DOCSLIB.ORG

Detection of Antimicrobial Traits in Fluorescent Pseudomonads And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Detection of Antimicrobial Traits in Fluorescent Pseudomonads And 3 Biotech (2016) 6:227 DOI 10.1007/s13205-016-0538-z ORIGINAL ARTICLE Detection of antimicrobial traits in fluorescent pseudomonads and molecular characterization of an antibiotic pyoluteorin 1 1 2 1 3 3 J. U. Vinay • M. K. Naik • R. Rangeshwaran • G. Chennappa • Sohel S. Shaikh • R. Z. Sayyed Received: 25 July 2016 / Accepted: 3 October 2016 / Published online: 20 October 2016 Ó The Author(s) 2016. This article is published with open access at Springerlink.com Abstract Thirty isolates of fluorescent pseudomonads Keywords Antibiotic Á Fluorescent pseudomonads Á were obtained from rhizosphere of different crops in Rai- Pyoluteorin Á TLC Á TOF–MS chur, India. The fluorescent pseudomonad strains were characterized in vitro for biochemical traits, antimicrobial traits, and pyoluteorin antibiotic production. All the iso- Introduction lates that showed fluorescent pigment production under UV light were rod shaped, Gram negative, positive for oxidase, Some of the rhizobacteria positively influence on plant catalase and citrate utilization tests, and negative for indole growth and health which were referred as Plant Growth test. Out of 30 isolates, 07 isolates were positive for HCN Promoting Rhizobacteria (PGPR). These rhizobacteria are production, 15 isolates were positive for H2S production, abundant in rhizosheric soil of several crops, and these and all the isolates were positive for siderophore produc- maintained the ecological balance in niche needed for their tion. Among all the isolates, RFP-22 showed the maximum survival. These PGPR played a pivotal role in both growth percent inhibition of mycelium (46.66 %) of Rhizoctonia promotion and plant disease control. The mechanisms of solani, the pathogen, and the remaining isolates showed the growth promotion by these PGPRs are complex and appear moderate to least inhibition of mycelium growth of R. to comprise both changes in the microbial balance in the solani. The 16S rRNA analysis confirmed that the antibi- rhizosphere and alterations in host plant physiology (Bashan otic positive isolates belonged to genus Pseudomonas. The and Bashan 2005). Biological control of diseases by plant amplification of 779 bp region in isolates RFP- 4 and RFP- growth promoting rhizobacteria was well-established phe- 19 corresponded to pyoluteorin antibiotic-coding pltB nomenon (Shaikh and Sayyed 2015; Shaikh et al. 2016). The gene. Further characterization of pyoluteorin antibiotic antibiotics, HCN, H2S, and siderophore have been shown to through TLC and TOF–MS analysis confirmed the pres- play a major role in the suppression of several plant patho- ence of pyoluteorin at 274.26 (g/mol) peak and 2.10 min gens (Handelsman and Stabb 1996; Shaikh et al. 2014). retention time. Biochemical and molecular analyses con- Among rhizobacteria, Pseudomonas sp. are often used as firmed the antagonism of Pseudomonas and isolate through model root-colonizing bacteria (Lugtenberg et al. 2001). The pyoluteorin production. plant growth promoting strain fluorescent Pseudomonas are known to produce an array of antibiotics, such as 2,4-di- acetylphloroglucinol (2,4-DAPG), pyoluteorin (PLT), & R. Z. Sayyed pyrrolnitrin (PRN), phenazine-1-carboxyclic acid (PCA), [email protected] 2-hydroxyphenazines, phenazine-1-carboxamide (PCN), 1 Department of Plant Pathology, University of Agricultural rhamnolipids, oomycin A, cepaciamide A, ecomycins, vis- Science, Raichur, India cosinamide, and karalicin which are capable of suppressing a 2 Department of Microbiology, NBAIR, Bangalore, India broad spectrum of plant pathogens. Among them pyolute- 3 orin, 2,4-DAPG and phenazine are major determinants in Department of Microbiology, PSGVP Mandal’s, Shri S I Patil Arts, G B Patel Science and STSKVS Commerce College, biocontrol activity (Borauh and Kumar 2002). Shahada Dist, Nandurbar, MS 425 409, India 