Immunomic analysis of sarcoma

Sang-Yull Lee*, Yuichi Obata†, Masahiro Yoshida‡, Elisabeth Stockert*, Barbara Williamson*, Achim A. Jungbluth*, Yao-Tseng Chen*§, Lloyd J. Old*, and Matthew J. Scanlan*¶

*Ludwig Institute for Cancer Research, New York Branch at Memorial Sloan–Kettering Cancer Center, 1275 York Avenue, New York, NY 10021; †RIKEN Bioresource Center, RIKEN Tsukuba Institute, 3-1-1 Koyadai Tsukuba 305-0074, Japan; ‡Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan; and §Department of Pathology, Weill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021

Contributed by Lloyd J. Old, December 30, 2002 The screening of cDNA expression libraries from human tumors (17) that elicit spontaneous cellular (18) and humoral immune with serum antibody (SEREX) has proven to be a powerful method (19) responses in some cancer patients. Because of their tissue- for identifying the repertoire of tumor antigens recognized by the restricted expression and immunogenicity, CT antigens are of cancer patients, referred to as the cancer potential targets for vaccine-based immunotherapies. In general, immunome. In this regard, cancer͞testis (CT) antigens are of CT antigens are expressed in 20–40% of specimens from a given particular interest because of their immunogenicity and restricted tumor type (18, 20). One exception to this is synovial sarcoma, expression patterns. Synoivial sarcomas are striking with regard to in which 80% of specimens express the CT antigens, NY-ESO-1 CT antigen expression, with >80% of specimens homogeneously (21), and MAGE (22). expressing NY-ESO-1 and MAGE-A3. In the present study, 54 The current study examines the humoral immune response of sarcoma patients were tested for serum antibodies to NY-ESO-1, sarcoma patients to sarcoma and testicular antigens. Sera from SSX2, MAGE-A1, MAGE-A3, MAGE-A4, MAGE-A10, CT7, and CT10. patients actively mounting a humoral immune response to their Two patients had detectable antibodies to CT antigens, and this cancers, as determined by an antibody response against NY- seroreactivity was restricted to NY-ESO-1. Thus, although highly ESO-1, were used to screen cDNA libraries derived from expressed in sarcoma, CT antigens do not induce frequent humoral CT-rich synovial sarcoma cell lines, as well as normal testis. immune responses in sarcoma patients. Sera from these two Although there was little overlap in the identity of clones isolated patients were used to immunoscreen cDNA libraries from two with different sarcoma sera, more than 30% of the isolated synovial sarcoma cell lines and normal testis, resulting in the clones were previously identified during SEREX analysis of identification of 113 distinct antigens. Thirty-nine antigens were other tumor types. In conformity with previous findings (14, 15), previously identified by SEREX analysis of other tumor types, and Ϸ60% of these antigens also reacted with sera from normal 23͞39 antigens (59%) had a serological profile that was not individuals. Thus, only a fraction of the serologically defined restricted to cancer patients, indicating that only a proportion of immunome is associated with a cancer-related immune response. SEREX-defined antigens are cancer-related. A novel CT antigen, A previously uncharacterized CT antigen, NY-SAR-35, was NY-SAR-35, mapping to chromosome Xq28 was identified among identified among the antigens associated with a cancer-related

the cancer-related antigens, and encodes a putative extracellular immune response. This antigen is striking, as it appears to be a IMMUNOLOGY . In addition to testis-restricted expression, NY-SAR-35 rare example of a cell surface͞secreted molecule identified as a mRNA was expressed in sarcoma, melanoma, esophageal cancer, CT antigen. It is therefore of significant interest as a potential lung cancer and breast cancer. NY-SAR-35 is therefore a poten- immunotherapeutic target. tial target for cancer vaccines and monoclonal antibody-based immunotherapies. Materials and Methods Cell Lines, Tissues, Sera, and RNA. SW1045 and SW982 synovial he identification of human tumor antigens recognized by the sarcoma cell lines were obtained from the cell repository of the Tautologous host is yielding an array of target molecules for Ludwig Institute for Cancer Research, New York Branch at the the diagnosis, monitoring, and immunotherapy of human cancer Memorial Sloan–Kettering Cancer Center. Tumor tissues and sera were obtained from Memorial Sloan–Kettering Cancer (1–4). Studies of the cellular and humoral immune response to Center, Weill Medical College of Cornell University, and Aichi cancer have revealed an extensive repertoire of tumor antigens Cancer Center Research Center, Nagoya, Japan. Normal tissue recognized by the immune system, collectively termed the cancer RNA preparations were purchased from CLONTECH and immunome. The immunome comprises antigens defined by T cell Ambion (Austin, TX). Total RNA from tumor tissues was cloning (5–8), MHC peptide elution (9–11), and serological prepared with guanidinium thiocyanate. expression cloning (SEREX, refs. 12–14), and is catalogued in three databases, the peptide database of T cell-defined tumor antigens SEREX Analysis of cDNA Expression Libraries. Poly(A)ϩ RNA from (www.cancerimmunity.org͞peptidedatabase͞Tcellepitopes. SW1045 and SW982 cells was prepared by using the Fast Track htm), SYFPEITHI database of MHC ligands and peptide motifs mRNA purification kit (Invitrogen, Life Technologies, Carlsbad, (www.bmi-heidelberg.com͞syfpeithi͞), and the cancer immunome CA). Poly(A)ϩ RNA from normal testis was purchased from database (www2.licr.org͞CancerImmunomeDB͞). CLONTECH. Separate cDNA libraries were constructed for SEREX is a method of immunoscreening tumor-derived each of these in the ZAP Express vector (Stragene) according to cDNA expression libraries with cancer patient sera to identify the manufacturer’s instructions using 5 ␮g poly(A)ϩ mRNA. molecules recognized by high titered IgG antibodies (12). Ap- Libraries containing 1–2 ϫ 106 recombinants were obtained, and proximately 1,100 distinct antigens have been defined by were not amplified before imunoscreening. SEREX analysis to date, including a number of etiologically and To remove serum antibodies reactive with vector-related therapeutically significant cancer antigens, such as mutational antigens (e.g., p53, LKB1; refs. 14 and 15), differentiation antigens (e.g., tyrosinase, NY-BR-1; refs. 12 and 16), overex- Abbreviations: SEREX, serological analysis of recombinant cDNA expression libraries; CT, pressed products (e.g., Her2neu, TPD52; ref. 14), and cancer/testis. cancer͞testis (CT) antigens (e.g., MAGE-1, NY-ESO-1, refs. 12 Data deposition: The sequences reported in this paper have been deposited in the GenBank and 13). CT antigens are the products of transcripts present only database (accession nos. AY211909–AY211931, and AY214130). in developing germ cells and human cancers of diverse origins ¶To whom correspondence should be addressed. E-mail: [email protected].

