Full Text (PDF)

Home , Cancer cell, Cell division, Endogenous retrovirus

Published OnlineFirst February 12, 2018; DOI: 10.1158/0008-5472.CAN-17-1861

Cancer Tumor Biology and Immunology Research

A Distinct Oncogenerative Multinucleated Cancer Cell Serves as a Source of Stemness and Tumor Heterogeneity David Díaz-Carballo1, Sahitya Saka1, Jacqueline Klein1, Tobias Rennkamp1, Ali H. Acikelli1, Sascha Malak1, Holger Jastrow2, Gunther Wennemuth2, Clemens Tempfer3, Inge Schmitz4, Andrea Tannapfel4, and Dirk Strumberg1

Abstract

The effects of anticancer treatments on cell heterogeneity and new mechanism used by tumor cells to invade surrounding tissues their proliferative potential play an important role in tumor and ensure life cycles. In contrast to the pregnant P1 cells with low persistence and metastasis. However, little is known about de- expression of stem cell markers despite their physiologic stem- polyploidization, cell fate, and physiologic stemness of the result- ness, the first offspring generations of daughter G1 cells expressed ing cell populations. Here, we describe a distinctive cell type high levels of ovarian cancer stem cell markers. Furthermore, termed "pregnant" P1 cells found within chemotherapy-refracto- both P1 and Gn cells overexpressed multiple human endogenous ry ovarian tumors, which generate and gestate daughter genera- retroviral envelope proteins. Moreover, programmed death- tion Gn cells intracytoplasmically. Release of Gn cells occurred by ligand 1 and the immunosuppressive domain of the retroviral ejection through crevices in the P1 cell membrane by body envelope proteins were also overexpressed in P1 cells, suggesting contractions or using a funiculus-like structure. These events effective protection against the host immune system. Together, characterized a not yet described mechanism of cell segregation. our data suggest that P1 oncogenerative cancer cells exhibit a not Maternal P1 cells were principally capable of surviving parturition yet described cell biological mechanism of persistence and trans- events and continued to breed and nurture Gn progenies. In mission of malignant cells in patients with advanced cancers. addition, P1 cells were competent to horizontally transmit off- Significance: P1 oncogenerative cell entities express low levels spring Gn cells into other specific proximal cells, injecting them to of CSC markers, which are characteristic of their histological receptor R1 cells via cell–cell tunneling. This process represents a origin. Cancer Res; 78(9); 2318–31. 2018 AACR.

Introduction tion into pluripotent stem cells (iPSC) can be induced via Yama- naka's quadriga of transcription factors (2, 3). Embryonic stem cells (ESC) derive from the undifferentiated The source of tumor cell heterogeneity is still under debate inner mass of blastocysts. As pluripotent cells, they can differen- because the "cell of origin" has remained elusive. However, tiate into all derivatives of the three primary germ layers (1). Adult multiple conclusive lines of evidence suggest the existence of stem cells (ASC) are undifferentiated multipotent cells with the cancer stem cells (CSC) with characteristics that are normally capacity of self-renewal and generation of fully differentiated associated with ASCs, including the capacity for long-term self- daughter cells. They are virtually tissue resident, help maintain renewal and multipotency, which contributes to tumor cell het- cellular homeostasis, and express high levels of ABC transporters. erogeneity, a hallmark of stem cells (4, 5). Despite their localized ASCs are capable of cell transdifferentiation, that is, generating origin, CSCs can disseminate to distant sites. Another ASC-like differentiated cell types of other histologies. ASC transdifferentia- characteristic is the overexpression of ABC transporters and DNA repair mechanisms, which play a critical role in untreatable malig- nancies. Moreover, under therapeutic treatment conditions, differ- 1 Institute of Molecular Oncology and Experimental Therapeutics. Division of entiated cancer cells may change their phenotype and alter their Haematology and Oncology, Marienhospital Herne, Ruhr University Bochum, – Medical School, Herne, Germany. 2Institute of Anatomy, University of Duisburg- biology toward a more stem-like state to ensure survival (4 6). Essen, Medical School, Essen, Germany. 3Gynaecology and Obstetrics, Marien- A common phenomenon associated with cytostatic- and irra- hospital Herne, Ruhr University Bochum, Medical School, Herne, Germany. diation-induced cell heterogeneity is believed to be the emergence 4Institute of Pathology, Ruhr University Bochum, Medical School, Bochum, of multinucleated giant cell entities with CSC properties (7, 8). Germany. These cells can be generated via two different mechanisms: Note: Supplementary data for this article are available at Cancer Research (i) endoreplication coupled with karyokinesis - endomitosis Online (http://cancerres.aacrjournals.org/). (plasmodium formation); and (ii) syncytin-mediated cell–cell Corresponding Author: David Díaz-Carballo, Institute of Molecular Oncology fusion (syncytium formation). Endoreplication can be seen as a and Experimental Therapeutics, Marienhospital Herne, Ruhr University Bochum, deviant form of the normal mitotic cell cycle in which mitosis is Medical School, Dungelstr.€ 33, Herne 44623, Germany. Phone: 4923-2349- completely suppressed. Endomitosis is an abortive from of 91092; Fax: 4923-2349-91049; E-mail: mitosis that does not result in cell division but leads to [email protected] the formation of multinucleated giant cells (9, 10). Another doi: 10.1158/0008-5472.CAN-17-1861 multinucleated cell type arises from speciﬁccell–cell fusion 2018 American Association for Cancer Research. events that are chieﬂymediatedbythefusogenicpropertiesof

