion. Within this sequence are elements found in many stranded DNA genome of approximately 150 kb that en- eukaryotic promoters, including a proximal TATA box codes three general classes of genes: c~ or immediate element and distal elements such as Spl-binding sites early (IE), [3 or early, and ~/or late. These genes are tran- and CAAT box homologies (McKnight and Tjian 1986). scribed by the host cell RNA polymerase II, and expres- Located far upstream of all five IE genes are varying sion is largely regulated at the level of transcription (Go- numbers of enhancer like elements bearing the AT-rich dowski and Knipe 1986; Weinheimer and McKnight consensus sequence, TAATGARATTC (Mackem and 1987). The IE genes are transcribed first and are defined Roizman 1982a, b; Cordingley et al. 1983; Preston et al. as those HSV genes that are expressed in the absence of 1984). IE transcription is stimulated by a structural com- prior de novo protein synthesis (Honess and Roizman ponent of the virus particle Vmw65 (Post et al. 1981; 1974). IE transcripts can be detected at approximately Batterson and Roizman 1983; Cordingley et al. 1983; 0.5 hr postinfection and reach peak levels-at approxi- Campbell et al. 1984; Kristie and Roizman 1984; Preston mately 2-3 hr postinfection (Harris-Hamilton and Ba- et al. 1984; Dalrymple et al. 1985; Pellet et al. 1985). The chenheimer 1985; Weinheimer and McKnight 1987). TAATGARATTC elements are required for the stimula- The transcription of IE genes is controlled by physically tion by Vmw65, which suggests that IE gene expression separable and movable promoter and regulatory se- is controlled by either direct or indirect interaction of quences (Mackem and Roizman 1982). The promoter Vmw65 with this sequence (Kristie and Roizman 1987). component is found within 110 bp upstream of the tran- Transcription of early genes requires functional IE scription start site and is absolutely required for expres- gene products (Honess and Roizman 1975). Studies with temperature-sensitive and deletion mutants have shown that the product of the oL4 gene is essential for transactivation of early promoters (Preston 1979; DeLuca et al. 1984, 1985; DeLuca and Schaffer 1985). Early transcripts 4present address: Division of MolecularBiology, The Upjohn Company, Kalamazoo, Michigan 49001 USA. can be detected at approximately 2 hr postinfection, SCorrespondingauthor. reach peak levels at 5-6 hr postinfection, and gradually

Transcriptional control of HSV late genes decrease to nearly undetectable levels late in infection cludes the gC TATA box, contains signals essential for (Harris-Hamilton and Bachenheimer 1985; Weinheimer fully regulated expression of the gC gene. We also show and McKnight 1987). The upstream regions of early that the TATA sequence of the tk gene and two random genes are less complex than those of IE genes in that TATA-like sequences are not capable of substituting for they lack enhancer like elements. The cis-acting signals the gC TATA sequence. In addition, evidence is pre- important for regulated expression of early genes have sented indicating that expression of [3 and ~/HSV-1 genes been shown to be located not more than 110 bp 5' of at early and late times during infection are controlled by early mRNA capsites (Zipser et al. 1981; Smiley et al. separate and distinct regulatory elements; the proper 1983; Halpern et al. 1984). Extensive mutational anal- DNA sequences distal to the TATA box are needed for ysis has identified four sequence elements required for early expression, whereas a gC-like TATA element is efficient expression of the HSV-1 early thymidine kinase needed for late expression. (tk) gene (McKnight et al. 1981; Zipser et al. 1981; McKnight and Kingsbury 1982; Smiley et al. 1983; Coen Results et al. 1986). These elements consist of a proximal TATA box and three upstream regions consisting of two Spl The gC promoter consists of the 15-bp sequence, binding sites separated by a CAAT box. Disruption of GGG TA TAAA TTC C G G any of these elements alters the level of tk expression. Transcription of late genes also requires functional IE We had previously described the construction of plasmid gene products and studies with temperature-sensitive pGC, which contained the entire 2.7-kb HSV-1 gC gene mutants have shown that the product of genes a4 and plus 1.3 kb of 5'-flanking sequence in a pUC18-based c,27 are essential for efficient expression of late pro- vector (Fig. 1). Using this plasmid, we constructed nine moters during infection (DeLuca and Schaffer 1985; De- deletion plasmids, pGCAI-pGCA9, in which varying Luca et al. 1985; Sacks et al. 1985). The late genes form portions of DNA were removed between bases -569 two subclasses, ~/1 and ~/2, differing in their dependence (BstEII site) and + 124 (BglII site) relative to the start of on viral DNA replication for expression. Prior to the gC transcription. These mutations were then transferred onset of viral DNA synthesis, 1-2 hr postinfection, low from plasmids into the viral genome through homolo- levels of ~/1 mRNAs can be detected while no ~2 tran- gous recombination to generate nondefective HSV-1 re- scripts are present (Holland et al. 1980). Following the combinants. The gC gene is amenable to these muta- onset of viral DNA replication, 2-3 hr postinfection, ex- tions because the gC-gene product is not required for pression of both ~1 and ~/2 transcripts increases and replication of HSV-1 in tissue culture (Heine et al. 1974; reaches peak levels at 7-8 hr postinfection and remains Holland et al. 1984a). Analysis of RNA extracted from at these high levels late in infection (Harris-Hamilton cells infected separately with each of the nine deletion and Bachenheimer 1985; Weinheimer and McKnight viruses showed that the DNA sequences required for 1987). regulated expression of this late HSV-1 gene lie within Recently we reported a study defining the cis-acting bases -34 to + 124 (Homa et al. 1986a). To further de- DNA sequences required for regulated expression of the fine the DNA sequences that comprise the gC promoter, glycoprotein C (gC) gene, a model ~/2 gene of HSV-1 six additional deletion viruses were constructed, (Homa et al. 1986a). Using a set of deletion mutant vi- A10-A15. These viruses each have deletions that re- ruses, each of which was missing varying portions of move varying portions of the -34 to + 124 sequence of DNA within bases - 569 to + 124 relative to the site of the gC promoter (Fig. 2) and were isolated by cotrans- initiation of the gC message, we showed that the DNA fecting the appropriate plasmid DNA (Fig. 1) with HSV sequences required for regulated expression of this ~/2 A2 viral DNA into Vero cells. The A2 virus contains a gene lie within bases -34 to + 124. Within the 34 bases deletion that removed bases -569 to + 124 of the gC upstream of the gC transcription start site is the TATA gene. The progeny from the transfection were then sequence located at -30. More recently, we have shown screened for the ability to hybridize with a restriction that the 63 bp between -34 and + 29 were sufficient for fragment specific for the region deleted in the a2 virus response to a-gene product activation in transient co- by an in situ hybridization screening procedure de- transfection assays (Shapira et al. 1987). Johnson and scribed previously (Homa et al. 1986a). To demonstrate Everett (1986) have also recently described the sequence that the mutant viruses recovered from each cross had requirements for properly regulated expression of the ~/2 acquired the deletion present in the input plasmid, DNA US11 gene of HSV-1. A sequence of only 31 nucleotides from deletion viruses A10-A15 were digested with SalI, 5' of the US11 mRNA start site (TATA located at -25) and the gC related fragments were analyzed by Southern was found to be sufficient for abundant expression of blot hybridization. Deleted versions of the 3700-bp US11 RNA from a replicating template. Therefore, and wild-type SalI gC fragment were present in all six iso- in contrast to ~ and [3 genes, sequences upstream of the lates, and these novel deletion-bearing fragments comi- TATA sequence are not required for regulated expres- grated with the corresponding SalI fragments of the sion of these two ~/2 genes. input plasmids (data not shown). In this paper we extend our studies on defining the Vero cells were infected separately with each of the minimum sequences of the gC promoter and show that A10-A15 mutant viruses in the presence and absence of the 15-bp sequence, GGGTATAAATTCCGG, which in- phosphonoacetic acid (PAA), a drug that blocks viral

GENES & DEVELOPMENT 41 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Homa et al.