www.pnas.org͞cgi͞doi͞10.1073͞pnas.0437972100 PNAS ͉ March 4, 2003 ͉ vol. 100 ͉ no. 5 ͉ 2651–2656 Downloaded by guest on September 29, 2021 antigens, sera was absorbed with Escherichia coli͞bacteriophage AGAATTGGCAGAGGCTCGTCATCA͞TTCCAATTTTGC- lysates prepared in the following manner. Wild-type ␭ ZAP CTTCTCTAACTG. NY-SAR-73 5Ј͞3Ј: CCCGGAGCACGTC- Express bacteriophage were amplified in E. coli XL1 Blue MRFЈ GAGGTCTAC͞GGTGAGGGGCCCAGGAAGC. NY-SAR-78 by overnight propagation of 5,000 plaque-forming units in 15-cm 5Ј͞3Ј: CACAATGTATCCTGTTGAAAG͞GAGATGATACAT- Petri dishes containing 100 ml of NZY͞0.7% agarose growth TCTTCCAG. NY-SAR-92 5Ј͞3Ј: CTTCCGCCAACTCCTC- media. Ten milliliters of binding buffer (0.1M NaHCO3, pH 8.3) CTACC͞GATGCCCGTGTCTTGTCCTT. NY-SAR-96 5Ј͞3Ј: was then added to the plates, and the plates were gently agitated CACTAGGCTGCTGAGGAAGAT͞GTTTTGGTGGGCAG- at 4°C for 15 h. The resultant supernatants were collected, and CATTGAG. NY-SAR-97 5Ј͞3Ј: GGACCACCCCAAATAGAA͞ residual E. coli were lysed by sonication. The lysates were then CCACCAGCTCAGGAAGA. NY-SAR-110 5Ј͞3Ј: TCTGATG- coupled to CNBr-Sepharose 4B (Amersham Pharmacia) as per GAGCGGTGGGATGC͞GTGTGCCTCGGCTTCTTTCTTC. manufacturer’s instructions. Patient sera were absorbed with an equal volume of Sepharose 4B coupled E. coli͞phage lysates at Real-Time Quantitative RT-PCR. The relative amount of NY- 4°C for 6 h. This procedure was repeated a total of three times, SAR-35 mRNA was measured by real-time RT-PCR using and was followed by a 15-h incubation with nitrocellulose filters normalized cDNA preparations derived from nonmalignant precoated with derived from E. coli and E. coli͞phage tissues and lung cancer specimens. Gene-specific TaqMan lysates. probes and PCR primers were designed by using Primer Express Library screenings were performed as described (14, 15). A software (PE Biosystems, Foster City, CA), and their sequences total of five independent SEREX immunoscreenings of the are provided below. Triplicate PCR reactions were prepared by cDNA librarieas were undertaken by using 1.75 ϫ 106 primary using 2.5 ␮l of cDNA diluted in TaqMan PCR Master Mix (PE (nonamplified) bacteriophage clones and sera from two sarcoma Biosystems) supplemented with 200 nM 6-carboxy-fluorescein patients. Serum reactive phage clones were converted to plasmid labeled gene-specific TaqMan probe, and a predetermined, forms and subjected to DNA sequencing (Cornell University optimum concentration of gene specific forward and reverse DNA Services, Ithaca, NY). primers (300–900 nM). PCR consisted of 40 cycles of 95°C denaturation (15 s) and 60°C annealing͞extension (60 s). Ther- Determination of Serum Antibody Reactivity. Serum antibody reac- mal cycling and fluorescent monitoring were performed with an tivity to CT antigens was determined by ELISA as described ABI 7700 sequence analyzer (PE Biosystems). The point at (19). Briefly, NY-ESO-1, SSX2, MAGE-A1, MAGE-A3, which the PCR product is first detected above a fixed threshold, MAGE-A4, MAGE-A10, CT7, and CT10 were produced in E. termed the cycle threshold (Ct), was determined for each coli by transfection with pQE30 expression vectors (Qiagen, sample. The abundance of gene-specific transcripts in normal Valencia, CA) as per the manufacturer’s protocol. Ten nano- tissues was determined by comparison with a standard curve grams of recombinant protein (1 ␮g͞ml) was absorbed to TC generated from the Ct values of known concentrations of microwell plates and incubated with diluted (1:100 to 1:25,000) plasmid DNA template encoding NY-SAR-35. patient sera. Bound antibody was detected with an alkaline TaqMan primers were as follows. NY-SAR-35 5Ј TaqMan phosphatase-conjugated goat anti-human IgG secondary anti- primer: TGGTGCGATCAGCCTTATCC. NY-SAR-35 3Ј Taq- body (Southern Biotechnology, Birmingham, AL). In the case of Man primer: CGGTTCGCTCCTCCAGAA. NY-SAR-35 Taq- SEREX-defined sarcoma antigens, SADA (Serum Antibody Man probe: TGTCTGCCCATTTATTGCCGCTCTCT. Detection Array, refs. 14 and 23) was used to determine sero- logical reactivity in preabsorbed serum samples from 39 sarcoma Results patients and 33 healthy blood donors. In brief, 5 ϫ 103 plaque- Frequency of Antibody Responses to CT Antigens in Sarcoma Patients. forming units per ␮l of bacteriophage encoding individual Sera from 54 sarcoma patientsʈ were tested by ELISA for the