2318 Cancer Res; 78(9) May 1, 2018

The Stemness Status of Oncogenerative P1 Cells

envelope proteins from exogenous or endogenous retroviruses TransferMan 4r micromanipulator (Eppendorf) and washed in (HERV), that is, HERV-WE1 and HERV-FRD1.Cell–cell fusion 25 mL DMEM. Next, the cells were placed in approximately 25 mL via syncytins may generate both normal (syncytium tropho- on a dish lid, inverted onto the PBS-filled bottom chamber, and blasts during placental development) and pathologic forms, as cultured in 5% CO2, 95% humidity, 37 C until morula-like observed, for example, in high-grade Reed–Sternberg cells, spheres had formed. chemoresistant tumors or after viral infection, for example, with the syncytial respiratory virus (11, 12). Studies on the migration capacity of P1 and G1-Gn cells by Although the two mechanisms differ vastly at the physiologic Transwell migration assay fi level, the nal fate of many giant cells is the reverted multi- A Transwell migration assay was used to track and quantify the nucleation, which leads to the generation of daughter cells, thus migration of P1 and offspring cells. Tissue culture inserts with a promoting tumor initiation and development (8, 13). The translucent 8 mm PET-membrane (Sarstedt) precoated with col- theory of cellularization states that in multinucleated cells, the lagen types I/IV (Thermo Fisher Scientific) were used. A total of nuclei may have developed internal perinuclear membrane 2 104 ovarian carcinoma cells from ascites were deposited on partitions facilitating the formation of new cells. This process the Transwell upper chamber, and DMEM containing 20% FBS has been described in Drosophila melanogaster embryos (14). was added as a chemoattractant to the lower chamber. After 24 However, to the best of our knowledge, the molecular mech- hours, cells were fixed with TCA 10% at 4C for one hour and anism behind this process has not been studied in detail in stained with SRB 0.4% in 1% acetic acid for one hour. Depending cancer cells. on the side of the membrane analyzed, the stained cells on the Here, we document a distinctive cell type termed "pregnant" P1 other side were removed mechanically. Migration was documen- cells found within chemotherapy-refractory ovarian tumors that ted using an inverted Nikon Eclipse TS100 microscope or generate daughter G1 cells intracytoplasmically by cellularization, quantified by immersing the membranes in Tris-HCl pH 10.5, which, upon gestation, are released into the immediate surround- measuring the dissolved proteins at 570 nm in a Tecan Infinite fi ings. Strikingly, P1 cells can inject G1 cells into speci c recipient M200 microtiter plate reader. Different P1/G1-Gn cell surface cells (R1) via cell–cell tunneling, which represents a horizontal structures like CXCR4, HERV-Fc1, HERV-KISD, and EpCAM were transmission of the entire genome between cells, resulting in new targeted using specific antibodies at 10 mg/mL for 24 hours to tetraploid cell entities. study their role in cell migration. P1 appears to be a distinctive tumor cell type with intriguing stem cell biology. Phenotypic characterization shows that P1 Differential expression of stem cell markers and immune express very low levels of CSC markers in spite of their stem cell checkpoints in P1 progenies as analyzed by qPCR biology (15). Interestingly, this is contrasted by the first genera- fi tion of progeny cells, which express a distinct signature of canon- Total RNA puri cation and cDNA synthesis. P1 progenies were ical CSC markers. Contrarily, P1 cells differentially produce more grown in hanging drops and harvested to study the expression of transcripts of several stem cell markers in comparison with their CSC markers. Total RNA was dually extracted with Trizol (Life fi offsprings. Technologies) and puri ed on RNeasy mini columns (Qiagen) Both P1 and G1 cells overexpress different human endogenous according to the manufacturer's instructions (19). retroviral (HERV) envelope proteins containing the immunosup- fi pressive domain (ISD; ref. 16). The programmed death-ligand Single-cell RNA isolation and cDNA ampli cation and real-time 1 (PD-L1) immune checkpoint was found to be overexpressed PCR. The REPLI-g WTA Single Cell Kit (Qiagen) was used to too, suggesting the cells may be able to circumvent immune attack generate and amplify cDNA from single cells following the in a way observed in both cancer and pregnancy (17). Thus, P1 manufacturer's instructions. Cells were obtained from ovarian cells may provide a sheltered immune- and therapy-resistant ascites and sorted in Transwell chambers after migration in FCS fl fl environment to guarantee the generation and gestation of new gradients as re ected above. Brie y, 100 cells were picked and tumor cells. These findings represent an as-yet undocumented lysed for 5 minutes at room temperature. gDNA was removed fi mechanism of conferring drug resistance and persistence to prior to the WTA process. Transcripts were ampli ed using ran- malignant cells and may provide a target for novel therapeutic dom and oligo-dT primers. The synthesized cDNA was ligated and fi strategies. then ampli ed by MDA technology, using the REPLI-g SensiPhi DNA polymerase, in an isothermal reaction for 2 hours. The Materials and Methods amplified cDNA was quantified with a Pico Green dsDNA Reagent Kit from Invitrogen. cDNA was employed for qPCR using 100 ng Cell lines, patient samples, and ethical considerations per reaction. All cells were obtained from the cell and tumor bank of the CSC markers, HERV and PDL1 expression was measured by Marienhospital Herne (Herne, Germany). This study was qPCR with validated primers and probes from Integrated DNA reviewed and approved by the Ethics Committee of the Ruhr Technologies Inc. Sequence and polarity of the primers are shown University of Bochum, Medical School (Herne, Germany; register in Table 1. 100 ng of RNA was amplified in triplicate in a CFX96 numbers: 5235-15, 5416-15, 17-6114). Real-Time System (Biorad Laboratories).

Generation of 3D spheroids from single P1 and G1 cells FACS analysis of cell cycle and polyploidic populations To analyze P1 cell heterogeneity, we cultivated single P1 and G1 Cell-cycle distributions were analyzed combining propidium cells in hanging drops to enable clonal proliferation in nonad- iodide (PI; Sigma-Aldrich) staining and 5-bromo-20-deoxyur- herent conditions and simulate the natural tumor architecture idine (BrdUrd) incorporation, as described previously (20). (18). Cells of different sizes (<80 mm) were picked using a BrdUrd incorporation and DNA content were measured using

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2319

Díaz-Carballo et al.

Table 1. Real-time PCR primers and probes Gene Accession Sense (50–30) Probe (50–30) Antisense (50–30) 18s NR_003286 GGACATCTAAGGGCATCACAG GGACATCTAAGGGCATCACAG GAGACTCTGGCATGCTAACTAG c-Myc NM_001354870.1 AGAGGCTTGGCGGGAAA AGGGAGGGATCGCGCTGAGTATAA CTGCCTCTCGCTGGAATTACTA KLF4 NM_001314052.1 AGGAGCCCAAGCCAAAG TAATCACAAGTGTGGGTGGCGGTC GCCTTGAGATGGGAACTCTT Nanog NG_004093.3 CAGGACAGCCCTGATTCTTC CAGTCCCAAAGGCAAACAACCCAC GTTTCTTGACCGGGACCTT Oct4 NM_002701.5 TATGGGAGCCCTCACTTCA TACTCCTCGGTCCCTTTCCCTGAG TCAGTTTGAATGCATGGGAGA Sox2 NM_003106.3 CGGACAGCGAACTGGAG AGAGGAGAGTAAGAAACAGCATGGAGA TTTGAGCGTACCGGGTTT EpCAM NM_002354.2 GGTGATGAAGGCAGAAATGAATG CCCATCATTGTTCTGGAGGGCC TCATCGCAGTCAGGATCATAAAG HERV-Fc1 AJ507128.1 GCCTCATCAGTCCTTTCAGATT TCGCCCAGAGAATGGACAAGCAT AAACACCAGGGACAGCTTATC

HERV-KISD DQ360584.1 TGTTCTAAGCTCATGAGTCTGTCT TGATCTTAGACAAACTGTCATTTGGATGGG CAGTCAGTAAACTTTGTTAATGATTGGC PDL1 AY291313.1 GCTGTCTTTATATTCATGACCTACT ACGCATTTACTGTCACGGTTCCCA TGTCATATTGCTACCATACTCTACC

the CytoFLEX Research Cytometer B5-R0-V0 (Beckman Coulter tistically; the results shown are representative of at least three Biosciences). independent experiments.