[ t ~------~ L. I TK 0B

= ._ ._ - -

-- u~ - ~E - - 13 u~ Go Q. x ~ ~a o3 o3 I pGC I, I l 1 1 ,,~ I I I I

AUG gC mRNA

-144 to -35 pGC~8 ~ , I I I ' i ,, -144 tO +14 pGCA9 , 1 , I I I J -144 Io -35 +30 tO +124 pGC &lO I I ' I H I 1 -144 IO -24 pGc ,,,, , ~ ' I I ' J -19 IO +14 ~GC ~,2 t l I I I I I

-19 tO +124 pGC a13 t • • } I I I

19 tO +29 pac~,4 I I i I I I I

-45 tO +14 pGC ~15 I I I I I I I -144 tO +124 pGC A37TK L, I I I [] I I ' ' ' TK PROMOTER -37 Io +52 Bgl II BamHI Bgl II I I I i pGC TK l \ ~..~ I ' TK PROMOTER -750 tO +52 2.7 kb mRNA

3.5 kb mRNA

Figure 1. Structure of pGC and pGC deletion and insertion plasmids. (Top) The HSV-1 genome in the prototype arrangement, displaying the unique (straight line) and inverted repeat (boxed area) sequences of the long (L) and short (S) components. The genomic location of the tk and gB genes are shown along with the location of the 4-kb SalI-HindIII fragment present in plasmid pGC. Relevant restriction enzyme sites of the pGC insert are shown along with the location of the gC mRNA coding sequences. The extent of the internal deletions carried by plasmids pGCA8-pGCA15 are indicated by gaps, with the bases deleted from each plasmid shown above the gaps, + 1 being the nucleotide found at the 5' terminus of the gC mRNA. Plasmids pGCA8 and pGCA9 were described in detail in an earlier publication (Homa et al. 1986a). Plasmid pGCA37TK contains a deletion that removes nucleotides - 144 to + 124 of the gC gene, and in their place are sequences of the tk promoter between bases -37 and + 52. Plasmid pGC-TK, which has been described previously (Homa et al. 1986a), was derived from pGC by inserting an 800-bp BglII-BamHI fragment containing the promoter regula o tory sequences of the HSV tk gene from - 750 to + 52 into the BglII site of pGC. Details of the methods used to prepare each plasmid are described in Materials and methods.

DNA replication, and total infected cell RNA was iso- defined gC promoter between bases -34 and +124. lated 7 hr postinfection. The expression of the 2.7-kb gC Northern blots of RNA isolated from cells infected with mRNA was assayed by Northern blot hybridization, and these mutants showed a hybridizing band of the same correctly initiated gC transcripts were detected by relative size as wild-type gC mRNA for mutants A10 primer extension assay using the probes shown in Figure A12, and A13, whereas mutant All lacked any detect- 3. Transcription of the HSV-1 gB gene served as an in- able gC transcript (Fig. 4A). The A11 mutant contains a ternal control to allow standardization of infections and deletion that removes only the TATA sequence from the RNA preparations. The probes used to assay expression -34 to + 124 region and thus shows that the TATA box of gB are shown in Figure 3. The relative levels of gC is an essential element of the gC promoter. Expression of mRNA expressed from each mutant were determined by gC message from A10, A12, and A13 remained dependent comparing the ratio of counts hybridizing to the gB and on viral DNA replication (Fig. 4A). The low level of gC gC mRNAs, as described in Materials and methods. message seen in the A10 infection was not reproducible The four deletion viruses, A10-A13, each contain de- and is due to inefficient block of DNA replication in this letions that removed varying portions of the previously experiment. The level of expression of gC from A10 and

42 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Transcriptional control of HSV late genes

°34 -20 +1 +20 +40 i l i i i GGGTATAAATT••GGAAGGGGA•AcGGGCTAC••T•A•TAc•GAGGG•GCTTGGTCGGGAGG•CG•ATCGAA•G•A•ACCC•CAT•

A 610 GGGTATAAATTCCGGAAGGGGACACGGGCTACCCTCACTACCGAGGGCGCTTGGTCGGGAGGC ......

Ali ...... CCGGAAGGGGACACGGGCTACCCTCACTACCGAGGGCGCTTGGTCGGGAGGCCGCATCGAACGCACACCCCCATC

A12 GGGTATAAATTCCGG ...... GCTTGGTCGGGAGGCCGCATCGAACGCACACCCCCATC

A13 GGGTATAAATTCCGG ......

A14 GGGTATAAATTCCGG ...... CCGCATCGAACGCACACCCCCATC

A15 ...... GCTTGGTCGGGAGGCCGCATCGAACGCACACCCCCATC

Relative Levels +60 +80 +100 +120 of gC mRNA i i i i CGGTGGTCCGTGTGGAGGTCGTTTTTCAGTGCCCGGTCTCGCTTTGCCGGGAACGCTAGCCGATCCCTCGCA 610 ...... 0.82

All CGGTGGTCCGTGTGGAGGTCGTTTTTCAGTGCCCGGTCTCGGTTTGCCGGGAACGGTAGCCGATCCCTCGCA ....

A12 CGGTGGTCCGTGTGGAGGTCGTTTTTCAGTGCCCGGTCTCGCTTTGCCGGGAACGCTAGCCGATCCCTCGCA 0.46

A13 ...... 0.18

A14 CGGTGGTCCGTGTGGAGGTCGTTTTTCAGTGCCCGGTCTCGCTTTGCCGGGAACGCTAGCCGATCCCTCGCA 0.70

A15 CGGTGGTCCGTGTGGAGGTCGTTTTTCAGTGCCCGGTCTCGCTTTGCCGGGAACGCTAGCCGATCCCTCGCA ....

-140 -120 -100 -80 B -60 -40 -20 TGTGTGATGATTTCGCCATAACACCCAAACCCCGGATGGGGCCCGGGTATAAATTCCGGAAGGGGACA

+1 +20 +40

CGGGCTACCCTCACTACCGAGGGCGCTTGGTCGGGAGGCCGCATCGAACGCACACCCCCATCC

+60 +80 +100 +120

GGTGGTCCGTGTGGAGGTCGTTTTTCAGTGCCCGGTCTCGCTTTGCCGGGAACGCTAGCCGATCCCT

-40 -20 +1 i i i C A37TK GGATCCAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAG BamHI +20 +40 i = CGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCT

Bgf II

Figure 2. Nucleotide sequence of gC deletion and tk insertion mutations used in this study. (A) The DNA sequence of the gC promoter between residues -34 and + 124 are shown, and the regions of this sequence that are deleted from the A10-A15 mutants are shown by the dashed lines. The gC TATA sequence is underlined. The relative levels of gC mRNA expressed from each gC mutant, determined as described in Materials and methods, are shown on the right (KOS = 1.01. (B) The DNA sequence of the gC promoter between bases - 140 and + 124 is shown, and the sequences deleted in the A15 mutant are underlined. The boxed sequences represent random TATA-like elements. (C) The DNA sequence of the tk promoter between bases -37 and +52 with the tk TATA box underlined. This fragment was used to generate plasmid pGCA37TK (see Fig. 1).