SEREX-defined tumor antigens were mixed with an equal presence of antibodies to NY-ESO-1, SSX2, MAGE-A1, volume of exponentially growing E. coli XL-1 Blue MRFЈ, and MAGE-A3, MAGE-A4, MAGE-A10, CT7, and CT10. Two spotted on NZY coated nitrocellulose membranes by using a patients, one with a malignant fibrous histocytoma (patient 96-pin replicator (Nalge Nunc). Membranes were incubated for MFH) and the other with a fibrosarcoma (patient FS), had 15hat37°C, and then processed as per the standard SEREX detectable serum antibodies to NY-ESO-1. All other serum͞ protocol (14, 15). antigen combinations were negative. Fibrosarcoma tissue from the NY-ESO-1 seropositive patient, FS, was available for CT RT-PCR Analysis. The cDNA preparations used as templates in the antigen typing by RT-PCR, and found to express 11͞12 different RT-PCR reactions were prepared by using 2.5 ␮g of total RNA CT antigen transcripts (NY-ESO-1, LAGE-1, MAGE-A1, -A3, in conjunction with the Superscript first strand synthesis kit -A4, -A10, BAGE, CT7, SSX1, -2, -4). Tissue from the NY- (Invitrogen, Life Technologies). PCR primers specific for select ESO-1 seropositive patient, MFH, was not available for CT SEREX-defined sarcoma antigens are listed below. The DNA antigen typing by RT-PCR. sequences of PCR primers specific for NY-ESO-1, LAGE-1, MAGE-1, MAGE-3, MAGE-4, MAGE-10, SCP-1, BAGE, CT7, Identification of Human Sarcoma Antigens by SEREX Analysis. Serum SSX1, SSX2, and SSX4, correspond to published primer se- samples from the two NY-ESO-1 seropositive patients (FS and quences (5, 6, 8, 13, 20, 25–27). Twenty-five-microliter PCR MFH) were used to immunoscreen cDNA libraries prepared mixtures, consisting of 2 ␮l of cDNA, 0.2 mM dNTP, 1.5 mM from the SW982 and SW1045 synovial sarcoma cell lines, both ␮ MgCl2, 0.25 M gene specific forward and reverse primers, and of which were shown to express eight or more known CT antigen 2.5 units of Platinum TaqDNA polymerase (Invitrogen Life transcripts (NY-ESO-1, MAGE-A1, -A3, -A4, -A10, BAGE, Technologies), were heated to 94°C for 2 min, followed by 35 CT7, and SSX4; and NY-ESO-1, LAGE-1, MAGE-A1, -A3, -A4, thermal cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min -A10, BAGE, CT7, SSX-1, and SSX-4, respectively). Further- (final cycle: 72°C for 5 min) by using a GeneAmp PCR System more, sera from the fibrosarcoma patient was also used to 9700 (Applied Biosystems). Resultant products were analyzed in 2% agarose͞Tris-acetate-EDTA gels. Primers were as follows. NY-SAR-12 5Ј͞3Ј: TGGCGCA- ʈNumber and tumor types of serum donors: 10 osteosarcoma, 7 Ewing sarcoma, 6 malignant GAAAGGAAAAGGAAAAT͞AGAGGTAGCTGGCAG- fibrous histocytoma, 6 leiomyosarcoma, 5 synovial sarcoma, 3 rhabdomyosarcoma, 2 Ј͞ Ј fibrosarcoma, 2 soft tissue sarcoma, 2 chondrosarcoma, 1 myxoid chondrosarcoma, 3 GATGTTAG. NY-SAR-35 5 3 : CTTGGTGCGATCAGCCT- giant-cell tumor, 2 liposarcoma, 1 lipoma, 1 myxoid liposarcoma, 2 desmoid, and 1 TAT͞TTGATGCATGAAAACAGAACTC. NY-SAR-41 5Ј͞3Ј: neurosarcoma.

2652 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0437972100 Lee et al. Downloaded by guest on September 29, 2021 immunoscreen a cDNA library derived from normal testis. In fetal tissue, and͞or less than three normal adult tissues were total, five independent SEREX immunoscreenings were per- further examined by RT-PCR. Gene products with restricted formed, leading to the identification of 113 distinct sarcoma EST profiles included five known CT antigens, NY-SAR-17͞ antigens, designated NY-SAR-1 through NY-SAR-113. These LAGE-1, NY-SAR-36͞SSX1, NY-SAR-43͞SSX4, NY-SAR- antigens are listed in Table 3, which is published as supporting 89͞SSX2 and NY-SAR-99͞SSX3, which are expressed exclu- information on the PNAS web site, www.pnas.org. The 113 sively in normal testis and a range of different tumor types SEREX-defined sarcoma antigens represent 91 known proteins (25–27). Nine other putative tissue-restricted antigens were and 22 uncharacterized gene products (novel, ESTs, KIAA identified, including five other known gene products, NY-SAR- series, FLJ series, MGC series, ORFs, DKFZ series). The 12͞nasopharyngeal specific protein 1(NESG1, ref. 28), NY- nucleotide sequences of all uncharacterized gene products (NY- SAR-73͞Protamine 2 (PRM2, ref. 29), NY-SAR-78͞TSP-NY SAR-3, -10, -16, -22, -23, -24, -27, -29, -35, -41, -48, -71, -77, -79, (unpublished data, UniGene cluster Hs.97643), NY-SAR-96͞ -80, -84, -88, -91, -95, -97, -104, -105, and -113) have been mitochondrial capsule selenoprotein (MCSP, ref. 30), and deposited in the GenBank database (sequential accession nos. NY-SAR-110͞NYD-SP14 (unpublished, Hs.98105), and four AY211909–AY211931). In terms of serum sources, 27 of the 113 uncharacterized gene products, NY-SAR-35 (Hs.128580), antigens were identified by using sera from a MFH patient and NY-SAR-41 (Hs.166670), NY-SAR-92 (Hs.368781), and NY- 86 were identified with FS sera. Of the 113 antigens identified, SAR-97 (not clustered). 