Immunocytochemical and IHC staining Results Immunocytochemical (ICC) and IHC staining was performed P1 cells are endoreplicative entities with virus-like life cycles according to standard protocols (21). In this study, we characterized a distinctive cell type termed Primary antibodies for CSC-phenotyping as for CD24, pregnant ("P1") cell and hypothesized it to be the primordial CD44pan, CD133, SCF, and vimentin were purchased from generative cell type. Figure 1A–I and Supplementary Videos S1 Cell Signaling Technology; ESA or Ep-CAM/TROP1 from R&D and S2 illustrate the morphology of P1 cells and how they give rise Systems; CD44 variants from Bio-Rad; primary antibodies for to the first generation of progeny cells ("G1"). P1 are hypertrophic the detection of HERV-WE1, HERV-FRD1, HERV-V3.1 from mono- and binucleated (in very early stages) or multinucleated Biorbyt and for HERV-K form BioSS. The anti-ISD was gener- (later stages) cells that can reach diameters of more than 200 mm ated using a 17 amino acid consensus fragment corresponding in adherent cultures. The P1 cell type was found both in tumors of to the ISD of different envelope proteins of the HERV-K family. different histologies and in primary cell cultures (Supplementary Conjugated secondary antibodies were purchased from Cell Fig. S1A). In untreated patients, we found that about 1% of all Signaling Technology. cells are P1, depending on the cellularity grade of the ascites. In pretreated and mostly chemoresistant cancers, viable P1 cells were Preparation of ultrathin tumor sections and transmission increased by 2% to 3%, indicating an influence of chemother- electron microscopy apeutics on the selection/induction (Supplementary Fig. S1B). Samples for transmission electron microscopy were prepared The ejection of G1 from the parental P1 starts with the forma- according to our unmodified protocol (7). A Zeiss transmission tion of funiculus-like structures (Fig. 1B and G; Supplementary electron microscope (EM 902A) was used applying 80 kV at Fig. S2A and S2B) and crevices in the P1 cell membrane through magnifications from 3,000 to 140,000. Digital images were which G1 are released by contraction of the P1 parent cell (Fig. 1A; taken with a MegaView II slow-scan CCD camera and aITEM 5.0 Supplementary Fig. S2C and S2D). The resulting local aperture is software (Soft Imaging Systems). then patched up with cellular content rich in HERV envelope proteins (Supplementary Fig. S2C and S2D). P1 and G1-Gn Morphologic studies of transmigrating P1 and G1-Gn cells by ultrastructure as well as the apertures left by the G1 upon ejection scanning electron microscopy from P1 cells are clearly discernible in tumor ultrathin sections – Cells on Transwell membranes were fixed using glutaralde- (Fig. 1J L; Supplementary Videos S3 and S4). hyde 2.5% in PBS for 12 minutes at room temperature, The development and cellularization of G1 cells inside P1 cells maintained in PBS, and then dehydrated in increasing con- and their subsequent release by P1 contraction represents a centrations of ethanol (1 in 25%, 50%, 75%, 95%, and 3 in unique, novel form of cell division (Fig. 1; Supplementary Videos anhydrous ethanol, 10 minutes each). The samples were sub- S5 and S6; Supplementary Fig. S2E andS2F). P1 cells undergo long quiescent phases, during which, they do not appear to generate jected to critical point drying in a CO2 atmosphere to mini- mize shrinkage, mounted on a holder using LeitC-Tabs adhe- and eject G1 cells (Supplementary Fig. S1A; Supplementary Video fi sive, and sputtered with gold in vacuum using an Edwards S7). These quiescent phases vary signi cantly and may extend up Sputter Coater S150B. Samples were scanned in a FEREM DSM to 6 weeks. 982 Gemini electron microscope (Zeiss) using an electron Another striking feature is the division of P1 cells as a whole cell beam of 15 kV. entity, which appears to imply a cytokinesis-like process. During cell division, mitochondria accumulate around the subsequent P2-Pn de novo cytoplasm delimiting frontiers (Supplementary Statistical analysis Fig. S3A and S3B; Supplementary Video S8). All experiments were performed at least in triplicate. Inter- group comparison of medians was performed by ANOVA. Statistical analysis was performed with Sigma Plot 12 (Systat P1 actively injects G1 cells into apparently specialized Software Inc.). Significance was accepted when P < 0.05. Elec- receptor cells tron microscopy, Western blot, ICC, IHC, and video micros- Endomitotic events of G1 cells inside P1 oncogenerative copy studies were descriptive and therefore not analyzed sta- cells, with subsequent karyokinesis, are common (Fig. 2A–J, red

2320 Cancer Res; 78(9) May 1, 2018 Cancer Research

The Stemness Status of Oncogenerative P1 Cells

Figure 1. Cellularization events linked to the generation of daughter cells by oncogenerative P1 cells. A–I, P1 cells are giant cell entities with the ability to breed daughter (G1) cells intracytoplasmically. The release of G1 cells from P1 starts with the formation of crevices through which the G1 cells are ejected via mechanical contraction of P1's cell body, leaving an aperture that will be repaired afterward. The connection between P1 and G1 is sustained for some time by a funiculus cellularis (Fu), analogous to placental organisms. The sequence of pictures was extracted from Supplementary Video S2. J–L, Ultrathin structure of P1 and G1 in ovarian carcinoma tissues. J and K, P1 oncogenerative cell that holds several G1 progeny cells. Note the aperture left by G1 cells once released from P1 (K). The separation of G1 cells from the P1 parental cell starts with the formation of crevices through which G1 are ejected (L). Mitochondria-rich plasma is observed in TEM image (L). These events are representative of several tumors.

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2321

Díaz-Carballo et al.

Figure 2. A P1 oncogenerative cell transmits stemness features by injecting progeny cells into selected adjacent receptor cells. A–J, Events of R1 polarization before the reception of a G1 cell (white arrows). In the sequence, it is possible to observe the development of a sulcus (red arrows) indicative of karyokinetic-like processes. K–S, Bidirectional interaction between P1 and surrounding cells and the transmission of stemness to a R1 cell. An adjacent cell is seen to be polarizing toward the P1 oncogenerative cell. These events are representative of several tumors.