123 227 Page 2 of 11 3 Biotech (2016) 6:227 Pyoluteorin was aromatic phenolic polyketide antibiotic oxidase and catalase tests were carried out to confirm the that was first isolated from P. aeruginosa (Takeda 1958) aerobic nature of pseudomonads. In oxidase test, a culture and later from P. fluorescens strains Pf-5 and CHA0 grown for 24 h in NA supplemented with 1 % glucose was (Bencini et al. 1983). PLT has bactericidal, herbicidal, and used. Loopful cells were rubbed onto a filter paper fungicidal activities, in particular against Pythium spp. impregnated with 1 % (w/v) aqueous tetra-methyl-p-phe- (Takeda 1958). Howell and Stipanovic (1980) first estab- nylene diamine dihydrochloride solution. A change in the lished the importance of pyoluteorin antibiotic production colour of the cultures to deep purple within 10 s was reg- in suppression of seedling pathogens, such as Pythium istered as a positive result (Kovacs 1956). In catalase test, a ultimum, causing damping off in cotton using P. fluo- loopful of 48 h growth of the test bacterium was smeared rescens pf-5. Similarly, the efficacy of P. fluorescens (Pf-5) on a slide and was covered with few drops of hydrogen could be improved by altering the expression of the peroxide. The reaction was noticed as positive if gas pyoluteorin producing genes in such a way that effective bubbles were produced. concentrations of the antibiotic are reached in the seed For indole test, tryptone broth was inoculated with a spermosphere more quickly after a seed was planted (Kraus small amount of a pure culture of Pseudomonas sp. and and Loper 1995). Genetic analysis of several Pseudomonas incubated at 35 °C for 48 h. Five drops of Kovac’s reagent strains has also established a positive correlation between were added directly to the tubes to test the indole pro- antibiotic production and disease suppression (Homma and duction. The reaction was noticed as positive if there is a Suzui 1989). formation of a pink-to-red colour in the reagent layer on The present investigation is aimed at screening of top of the medium. pyoluteorin gene and antimicrobial traits in several fluo- rescent pseudomonad strains of different crop rhizospheres Characterization of antimicrobial traits through PCR and to characterize pyoluteorin antibiotic in fluorescent pseudomonads through thin-layer chromatography and Time-of-Flight– Mass spectroscopy (TOF–MS). Hydrogen sulfide test Bacterial isolates were stab inoculated to test tube con- Materials and methods taining the SIM agar medium and were incubated at 37 °C for 48 h. Black colouration along the line of stab inocu- Isolation and biochemical characterization lation indicated positive reaction (Vanitha et al. 2009). of fluorescent Pseudomonas isolates Hydrogen cyanide production Isolation of fluorescent Pseudomonas was carried out by serial dilution technique. The 0.1 ml of 10-5 and 10-6 was A strip of sterilized filter paper saturated with a solution placed on King’s B medium to isolate the colonies. Plates containing picric acid, 0.5 %, and sodium carbonate were incubated at 28 °C for 48 h. After incubation, well- (2.0 %) was placed inside the NA slants amended with separated individual colonies with yellow green and blue glycine (4.4 g/l) and FeCl3Á6H2O (0.3 mM) which were white pigments were marked and detected by viewing already inoculated with test bacteria and hermetic sealing under UV light. was done. Change in colour of the filter paper from yellow Gram staining and pigment production in different iso- to brown in 5 days was considered as positive reaction lates of fluorescent Pseudomonas was carried out according (Bakker and Schippers 1987). to the Laboratory Guide for Identification of Plant Patho- genic Bacteria published by the American Phytopatholog- Siderophore production ical Society (Schaad 1992). Simmon’s citrate agar medium was adjusted to pH 7.0, Siderophore production was determined by Chrome Azurol and then, the slants were prepared. Culture was streaked in S (CAS) assay. The CAS agar medium was prepared the slant. The citrate utilization positive reaction was according to procedure given by Schwayn and Neilands indicated by the change in the colour of the media from (1987). The bacterial culture streaked on the CAS plate. green to Prussian blue (Simmons 1926). Change of medium colour to orange or presence of light Oxidase, catalase, and indole tests were also carried out orange halo surrounding the bacterial growth indicates as per the protocol given by Vanitha et al. (2009). The siderophore production by the bacterial isolates. 