95 were unique to a particular cDNA library screening, and 18 Two of the nine putative tissue restricted antigens, NY-SAR- antigens were identified in more than one library. 73͞PRM2 and NY-SAR-110͞NYD-SP14, were ubiquitously ex- pressed in a panel of 20 normal tissues as determined by Seroepidemiology of SEREX-Defined Sarcoma Antigens. There was RT-PCR (Table 2). The remaining seven were found to be little overlap between the antigens recognized by serum anti- expressed with frequencies ranging from 1 to 9 of 20 normal bodies from the MFH and FS patients. Only three of the 113 tissues. NY-SAR-35 and NY-SAR-78 were both testis-specific. antigens, NY-SAR-1͞TMF1, NY-SAR-4͞FH, NY-SAR-17͞ The mRNA expression profiles of NY-SAR-35 and NY-SAR-78 LAGE-1, were reactive with both these serum samples. Because were then analyzed in various malignant tissues by RT-PCR. serological reactivity to NY-ESO-1 was the criteria used in Transcripts encoding NY-SAR-78͞TSP-NY were not detected selecting sera for cDNA library screening, mutual immunore- in cancer. The tumor specimens examined included, lung cancer activity to the highly homologous (84% amino acid identity) (0 of 9), colon cancer (0 of 9), breast cancer (0 of 18), renal NY-SAR-17͞LAGE-1 antigen was expected, and in all likeli- cancer (0 of 11), esophageal cancer (0 of 12), ovarian cancer (0 hood is due to shared . To determine whether immune of 14), melanoma (0 of 18), and sarcoma (0 of 8). Thus, although recognition of NY-SAR-1͞TMF1and NY-SAR-4͞FH was can- NY-SAR-78͞TSP-NY is a ‘‘virtual CT antigen,’’ with 100% cer-related, allogeneic sera samples obtained from 33 normal identity with ESTs derived from prostate cancer and leukemia, blood donors and 39 sarcoma patients (various histologies) were its expression in cancer could not be verified in our RT-PCR tested for reactivity to these two antigens by SADA. Sera from series. two normal individuals and three sarcoma patients reacted with NY-SAR-35 mRNA was detected in a variety of tumor NY-SAR-1͞TMF1, suggesting the reactivity was unrelated to specimens, such as melanoma (1 of 16 specimens), sarcoma (2 of cancer, whereas NY-SAR-4͞FH reactivity was restricted to 26 specimens), lung cancer (5 of 29 specimens), breast cancer (3 IMMUNOLOGY cancer patients (see Discussion). Five of 39 (13%) sarcoma of 13 specimens), bladder cancer (5 of 12 specimens), esophageal patients had serum antibodies to NY-SAR-4͞FH. The serore- cancer (1 of 12 specimens) and ovarian cancer (1 of 12 speci- active sarcoma patients included 2 of 10 osteosarcoma patients, mens). NY-SAR-35 mRNA was not detected in colon cancer 1 of 6 MFH patients, 1 of 2 FS patients, and 1 of 7 Ewing sarcoma (n ϭ 9) or renal cancer (n ϭ 8). The CT-restricted expression patients. profile of NY-SAR-35 was confirmed by real time quantitative The cDNA sequences encoding the 113 sarcoma antigens were RT-PCR at 40 amplification cycles (Fig. 1). In these studies, also compared with sequences deposited in the cancer immu- NY-SAR-35 was expressed in normal testis at a level corre- nome database (http:͞͞www2.licr.org͞CancerImmunomeDB). sponding to 83.2 ag (1 ag ϭ 10Ϫ18 g), which was more than 1,000 These comparisons showed that 39 of the 113 sarcoma antigens times the level detected in the remaining 15 normal tissues. In defined in this study (34%) were also identified through SEREX two of nine non-small cell lung cancer specimens tested, NY- analysis of other tumor types (Table 1). To determine whether SAR-35 was expressed at levels that were 0.13 and 0.15 times the immune recognition of these 39 antigens was cancer-related, level detected in normal testis. Thus, on the basis of its immu- serum samples from normal individuals (n ϭ 33) were tested for nogenicity in a fibrosarcoma