2322 Cancer Res; 78(9) May 1, 2018 Cancer Research

The Stemness Status of Oncogenerative P1 Cells

arrows). We noticed another cell type in bidirectional interaction of unilateral migration. More than 90% of cells that invaded the with P1 and termed this second cell type as receptor cell ("R1") to lower side of the chamber were less than 25 mm measured as account for its capability of accepting G1 cells. First, a R1 in close planar. Contrarily, in the upper chamber, more than 90% of cells proximity to a P1 polarizes by accumulating material in the were greater than 25 mm in size, proving that the G1-Gn cells in membrane area facing the P1 cell (Fig. 2A–J, white arrows), which, particular may have dissemination capacity via intra/extravasa- in response, extends a protrusion toward the polarized R1 cell tion (Supplementary Fig. S6). connecting both cells. Via this protrusion, or injector, the P1 cell inoculates a G1 into R1. The resulting heterotic tetraploid entity is Gene expression of stem cell transcriptional factors and a "P2" cell with the same set of characteristics as the P1 polyploid CSC markers is not proportionate to protein expression as ancestor (Fig. 2K–S; Supplementary Video S1). Analysis of these analyzed by qPCR injectors revealed a composition rich in actin and tubulin proteins We studied the gene expression of pivotal stem cell tran- as described previously (7). scription factors like Oct4, Sox2, Nanog, c-Myc, KLF4 as well as EpCAM in migrating cells. P1 and hypertrophic cells did not Replication fitness, mitochondrial fission, and the migrate through an 8-mm pore membrane, whereas G1-Gn did spherogenicity of P1 and G1-Gn unimpedingly. We isolated the RNA from both populations The proliferative status of P1 and G1-Gn cells is reflected with a high sensitive kit, which allows the isolation of RNA in Fig. 3A and B. Cyclin D2 and Poliota replicative enzymes are from single cells. Figure 4I shows a representative gene expres- highly expressed in both P1 and G1 cells. Also, proliferating cell sion pattern of both cell populations [large nonmigrating (up) nuclear antigen is highly expressed in P1 cells and many tetra- and small migrating (down) cells] isolated from ovarian car- nuclear cells surrounding P1 (Supplementary Fig. S4A). More- cinoma patients. over, we observed high expression of HERV envelope proteins After separation of both cell types, we noted that multinu- in different mitotic phases of G1 cells (Supplementary Fig. cleated giant cells differentially produced more transcripts of S4B). P1 oncogenerative cells do not show an apoptotic phe- stem cell markers than their offsprings (Fig. 4I). This inversely notype (Fig. 3C). Moreover, these high replication rates are mirrors the protein expression of these markers as seen by ICC supported by the presence of large quantities of mitochondria studies (Fig. 4A–H). Moreover, stem cell transcription factors in both cell types (Fig. 3D). associated with pluripotency like Oct4, Sox2, Nanog, and KLF4 In 3D cultures, the G1-Gn populations grew faster than P1 cells, at the protein levels were found to be expressed by approxi- as measured by the size of the spheroids, indicating replicative mately 2% of the cells in the entire population. Contrarily, fitness. Moreover, P1 cells were not able to form spheres in c-Myc was expressed by approximately 60% of the cells (Sup- hanging drops, resembling the growth patterns seen in highly plementary Fig. S7A). chemotherapy-refractory ovarian cancers growing in 3D (Fig. 3E– We next compared the gene expression of the above-men- K). This indicates that it might be P1 cells that give rise to the tioned markers in the chemotherapy-refractory ovarian carci- heterogeneous cell populations that make up the bulk of a tumor. noma cell model SKOV3 and cells from ovarian carcinoma In contrast, G1-Gn cells were able to form symmetrical spheres patients. Interestingly, expression of Nanog and Sox2 was (Fig. 3F, I, and J). When the content of hanging drops from P1 cells significantly higher in patients than in chemotherapy-na€ve and G1-Gn was placed on Transwell membranes in an FCS ovarian models (Fig. 4J). gradient, P1-derived cells migrated rapidly in comparison with To get a hint about the differential gene expression of different G1-Gn spheres (Fig. 3H and K). stem cell markers in adherent as well as 3D cultures and to In an attempt to investigate the polyploidy status of these compare this with the same markers in patient material, we þ heterokaryotic multinucleated ovarian cells, we undertook cyto- employed the SKOV3 wild-type, MDR , and CP-resistant cells metric studies of the cell-cycle distribution using PI and BrdUrd and detected that the multinucleated P1 cells isolated from incorporation. Small and large cells from the whole population patients reflect similar behavior as the cells growing in 3D, were sorted, revealing high numbers of large polyploid popula- especially those cells that are highly resistant to cytostatics (Sup- tions alongside the near diploid small cells (Fig. 3L–Q). plementary Fig. S7B).

P1 and G1-Gn cells differentially express CSC markers typical of P1 and G1 cells express HERV envelope proteins their histologic origin P1 cells expressed low levels of HERV-derived envelope pro- We found that P1 oncogenerative and G1-Gn cells do express teins, indicating that P1 cells do not originate from cell–cell CSC markers differentially. P1 cells, despite their physiologic fusion. In contrast, G1 cells were very high in HERV protein stemness, produced low levels of CSC antigens, thus presenting expression (Fig. 5), indicating that G1-Gn cells retain fusogenic – an example of CSC marker low phenotypes that can initiate properties. Four different envelope proteins from HERVs (HERV- tumor formation. Contrarily, G1-Gn expressed high levels of CSC WE1, HERV-FRD1, HERV-V3.1, and HERV-KISD) were differentially markers. The differential expression of different CSC markers expressed in P1 and G1-Gn cells. Notably, various HERV proteins (CD24, CD44 variants, CD133, ESA/TROP1, Oct-4, SCF, Nanog, were found to be strongly overexpressed in different mitotic and SUZ12) by P1 and G1 in a primary ovarian carcinoma is phases (Supplementary Fig. S4B). – depicted in Fig. 4A H and Supplementary Fig. S5. The localization of HERV envelope proteins in the perinuclear cell compartment is of particular relevance too (Fig. 5A–D). G1-Gn cells show high migration rates Cytometric analysis for HERV envelope proteins revealed the We examined cell populations containing both P1 and G1-Gn expression of these viral elements to be high in ovarian cancers cells on Transwell and analyzed the populations that were capable (Fig. 5E–H).

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2323

Díaz-Carballo et al.

Figure 3. Replication fitness, apoptotic status, mitochondrial fission, and the spherogenic capacity of P1 and G1 cells. A–D, Replication fitness and apoptotic status of the oncogenerative and their offspring cells. P1 and G1-Gn cells do not express apoptotic phenotype and several replicative enzymes that denote strong replicative events (A–C). D, High mitochondrial fission in G1-Gn cells. E–K, 3D cultures of P1 and G1 cells display different growth patterns. E–G, I,andJ, 3D culture of P1 and G1 from ovarian tumor cells grown in hanging drops. P1 and G1 cells were aspirated after accutase detachment, washed in media, and resuspended in 25 mL media for 3D cultures. Single P1 oncogenerative cells grown in hanging drops show similar growth patterns as in 2D culture. They are able to form several spheroids during culturing, recapitulating the adjacent colony formation. Contrarily, G1-Gn cells grow uniformly into morula-like structures. Difference in migration patterns of P1 (H) and G1-Gn (K) cells cultured in 3D was observed after being subjected to chemotactic gradient using Transwell chambers as visualized by SEM. L–Q, Cytometric analysis of ovarian carcinoma primary cell cultures by FACS. Cell-cycle distribution (L, N,andP) reveals that G1-Gn small cells are near diploids (N), whereas giant cell population shows polyploid genomes (P). L, N, and P represent the BrdUrd incorporation and M, O,andQ represent the DNA content as measured by PI. Pictures are representative of 10 patient ascites analyzed.