A12 was slightly reduced relative to a KOS infection, blot analysis of RNA isolated from cells infected with whereas A13 synthesized roughly 20% of the wild-type A14 showed (Fig. 5A) that (1) the predicted 2.7-kb gC level of gC mRNA. A second independent isolate of A13 mRNA was expressed, (2) expression of gC was depen- behaved in a similar manner (data not shown). The dif- dent on viral DNA replication, and (3) the level of ferences in the sequences deleted from A10, A12, and steady-state gC mRNA was comparable to a wild-type A13 suggested that a region within the 5'-transcribed infection (Fig. 2). Because the A10, A12, and A14 dele- noncoding sequences of the gC message between bases tions together remove the same sequences as the A13 + 14 and +30 may contain signals important for quanti- deletion (Fig. 2A), these data would suggest that the de- tative., expression of gC. To determine whether there creased level of gC mRNA expressed from A13 was not were specific regulatory sequences within the gC leader due to the loss of specific DNA sequences from the gC sequence, we constructed deletion virus A 14, which was gene, but rather that the length of the leader sequence is missing the same sequences as the A12 deletion, but in important for quantitative expression of gC mRNA. addition the + 15 to +30 region was deleted. Northern Primer extension analysis to locate the 5' termini of

GENES & DEVELOPMENT 43 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Homa et al.

gC 2.Tkb gC mRNA Figure 3. Diagram of the probes used to map gC and gB (0.620) ¢0~647) Soil Bgl II Smo I EcoRI Hind III mRNA by primer extension and Northern blot analysis. Shown +1 +124 +297 +580 are a restriction map of the SalI-HindIII fragment containing // I , , i // , the gC gene and the SalI-SstI fragment containing the gB gene. --de 48 nts The numbers in parentheses represent the map unit position of I // I these restriction sites on the HSV-1 genome. The direction of 297 nts 2.0 kbp transcription of the gC and gB mRNAs and the nucleotide (:505 nts) NORTHERN number of restriction sites relative to the 5' end (+ 1) of each PROBE message are indicated. The 48-nucleotide gC and 72-nucleotide gB primers were uniquely end labeled at the Sinai and AccI restriction sites, respectively. When these primers were annealed gB 3.3kb gB mRNA to RNA isolated from KOS-infected cells and extended with re- (0.386) verse transcriptase, 297-base gC and 189-base gB primer exten- Sol I Sst I Acc I Sst I + I +40 +189 sion products should be generated. In the case of the gC recom- // , i , ,// binants, the extension product is 305 bases due to the presence of the BglII linker that was added during the construction of 72 nts plasmid pGC (Homa et al. 1986a). The linker adds eight nu- 189 nts cleotides to the 5' noncoding region of the gC mRNA. To detect I gC and gB transcripts on Northern blots, the indicated restric- ~8 kbp tion fragments were 32P-labeled by nick translation, as de- NORTHERN scribed by Holland et al. (1984b). PROBE gC transcripts synthesized by A10-A14 resulted in dis- on the gC-CAT plasmids, high levels of CAT activity crete extension products at approximate lengths, respec- could be induced after cotransfection with pSG1. How- tively, of 210, 279, 170, and 266 nucleotides (Figs. 4B and ever, when the gC TATA box and transcription start site 5B). The A10 extension product was the predicted size were deleted, no induction was seen after cotransfection for transcription initiation at the wild-type gC transcrip- with pSG1. This assay was used to examine several of tion start site. The difference in the size of the A10 the gC promoter deletions presented in this paper, and primer extension product when compared to wild-type the construction of these gC-CAT plasmids are de- gC mRNA can be accounted for by the deletion of 5'- scribed in Materials and methods. When cells were transcribed noncoding sequences in A 10. The A 12-A 14 transfected with pGC-CAT alone, which contained se- primer extension products correspond to a gC transcrip- quences of the gC promoter from -1200 to + 124, the tion start site located 30 bases downstream from the gC resulting cell extracts contained only low levels of CAT TATA sequence and reflect RNA molecules bearing 5' activity (Fig. 6). This low level of activity was increased termini that map to a position formerly occupied by nu- approximately 15-fold when pSG1 was included in the cleotide + 1 of the gC structural gene. Thus, information transfection (Fig. 6). Similar levels of induction were capable of dictating the site of transcription initiation is seen with &10CAT, A12CAT, and &13CAT, whereas retained even after deletion of the wild-type gC tran- only background levels of CAT activity were detected scription start site and 19 additional 5'-flanking nucleo- with AllCAT (Fig. 6). The common sequence retained tides. The results of infections with deletion viruses by the A10-A13 plasmids, which was missing from the A10-A14, therefore, showed that sequence elements All plasmid, was the 15-bp sequence, GGGTA- necessary for fully regulated expression of the gC gene TAAATTCCGG (Fig. 1). These findings corroborate the lie between bases -34 and - 19. This 15-bp region con- results obtained with the gC deletion viruses and show tains the TATA homology. that the gC promoter consists of a small sequence around and including the gC TATA box. Sequences responsive to transactivation by the IE gene products ICP4 and ICPO reside within the 15-bp gC Will other TATA sequences substitute for the gC TA TA sequence TA TA ? Previously we showed that the cloned IE gene products The experiments described in the preceding section ICP4 and ICP0 from HSV-1 stimulate the gC promoter show that the 15-bp sequence GGGTATAAATTCCGG in short-term transfection experiments (Shapira et al. is required for fully regulated expression of the HSV-1 ~/2 1987). In these experiments, the wild-type gC promoter gC gene. This sequence contains the consensus TATA and several deletion variants were linked to the bacterial homology. To examine whether other TATA-like se- chloramphenicol acetyltransferase (CAT) gene. These quences were capable of substituting for the gC TATA plasmids were then transfected into mouse LTK- cells sequence, two additional viral constructs were studied. in the presence or absence of a second plasmid, pSG1, The first virus, A37TK, contained a chimeric tk-gC gene which contained the ICP4 and ICP0 genes. The results in which sequences of the promoter for the HSV-1 tk showed that as long as 34 bp upstream and 29 bp down- gene between bases -37 and +52 replaced those of the stream from the gC transcription start site were retained gC promoter between bases - 146 and + 124 (Fig. 1). A

44 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Transcriptional control of HSV late genes

344

Ira8

154

. 3235 ...gB 267O -~C 75

1690

1125

PAA

Figure 4. Analysis of transcripts produced by wild-type and A10-A13 mutant virus infections. RNA was isolated 7 hr postinfection from KOS- and A10-through A13-infected cells maintained in medium containing 400 ~g/ml of PAA or in drug-free medium. (A) Autoradiographic exposure of a Northern blot used to detect gC and gB specific mRNA. RNA (10 ~g) isolated from cells infected with the indicated virus was denatured with glyoxal, size fractionated on a 1% agarose gel, and transferred to GeneScreen Plus (NEN/Du- pont). The blot was hybridized with a mixture of the gC and gB probes shown in Fig. 3. The positions of the gC and gB mRNAs are indicated. Single-stranded DNA size markers were derived from a mixture of restriction digests from pBR322 DNA (Holland et al. 1984b), and these were detected by including pBR322 DNA, 32P-labeled by nick translation in the hybridization mix (lane M). Their sizes in nucleotides are shown at left. (B) Autoradiographic exposure of a 6% DNA sequencing gel used to map gC- and gB-specific primer extension products. RNA (10 ~g) prepared from cells infected with the indicated virus was annealed to the gC and gB primers shown in Fig. 3 and extended with reverse transcriptase. The locations of the gB (large arrow) and gC (small arrows) primer extension products are indicated. End-labeled, HinfI-digested pBR322 DNAs served as size markers (lane M). Their sizes in nucleotides are shown at left. The four lanes on the right are Maxam and Gilbert (1980) sequencing reactions of the 500-bp BglII-PstI fragment of plasmid pGCA12 (see Fig. 1) 5' end labeled at the BglII site.

TATA-box is located at position -27 to -21 of the tk A15, no gC-specific mRNA could be detected on a gene (Fig. 2C), and it has been shown to be essential for Northern blot (Fig. 7). These results showed that the gC efficient expression of tk during infection (Coen et al. TATA sequence contained specific promoter elements 1986). A37TK virus was isolated by cotransfecting not found in a similar region of the tk promoter or in plasmid pGCA37TK with HSV-1 A2 DNA into Vero other random TATA-like sequences found in the HSV-1 cells and the resulting recombinant contained the chi- genome. meric tk-gC gene at the gC locus. The A15 virus contained a deletion that removed bases -45 to + 14 of the Construction and expression of a recombinant virus gC gene (Figs. 1 and 2A). This deletion removed the gC containing a chimeric gene in which the distal control TATA sequence. Located at approximately -105 and signals of a f~-gene promoter were fused upstream of a -120 of the wild-type gC gene are two TATA-like se- ~/2 TATA box quences, which read AATAAA and ATATA, respectively (Fig. 2B). If either of these two sequences was ca- To examine the effect of B-regulatory sequences on ex- pable of functioning as a late promoter, it would be expression of gC as a 72 gene, we constructed a virus in pected that the -45 to +14 deletion would not which the distal control signals of the HSV tk gene were appreciably alter expression of a gC-related mRNA. fused upstream of the gC TATA sequence. The con- When cells were infected with either A37TK or with struction of this chimeric gene is shown in Figure 8.