123 3 Biotech (2016) 6:227 Page 3 of 11 227 Screening of fluorescent pseudomonads for testing reverse primer rP2 (ACGGCTACCTTGTTACGACTT). bioefficacy against Rhizoctonia solani by dual PCR cocktail (50 ll) contained 50 pM of primer, 50 ng of culture genomic DNA, 1X TaqDNA polymerase buffer, 1 U of TaqDNA polymerase, 0.2 mM of each dNTPs, and 1.5 mM The pseudomonads were streaked 1 day earlier to the test MgCl2. The thermal cycling program for the amplification pathogen. They were incubated for control reaches of 16S rRNA gene consisted of initial denaturation at periphery of plates. The diameter of the colony of the 94 °C for 1 min, 30 cycles of denaturation at 94 °C for fungus was measured in both directions and average was 1 min, annealing at 46 °C for 30 s, and extension at 72 °C recorded and the percent inhibition on growth of the test for 4 min with a final extension at 72 °C for 10 min. fungus was calculated using the formula given below by Amplification was performed in a DNA thermal cycler. A (Vincent 1927): 5-ll aliquot of each amplification product was elec- C À T trophoresed on a 1.5 % agarose gel in 19 TAE buffer at I ¼ Â 100 C 50 V for 45 min, stained with ethidium bromide and the PCR products were visualized with a UV transilluminator. where I = Percent inhibition, C = Radial growth of fun- gus in control, and T = Radial growth of fungus in Detection of pyoluteorin antibiotic through thin- treatment. layer chromatography (TLC) Molecular characterization of pyoluteorin gene The pyoluteorin antibiotic production by strain of P. putida was determined using a modified method of Chang and Genomic DNA isolation Blackwood (1969).
Load more

Recommended publications
  • Document Downloaded From: the Final Publication Is Available At
    Document downloaded from: http://hdl.handle.net/10459.1/65019 The final publication is available at: https://doi.org/10.1016/j.lwt.2017.02.029 Copyright cc-by-nc-nd, (c) Elsevier, 2017 Està subjecte a una llicència de Reconeixement-NoComercial- SenseObraDerivada 4.0 de Creative Commons 1 Studies on the biocontrol mechanisms of Pseudomonas graminis strain CPA-7 2 against food-borne pathogens in vitro and on fresh-cut melon. 3 Cyrelys Collazo1, Maribel Abadias2, Ingrid Aguiló-Aguayo2, Isabel Alegre1, Empar 4 Chenoll3, Inmaculada Viñas1* 5 1Food Technology Department, University of Lleida. Agrotecnio Lleida, Spain. 6 2IRTA, Postharvest, Edifici Fruitcentre, Parc Científic i Tecnològic Agroalimentari de 7 Lleida, Spain. 8 3Department of Food Biotechnology, Biópolis S.L., Valencia, Spain. 9 *Corresponding author. Tel.: +34973702677; fax: +34973702596. 10 Email: [email protected] 11 Abstract 12 The present study was aimed at gaining insight into the mode of action of the 13 antagonistic bacteria Pseudomonas graminis CPA-7, which has been previously 14 identified as an effective biocontrol agent against Listeria monocytogenes, Salmonella 15 enterica and Escherichia coli O157:H7 on fresh-cut fruit. In vitro experiments did not 16 reveal any antimicrobial or proteolytic activity on solid media or any biosurfactant 17 activity on hydrophobic surfaces. Metabolites produced by CPA-7 in two different 18 culture media and on 'Galia' melon were unable to inhibit L. monocytogenes 19 populations on 'Galia' melon plugs at 25 °C or 5 °C. In contrast, at 25 °C the population 20 of this pathogen on 'Galia' plugs was reduced by 2.1 and 3.3 log-units when co- 21 inoculated with the antagonist in water, after 24 and 48 h, respectively.