P1 cells express high levels of HERV-KISD and PD-L1 to ensure In the next step, we sought to identify a second immune escape immune escape mechanism by investigating the expression of PD-L1 (or The expression of ISD as depicted in Fig. 6A is expected to CD274) in heterogenic tumor populations. As illustrated confer some immune escape capability to P1 and G1-Gn cells. in Fig. 6B, P1 is the predominant cell type to overexpress

2324 Cancer Res; 78(9) May 1, 2018 Cancer Research

The Stemness Status of Oncogenerative P1 Cells

PD-L1, which appears to be delivered to the intercellular space In patient material, PDL-1 and EpCAM were signiﬁcantly over- in extrasomal vesicles. Immune escape mediated by ISD in P1 expressed at the genetic level (Fig. 6E) in comparison with and G1-n cells in ovarian carcinoma tumors was found very cytostatic-sensitive ovarian cancer cells. Expression of the ISD high as seen in Fig. 6C. Interestingly, normal ovarian tissues do motif of HERV-K was also higher than the immune checkpoint not express this protein (Fig. 6D). PD-L1, regardless of the cells' resistance status. The relevance of

Figure 4. P1 and G1 cells show differential expression of specific CSC markers. A–H, These pictures reflect the ICC analysis of different CSC markers in a primary ovarian carcinoma. A, Different forms of the release of G1 cells, which are predominantly CD24 positive. This same pattern is noted for CD44PAN and CD133 as observed in B and C, respectively. Expression of CD44 variant 5 is similar in P1 and G1-Gn cells (F). This CSC expression pattern was found in several primary ovarian carcinomas. D, Ejection of a SCF-positive cell. E and F, Expression of c-Kit and Oct-4, respectively. G and H, Expression of Nanog and SUZ12, respectively. I, Genetic expression of c-Myc, KLF4, Nanog, Oct4, and Sox2 stem cell transcription factors as well as EpCAM in ovarian carcinoma cells obtained from ascites. Up represents the giant cells that are not able to migrate, whereas down represents the small highly migrating cells. J, Comparison of the expression of CSC markers between patient material and SKOV3 ovarian carcinoma wild-type and chemotherapy-resistant models. Significant expression in patient material was observed for Nanog. Experiments are representative of 10 patients analyzed.

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2325

Díaz-Carballo et al.

Figure 5. HERV envelope proteins are widely expressed in P1 and G1 cells obtained from primary ovarian tumors. A–D, ICC analysis of the expression of HERVs. At

least four different envelope proteins from endoretroviruses like HERV-WE1, HERV-FRD1, HERV-V3.1, and HERV-K are differentially expressed in P1 and G1-Gn cells. HERV envelope proteins are principally localized in the perinuclear cell compartments, which are rich in mitochondria. A, Release of G1 cells. The expression

of HERV-WE1, also known as syncytin 1, is similar in P1 and G1-Gn cells. B, Perinuclear distribution of the protein HERV-FRD1, also known as syncytin 2. The lateral cell division is observable by the expression of EpCAM. In this picture, a repaired aperture is clearly recognizable. C, P1 cell separation (cytokinesis-like event), suggesting that P1 cells are complete, replicative entities. A dense accumulation of mitochondria in the perinuclear area (mitoplasma or mitochondrial plasma) is seen in HERV-K positive G1-Gn cells (D). E–H, Cytometric analysis of HERV expression. Ovarian cancer cells express several envelope proteins derived from endogenous retroviruses as seen by FACS (E–H). Pictures are representative of 10 patient ascites analyzed.

these antigens as immunotargets lies in their capacity to inhibit based on the activation of embryogenic programs that confer the migration of small cells as seen in Fig. 6F for EpCAM and ISD, phenotypic germ cell features (23). In particular, the "oncotro- respectively. phoblastic cells" and their role in cell division, migration, host– tissue conditioning for angiogenesis, and immune tolerance seem P1 cells undergo several replicative and cellularization events to be of particular relevance in tumorigenesis and metastatic simultaneously spread (24). Another deﬁnition, which refers to the embryonic Figure 7A depicts a cartoon illustrating the major replication theory of tumorigenesis, was given by Lloyd J. Old, who claimed events experienced by P1 oncogenerative cells and Fig. 7B–M that cancer is somatic cell pregnancy (22). represents each event captured individually. P1 cells spawn vast Cell heterogeneity is a hallmark of cancer, especially in the number of functional progenies (G1-Gn) by lateral (Fig. 7B) parenchymal structures. The cells constituting a malignant tu- andcrevice-mediatedeclosions (Fig. 7C), which sometimes mor are thought to have a common origin and exhibit a rather leave plicae and apertures in cell membranes (Fig. 7D and multipotent phenotype (25). These oncogenerative cells are E). P1 cells have the ability to inoculate G1 cells via injectors hard to characterize based on a set of markers that deﬁne CSC (Fig. 7F) into adjacent polarized (Fig. 7G) receptor R1 cells (Fig. phenotypes. Moreover, little effort has been made to determine 7H). G1 cells released from P1 (Fig. 7I) fuses (Fig. 7J) with R1 for how many generations after the very stem cells these CSC receptor cells. The admixture of G1-R1 (Fig. 7K) forms a antigens continue to be expressed. Interestingly, some tumors heterotic tetranuclear P2 cell with the same stemness character- have been demonstrated to arise from CSC-negative cells (26). istics as P1. Two additional forms of G1-Gn release from P1 These reports have kindled a debate over the interpretation of oncogenerative cells are by budding (Fig. 7L) and via funiculus- the results and the reliability of the known CSC markers as an like structures (Fig. 7M). instrument to identify stemness characteristics (26, 27).

P1 and Gn life cycles and cellularization Discussion The neosis theory introduced by Rajaraman seeks to explain the Oncogenesis and CSCs replication mechanism of multinucleated cells. Neosis is thought Several theories of oncogenesis have been put forward. In the to occur in postsenescent multinucleated cells, and it is charac- early 1900s, it was noted that processes of germ cell development terized by karyokinesis via nuclear budding leading to aneuploid and oncogenesis share similar characteristics (22). In fact, John mononuclear cells with transient stem cell features, while the Beard proposed the trophoblastic theory of cancer. More recently, polyploid mother cells die (28). Although attractive, the neosis Vinnitsky suggested the oncogerminative theory of tumor forma- concept does not provide a satisfactory explanation for a few tion after which the malignant transformation of somatic cells is major aspects of our observations: P1 oncogenerative cells do not

2326 Cancer Res; 78(9) May 1, 2018 Cancer Research

The Stemness Status of Oncogenerative P1 Cells

Figure 6.