patient, and its restricted mRNA reactivity to these antigens. Twenty-three of the 39 antigens expression profile, NY-SAR-35 can be considered a novel CT (59%) had a serological profile that was not restricted to cancer antigen. In conformity with the proposed nomenclature for CT patients, whereas the remaining 16 antigens had a cancer-related antigens (31), NY-SAR-35 is designated CT-20. serological profile, reacting only with sera from cancer patients (sarcoma patients and serum source of SEREX database entry), The NY-SAR-35 Gene, Transcript, Putative Protein, and Orthologous and not with sera from normal individuals. Fourteen of these 16 Gene. Analysis of the human genome databases (www.ncbi.nlm. antigens reacted only with sera from a single sarcoma patient nih.gov͞genome and www.celera.com) mapped NY-SAR-35 to when tested for reactivity with additional allogeneic sarcoma Xq28. The NY-SAR-35 gene is Ϸ44 kb in length, spanning six sera (n ϭ 39). The remaining 2 antigens, NY-SAR-17͞LAGE-1 exons. Database analysis revealed no genomic sequences of high and NY-SAR-80͞FLJ12577 (see Discussion), reacted with 2 of similarity, suggesting that it is a single copy gene with no 39 and 3 of 39 sarcoma sera, respectively, and not with sera from additional family members. These results were supported by normal individuals (n ϭ 33). probing Southern blots of human genomic DNA with NY- SAR-35 cDNA (data not shown). Expression Patterns of mRNA Encoding Serologically Defined Sarco- The present SEREX analysis provided four overlapping NY- ma͞Testis Antigens in Normal and Malignant Tissues. A preliminary SAR-35 cDNA clones, ranging from 677 to 767 bp in length, all in silico mRNA expression profile of all gene products identified with identical 3Ј sequences. The NY-SAR-35 cDNA sequence in this study was carried out based on the tissue distribution of was identical to three ESTs (GenBank accession nos. AA909915, ESTs in the human EST database. Products with no EST AA906131, and AW593050) derived from the NFL࿝T࿝GBC࿝S1 matches, or those having EST matches limited to tumor tissue, mixed tissue (fetal lung, testis, germinal center B cell) cDNA

Lee et al. PNAS ͉ March 4, 2003 ͉ vol. 100 ͉ no. 5 ͉ 2653 Downloaded by guest on September 29, 2021 Table 1. Immunomic analysis of sarcoma͞testis antigens: Reactivity with sera from sarcoma patients, patients with other forms of cancer, and normal individuals Gene identity Cancer patient Normal NY-SAR-antigen (ugene cluster) seroreactivity* seroreactivity

1 TMF1 (Hs.267632) GC, BC, CC, SRC 2͞33 2 STAU (Hs.6113) PC, BC, SRC 3͞30 3 KIAA1536 (Hs.156667) BC, SRC 2͞33 6 RHAMM (Hs.72550) OC, SRC 1͞33 7 PINCH (Hs.112378) CC, GC, RC, BC, HN, ESO, AML, SRC 16͞21 11 U2AF1RS2 (Hs.171909) RC, HD, BC, GC, SRC 6͞33 13 ACTN1 (Hs.119000) BC, SRC 5͞30 15 RBM6 (Hs.173993) LC, SRC 0͞33 16 FLJ12785 (Hs.192742) TALL, SRC 0͞33 17 LAGE-1a (Hs.87225) BC, SRC 0͞33 18 SSSCA1 (Hs.25723) CC, SRC 0͞33 19 HEF1 (Hs.80261) RC, SRC 3͞33 28 PPIL4 (Hs.11065) BC, SRC 0͞33 29 FLJ13441 (Hs.232146) PN, SRC 6͞33 31 AUANTIG (Hs.75528) BC, GC, OC, SRC 2͞33 39 PSMD4 (Hs.148495) MEL, SRC 0͞33 44 LGALS1 (Hs.227751) RC, SRC 0͞33 45 STIP1 (Hs.75612) RC, SRC 4͞33 47 MIF (Hs.73798) MEL, SRC 0͞33 57 GCN5L2 (Hs.101067) PC, SRC 0͞33 61 ZNF282 (Hs.58167) RC, SRC 1͞33 63 USP19 (Hs.301373) OC, SRC 0͞33 64 USP16 (Hs.99819) PN, SRC 2͞33 66 ROCK1 (Hs.17820) RC, BC, CC, SRC 1͞33 74 RANBP2 (Hs.199179) BC, GL, BC, SRC 2͞33 77 KIAA0992 (Hs.194431) PC, SRC 4͞15 80 FLJ12577 (Hs.87159) GC, SRC 0͞33 81 SDS3 (Hs.20104) GC, SRC 4͞16 82 NYCO45 (Hs.160881) CC, SRC 0͞33 89 SSX2 (Hs.289105) BC, MEL, SRC 0͞33 90 UACA (Hs.49753) BC, ESO, SRC 4͞25 93 NYBR15 (Hs.178175) BC, SRC 1͞12 98 OIP2 (Hs.274170) BC, SRC 0͞33 99 SSX3 (Hs.178749) BC, MEL, SRC 2͞30 101 RANBP2L1 (Hs.179825) GL, BC, SRC 3͞33 102 RBPJK (Hs.356806) GC, RC, BC, MEL, SRC 1͞16 103 Hsp40 (Hs.94) HN, HCC, SRC 0͞33 108 EIF4G (Hs.25732) GC, SRC 5͞27 112 PMSCL1 (Hs.91728) CC, SRC 0͞33

AML, acute myelogenous leukemia; BC, breast cancer; CC, colon cancer; GC, gastric cancer; GL, glioma; HCC, hepatocellular carcinoma; HN, head and neck cancer; LC, lung cancer; MEL, melanoma; OC, ovarian cancer; PC, prostate cancer; PN, pancreatic cancer; RC, renal cancer; SRC, sarcoma; TALL, T cell acute lymphocytic leukemia. *Determined by sequence comparisons with the SEREX database (www2.licr.org͞CancerImmunomeDB͞).