GENES & DEVELOPMENT 45 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Homa et al.

~O(9OO 0 0 0 (9 (9 O ~" ¢q 03 O < < < < + + + + + - cotransfection with ICP4 + ICPO

li g~ O 4 Q g 1,' .ram 15 7 1 10 9 1 relative CAT act i vity

Figure 6. CAT assays of wild-type and mutant gC-CAT plasmids after cotransfection with an ICP4 + ICP0-containing plasmid. LTK- cells were cotransfected with equimolar amount of the indicated CAT plasmids and with plasmid pSG1 (Goldin et al. 1981), which contains both the ICP4 and ICP0 genes of HSV-1. Cells were harvested 40 hr post-transfection, extracted, and assayed for CAT activity. The CAT activity is expressed relative to a transfection of pGC-CAT alone.

PAA promoter that contained the TATA/transcription start Figure 5. Analysis of transcripts produced by wild-type and site of the ~/2 gC gene and the upstream controlling A14 mutant viruses. RNA was isolated 7 hr postinfection from signals of the early tk gene. The chimeric tk-gC gene KOS- and a 14- infected cells maintained in medium containing present in pGCA8LS-45 was transferred into the viral 400 t~g/ml PAA or in drug-free media. (A) Autoradiographic ex- genome by cotransfecting Vero cells with intact HSV-1 posure of a Northern blot used to detect gC- and gB-specific A2 DNA and SalI-digested pGCA8LS-45 DNA. The mRNA. RNA (10 ~g) isolated from cells infected with the indi- progeny from this contransfection were then screened by cated viruses was treated and probed as described in the legend to Fig. 4A. The positions of the gC and gB messages are indi- the viral plaque hybridization procedure using a probe cated. Sizes in nucleotides are indicated at left. (B) Autoradio- specific for the region deleted in the A2 virus. Because graphic exposure of a 6% DNA sequencing gel used to map gC- the tk sequences present in pGCA8LS-45 are flanked by and gB-specific primer extension products. RNA (10 ~g) isolated from cells infected with the indicated virus was annealed to the gC and gB primers shown in Fig. 3 and extended with I-" reverse transcriptase. The locations of the gB (large arrow) and gC (small arrows) primer extension products are indicated. End- o~,, ~< co < labeled, HinfI-digested pBR322 DNAs served as size markers. Their sizes in nucleotides are shown at left. The four lanes on 4362 the right are Maxam and Gilbert (1980) sequencing reactions of the 500-bp BglII-EcoRI fragment of plasmid pGC (see Fig. 1) 5' 3235 end labeled at the BglII site. 2670 Starting with atk linker scanning plasmid, pLS-47/-37 (McKnight and Kingsbury 1982), in which a 10-bp BamHI linker replaced the wild-type tk promoter se- 1690 quences between bases -47 and -37, the 450-bp BamHI-HindIII fragment of this plasmid was blunt-end 1125 ligated into the XhoI site of the plasmid pGCA8. This yielded plasmid pGCA8LS-45, in which the distal con- Figure 7. Northern blot hybridization of RNA isolated from trol sequences, as defined by the GGGCGG sequence at wild-type-, A15-, and A37TK-infected Vero vells. RNA (10 ~g) -50 and the CCGCCC sequence at - 100, of the tk pro- isolated 7 hr postinfection from cells infected with the indi- moter were fused upstream of the gC TATA box. cated virus was treated and probed as described in the legend to Plasmid pGCA8LS-45, therefore, contained the struc- Fig. 4A. The positions of the gB and gC messages are indicated. tural sequences of the gC gene under the control of a Sizes in nucleotides are indicated at left.

46 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Transcriptional control of HSV late genes

-= ~ LS-47/- 37 TK F-- mRNA --,,- _

I',~ -I00 -50 -38 -25 *I 1 . I ' l I pB-R- /'--CCGCCC GGGCGG-CC~GATCCGG--ATATTA ACAC--"//--~- p'BR

BomHI gC _ pGCA8LS-45 = F- mRNA---~ ._ -96 -46 -30 * I I .L ...... I

...... : :::::::::: , pUG gC _= pGCA8 N F mRNA---.- ,~. -30 *l T ...... I ...... I ......

~ U C ...... p U C Xh~

Figure 8. Scheme used to construct recom- ,* ? binant virus A8LS-45. (Top) Plasmids pLS-47/ =4 -37 and pGCA8 contain the HSV-1 tk and gC genes, respectively. These plasmids were if) used to generate the tk-gC chimeric gene contained in plasmid pGCA8LS-45, and details of how this was done are described in the text. The open boxed areas represent tk sequences, and the stippled boxed areas represent gC seqeunces. After cotransfection of HSVA2 DNA with a SalI digest of pGCA8LS- 45, in situ hybridization screening yielded virus, A8LS-45. (Bottom) Southern blot analysis of A8LS-45. Viral DNA (10 }xg) isolated from KOS-, A2-, and &8LS-45-infected cells, along with pGCA8LS-45 plasmid DNA, was digested with SalI, size-fractionated on a 0.8% agarose gel, and transferred to Gene- Screen Plus. Identical blots were hybridized with 32P-labeled probes. (A) To detect gC-specific bands, the probe was the 3.7-kb SalI fragment of plasmid pGC (see Fig. 1). (B) To detect tk-specific bands, the probe was the 450-bp BamHI-HindlII fragment of plasmid pLS-47/-37. EcoRI-HindIII digests of bacte- I I riophage X DNA served as size markers. Sizes A B in nucleotides are shown at left.

gC sequences, homologous recombination would result cell mRNA was isolated 7 hr postinfection. Northern in the insertion of the chimeric tk-gC gene into the gC blot analysis of these RNA samples [Fig. 9A)established locus of the A2 viral genome. To demonstrate that the that gC was expressed in the absence of viral DNA syn- A8LS-45 virus had acquired the input mutation, viral thesis from the A8LS-45 infection, whereas gC was not DNA was digested with SalI, and the gC- and tk-con- expressed from the KOS infection under the same condi- taining fragments were analyzed by Southern blot hy- tions. Primer extension analysis (Fig. 9B) demonstrated blidization {Fig. 8). When the probe used was specific for that the 5' terminus of the gC mRNA of A8LS-45 was gC sequences, only a single hybridizing band was de- identical to that of RNA isolated from either the gC detected for the A8LS-45 viral DNA, and this band comi- letion virus A8 or from a wild-type infection. The differ- grated with the plasmid pGCA8LS-45 SalI fragment (Fig. ence in size of the gC primer extension product for KOS 8A). When the probe was specific for tk sequences, two when compared to A8 and A8LS-45 can be accounted for hybridizing bands were detected for A8LS-45 (Fig. 8B). by the presence of an 8-bp BglII linker added to the 5'- The higher-molecular-weight band corresponded to the transcribed noncoding region of the gC gene during the wild-type tk gene, whereas the lower-molecular-weight construction of plasmid pGCA8 (see Fig. 1). These re- band corresponded to the tk-gC gene located at the gC sults clearly demonstrate that the presence of the distal locus. control sequences of the tk gene upstream from the gC Cells were infected separately with A8LS-45 and KOS TATA box is sufficient to negate the DNA replication in the presence and absence of PAA, and total infected requirement for expression of gC.