Expression of immune escape markers in P1 cells and patient parafﬁn sections of ovarian carcinoma. A–D, The expression of HERV-KISD in patient parafﬁn sections and primary ovary cells obtained from ascites (A, C, and D). The programmed death-ligand 1 (PD-L1) or CD274 in heterogenic tumor populations was

monitored by ICC in primary ovarian carcinoma cells. A, Expression of HERV-KISD in P1 and G1-Gn cells. Parallel expression of both immune modulator proteins was noted in several tumors of the same histology. PD-L1 is overexpressed in P1, as observed in B. C, Expression of the HERV-KISD domain in ovarian carcinoma paraffin sections. D, Expression of the ISD domain in normal ovarian tissues. E and F, Genetic expression of EpCAM, HERV-Fc1, HERV-KISD, and PDL-1 (E). EpCAM and PDL-1 were found to be significantly overexpressed in ovarian cells isolated from ascites in comparison with wild-type SKOV3 cells (E). The influence of

blocking antibodies against CXCR4, EpCAM, HERV-Fc1, and HERV-KISD on cell migration was signiﬁcant at 10 mg/mL concentration (F) using Transwell migration assay. Migration capacity was measured by SRB proliferation assay. Pictures are representative of 10 patient ascites analyzed.

necessarily die upon G1 generation. Moreover, they are not biological systems (30). Although polyploidy may reduce overall phenotypically senescent as evidenced by the lack of b-galacto- cell fitness, it has enormous adaptive potential, as its genetic or sidase expression and appear to be highly viable according to the epigenetic changes (amplification of oncogenes, new acetylation, abundant presence of antiapoptotic effectors like Bcl-2, which are or methylation patterns) can alter physiology, metabolism, and, markers of cellular fitness. Furthermore, P1 cells show a mode finally, morphology of the cell. This leads up to new phenotypes of cytokinesis that allows them to divide as a whole system that contribute to tumorigenesis, drug resistance, and metastatic (Supplementary Video S8), recently described as cytofission (29). spread (7, 8, 31). Our studies established that P1 cells might not meet the current We found that P1 oncogenerative cells have the ability of biological criteria of endoreplication (endomitosis and endocy- inoculating receptor cells (which probably represent a specialized cling) in a strict sense per se (9, 10). The way P1 cells generate the cell type for which P1 has a "tropism") with G1 via a connective first (i.e., proximal) daughter cell generation shows some analogy tube or injector. This process has not been described until now, as to cells "infected" (P1) by "giant viruses" (G1) that cycle through a it is an active, targeted act rather than an unspecific fusion event. It lysogenic phase without killing the host cell as described for viral implies the horizontal transmission of the entire genomes, epi- life cycles. In fact, the contribution of viral proteins to multi- genetic patterns, or amplified genes. nucleation different from classic cell–cell fusion has been The mixing of genetic material (heterosis) in the same cell described previously (20). system (autopolyploidy) or among cells of divergent structure (allopolyploidy) leads to increased allelic diversity that may P1 oncogenerative cells may drive tumor evolution result in hybrid, more robust de novo cells that are superior to Endoreplication and the resulting polyploidy is an adaptive the parental cells in terms of growth rate, robustness, etc., and the mode with far-reaching consequences for the evolution of many ability to occupy new niches (evolutionary selection; ref. 30). The

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2327

Díaz-Carballo et al.

Figure 7. Cartoon of the cellular events taking place in and around P1 oncogenerative cells. P1 cells are multinucleated giant cells that can reach up to 200 mm diameter with nuclei of about 20 mm diameter. G1 cells are generated by P1: (i) by peripheral cell eclosion or (ii) by intracytoplasmic cell division with subsequent release of the daughter cells by contraction of P1 cells. An aperture or foramen remains once G1 is released. P1 have the ability to inoculate receptor (R1) cells with G1 cells via an injector that docks to the R1 cells. Once the connection is established, the G1-daughter cell detaches from the parent cell and fuses with R1, resulting in a P2 cell with the same stemness characteristics as P1. G1 cells replicate via symmetric division, giving rise to G2-Gn cell generations that will form the mass of the tumor. A–M illustrate the events observed in this work.

2328 Cancer Res; 78(9) May 1, 2018 Cancer Research

The Stemness Status of Oncogenerative P1 Cells

mixing of genetic material between P1 and R1 represents an event cancer cells into stem cells of higher orders have resulted in of heterosis that may lead to a more adaptive phenotype that in normal cells (34). turn supports tumor spread and persistence. Our studies revealed a significant discrepancy in the levels of Polyploidy and multinucleation may arise from tetraploidy mRNA–protein pairs of specificstemcellmarkers,which intermediates. It has been demonstrated that neither a tetra- demands a further explanation. On the one hand, we know ploid condition nor centrosome or cell size anomalies or the that multinucleated oncogenerative cells are highly polyploid. failureofcytokinesisleadtoG0–G1 cell-cycle arrest. This Polyploid cells commonly show a near-global mRNA increase indicates that there are no efficient checkpoint restrictions in that is proportional to overall genome content and partially the cell cycle of mammalian cells to avoid tetraploidy (32). driven by epigenetic regulations. The increase in mRNA tran- Tetraploid cells are thought to be unstable intermediates with scripts observed for several stem cell factors seems to be not a aberrant proliferation, probably by the loss of caretaker genes requirement for P1 cells, because it does not lead to protein of cell-cycle checkpoint controls. These cell entities are often synthesis. But, what could be the fate of this overabundant with restricted distribution but resisting eradication even in the mRNA? We hypothesize that (i) P1 cells may translocate face of antireplicative therapies. Importantly, multinucleation mRNA transcripts to de novo G1 cells during cellularization via tetraploidization may lead to induced embryonic-like stem- to drive their development, or (ii) that in these cells the ness as proposed by Erenpreisa and colleagues (31, 33). In translational/posttranslational events are the dominant factors tumors, endoreplication and subsequent depolyploidization is controlling protein turnover and abundance for the analyzed thought to protect the tumor cells from stress, thus increasing transcripts (35, 36). The first assumption may explain the high cellular fitness and contributing to the emergence of highly expression of CSC markers, provided that robust protein resistant cancer entities (8, 13). synthesis in G1-Gn cells is robust. The latter may explain the P1 oncogenerative cells are somatic cells in "pregnancy" low expression of CSC markers at the protein level observed in generating and gestating a prole of cells intracytoplasmically P1 cells. On the other hand, the offspring of P1 cells are nearly that are cellularized into immediate surroundings, forming new diploid and therefore expected to have a more regular tran- colonies. They have the capacity of a horizontal transmission of scriptome with less genetic redundancy (30). G1-Gn de novo the entire genome to other cells, resulting in new tetraploid cell cells express much higher levels of CSC markers at the protein entities. level than P1. This divergence supports the view that these new We expect the striking size difference between P1 and G1-Gn cells are initially primed to face the conditions they are about cells to be of crucial importance in the metastatic spread process. to encounter. Invasiveness via transendothelial migration (tumor–vessel Genome-wide correlations between mRNA and protein expres- lumen–target tissue) may be different for P1 and G1-Gn cells. sion levels are notoriously inconsistent in human cancers. In fact, We hypothesize that large cells like P1 will remain confined to the only some 40% of the cellular protein levels can be predicted from local tumor, whereas the smaller G1-Gn cells are likely to be more mRNA measurements (37). Recently, van Velthoven and collea- mobile and therefore possess a higher metastatic potential. gues described the balance between synthesis and degradation of transcripts in quiescent muscle stem cells (36). The stemness status of P1 oncogenerative cells P1 oncogenerative cells display few CSC marker characteristics Tumor immune escape may be facilitated by endoretroviral for multipotency despite their physiologic stemness as judged by elements their capacity to generate and gestate de novo cells. Interestingly, One of the central tenets of the immune system is the active this is contrasted by the first generation of progeny cells (G1), surveillance for malignant transformation and elimination of which clearly express a signature of canonical ovarian CSC mar- cancer cells but cancer cells present "self" antigens, and as a kers (15, 27). Importantly, both P1 and G1-Gn express EpCAM/ consequence, autoreactive immune cells are usually eliminated. TROP1, a marker of trophoblastic lineage that matches the char- On the other hand, tumors generate an immunosuppressive acteristic of oncotrophoblastic cells. Although Oct-4A (one of the microenvironment that prevents their infiltration by immune essential stem cell transcriptional factors, among c-Myc, Sox2, and cells. KLF4) was expressed in P1 cells to some extent, this alone does not Interestingly, all P1 and G1-Gn cells overexpress some endog- qualify for pluripotency. c-Myc is thought to be another essential enous retroviral proteins, in particular, HERV-coded envelope stem cell transcriptional factor, but is also upregulated in several proteins that are mostly intact. HERV-WE1 and FRD1 are key tumors. Thus, the quadriga of stem cell transcriptional factors that fusogenic factors that mediate syncytial assembly, a collateral leads to pluripotency is not complete. This indicates a rather effect attributed to a number of different viruses (38, 39). This multipotent phenotype (1, 4). raises questions as to the role of the reactivation of endogenous In general, the presence of pluripotent cells in tumors has retroviral elements and its implication in cancer development and remained obscure. The existence of such cells implies at least metastatic spread (40, 41). In this context, HERV envelope pro- theoretically, that such pluripotent CSCs may simultaneously teins may contribute to multinucleation by virtue of their fuso- transdifferentiate into tumors of dissimilar histologies. This pos- genic properties and, as self-antigens, help mask tumor cells sible scenario is not supported by clinical evidence, because such against immune attack in a virus-like fashion (42, 43). Interest- tumors are uncommon. Biologically speaking, a pluripotent cell ingly, HERV elements were overexpressed in mitotic cells in has a particular signature amidst the expression of some factors different phases of cell division, indicating an important role in necessary for development and maintenance of this quality. these populations. Of note is the biological function of the ISD Normal cells can be reprogrammed to totipotent stem cells using introduced by viral envelope proteins, which may help the tumor the Yamanaka cocktail stem cell transcriptional factors simulta- escape the immune response (16). This means that blocking ISD neously (2). Interestingly, efforts directed toward reprogramming may be killing two birds with one stone, first by staging a powerful