library, and found in UniGene cluster Hs.128580, as well as 4 data suggest that NY-SAR-35 is a secreted or membrane bound ESTs (GenBank accession nos. BC034320, AK098602, protein. BG771667, and BI465380) derived from a testis cell line, and To identify a murine orthologue of NY-SAR-35, the putative found in Unigene cluster Hs.375082. To obtain a full-length human NY-SAR-35 protein sequence was used to search a NY-SAR-35 transcript, 5Ј RACE was undertaken, yielding 262 translated nonredundant nucleotide database by using the bp of additional 5Ј DNA sequence. Thus, the full-length NY- TBLASTN tool of the NCBI (www.ncbi.nlm.nih.gov͞blast͞ SAR-35 transcript is Ϸ1,029 bp (GenBank accession no. Blast.cgi). A hypothetical mouse protein, termed XP࿝150408, AY211917), a size that is in agreement with the 1.1-kb hybrid- generated from a conceptual translation of the mouse X chro- ization signal seen in Northern blots of testis mRNA probed with mosome, was found to have 57% identity (49͞85 aa) with NY-SAR-35 cDNA (data not shown). NY-SAR-35. Using nucleotide primers corresponding to se- The NY-SAR-35 transcript encodes an ORF of 255 aa (bp quences encoding XP࿝150408, 5Ј and 3Ј RACE reactions were 68–895) with a predicted molecular mass of 29.2 kDa. It is undertaken by using mouse testis cDNA. By combining 5Ј and 3Ј identical to the hypothetical protein, XM098959, predicted from RACE products, a 1,202 bp cDNA was identified (GenBank Genefinder analysis of human chromosome X sequences. The accession no. AY214130). This cDNA encoded a putative full putative NY-SAR-35 protein has a signal peptide, a transmem- length mouse protein of 238 aa which is 41% identical to human brane domain, and a cysteine-rich trefoil͞P-domain, found in NY-SAR-35, with conservation of the trefoil and transmem- several secreted proteins of the gastrointestinal tract (32). These brane domains. This murine NY-SAR-35 (mNY-SAR-35)

2654 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0437972100 Lee et al. Downloaded by guest on September 29, 2021 Table 2. Analysis of mRNA expression by RT-PCR of 9 of the 113 mosome X. Analysis of this sequence showed the mNY-SAR-35 sarcoma͞testis antigens gene is composed of Ϸ42,600 nucleotides and seven exons. NY-SAR antigen* Discussion Tissue 12 35 41 73 78 92 96 97 110 Immunohistochemical analyses have shown that CT antigens, Brain ϪϪϪ ϩ ϪϪϪϪ ϩ such as NY-ESO-1 and MAGE-A, are expressed in 80% of Kidney ϪϪϪ ϩ ϪϪϪϪ ϩ synovial sarcomas, and that the expression is often homogeneous Liver ϪϪϪ ϩ ϪϪϪϪ ϩ throughout the tumor (21, 22). Because CT antigen expression Pancreas ϪϪϪ ϩ ϪϪϪϪ ϩ rarely exceeds 40% of a given cancer type (17, 18, 20, 26), and Placenta ϩϪϪ ϩ ϪϪϪϪ ϩ is generally heterogenous (33, 34), this CT antigen expression Testis ϩϩϩ ϩ ϩϩϩϩ ϩ profile in synovial sarcoma was extraordinary. To identify ad- Fetal brain ϪϪϩ ϩ ϪϪϩϩ ϩ ditional immunoreactive antigens in sarcoma, the present com- Small intestine ϪϪϪ ϩ ϪϪϪϪ ϩ prehensive SEREX analysis was undertaken by using cDNA Heart ϪϪϪ ϩ ϪϪϪϪ ϩ libraries prepared from two synovial cell sarcoma cell lines, Prostate ϪϪϪ ϩ ϪϪϩϩ ϩ SW982 and SW1045, both of which express multiple CT antigens Adrenal ϪϪϪ ϩ ϪϪϩϩ ϩ (e.g., NY-ESO-1, BAGE, MAGE-A3, CT7, and SSX4). A testis Spleen ϩϪϪ ϩ Ϫϩϩϩ ϩ cDNA library was also immunoscreened to increase the proba- Colon ϩϪϩ ϩ ϪϪϪϪ ϩ bility of isolating unidentified CT antigens that are immunogenic Stomach ϪϪϪ ϩ ϪϪϪϪ ϩ in cancer patients. The presence of serum antibody to a panel of Lung ϩϪϩ ϩ ϪϪϪϩ ϩ CT antigens was used to identify sarcoma patients who were Bladder ϪϪϩ ϩ ϪϪϪϩ ϩ actively mounting a humoral immune response to tumor-related Ovary ϩϪϩ ϩ ϪϪϪϩ ϩ antigens, and who could serve as serum sources for immuno- Breast ϪϪϪ ϩ ϪϪϪϩ ϩ screening. Although CT antigen expression is frequent in sar- Cervix ϪϪϪ ϩ ϪϪϪϪ ϩ coma tissue (21, 22, 35, 36), we detected antibodies in only two Skeletal muscle ϪϪϪ ϩ ϪϪϪϪ ϩ of 54 sarcoma patients (4%) to just one of eight CT antigens Total no. of 6͞20 1͞20 6͞20 20͞20 1͞20 2͞20 5͞20 9͞20 20͞20 (NY-ESO-1). In particular, none of the serum samples from the positive five synovial sarcoma patients had detectable anti-CT antigen tissues reactivity, and were therefore not used for immunoscreening purposes. Interestingly, humoral immune responses to SSX *Unigene clusters: NY-SAR-12, Hs.158450; NY-SAR-35, Hs.128580; NY-SAR-41, antigens were detected in sarcoma patients by SADA, but were Hs.166670; NY-SAR-73, Hs.2324; NY-SAR-78, Hs.97643; NY-SAR-92, not detected by ELISA, suggesting SADA may be a more Hs.368781; NY-SAR-96, Hs.111850; NY-SAR-97, Hs.128836; NY-SAR-110, sensitive method compared with ELISA. This may be due to Hs.98105. qualitative differences in the assays, such as the use of denatured (ELISA) versus native (SADA) recombinant proteins, or quan- titative differences, such as the amount of recombinant protein cDNA sequence was used to search mouse genome sequences IMMUNOLOGY ͞ ͞ ͞ binding to the plastic (ELISA) or nitrocellulose (SADA) support (www.ncbi.nlm.nih.gov genome seq MmBlast.html) yielding matrices. an identical