    [Show full text]
  • The Potential of Pseudomonas Bacteria As Biocontrol Agents Against Multiple Plant Pathogens
    The potential of Pseudomonas bacteria as biocontrol agents against multiple plant pathogens Sophie Elizabeth Clough Doctor of Philosophy University of York Biology September 2020 Abstract Plant pathogenic bacterium Ralstonia solanacearum (the causative agent of bacterial wilt), and plant parasitic nematodes Globodera pallida (white potato cyst nematode) and Meloidogyne incognita (root-knot nematode) have devastating impacts on several economically important crops globally. While these pathogens are traditionally treated with agrochemicals, their use is in decline due to legal restrictions and harmful impacts on the environment. One environmentally- friendly alternative to agrochemicals could be biocontrol, which takes advantage of naturally occurring plant growth-promoting bacteria. While recent studies have shown promising results, there is no clear screening pipeline to identify and validate successful biocontrol strains with broad activity against multiple different pathogen species. This thesis establishes a screening method to identify effective Pseudomonas biocontrol agents to both bacterial and nematode pathogens using a combination of in vitro laboratory assays, comparative genomics, mass spectrometry and greenhouse experiments. It was found that Pseudomonas strains suppressed both pathogens, with strains CHA0, MVP1-4 and Pf-5 showing high activity. Several secondary metabolite clusters were identified and the suppressive role of DAPG, orfamides A and B and pyoluteorin antimicrobials were experimentally verified. Experimental evolution was used to show that R. solanacearum can evolve tolerance to Pseudomonas strains during prolonged exposure in vitro. However, further work is needed to test whether the evolution of tolerance could limit Pseudomonas biocontrol efficiency in the field. High nematode suppression by all Pseudomonas strains was observed in laboratory assays. Moreover, clear behavioural and developmental changes were observed in response to tested individual compounds.
    [Show full text]
  • Strain-Dependent Diversity in the Pseudomonas Aeruginosa Quorum
    Strain-dependent diversity in the Pseudomonas PNAS PLUS aeruginosa quorum-sensing regulon Sudha Chugania, Byoung Sik Kimb, Somsak Phattarasukola, Mitchell. J. Brittnachera, Sang Ho Choib, Caroline S. Harwooda, and E. Peter Greenberga,1 aDepartment of Microbiology, University of Washington, Seattle, WA 98195; and bDepartment of Agricultural Biotechnology, Seoul National University, Seoul 151-921, South Korea Contributed by E. Peter Greenberg, August 17, 2012 (sent for review May 21, 2012) Quorum sensing allows bacteria to sense and respond to changes P. aeruginosa has been isolated from diverse environments. It in population density. Acyl-homoserine lactones serve as quorum- can be found in soil and water, as a member of the normal sensing signals for many Proteobacteria, and acyl-homoserine microbiota of eukaryotes or as an opportunistic pathogen in lactone signaling is known to control cooperative activities. a wide range of hosts including plants and humans. Comparative Quorum-controlled activities vary from one species to another. genomic analyses of multiple P. aeruginosa strains have identified Quorum-sensing controls a constellation of genes in the opportu- core (shared) and accessory (strain-variable) genome sequences nistic pathogen Pseudomonas aeruginosa, which thrives in a num- (4). Evidence indicates that accessory genes encode functions as- ber of habitats ranging from soil and water to animal hosts. We sociated with adaptation and niche diversification (4). P. aeruginosa hypothesized that there would be significant variation in quorum- has a quorum-sensing system comprising two AHL synthases and sensing regulons among strains of P. aeruginosa isolated from three receptors. The LasI synthase produces 3OC12-HSL, for different habitats and that differences in the quorum-sensing reg- which there are two receptors, LasR and QscR.