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2329

Díaz-Carballo et al.

anticancer immune response, and second by killing ISD-rich Authors' Contributions tumor cells directly (44). Conception and design: D. Díaz-Carballo, A. Tannapfel Our data show that P1 cells are high in PD-L1 expression, Development of methodology: D. Díaz-Carballo which, together with the presence of ISD introduced by the HERV Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): D. Díaz-Carballo, S. Saka, J. Klein, T. Rennkamp, proteins, may help to ensure tumor escape from immunologic A.H. Acikelli, H. Jastrow, C. Tempfer, I. Schmitz surveillance. Analysis and interpretation of data (e.g., statistical analysis, biostatistics, Another critical observation is that perinuclear mitochondri- computational analysis): D. Díaz-Carballo, H. Jastrow, G. Wennemuth, al fissionactivityandcrowdingisextremelyhighinbothP1and I. Schmitz G1-Gn cells and especially the latter, which are particularly rich Writing, review, and/or revision of the manuscript: D. Díaz-Carballo, in mitochondria. The dense perinuclear mitochondrial mass S. Malak, H. Jastrow, G. Wennemuth, C. Tempfer, D. Strumberg Administrative, technical, or material support (i.e., reporting or organizing seen in G1-Gn appears to form a plasmatic shield or mito- data, constructing databases): A. Tannapfel, D. Strumberg plasm, which delimits the G1 cell boundaries. Their high Study supervision: D. Strumberg mitochondrial content, together with their small size, could Other (final approval): D. Strumberg explain the very high dividing rates and distinct infiltration Acknowledgments potential of G1-Gn, as this process places enormous energy The authors want to thank to Marienhospital Herne from the Elisabeth requirements on the cells (19, 45). Group for supporting this investigation. Special thanks to the staff of the fi In conclusion, the identi cation and description of P1 Gynaecology Department for the coordination of samples collection. This oncogenerative cells and G1-Gn daughter cells in ovarian investigation was supported by grants afforded by institutional funds from cancer sheds new light on tumorigenesis and tumor persist- Marienhospital Herne. ence and may open up new avenues for targeted cancer therapies in the future. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Disclosure of Potential Conflicts of Interest Received July 10, 2017; revised November 20, 2017; accepted February 6, No potential conflicts of interest were disclosed. 2018; published first February 12, 2018.