GENES & DEVELOPMENT 47 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Homa et al.

levels of tk then declined steadily from 7-18 hr postin- B ~m, O fection. The 2.7-kb gC mRNA was not detected until O 4-5 hr postinfection, reached peak levels at 10 hr, and 396 remained at high levels through 18 hr. The time course data reflect the DNA inhibition data presented above in 344 ~ that an early gene such as tk was expressed prior to the onset of DNA replication {-2-3 hr postinfection), -.,gC whereas a ~/2 gene such as gC was not expressed until ) after the onset of DNA replication. The time course also demonstrates a point not apparent in the DNA inhibition data, that is, the down regulation of the f~ tk gene 2 1 late in infection. The difference in the levels of the early tk and late gC a8LS-45 KO S A M + + - PAA messages at late times during infection suggests a mech- ~gB anism to turn down early gene transcription without af- fecting late gene expression. This could be by (1) having B 154 factors that bind upstream sequences that enhance tran-

KOS 4362 ~ 4362

3235 ~gB 3235 26/O ..,gc 2670 -..,gC 75

~TK 1690 1125 e. M 1125

Figure 9. Analysis of transcripts produced by wild-type and A8LS-45 mutant virus infections. RNA was isolated 7 hr pos- 3235 tinfection from KOS- and/~8LS-45-infected cells maintained in 267O medium containing 400 ~g/ml PAA or in drug-free medium (A) Autoradiographic exposure of a Northern blot used to detect m -,~TK gC- and gB-specific mRNA. RNA {10 ~g) isolated from cells in- 1125 fected with the indicated virus was treated and probed as described in the legend to Fig. 4A. The positions of the gC and gB 2 3 4 6 7 10 12 14 16 18 messages are indicated. Sizes in nucleotides are indicated at left. (B) Autoradiographic exposure of a 6% DNA sequencing ~GC gel used to map gC- and gB-specific primer extension products. RNA (10 tzg) isolated from cells infected with the indicated 4362 ~ virus was annealed to the gC and gB primers shown in Fig. 3 3235 ~gC -3.5kb and extended with reverse transcriptase. The locations of the 2570 .... RNAs (10 ~g) isolated To determine the kinetics of accumulation of transcripts at various times postinfection from cells infected with the indi- during a normal infection, we isolated total infected cell cated viruses were denatured in glyoxal, size-fractionated on a RNA hourly from 2 to 7 and at 10, 12, 14, 16, and 18 hr 1% agarose gel, and transferred to a nylon membrane. The blots postinfection from KOS- and/~8LS-45-infected cells. The were hybridized with a mixture of a2P-labeled gC- and tk-specific probes. The gC probe is the 2.0-kb EcoRI-HindIII fragment RNA was electrophoresed and analyzed by Northern shown in Fig. 3, and the tk probe consisted of a 1700-bp Sinai blot hybridizaton using a mixture of two 32p-labeled fragment isolated from a Sinai digest of plasmid pX1 (Enquist et probes, one specific for the ~/2 gC gene and one specific al. 1979). This fragment extends approximately 500 bp 5' and for the [~ tk gene (Fig. 10). In the KOS infections, the 1200 bp 3' of the tk transcription start site. The size markers 1.5-kb tk message was first detected at 2 hr and accumu- are the same as those in Fig. 4A {lane M). Their sizes in nucleo- lated to maximum levels at 5-6 hr postinfection. The tides are shown at left.

48 GENES& DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Transcriptional control of HSV late genes scription at early times but are either absent or inhibited ~/2 gene from the gC promoter, suggesting that the domi- at late times, (2) the function of the factors that bind nant effect on gene expression is the nature of the cis- upstream sequences being altered at late times causing acting transcriptional signals and not the sequence of inhibition of early gene expression, or (3) expression late the message. during infection being dependent on the presence of a gC-like TATA sequence. In the A8LS-45 infection, the Discussion pattern of accumulation of the 1.5-kb tk message was similar to that of the KOS infection (Fig. 10). However, Previously, using a series of recombinant HSV viruses, the pattern of accumulation of the 2.7-kb gC message we showed that the cis-acting regulatory elements of the was different in that the message was expressed early, as HSV-1 "/2 gC gene resides within a 158-bp sequence. This well as late, in infection. The presence of the tk up- sequence is comprised of 34 bp upstream and 124 bp stream control signals that were cis- dominant early in downstream from the transcription start site of the gC infection, as demonstrated by the DNA inhibition data gene. These results demonstrated that sequences located described above, did not affect the late pattern of expres- upstream from the gC TATA box are not required for sion of the gC gene from A8LS-45. This would indicate regulated expression of this true late HSV gene. In the that the upstream signals function independently of the present study, we have extended this work and show downstream TATA signals present in this chimeric gene that only a very short stretch of 5' flanking sequence is and would suggest that the upstream signals function to required for synthesis of gC mRNA. The 15-bp sequence allow early expression, whereas the downstream signals GGGTATAAATTCCGG located between bases -34 allow late expression. The difference in the pattern of and - 19 of the gC promoter, contains signals that deter- expression of the wild-type tk and gC genes would there- mine the 5' end of the gC message and signals that fore be due to the lack of functional upstream transcrip- maintain the stringent requirement on viral DNA repli- tion control signals in the gC promoter and the lack of a cation for expression of this gene. We have also shown in specific TATA promoter element in the tk promoter. short-term transfection experiments that this 15-bp se- It could also be argued that the difference in the pat- quence contains signals responsive to transactivation by tern of expression of the tk and gC genes is not due to the viral IE gene products, ICP4 and ICP0. down-regulation of the tk promoter but to specific degra- The lack of requirement for sequences distal to the dation of the tk message late in infection. To examine TATA box appears to be a general property of HSV "/2 this, we looked at the kinetics of accumulation of tk and promoters. Johnson and Everett (1986)have recently gC transcripts from a recombinant virus, ~GC, described shown that the promoter for the ~2 US11 gene simply previously (Homa et al. 1986a). This virus was con- consists of a TATA box and transcription initiation site. structed by cotransfecting plasmid pGC-TK (Fig. 1) with We find similar results with the ~/2 glycoprotein H (gH) HSV-1 DNA, and the resulting recombinant virus con- promoter (F. Homa, unpubl.). Thus, true late promoters tained a gC gene in which the wild-type tk promoter- do not require binding sites for cellular transcription regulatory sequences were inserted in the correct tran- factors such as Spl and CAAT, which have been shown scriptional orientation between the gC transcription to be important elements in the promoters of IE and start site and the coding sequences of the gC gene. early HSV genes (McKnight and Kingsbury 1982; Jones Primer extension analysis of RNA isolated from cells in- and Tjian 1985). In most eukaryotic promoters, the fected with ~GC showed that the tk-gC fusion gene TATA box is an important regulatory element for posi- present in this virus was transcribed from the tk pro- tioning the start site of transcription. In the case of an moter and that expression of gC was not dependent on HSV infection, the TATA box appears to be the only pro- virual DNA replication (Homa et al. 1986a). When the moter element of true late genes. time course of gC expression from this recombinant was One of the mutant viruses, A13, that retained the examined, two gC-related transcripts were observed (Fig. GGGTATAAATTCCGG sequence accumulated less 10). The first transcript of approximately 2.7 kb was the than 20% of the wild-type levels of gC message. The A13 message we detected in the primer extension experi- deletion removed all but 14 bases of the noncoding se- ments and corresponded to mRNA expressed from the quences of the gC message, raising the possibility that tk promoter (see Fig. 1). The second transcript of approx- sequences within the leader might be important for de- imately 3.5 kb corresponded to mRNA originating from termining the level of expression of gC message. Al- the wild-type gC promoter (see Fig. 1). The difference in though we cannot rule out this possibility completely, size of the two transcripts was due to the insertion of the the results obtained with deletion viruses A10, A12, and 800-bp tk-promoter-containing fragment into the 5'- A14--whose deletions taken together remove the same transcribed noncoding region of the gC gene, such that sequences as the A13 deletion--suggest that the length transcripts initiating from the wild-type gC promoter and not a sequence in the gC leader is important for the contained these additional sequences. The time course quantity of gC transcripts. This conclusion is consistent of the f~GC infection shows that the 2.7-kb mRNA was with the transient expression experiments of Blair et al. expressed with kinetics similar to that of the wild-type (1987), which showed that in infected cells stabilization tk gene, whereas the pattern of expression of the 3.5-kb of CAT transcripts, driven by the promoter for the HSV mRNA was similar to the wild-type gC gene. Thus, gC Vmw65 gene, is mediated by sequences located in the was expressed as a [3 gene from the tk promoter and as a 5'-transcribed noncoding region and that, in addition,