    [Show full text]
  • The Compound 2-Hexyl, 5-Propyl Resorcinol Has a Key Role in Biofilm Formation by the Biocontrol Rhizobacterium Pseudomonas Chlororaphis PCL1606
    fmicb-10-00396 February 26, 2019 Time: 15:3 # 1 ORIGINAL RESEARCH published: 28 February 2019 doi: 10.3389/fmicb.2019.00396 The Compound 2-Hexyl, 5-Propyl Resorcinol Has a Key Role in Biofilm Formation by the Biocontrol Rhizobacterium Pseudomonas chlororaphis PCL1606 Claudia E. Calderón1,2, Sandra Tienda1,2, Zaira Heredia-Ponce1,2, Eva Arrebola1,2, Gerardo Cárcamo-Oyarce3, Leo Eberl3 and Francisco M. Cazorla1,2* 1 Departamento de Microbiología, Facultad de Ciencias, Universidad de Málaga, Málaga, Spain, 2 Instituto de Hortofruticultura Subtropical y Mediterránea “La Mayora,” Consejo Superior de Investigaciones Científicas, Universidad de Málaga, IHSM-UMA-CSIC, Málaga, Spain, 3 Department of Plant and Microbial Biology, University of Zürich, Zurich, Edited by: Switzerland Jesús Mercado-Blanco, Spanish National Research Council (CSIC), Spain The production of the compound 2-hexyl-5-propyl resorcinol (HPR) by the biocontrol Reviewed by: rhizobacterium Pseudomonas chlororaphis PCL1606 (PcPCL1606) is crucial for fungal Daniel Muller, antagonism and biocontrol activity that protects plants against the phytopathogenic Claude Bernard University Lyon 1, fungus Rosellinia necatrix. The production of HPR is also involved in avocado root France Sotiris Tjamos, colonization during the biocontrol process. This pleiotrophic response prompted us Agricultural University of Athens, to study the potential role of HPR production in biofilm formation. The swimming Greece motility of PcPLL1606 is enhanced by the disruption of HPR production. Mutants *Correspondence: Francisco M. Cazorla impaired in HPR production, revealed that adhesion, colony morphology, and typical [email protected] air–liquid interphase pellicles were all dependent on HPR production. The role of HPR production in biofilm architecture was also analyzed in flow chamber experiments.
    [Show full text]
  • Biological Control of Late Blight of Potatoes: in Vivo and in Vitro Evaluation of Microbial Antagonists Against Tuber Blight
    Biological Control of Late Blight of Potatoes: in vivo and in vitro evaluation of microbial antagonists against tuber blight Jane C Hollywood BSc Biology and Geography (University of Bristol) Biology Department Darwin Building Gower Street London Presented for the degree of Doctor of Philosophy, University of London UMI Number: U602517 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. Dissertation Publishing UMI U602517 Published by ProQuest LLC 2014. Copyright in the Dissertation held by the Author. Microform Edition © ProQuest LLC. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT The cost of losses and control measures attributed to late blight of potatoes caused by Phytophthora infestans, are estimated to exceed $5 billion annually. Breeding for resistance is difficult owing to the tetraploid genotype of potato and current strains of the pathogen have developed resistance to chemical control. Consequently the search for biological control has assumed greater importance. In this investigation an in vivo bioassay was used to select soils antagonistic to late blight of potatoes, caused by Phytophthora infestans. Four out of eight samples demonstrated reproducible antagonism as determined by a reduction in the volume of tuber tissue rotted. A total of 292 bacterial and yeast samples and 20 fungal samples were recovered from suppressive soils using a variety of non- selective and selective media.