References 1. Martello G, Smith A. The nature of embryonic stem cells. Annu Rev Cell Dev 14. Morgan DO. "Specialization of Cytokinesis in Animal Development." In Biol 2014;30:647–75. Cell Cycle: Principles of Control, 170–1. London: Publisher: New Science 2. Schmidt R, Plath K. The roles of the reprogramming factors Oct4, Sox2 and Press Ltd, 2007. Klf4 in resetting the somatic cell epigenome during induced pluripotent 15. Ottevanger PB. Ovarian cancer stem cells more questions than answers. stem cell generation. Genome Biol 2012;13:251. Semin Cancer Biol 2017;44:67–71. 3. Scott EW. Stem cell reviews and reports. Adult stem cells and tissue 16. Denner J. Immunosuppressive properties of retroviruses. Eur J Immunol regeneration section. Stem Cell Rev 2017;13:2. 2016;46:253–5. 4. Aponte PM, Caicedo A. Stemness in cancer. Stem cells, cancer stem 17. Robainas M, Otano R, Bueno S, Ait-Oudhia S. Understanding the role of cells, and their microenvironment. Stem Cells Int 2017;2017: PD-L1/PD1 pathway blockade and autophagy in cancer therapy. Onco 5619472. Targets Ther 2017;10:1803–7. 5. van Niekerk G, Davids LM, Hattingh SM, Engelbrecht A-M. Cancer stem 18. Weihua Z, Lin Q, Ramoth AJ, Fan D, Fidler IJ. Formation of solid cells. A product of clonal evolution? Int J Cancer 2017;140:993–9. tumors by a single multinucleated cancer cell. Cancer 2011;117: 6. Lopez-L azaro M. The migration ability of stem cells can explain the 4092–9. existence of cancer of unknown primary site. Rethinking metastasis. 19. Díaz-Carballo D, Klein J, Acikelli AH, Wilk C, Saka S, Jastrow H, et al. Oncoscience 2015;2:467–75. Cytotoxic stress induces transfer of mitochondria-associated human 7. Diaz-Carballo D, Gustmann S, Jastrow H, Acikelli AH, Dammann P, Klein J, endogenous retroviral rna and proteins between cancer cells. Oncotarget et al. Atypical cell populations associated with acquired resistance to 2017;8:95945–64. cytostatics and cancer stem cell features. The role of mitochondria in 20. Patel D, Incassati A, Wang N, McCance DJ. Human papillomavirus type nuclear encapsulation. DNA Cell Biol 2014;33:749–74. 16 E6 and E7 cause polyploidy in human keratinocytes and up-regulation 8. Puig P-E, Guilly M-N, Bouchot A, Droin N, Cathelin D, Bouyer F, of G2-M-phase proteins. Cancer Res 2004;64:1299–306. et al. Tumor cells can escape DNA-damaging cisplatin through DNA 21. Diaz-Carballo D, Acikelli AH, Klein J, Jastrow H, Dammann P, Wyga- endoreduplication and reversible polyploidy. Cell Biol Int 2008;32: nowski T, et al. Therapeutic potential of antiviral drugs targeting chemo- 1031–43. refractory colorectal adenocarcinoma cells overexpressing endogenous 9. Fox DT, Duronio RJ. Endoreplication and polyploidy. Insights into devel- retroviral elements. J Exp Clin Cancer Res 2015;34:81. opment and disease. Development 2013;140:3–12. 22. Old LJ. Cancer is a somatic cell pregnancy. Cancer Immun 2007;7:19. 10. Lee HO, Davidson JM, Duronio RJ. Endoreplication: polyploidy with 23. Vinnitsky VB. Oncogerminative hypothesis of tumor formation. Med purpose. Genes Dev 2009;23:2461–77. Hypotheses 1993;40:19–27. 11. Larsson L-I, Bjerregaard B, Wulf-Andersen L, Talts JF. Syncytin and cancer 24. Vinnitsky V. The development of a malignant tumor is due to a desperate cell fusions. Scientiﬁc World Journal 2007;7:1193–7. asexual self-cloning process in which cancer stem cells develop the ability 12. Rengstl B, Newrzela S, Heinrich T, Weiser C, Thalheimer FB, Schmid F, et al. to mimic the genetic program of germline cells. Intrinsically Disordered Incomplete cytokinesis and re-fusion of small mononucleated Hodgkin Proteins 2014;2:e29997. doi: 10.4161/idp.29997. cells lead to giant multinucleated Reed-Sternberg cells. Proc Natl Acad Sci 25. Prasetyanti PR, Medema JP. Intra-tumor heterogeneity from a cancer stem U S A 2013;110:20729–34. cell perspective. Mol Cancer 2017;16:41. 13. Erenpreisa J, Salmina K, Huna A, Kosmacek EA, Cragg MS, Ianzini F, et al. 26. HuangS-D,YuanY,TangH,LiuX-H,FuC-G,ChengH-Z,etal.Tumor Polyploid tumour cells elicit paradiploid progeny through depolyploidiz- cells positive and negative for the common cancer stem cell markers ing divisions and regulated autophagic degradation. Cell Biol Int 2011; are capable of initiating tumor growth and generating both progenies. 35:687–95. PLoS One 2013;8:e54579.

2330 Cancer Res; 78(9) May 1, 2018 Cancer Research

The Stemness Status of Oncogenerative P1 Cells

27. Abbaszadegan MR, Bagheri V, Razavi MS, Momtazi AA, Sahebkar 37. Maier T, Guell€ M, Serrano L. Correlation of mRNA and protein in complex A, Gholamin M. Isolation, identification, and characterization of biological samples. FEBS Lett 2009;583:3966–73. cancer stem cells. A review. J Cell Physiol 2017;232:2008–18. 38. Gonzalez-Cao M, Iduma P, Karachaliou N, Santarpia M, Blanco J, Rosell R. 28. Rajaraman R, Rajaraman MM, Rajaraman SR, Guernsey DL. Neosis–a Human endogenous retroviruses and cancer. Cancer Biol Med 2016; paradigm of self-renewal in cancer. Cell Biol Int 2005;29:1084–97. 13:483–8. 29. Niu N, Zhang J, Zhang N, Mercado-Uribe I, Tao F, Han Z, et al. Linking 39. Soygur B, Sati L. The role of syncytins in human reproduc- genomic reorganization to tumor initiation via the giant cell cycle. tion and reproductive organ cancers. Reproduction 2016;152: Oncogenesis 2016;5:e281. doi: 10.1038/oncsis.2016.75. R167–78. 30. Comai L. The advantages and disadvantages of being polyploid. Nat Rev 40. Ohnuki M, Tanabe K, Sutou K, Teramoto I, Sawamura Y, Narita M, et al. Genet 2005;6:836–46. Dynamic regulation of human endogenous retroviruses mediates factor- 31. Erenpreisa J, Cragg MS. MOS, aneuploidy and the ploidy cycle of cancer induced reprogramming and differentiation potential. Proc Natl Acad Sci cells. Oncogene 2010;29:5447–51. U S A 2014;111:12426–31. 32. Wong C, Stearns T. Mammalian cells lack checkpoints for tetraploidy, aber- 41. Santoni FA, Guerra J, Luban J. HERV-H RNA is abundant in human rant centrosome number, and cytokinesis failure. BMC Cell Biol 2005;6:6. embryonic stem cells and a precise marker for pluripotency. Retrovirology 33. Salmina K, Jankevics E, Huna A, Perminov D, Radovica I, Klymenko T, et al. 2012;9:111. Up-regulation of the embryonic self-renewal network through reversible 42. Blinov VM, Krasnov GS, Shargunov AV, Shurdov MA, Zverev VV. Mechan- polyploidy in irradiated p53-mutant tumour cells. Exp Cell Res 2010; isms of retroviral immunosuppressive domain-induced immune modu- 316:2099–112. lation. Mol Biol 2013;47:707–16. 34. Lang J-Y, Shi Y, Chin YE. Reprogramming cancer cells. Back to the future. 43. Izsvak Z, Wang J, Singh M, Mager DL, Hurst LD. Pluripotency and the Oncogene 2013;32:2247–8. endogenous retrovirus HERVH. Conflict or serendipity? Bioessays 2016; 35. Jiang Q, Crews LA, Holm F, Jamieson CHM. RNA editing-dependent 38:109–17. epitranscriptome diversity in cancer stem cells. Nat Rev Cancer 2017; 44. Codd AS, Kanaseki T, Torigo T, Tabi Z. Cancer stem cells as targets for 17:381–92. immunotherapy. Immunology 2018;153:304–14. 36. van Velthoven CTJ, de Morree A, Egner IM, Brett JO, Rando TA. Transcrip- 45. Farnie G, Sotgia F, Lisanti MP. High mitochondrial mass identifies a sub- tional profiling of quiescent muscle stem cells in vivo. Cell Rep population of stem-like cancer cells that are chemo-resistant. Oncotarget 2017;21:1994–2004. 2015;6:30472–86.

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2331

A Distinct Oncogenerative Multinucleated Cancer Cell Serves as a Source of Stemness and Tumor Heterogeneity

David Díaz-Carballo, Sahitya Saka, Jacqueline Klein, et al.

Cancer Res 2018;78:2318-2331. Published OnlineFirst February 12, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-17-1861

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2018/02/10/0008-5472.CAN-17-1861.DC1

Cited articles This article cites 44 articles, 7 of which you can access for free at: http://cancerres.aacrjournals.org/content/78/9/2318.full#ref-list-1

Citing articles This article has been cited by 4 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/78/9/2318.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/78/9/2318. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.