genome sequence, NW 042622, from mouse chro- In the current study, 113 distinct antigens were isolated from these three cDNA libraries following SEREX immunoscreening with sera from two NY-ESO-1 seroreactive sarcoma patients. Only 18 of 113 antigens (16%) were isolated from more than one cDNA library, thus underlining the importance of incorporating multiple cDNA libraries into large-scale SEREX analyses of the cancer immunome. In addition to the LAGE-1͞NY-ESO-2 antigen (NY-SAR-17), which is highly homologous to NY- ESO-1, only two other antigens, NY-SAR-4͞FH, and NY-SAR- 80͞FLJ12577, were recognized by antibodies present in multiple sarcoma patients (5 of 39 and 3 of 39 sarcoma patients, respec- tively), but not in normal individuals (n ϭ 33). This serological response to NY-SAR-4͞FH is of considerable interest given the recent finding that germ-line mutations in the FH gene are associated with a predisposition to uterine and cutaneous leiomyomata, and also renal cell carcinoma (37) and is a target of somatic mutation in sarcoma (38), suggesting that the immune response is directed against mutated epitopes. NY-SAR-80͞ FLJ12577 is an uncharacterized member of the Mo25 protein family, an evolutionarily conserved family of proteins with no known function. Analysis of the tissue distribution and frequency of EST sequences homologous to NY-SAR-80͞FLJ12577 indi- cate widespread mRNA expression, with a preponderance of malignant tissue-derived homologous ESTs suggesting possible overexpression in cancer. Fig. 1. Quantitative real-time RT-PCR analysis of NY-SAR-35 mRNA in various Overall, the relative infrequency of overlapping humoral normal tissues and non-small cell lung cancer specimens. NY-SAR-35 was expressed in normal testis (83.2 ag) at a level that was Ͼ1,000 times the level immune responses among the population of sarcoma patients detected in all other normal tissues. In two of nine cases of non-small cell analyzed in the current study is contrary to previous findings for lung cancer examined, the level of NY-SAR-35 expression was equivalent to colon (23), breast (14), and renal cancers (15), in which a subset 0.15 (12.5 ag) and 0.13 (10.8 ag) times the level detected in normal testis, or of antigens were mutually seroreactive in a cancer related Ϸ100 times the level detected in normal tissues. manner. These results suggest that the immune response to

Lee et al. PNAS ͉ March 4, 2003 ͉ vol. 100 ͉ no. 5 ͉ 2655 Downloaded by guest on September 29, 2021 sarcoma is either highly variable, or that distinct sarcoma cancer. Their tissue restricted expression profile and immuno- histiotypes have distinct immunomes. Thirty-nine of the 113 genicity indicate that these 12 antigens should be further ana- sarcoma antigens (34%) defined in the current study were also lyzed with regard to their immunotherapeutic potential. Of identified through SEREX analysis of other tumor types. Twen- particular interest is NY-SAR-35, which represents a recently ty-three of these 39 antigens (59%) reacted with sera from defined CT antigen apparently expressed exclusively in normal normal individuals, indicating that the humoral immune re- testis, as well as melanoma, sarcoma, lung cancer, esophageal sponse to a large proportion of SEREX-defined antigens is not cancer, ovarian cancer, and breast cancer. Like several other CT related to cancer. antigens, NY-SAR-35, maps to chromosome X, but in contrast The current SEREX analysis of sarcoma led to the isolation to other CT antigens (e.g., MAGE, NY-ESO-1, GAGE, and SSX), NY-SAR-35 is not a member of a multigene family. The of 12 tissue-restricted gene products, including six known testis- ͞ ͞ presence of a signal sequence, a putative transmembrane do- restricted antigens (NY-SAR-17 LAGE-1, NY-SAR-36 SSX1, main, and a Trefoil domain suggests that NY-SAR-35 may be an NY-SAR-43͞SSX4, NY-SAR-78͞TSP-NY, NY-SAR-89͞SSX2, ͞ extracellular or plasma membrane associated protein. Thus, in and NY-SAR-99 SSX3). Four of these differentially expressed addition to being a potential cancer vaccine target, NY-SAR-35 antigens (NY-SAR-35, NY-SAR-41, NY-SAR-92, and NY- may also be a target for of therapeutic antibodies. SAR-97) are novel gene products, and the remaining two tissue-restricted antigens (NY-SAR-12͞NESG1 and NY-SAR- We thank Mr. Darren Santiago of the Ludwig Institute for Cancer 96͞MCSP) have not been previously studied in relation to Research, New York Branch, for his excellent technical assistance.