GENES & DEVELOPMENT 49 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Homa et al. the longer the leader was, the more stable the message. TATA box or two random TATA-like sequences were Late genes form two subclasses, ~/1 and ~2, differing in not capable of substituting for the gC promoter indicates their dependence on viral DNA replication for expres- that specific signals are needed for a TATA sequence to sion. Inhibition of viral DNA replication causes a mod- be recognized by RNA polymerase II as a ~/2 promoter. erate reduction in the accumulation of ~l mRNAs, Visual comparison of TATA sequences for several early whereas ~2 mRNAs are not detected in the absence of and late HSV genes did not reveal any obvious differ- viral DNA synthesis. High levels of both ~/1 and ~2 ences or similarities that might account for one se- mRNAs can be detected at late times in infection, quence functioning as a ~2 promoter and another not. whereas accumulation of most early mRNAs declines Presently, we are attempting to decipher the signals late during infection. In this paper we have shown that needed to specify a TATA box as a ~/2 promoter by point insertion of the distal control signals of the tk promoter mutagenesis. upstream from the gC TATA box negated the DNA rep- What is the mechanism of activation of late gene ex- lication requirement for expression of the gC gene. The pression in HSV-infected cells? Nuclear runoff tran- rate of accumulation of gC transcripts from this chi- scription assays have yielded conflicting results con- meric tk-gC promoter remained at high levels late cerning the role of viral DNA replication in expression during infection. Thus, gC was expressed with kinetics of ~2 genes. Godowski and Knipe (1986) have reported similar to that of a ~/1 gene under these conditions. We that transcriptional induction of the ~/2 gC gene was de- conclude from this that the difference in the pattern of pendent on viral DNA replication. In contrast, Wein- expression during infection between early and late HSV heimer and McKnight (1987)have reported that activa- genes is largely determined by the nature of the cis- tion of late gene transcription precedes viral DNA repli- acting DNA sequences contained within their respective cation, suggesting that post-transcriptional events play promoters. For a gene to be expressed early during infec- an important role in the production of stable late tran- tion (prior to the onset of DNA replication), it must con- scripts. The results of infections with recombinant virus tain the proper cis-acting distal signals such as Spl- or A8LS-45 indicate that accumulation of mRNA synthe- CAAT-binding sites, whereas for a gene to be expressed sized from the ~/2 gC gene is not regulated post-transcrip- at late times it must have a gC-like TATA sequence. If tionally. Without altering transcribed seqences of the gC this model were to apply to all early and late HSV genes, gene, this virus produced stable gC mRNA prior to the we would predict that any gene expressed at high levels onset of viral DNA synthesis. Post-transcriptional regulate during infection should have a TATA box that can lation would more likely involve specific sequences act as a ~/2 promoter in the absence of its upstream se- found in the transcribed region. The A8LS-45 results quences. This model is supported by the following ob- would also argue against a repressor model for inhibition servations with the promoters of two HSV genes whose of late gene transcription at early times during infection, transcripts are expressed at high levels late during infec- as has been suggested previously (Homa et al. 1986a; tion. First, Johnson and Everett (1986) have shown that Mavromara-Nazos et al. 1986). However, late promoters the TATA box/initiation region of the glycoprotein D can be activated by IE proteins in the absence of viral promoter, when linked to an HSV origin of replication DNA replication in transfection experiments (Mavo- and transfected into cells, could function as ~2 promoter mara-Nazos et al. 1986; Shapira et al. 1987). Thus, late following superinfection with HSV. Second, we have genes are differentially regulated, depending on their ge- data showing that the TATA box/initiation region of the nomic environment, which suggests that transcription gB gene can substitute for the gC promoter in a recombi- of ~/2 genes resident in the viral genome may require ad- nant viral construct (F. Homa, unpubl.). ditional factors. A plausible model is that activation of In additon to the requirement for viral DNA syn- ~/2 genes is associated with specific compartments thesis, expression of ~/2 genes is also dependent on the within the nucleus of infected cells. Knipe et al. (1987) availability of functional a4 and oL27 proteins (DeLuca have shown that the major transactivating IE protein, and Schaffer 1985; DeLuca et al. 1985; Sacks et al. 1985). ICP4, appears in a diffuse nuclear distribution early in The data presented in this paper show that the activa- infection. ICP4 later localizes to large globular struction of the ~/2 gC promoter by IE gene products is me- tures in the nucleus, and this redistribution is dependent diated via the gC TATA box. Because the TATA box is a on viral DNA replication. These compartments also binding site for host cell RNA polymerase II transcrip- contain the HSV major DNA-binding protein, ICP8. tion factors (Parker and Topol 1984; Sawadogo and ICP4 and ICP8 promote transcription and DNA replica- Roeder 1985), IE gene products might increase the ac- tion, respectively, so these compartments may serve as tivity of a TATA box factor or otherwise alter the ac- sites for viral DNA replication and late gene transcrip- tivity of a transcription factor that must interact with a tion. TATA box factor. Evidence for such a mechanism has Finally, the 15-bp gC promoter defined in this study is been demonstrated for activation of the adenovirus EIB the smallest sequence we are aware of that will effi- gene by the product of the adenovirus IE gene, EIA (Wu ciently serve as an RNA polymerase II promoter. Due to et al. 1987). its simplicity, the gC promoter should prove to be a very Not all TATA sequences are functionally equivalent, useful template for studies concerning the mechanisms as we showed with recombinant viruses A37TK and A15. by which transcription factors control the initiation of The finding that DNA fragments containing the tk transcription.

50 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Transcriptional control of HSV late genes