    [Show full text]
  • DEVELOPMENT of MOLECULAR MONITORING METHODS and ASSESSMENT of the ENVIRONMENTAL FATE of the BIOLOGICAL CONTROL AGENT of FIRE BLIGHT Pseudomonas Fluorescens Eps62e
    DEVELOPMENT OF MOLECULAR MONITORING METHODS AND ASSESSMENT OF THE ENVIRONMENTAL FATE OF THE BIOLOGICAL CONTROL AGENT OF FIRE BLIGHT Pseudomonas Fluorescens EPS62e Marta PUJOL ABAJO ISBN: 978-84-690-4636-4 Dipòsit legal: GI-286-2007 Departament d’Enginyeria Química, Agrària i Tecnologia Agroalimentària Institut de Tecnologia Agroalimentària Doctoral Thesis Development of molecular monitoring methods and assessment of the environmental fate of the biological control agent of fire blight Pseudomonas fluorescens EPS62e Memòria presentada per Marta Pujol Abajo, inscrita al programa de doctorat de Ciències Experimentals i de la Salut, itinerari Biotecnologia, per optar al grau de Doctor europeu per la Universitat de Girona Marta Pujol Abajo 2006 Emili Montesinos Seguí i Esther Badosa Romanyó, catedràtic i professora de l’àrea de Patologia Vegetal del Departament d’Enginyeria Química, Agrària i Tecnologia Agroalimentària de la Universitat de Girona, CERTIFIQUEN Que la llicenciada en Biologia Marta Pujol Abajo ha dut a terme, sota la seva direcció, el treball amb el títol: “Development of molecular monitoring methods and assessment of the environmental fate of the biological control agent of fire blight Pseudomonas fluorescens EPS62e”, que presenta en aquesta memòria la qual constitueix la seva Tesi per a optar al Grau de Doctor europeu per la Universitat de Girona. I per a què consti als efectes oportuns, signen la present a Girona, el 8 de juny de 2006. Vist‐i‐plau dels directors de la Tesi Dr. Emili Montesinos Seguí Dra. Esther Badosa Romanyó Emili Montesinos Seguí, director dels projectes de recerca “Optimización de los métodos de detección, prevención y control del fuego bacteriano de las rosáceas en España” (Ref.
    [Show full text]
  • Adaptation of Pseudomonas Aeruginosa to the Cystic Fibrosis Lung and the Role of Shear Stress in Disrupting Alginate Matrix Biofilms
    Faculty of Science and Bio-engineering Sciences, Department of Bio-engineering Sciences, Research Group of Microbiology, Academic Year 2015-2016 Adaptation of Pseudomonas aeruginosa to the cystic fibrosis lung and the role of shear stress in disrupting alginate matrix biofilms Thesis submitted in fulfillment of the requirements for the degree of Doctor (Ph.D.) in Bio-engineering Sciences Jozef Dingemans Promotors: Em. Prof. Dr. Pierre Cornelis Prof. Dr. Daniel Charlier Co-promotors: Prof. Dr. Anne Malfroot (UZ Brussel) Dr. Rob Van Houdt (SCK•CEN) Members of the jury Promotors: Em. Prof. Dr. Pierre Cornelis (VUB) Prof. Dr. Daniel Charlier (VUB) Co-promotors: Prof. Dr. Anne Malfroot (VUB, UZ Brussel) Dr. Rob Van Houdt (SCK-CEN) President: Prof. Dr. Geert Angenon (VUB) Secretary: Prof. Dr. Wim Versees (VUB) Internal jury members: Prof. Dr. Guido Verniest (VUB) Prof. Dr. Jo Van Ginderachter (VUB) Prof. Dr. Kim Roelants (VUB) External jury members: Prof. Dr. Craig Winstanley (University of Liverpool) Prof. Dr. Sylvie Chevalier (Université de Rouen) Prof. Dr. René De Mot (KU Leuven) The work described in this dissertation was performed at: -Research Group of Microbiology, Department of Bio-engineering Sciences, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussel -Unit of Microbiology, Institute for Health, Environment and Safety, Studiecentrum voor kernenergie (SCK•CEN), Boeretang 200, 2400 Mol This research was financially supported by: - The government agency for Innovation by Science and Technology (IWT Vlaanderen). - The Belgian Association
    [Show full text]
  • Novel Mechanism of Metabolic Co-Regulation Coordinates the Biosynthesis of Secondary Metabolites in Pseudomonas Protegens