1. Van Der Bruggen, P., Zhang, Y., Chaux, P., Stroobant, V., Panichelli, C., 19. Stockert, E., Ja¨ger, E., Chen, Y.-T., Scanlan, M. J., Gout, I., Karbach, J., Arand, Schultz, E. S., Chapiro, J., Van Den Eynde, B. J., Brasseur, F. & Boon, T. (2002) M., Knuth, A. & Old, L. J. (1998) J. Exp. Med. 187, 1349–1354. Immunol. Rev. 188, 51–64. 20. Sahin, U., Tureci, O¨ ., Chen, Y.-T., Seitz, G., Villena-Heinsen, C., Old, L. J. & 2. Rosenberg, S. A. (2001) Nature 411, 380–384. Pfreundschuh, M. (1998) Int. J. Cancer 78, 387–389. 3. Preuss, K. D., Zwick, C., Bormann, C., Neumann, F. & Pfreundschuh, M. 21. Jungbluth, A. A., Antonescu, C. R., Busam, K. J., Iversen, K., Kolb, D., Coplan, (2002) Immunol. Rev. 188, 43–50. K., Chen, Y.-T., Stockert, E., Ladanyi, M. & Old, L. J. (2001) Int. J. Cancer 94, 4. Chen, Y.-T., Scanlan, M. J., Obata, Y. & Old, L. J. (2000) in Principles and 252–256. Practice of Biologic Therapy of Cancer, ed. Rosenberg, S. A. (Lippincott 22. Antonescu, C. R., Busam, K. J., Iversen, K., Kolb, D., Coplan, K., Spagnoli, Williams & Wilkins, Philadelphia), pp. 557–570. G. C., Ladanyi, M., Old, L. J. & Jungbluth, A. A. (2002) Hum. Pathol. 33, 5. van der Bruggen, P., Traversari, C., Chomez, P., Lurquin, C., De Plaen, E., Van 225–229. den Eynde, B., Knuth, A. & Boon, T. (1991) Science 254, 1643–1647. 23. Scanlan, M. J., Welt, S., Gordon, C. M., Chen, Y.-T., Gure, A. O., Stockert, E., 6. Gaugler, B., Van den Eynde, B., van der Bruggen, P., Romero, P., Gaforio, J. J., Jungbluth, A. A., Ritter, G., Ja¨ger, D., et al. (2002) Cancer Res. 62, 4041–4047. De Plaen, E., Lethe, B., Brasseur, F. & Boon, T. (1994) J. Exp. Med. 179, 24. Guillaudeux, T., Gomez, E., Onno, M., Drenou, B., Segretain, D., Alberti, S., 921–930. 55, 7. Kawakami, Y., Eliyahu, S., Delgado, C. H., Robbins, P. F., Rivoltini, L., Lejeune, H., Fauchet, R., Jegou, B. & Le Bouteiller, P. (1996) Biol. Reprod. Topalian, S., L., Miki, T. & Rosenberg, S. A. (1994) Proc. Natl. Acad. Sci. USA 99–110. 91, 3515–3519. 25. Lethe, B., Lucas, S., Michaux, L., De Smet, C., Godelaine, D., Serrano, A., De 8. Boel, P., Wildmann, C., Sensi, M. L., Brasseur, R., Renauld, J. C., Coulie, P., Plaen, E. & Boon, T. (1998) Int. J. Cancer 76, 903–908. Boon, T. & van der Bruggen, P. (1995) 2, 167–175. 26. Tu¨reci, O¨ ., Chen, Y.-T., Sahin, U., Gure, A. O., Zwick, C., Villena, C., Tsang, 9. Skipper, J. C., Hendrickson, R. C., Gulden, P. H., Brichard, V., Van Pel, A., S., Seitz, G., Old, L. J. & Pfreundschuh, M. (1998) Int. J. Cancer 77, 19–23. Chen, Y., Shabanowitz, J., Wolfel, T., Slingluff , C. L., Jr., et al. (1996) J. Exp. 27. Gure, A. O., Tu¨reci, O¨ ., Sahin, U., Tsang, S., Scanlan, M. J., Ja¨ger, E., Knuth, Med. 183, 527–534. A., Pfreundschuh, M., Old, L. J. & Chen, Y.-T. (1997) Int. J. Cancer 72, 10. Cox, A. L., Skipper, J., Chen, Y., Henderson, R. A., Darrow, T. L., Shabano- 965–971. witz, J., Engelhard, V. H., Hunt, D. F. & Slingluff, C. L., Jr. (1994) Science 264, 28. Li, Z., Yao, K. & Cao, Y. (1999) Gene 237, 235–240. 716–719. 29. Domenjoud, L., Fronia, C., Uhde, F. & Engel, W. (1998) Nucleic Acids Res. 16, 11. Pascolo, S., Schirle, M., Guckel, B., Dumrese, T., Stumm, S., Kayser, S., Moris, 7733. A., Wallwiener, D., Rammensee, H. G. & Stevanovic, S. A. (2001) Cancer Res. 30. Aho, H., Schwemmer, M., Tessman, D., Murphy, D., Mattei, G., Engel, W. & 61, 4072–4077. Adham, I. M. (1996) Genomics 32, 184–190. ¨ 12. Sahin, U., Tu¨reci, O., Schmitt, H., Cochlovius, B., Johannes, T., Schmits, R., 31. Chen, Y.-T., Gure, A. O., Tsang, S., Stockert, E., Ja¨ger, E., Knuth, A. & Old, Stenner, F., Luo, G., Schobert, I. & Pfreundschuh, M. (1995) Proc. Natl. Acad. L. J. (1998) Proc. Natl. Acad. Sci. USA 95, 6919–6923. Sci. USA 92, 11810–11813. 32. Hoffmann, W. & Hauser, F. (1993) Trends Biochem. Sci. 18, 239–243. 13. Chen, Y.-T., Scanlan, M. J., Sahin, U., Tureci, O., Gure, A. O., Tsang, S., 33. Jungbluth, A. A., Chen, Y.-T., Stockert, E., Busam, K. J., Kolb, D., Iversen, K., Williamson, B., Stockert, E., Pfreundschuh, M. & Old, L. J. (1997) Proc. Natl. Coplan, K., Williamson, B., Altorki, N. & Old, L. J. (2001) Int. J. Cancer 92, Acad. Sci. USA 94, 1914–1918. 856–860. 14. Scanlan, M. J., Gout, I., Gordon, C. M., Williamson, B., Stockert, E., Gure, 34. Jungbluth, A. A., Busam, K. J., Kolb, D., Iversen, K., Coplan, K., Chen, Y.-T., A. O., Ja¨ger, D., Chen, Y.-T., Mackay, A., O’Hare, M. J. & Old, L. J. (2001) Spagnoli, G. C. & Old, L. J. (2000) Int. J. Cancer 85, 460–465. Cancer Immunity 1,4. 15. Scanlan, M. J., Gordan, J. D., Williamson, B., Stockert, E., Bander, N. H., 35. Naka, N., Araki, N., Nakanishi, H., Itoh, K., Mano, M., Ishiguro, S., de Bruijn, Jongeneel, V., Gure, A. O., Ja¨ger, D., Ja¨ger, E., Knuth, A., et al. (1999) Int. D. R., Myoui, A., Ueda, T. & Yoshikawa, H. (2002) Int. J. Cancer 98, 640–642. J. Cancer 83, 456–464. 36. Martelange, V., De Smet, C., De Plaen, E., Lurquin, C. & Boon, T. (2000) 16. Ja¨ger, D., Stockert, E., Gure, A. O., Scanlan, M. J., Karbach, J., Ja¨ger, E., Cancer Res. 60, 3848–3855. Knuth, A., Old, L. J. & Chen, Y. T. (2001) Cancer Res. 61, 2055–2061. 37. Tomlinson, I. P., Alam, N. A., Rowan, A. J., Barclay, E., Jaeger, E. E., Kelsell, 17. Scanlan, M. J., Gure, A. O., Jungbluth, A. A., Old, L. J. & Chen, Y. T. (2002) D., Leigh, I., Gorman, P., Lamlum, H., et al. (2002) Nat. Genet. 30, 406–410. Immunol. Rev. 188, 22–32. 38. Kiuru, M., Lehtonen, R., Arola, J., Salovaara, R., Jarvinen, H., Aittomaki, 18. Van den Eynde, B. J. & van der Bruggen, P. (1997) Curr. Opin. Immunol. 9, K., Sjoberg, J., Visakorpi, T., Knuutila, S., et al. (2002) Cancer Res. 62, 684–693. 4554–4557.

2656 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0437972100 Lee et al. Downloaded by guest on September 29, 2021