Materials and methods genome as described previously (Homa et al. 1986a). Each mutant plasmid was cotransfected separately with &2 viral DNA Cell and virus stocks into Vero cells. The resulting virus stocks were screened for HSV-1 virus stocks were grown and titered on Vero cells as de- ability to hybridize with a restriction fragment specific for the scribed previously (Holland et al. 1983). The properties of region deleted in the &2 virus by an in situ viral plaque hybrid- HSV-1 strain KOS (KOS321) and the gC mutants 42, 47, 48, ization procedure (Homa et al. 1986a). The 42 virus contains a and ~GC have been described elsewhere (Holland et al. 1983; deletion that removes sequences of the gC gene between bases Homa et al. 1986a,b). - 569 and + 124 relative to the 5' terminus of the gC mRNA. Each of the plasmids used in the cotransfections contains a portion of the sequences deleted from the 42 virus. To demon- Plasmid constructions strate that the mutant viruses recovered from each transfection Construction of pGC and pGC-TK were described previously had acquired the deletion present in the input plasmid, viral (Homa et al. 1986a). The pGC deletion constructs pGCA8 and DNA isolated from cells infected with each mutant was di- pGCA9 were also described previously (Homa et al. 1986a) and gested with SalI, and the gC-related fragments were analyzed by contain deletions that remove bases -144 to -35 (A8) and Southern blot hybridization as described previously (Homa et - 144 to + 14 (A9) of the gC promoter; each has an XhoI linker al. 1986a). at the point of the deletion (Fig. 1). The pGC deletion constructs pGCA10-pGCA15 were derived in the following manner, pGCA10 was constructed by cleavage of pGCA8 with Analysis of RNA HaeIII followed by ligation of BglII linkers to the blunt-ended Vero cells grown in T-150 flasks were infected at a multiplicity fragments generated by this enzyme. The sample was then of 10pfu/cell, and total cellular RNA was prepared by the pro- cleaved with XhoI and BglII and size-fractionated on a 10% cedure of Chirgwin et al. (1979), as modified by Maniatis et al. polyacrylamide gel. XhoI-BglII fragments of approximately (1982). For drug inhibition studies, cells were maintained in 60-65 bases were recovered from the gel and ligated to pGC48 medium containing 400 ~g/ml of PAA continuously from 1 hr DNA that was cleaved with XhoI and BglII. The resulting before infection until extraction, as described previously (Homa plasmid contains a double deletion of sequences between - 144 et al. 1986a). Northern blot and primer extension analysis was and -35 and between +30 and +124 (Fig. 1). pGCAI1 was performed as described previously (Homa et al. 1986a), using constructed by Bal31 nuclease digestion of XhoI-cut pGC. Fol- the nick-translated or 5' end-labeled DNA probes shown in lowing the addition of XhoI linkers and digestion with XhoI and Figure 3. The relative levels of gC mRNA expressed from each BglII, the sample was size-fractionated on an 8% polyacryl- gC mutant were determined as described previously (Homa et amide gel. XhoI-BglII fragments of approximately 150 bp were al. 1986a). Northern blots of RNA isolated 7 hr postinfection recovered and ligated to pGCA8 vector DNA cleaved with XhoI were hybridized with a mixture of the gC and gB probes, and and BglII. pGCA12 and pGCA15 were constructed by Bal-31 regions of the membrane corresponding to gC and gB mRNAs nuclease digestion of EcoRI-cut pFH60. Following addition of were removed and counted. By comparing the ratio of the XhoI linkers and digestion with XhoI and PstI, the sample was counts hybridizing to the gB and gC mRNAs, we were able to size-fractionated on a 5% polyacrylamide gel. Fragments of ap- quantitate the abundance of gC mRNA and assess the tran- proximately 300-400 bp were recovered from the gel and li- scriptional efficiency of each deletion mutant relative to that of gated to pGC49 vector DNA cleaved with XhoI and PstI. pFH60 a wild-type infection. contains the 3700-bp SalI T fragment (map units 0.620-0.647) of KOS DNA cloned in pBR322 (Holland et al. 1984a). This fragment differs from the pGC insert in that it does not contain CAT plasmids and CAT assays the BglII and XhoI restriction enzyme sites found in pGC. The gC-CAT plasmids pGC-CAT and pGC-A 10CAT through pGCA13 was constructed by cleaving pGCA12 with XhoI and pGC-A13CAT were constructed by inserting the 1.6-kb BglII- BglII, repairing the protruding ends with T4 polymerase and li- HindIII fragment of plasmid pSVOCAT-BH (Shapira et al. 1987) gation to recircularize the plasmid, pGCA14 was constructed into the BglII-HindIII site of the appropriate pGC plasmid by cleaving pGCA8 with HaeIII followed by ligation of XhoI shown in Figure 1 such that the coding sequences of the CAT linkers to the blunt-ended HaeIII fragments. The sample was gene replaced the gC coding sequences. Transfections and in then digested with XhoI and BglII and size-fractionated on a vitro assays for CAT activity were conducted as described pre- 10% polyacrylamide gel. XhoI-BglII fragments of approxi- viously (Shapira et al. 1987). mately 100 bp were recovered from the gel and ligated to pGCA12 DNA digested with XhoI and BglII. The extent of the deletions present in pGC410-pGC415 were resolved to the nucleotide level by DNA sequencing (Maxam and Gilbert Acknowledgments 1980). pGC437TK was constructed by using the BamHI-BglII frag- We thank Barbara Myszkiewicz Sullivan for help with the CAT ment from plasmid pLS-47/-37 (McKnight and Kingsbury 1982), experiments and for helpful comments during the writing of which contains sequences extending from approximately - 37 this manuscript, and Alexandra Krikos for suggestions, criti- to + 52 relative to the tk mRNA start site. This 89-bp fragment cism on experimental methods, interpretations of this work, was inserted in the correct transcriptional orientation into the and for critical reading of this manuscript. This work was sup- BglII site of pGCA3, a pGC deletion plasmid in which bases ported by U.S. Public Health Service grants AI17900, AI18228, RR00200, and GM34534 from the National Institutes of - 146 to + 124 of the gC promoter was deleted (Homa et al. 1986a). Health.

Isolation of recombinant viruses References Mutations were transferred from plasmids into the viral Batterson, W. and B. Roizman. 1983. Characterization of the

GENES & DEVELOPMENT 51 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Homa et al.