    1 Novel mechanism of metabolic co-regulation coordinates the biosynthesis 2 of secondary metabolites in Pseudomonas protegens 3 Qing Yan1, Benjamin Philmus2, Jeff H. Chang1 & Joyce E. Loper1, 3* 4 1Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR, USA. 5 2Department of Pharmaceutical Sciences, Oregon State University, Corvallis, OR, USA. 6 3US Department of Agriculture, Agricultural Research Service, Horticultural Crops Research 7 Laboratory, Corvallis, OR, USA. 8 *Correspondence and requests for materials should be addressed to J.E.L. (email: 9 [email protected]) 1 10 Abstract 11 Metabolic co-regulation between biosynthetic pathways for secondary metabolites is common in 12 microbes and can play an important role in microbial interactions. Here, we describe a novel 13 mechanism of metabolic co-regulation in which an intermediate in one pathway is converted into 14 signals that activate a second pathway. Our study focused on the co-regulation of 2,4- 15 diacetylphloroglucinol (DAPG) and pyoluteorin, two antimicrobial metabolites produced by the 16 soil bacterium Pseudomonas protegens. We show that an intermediate in DAPG biosynthesis, 17 phloroglucinol, is transformed by a halogenase encoded in the pyoluteorin gene cluster into 18 mono- and di-chlorinated phloroglucinols. The chlorinated phloroglucinols function as intra- 19 and inter-cellular signals that induce the expression of pyoluteorin biosynthetic genes, 20 pyoluteorin production, and pyoluteorin-mediated inhibition of the plant-pathogenic bacterium 21 Erwinia amylovora. This metabolic co-regulation provides a strategy for P. protegens to 22 optimize the deployment of secondary metabolites with distinct roles in cooperative and 23 competitive microbial interactions. 24 Introduction 25 Many microorganisms produce multiple secondary metabolites with diverse chemical properties 26 and ecological functions that contribute to the fitness of the producing organism in natural 27 environments (Haas and Keel 2003, O’Brien and Wright 2011, Traxler and Kolter 2015).
    [Show full text]
  • Harnessing Synthetic Biology for the Bioprospecting and Engineering of Aromatic Polyketide Synthases
    HARNESSING SYNTHETIC BIOLOGY FOR THE BIOPROSPECTING AND ENGINEERING OF AROMATIC POLYKETIDE SYNTHASES A thesis submitted to The University of Manchester for the degree of Doctor of Philosophy in the Faculty of Science and Engineering (2017) MATTHEW J. CUMMINGS SCHOOL OF CHEMISTRY 1 THIS IS A BLANK PAGE 2 List of contents List of contents .............................................................................................................................. 3 List of figures ................................................................................................................................. 8 List of supplementary figures ...................................................................................................... 10 List of tables ................................................................................................................................ 11 List of supplementary tables ....................................................................................................... 11 List of boxes ................................................................................................................................ 11 List of abbreviations .................................................................................................................... 12 Abstract ....................................................................................................................................... 14 Declaration .................................................................................................................................
    [Show full text]
  • Dynamic Visualization of Type II Peptidyl Carrier Protein Recognition in Pyoluteorin Biosynthesis RSC Chemical Biology
    Volume 1 Number 1 April 2020 l 1| b 1|2020 Pages 1–36 RSC Chemical Biology rsc.li/rsc-chembio SC Ch i l i l ISSN 2633-0679 COMMUNICATION 16 Michael D. Burkart et al . Dynamic visualization of type II peptidyl carrier protein recognition in pyoluteorin biosynthesis RSC Chemical Biology View Article Online COMMUNICATION View Journal | View Issue Dynamic visualization of type II peptidyl carrier protein recognition in pyoluteorin biosynthesis† Cite this: RSC Chem. Biol., 2020, 1,8 Joshua C. Corpuz, a Larissa M. Podust, b Tony D. Davis, a Received 27th December 2019, Matt J. Jaremko a and Michael D. Burkart *a Accepted 26th February 2020 DOI: 10.1039/c9cb00015a rsc.li/rsc-chembio Using a covalent chemical probe and X-ray crystallography coupled to nuclear magnetic resonance data, we elucidated the dynamic molecular basis of protein recognition between the carrier protein and adenylation domain in pyoluteorin biosynthesis. These findings Creative Commons Attribution-NonCommercial 3.0 Unported Licence. reveal a unique binding mode, which contrasts previously solved carrier protein and partner protein interfaces. The type II non-ribosomal peptide synthetase (NRPS) system consists of stand-alone enzymes that commonly participate in hybrid pathways along with fatty acid synthase (FAS) and polyketide synthase(PKS)enzymes.1 The stand-alone architecture of type II NRPS proteins makes them promising candidates for metabolic engineering, as they commonly serve to install unique This article is licensed under a chemical functionality into growing metabolites. These hybrid pathways afford complex natural products that include antibiotic, antitumor, and antifungal agents.2 Examples of functionalized natural products include those that utilize dehydrogenated Open Access Article.
    [Show full text]
  • Wide Analysis Reveals That Burkholderia Contaminans MS14
    ORIGINAL RESEARCH Comparative genome-­wide analysis reveals that Burkholderia contaminans MS14 possesses multiple antimicrobial biosynthesis genes but not major genetic loci required for pathogenesis Peng Deng1, Xiaoqiang Wang1, Sonya M. Baird1, Kurt C. Showmaker2, Leif Smith3, Daniel G. Peterson2 & Shien Lu1 1Departments of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi state, Mississippi 2Institute for Genomics, Biocomputing and Biotechnology, Mississippi State University, Mississippi state, Mississippi 3Department of Biology, Texas A&M University, College Station, Texas Keywords Abstract Antimicrobial, Burkholderia contaminans MS14, comparative genomics, virulence, Burkholderia contaminans MS14 shows significant antimicrobial activities against whole genome sequencing. plant and animal pathogenic fungi and bacteria. The antifungal agent occidi- ofungin produced by MS14 has great potential for development of biopesticides Correspondence and pharmaceutical drugs. However, the use of Burkholderia species as biocontrol Shien Lu, Department of Biochemistry, agent in agriculture is restricted due to the difficulties in distinguishing between Molecular Biology, Entomology and Plant plant growth-­promoting bacteria and the pathogenic bacteria. The complete Pathology, Mississippi State University, MS. Tel: +1 (662) 325-3511; MS14 genome was sequenced and analyzed to find what beneficial and virulence-­ Fax: +1 (662) 325-8955; related genes it harbors. The phylogenetic relatedness of B. contaminans MS14 E-mail: [email protected] and other 17 Burkholderia species was also analyzed. To research MS14′s potential virulence, the gene regions related to the antibiotic production, antibiotic resist- Funding Information ance, and virulence were compared between MS14 and other Burkholderia This research was funded by USDA National ­genomes. The genome of B. contaminans MS14 was sequenced and annotated.
    [Show full text]
  • WO 2015/017866 Al 5 February 2015 (05.02.2015) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2015/017866 Al 5 February 2015 (05.02.2015) P O P C T (51) International Patent Classification: Gregory, B. [US/US]; C/o 83 Cambridge Parkway, Cam C12N 15/63 (2006.01) C40B 40/06 (2006.01) bridge, MA 02142 (US). C12N 15/87 (2006.01) (74) Agents: ALTIERI, Stephen, L. et al; Bingham Mc- (21) International Application Number: cutchen LLP, 2020 K Street, NW, Washington, DC 20006- PCT/US20 14/049649 1806 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 4 August 2014 (04.08.2014) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (25) Filing Language: English BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (26) Publication Language: English DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/861,805 2 August 2013 (02.08.2013) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/883,13 1 26 September 2013 (26.09.2013) US OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, 61/935,265 3 February 2014 (03.02.2014) US SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, 61/938,933 12 February 2014 (12.02.2014) US TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, (71) Applicant: ENEVOLV, INC.
    [Show full text]