herpes simplex virion-associated factor responsible for in- glycoprotein-specific monoclonal antibodies. L Virol. duction of c, genes. L Virol. 46: 371-377. 45: 672-682• Blair, E.D., C.C. Blair, and E.K. Wagner. 1987. Herpes simplex Holland, T.C., F.L. Homa, S.D. Marlin, M. Levine, and J. Glor- virus virion stimulatory protein mRNA leader contains se- ioso. 1984a. Herpes simplex virus type 1 glycoprotein C-neg- quence elements which increase both virus-induced tran- ative mutants exhibit multiple phenotypes, including secre- scription and mRNA stability. J. Virol. 61: 2499-2508. tion of truncated glycoproteins. J. Virol. 52: 566-674. Campbell, M., J. Palfreyman, and C.M. Preston. 1984. Identifi- Holland, L.E., R.M. Sandri-Goldin, A.L. Goldin, J.C. Glorioso, cation of herpes simplex virus DNA sequences which en- and M. Levine. 1984b. Transcriptional and genetic analyses code a trans-acting polypeptide responsible for stimulation of the herpes simplex virus type 1 genome: Coordinates 0.29 of immediate early transcription. J. Mol. Biol. 18: 1-19. to 0.45. [. Virol. 49: 947-959. Chirgwin, J.M., A.E. Przbyla, R.J. MacDonald, and W.J. Rutter. Homa, F.L., T.M. Otal, J.C. Glorioso, and M. Levine. 1986a. 1979. Isolation of biologically active ribonucleic acid from Transcriptional control signals of a herpes simplex virus sources enriched in ribonuclease. Biochemistry 18: 5294- type 1 late (~2) gene lie within bases -34 to + 124 relative to 5299. the 5' terminus of the mRNA. Mol. Cell. Biol. 6: 3652- Coen, D.M., S.P. Weinheimer, and S.L. McKnight. 1986. A ge- 3666. netic approach to promoter recognition during trans induc- Homa, F.L., D.J.M. Purifoy, J.C. Glorioso, and M. Levine. tion of viral gene expression. Science 234: 53-59. 1986b. Molecular basis of the glycoprotein C-negative phe- Cordingley, M., M. Campbell, and C.M. Preston. 1983. Func- notypes of herpes simplex virus type 1 mutants selected tional analysis of a HSV-1 promoter: Identification of far-up- with a virus-neutralizing monoclonal antibody. J. Virol. stream regulatory sequences. Nucleic Acids Res. 11: 2347- 58: 281-289. 2365. Honess, R.W. and B. Roizman. 1974. Regulation of herpes virus Dalrymple, M.A., D.J. McMeoch, A.J. Davison, and C.M. macromolecular synthesis. I. Cascade regulation of the syn- Preston. 1985. DNA sequence of the herpes simplex virus thesis of three groups of viral protein• ]. Virol. 14: 8-19. type 1 gene whose product is responsible for transcriptional Honess, R.W. and B. Roizman. 1975. Regulation of herpesvirus activation of immediate early promoters. Nucleic Acids Res. macromolecular synthesis: Sequential transition of polypep- 13: 7865-7879. tide synthesis requires functional viral polypeptides. Proc. DeLuca, N.A. and P.A. Schaffer. 1985. Activation of imme- Natl. Acad. Sci 72: 1276-1280. diate-early, early, and late promters by temperature-sensi- Johnson, P.A. and R.D. Everett. 1986. The control of herpes tive and wild-type forms of the herpes simplex virus type 1 simplex virus type-1 late gene transcription: A TATA-box/ protein ICP4. Mol. Cell. Biol. 5: 1997-2008. capsite region is sufficient for fully regulated activity. Nu- DeLuca, N.A., M.A. Courmey, and P.A. Schaffer. 1984. Tem- cleic Acids Res. 14" 8247-8264. perature-sensitive mutants in herpes simplex virus type 1 Jones, K.A. and R. Tjian. 1985. Spl binds to promoter sequences ICP4 permissive for early gene expression. ]. Virol. 52: 767- and activates HSV 'immediate early' gene transcription in 776. vitro. Nature 317: 179-182. Deluca, N.A., A.M. McCarthy, and P.A. Schaffer. 1985. Isola- Knipe, D.M., D. Senechek, S.A. Rice, and J.L. Smith. 1987. tion and characterization of deletion mutants of herpes sim- Stages in the nuclear association of the herpes simplex virus plex virus type 1 in the gene encoding immediate-early regu- transcriptional activator protein ICP4. J. Wrol. 61: 276-284. latory protein ICP4. J. Virol. 56: 558-570. Kristie, T.M. and B. Roizman. 1984. Separation of sequences Enquist, L.W., G.F. Vande Woude, M. Wagner, J.R. Smiley, and defining basal expression from those conferring a gene rec- W.C. Summers. 1979. Construction and characterization of ognition within regulatory domains of herpes simplex virus a recombinant plasmid encoding the gene of the thymidine 1 a genes. Proc. Natl. Acad. Sci. 81: 4065-4069. kinase of herpes simplex type 1 virus. Gene 7" 335-342. • 1987. Host cell proteins bind to the cis-acting sites for Godowski, P.J. and D.M. Knipe. 1986. Transcriptional control virion-mediated induction of herpes simplex virus 1 c~ genes• of herpesvirus gene expression: Gene functions required for Proc. Natl. Acad. Sci. 84: 71-75. positive and negative regulation. Proc. Natl. Acad. Sci. Mackem, S. and B. Roizman. 1982a. Structural features of the 83" 256-260. herpes simplex virus a gene, 4, 0, and 27 promoter-regula- Goldin, A.L., R.M. Sandri-Goldin, M. Levine, and J.C. Glorioso. tory sequences which confer alpha regulation on chimeric 1981. Cloning of herpes simplex virus type 1 sequences rep- thymidine kinase genes• J. Virol. 44: 939-944. resenting the whole genome. ]. Virol. 38: 50-58. 1982b. Differentiation between promoter and regula- Halpem, M.E. and J.R. Smiley. 1984. Effects of deletions on ex- tory regions of herpes simplex virus 1: The functional do- pression of the herpes simplex virus thymidine kinase gene mains and sequence of a moveable a regulator. Proc. Natl. from the intact viral genome: The amino terminus of the Acad. Sci. 79: 4917-4921. enzyme is dispensable for catalytic activity. J. Virol. Maniatis, T., E. Fritsch, and J. Sambrook. 1982. Molecular 50: 733-738. cloning: A laboratory manual. Cold Spring Harbor Labora- Harris-Hamilton, E. and S.L. Bachenheimer. 1985. Accumula- tory, Cold Spring Harbor, New York. tion of herpes simplex virus type 1 RNAs of different kinetic Mavromara-Nazos, P., S. Silver, J. Hubenthal-Voss, J.L.C. classes in the cytoplasm of infected cells. J. Virol. 53: 144- McKnight, and B. Roizman. 1986. Regulation of herpes sim- 151. plex virus 1 genes: a gene sequence requirement for tran- Heine, J.W., R.W. Honess, E. Cassai, and B. Roizman. 1974. sient induction of indicator genes regulated by [3 or late (~/2) Proteins specified by herpes simplex virus. XII. The virion promoters. Virology 149: 152-164. polypeptides of type 1 strains• J. Virol. 14: 640-651. Maxam, A. and W. Gilbert. 1980. Sequencing end-labeled DNA Holland, L., K. Anderson, C. Shipman, Jr., and E. Wagner. 1980. with base-specific chemical cleavages. Methods Enzymol. Viral DNA synthesis is required for the efficient expression 65: 499-559. of specific HSV-1 mRNA species. Virology 101: 10-24. McKnight, S.L. and R. Kingsbury. 1982. Transcriptional control Holland, T.C., S.D. Marlin, M. Levine, and J. Glorioso. 1983. signals of a eukaryotic protein-coding gene. Science Antigenic variants of herpes simplex virus selected with 217: 316-324.

52 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Transcriptional control of HSV late genes

McKnight, S. and R. Tjian. 1986. Transcriptional selectivity of viral genes in mammalian cells. Cell 46: 795-805. McKnight, S.L., E.R. Gavis, R. Kingsbury, and R. Axel. 1981. Analysis of transcriptional regulatory signals of the HSV thymidine kinase gene: Identification of an upstream control region. Cell 25: 385-398. Parker, C.S. and J. Topol. 1984. A drosophila RNA polymerase II transcription factor contains a promoter-region-specific DNA-binding activity. Cell 36: 357-369. Pellett, P.E., J.L.C. McKnight, F.J. Jenkins, and B. Roizman. 1985. Nucleotide sequence and predicted amino acid sequence of a protein encoded in a small herpes simplex virus DNA fragment capable of trans-inducing ot genes. Proc. Natl. Acad. Sci. 82: 5870-5874. Post, L.E., S. Mackem, and B. Roizman. 1981. Regulation of genes of herpes simplex virus: Expression of chimeric genes produced by fusion of the thymidine kinase with a gene promoters. Ceil 24: 555-565. Preston, C.M. 1979. Control of herpes simplex virus type 1 mRNA synthesis in cells infected with wild-type virus or the temperature-sensitive mutant tsK. J. Virol. 29: 275-284. Preston, C.M., M. Cordingley, and N. Stow. 1984. Analysis of DNA sequences which regulate the transcription of a herpes simplex virus immediate-early gene. J. Virol. 50: 708-716. Sacks, W.R., C.C. Greene, D.P. Aschman, and P.A. Schaffer. 1985. Herpes simplex virus type 1 ICP27 is an essential regulatory protein. J. Virol. 55: 796-805. Sawadogo, M. and R.G. Roeder. 1985. Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43: 165-175. Shapira, M., F.L. Homa, J.C. Glorioso, and M. Levine. 1987. Regulation of the herpes simplex virus type 1 late (~/2) glycoprotein C gene: Sequences between base pairs -34 to + 29 control transient expression and responsiveness to transactivation by the products of immediate early (R) 4 and 0 genes. Nucleic Acids Res. 15:3097-3111. Smiley, J.R., H. Swan, M. Pater, A. Pater, and M. Halpern. 1983. Positive control of the herpes simplex virus thymidine kinase gene requires upstream DNA sequences. J. ViroI. 47: 301-310. Weinheimer, S.P. and S.L. McKnight. 1987. Transcriptional and post-transcriptional controls establish the cascade of herpes simplex virus protein synthesis. J. Mol. Biol. 195: 819-833. Wu, L., S.E. Rosser, M.C. Schmidt, and A. Berk. 1987. A TATA box implicated in E1A transcriptional activation of a simple adenovirus 2 promoter. Nature 326: 512-515. Zipser, D., L. Lipsich, and J. Kwoh. 1981. Mapping functional domains in the promoter region of the herpes thymidine kinase gene. Proc. Natl. Acad. Sci. 78: 6276-6280.

GENES & DEVELOPMENT 53 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

A specific 15-bp TATA box promoter element is required for expression of a herpes simplex virus type 1 late gene.

F L Homa, J C Glorioso and M Levine

Genes Dev. 1988, 2: Access the most recent version at doi:10.1101/gad.2.1.40

References This article cites 48 articles, 30 of which can be accessed free at: http://genesdev.cshlp.org/content/2/1/40.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the top Service right corner of the article or click here.