Microrna Regulation of CD44 and CD151 in Hepatocellular Carcinoma

microRNA regulation of CD44 and CD151 in hepatocellular carcinoma:

Implications for novel therapies

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of

Philosophy in the Graduate School of The Ohio State University

Ji Hye Kim, M.S.

Graduate Program in Pharmacy

The Ohio State University

2015

Dissertation Committee:

Thomas D. Schmittgen, PhD, Advisor

Jack C. Yalowich, PhD

Mitch Phelps, PhD

Ji Hye Kim

2015

ABSTRACT

Hepatocellular carcinoma (HCC) is the second most common cause of cancer death

worldwide, accounting for an estimated 745,000 deaths per year, representing 10% of all

deaths from cancer. Most patients present with advanced HCC for which the overall

survival is poor due to rapid tumor progression, metastasis and lack of effective treatments.

Sorafenib is the first-line treatment for the advanced HCC, however sorafenib treatment

showed clinically modest improvement and a number of patients develop resistance to

sorafenib. There exists an urgent need to better understand the molecular mechanisms of

the development of HCC and the resistance to current therapy and to develop new

therapeutic options for advanced or recurrent HCC.

We confirm previous findings that low miR-199a-3p expression is correlated with

poor survival in HCC and that miR-199a-3p is significantly down-regulated in HCC. We

identify a direct target of miR-199a-3p in HCC and reintroduction of miR-199a-3p to HCC

cells strikingly suppressed cell migration and invasion in vitro in part by targeting CD151.

In addition, a new bioanalytical method is validated to quantify miR-199a-3p levels in

plasma and liver tissue for future Pharmacokinetic/Pharmacodynamic in vivo study. This

bioanalytical method can be applied to other oligonucleotides therapeutic agents.

miR-221 expression is upregulated in HCC patients. CD44 is responsible for cell-

cell interaction, cell adhesion, cell migration and invasion and an important cancer stem

cell marker. We report a direct correlation between miR-221 and CD44 expression in HCC

cells; miR-221 and CD44 are low in epithelial-like HCC cells and high in mesenchymal-

like HCC cells. Inhibition of miR-221 with antisense oligonucleotide negatively regulates

CD44 expression at the translational level through the P13K-AKT-mTOR signaling

pathway.

The PI3K/AKT/mTOR signaling pathway is abnormally activated in HCC and

sorafenib resistant cells. However, a recent phase III clinical trial with the allosteric mTOR

inhibitor, everolimus failed to show better overall survival in patients with advanced HCC

who were resistant or intolerant to sorafenib. Here we report that the ATP-competitive

mTOR inhibitors showed better anti-proliferative and anti-migration effects on the

mesenchymal-like HCC cells and sorafenib resistant HCC cells compared to everolimus.

ATP-competitive mTOR inhibitors suppress CD44 expression by blocking

phosphorylation of eukaryotic translation initiation factor eIF4E-binding protein 1,

suggesting that ATP-competitive mTOR inhibitors would be more effective in treating the

advanced HCC patients who are insensitive or resistant to sorafenib.

Since miRNAs target entire pathways, miRNA-based therapy could be an effective

option for treating HCC patients. miRNA-based therapy can be combined with small

molecule ATP-competitive mTOR inhibitors such as INK128. We show here that these

agents produce anti-proliferative and anti-migratory effects on mesenchymal-like HCC

iii

cells as well as sorafenib resistant HCC cells. Taken together, our findings aid in our

understanding of the molecular mechanisms of sorafenib resistance in HCC and could

contribute to the development of alternative strategies for treating advanced HCC who are

intolerant or resistant to the current therapy.

ACKNOWLEDGEMENTS

First of all, I would like to thank my advisor, Dr. Schmittgen, for support and

mentorship throughout my projects. He trained me to become an independent investigator

and to improve my capabilities for better academic career. His enthusiasm for research

extremely inspired me to pursue my goal with hard work and dedication. I also would like

to thank my committee members, Dr. Jack Yalowich and Dr. Mitch Phelps for their critical

advices on my research as well as warm encouragement. They always guided me to move

my project in the right direction. Without all their support, I could not have finished my

graduate study.

I also would like to thank all my lab members for their help and friendship. At the

beginning stage, Jong-Kook Park taught me the necessary techniques for research to set up

the experiments. I would like to thank Dr. Jinmai Jiang, Ola Elgamel, Dhruvit Sutaria and

Mohamed Badawi for their friendship and support.

I would like to sincerely thank my parents, Ounsoo Kim and Samja Jang and my

parents in law, Jongchul Lee and Jungja Choi for providing me all the support over the

years and their continuous love. v

Lastly, I would like to give special thanks to my family for their support and

encouragement. I would like to thank my husband, Yun Soo Lee for his endless care and

encouragement during the entire process and my son, Daniel Lee for his big smile. I could

not have achieved it without them. Their love and support inspired me to continue to strive

to become better.

VITA

1997-2001………………………………… B.S., Pharmacy, Seoul National University,

Seoul, South Korea

2001-2003………………………………… M.S., Pharmaceutics, Seoul National University,

Seoul, South Korea

2008-2010, 2012-2015………………Graduate Teaching Associate/ Graduate Fellow,

The Ohio State University, Columbus, Ohio, USA

PUBLICATIONS

1. Jon C. Henry, Jong-Kook Park, Jinmai Jiang, Ji Hye Kim, Lewis R. Roberts, Soma

Banerjee, Thomas D. Schmittgen. miR-199a-3p targets CD44 and reduces

proliferation of CD44 positive hepatocellular carcinoma cell lines..Biochem

Biophys Res Commun. 2010;403(1):120-5.

2. Jong-Kook Park, Takayuki Kogure, Gerard J. Nuovo, Jinmai Jiang, Lei He, Ji Hye

Kim, Mitch A. Phelps, Tracey L. Papenfuss, Carlo M. Croce, Tushar Patel, and

vii

Schmittgen, T.D. miR-221 silencing blocks hepatocellular carcinoma and promotes

survival. Cancer Res. 2011;71(24):7608-16.

3. Ji Hye Kim, Jong-Kook Park, Jinmai Jiang, Mohamed Badawi, Xiaokui Mo,

Lewis R. Roberts and Thomas D. Schmittgen. Anti-invasion and anti-migration

effects of miR-199a-3p in hepatocellular carcinoma are due in part to targeting

CD151. Submitted

4. Ji Hye Kim, Mohamed Badawi, Jinmai Jiang and Thomas D. Schmittgen. ATP-

competitive mTOR inhibitors exhibit anti-cancer effects in mesenchymal-like as

well as sorafenib resistant hepatocellular carcinoma. Manuscript in preparation.

viii

Fields of Study

Major Field – Pharmaceutics, Pharmacy

Table of Contents

Page

Abstract…………………………………………………………………………………………………………………… ii

Acknowledgements………………………………………………………………………………………………… v

Vita ………………………………………………………………………………………………………………………… vii

List of Tables……………………………………………………………………………………………………………xiii

List of Figures………………………………………………………………………………………………………… xiv

1. Chapter 1: Introduction ...... 1

1.1. Hepatocellular Carcinoma ...... 13

1.2. Non-coding RNAs ...... 2

1.3. miRNAs in HCC ...... 4

1.4. CD44 in cancers ...... 7

1.5. Sorafenib and the acquired drug resistance in advanced HCC ...... 8

1.6. PI3K-AKT-mTOR pathway in sorafenib resistant HCC ...... 11

2. Chapter 2: Anti-invasion and anti-migration effects of miR-199a-3p in hepatocellular carcinoma are due in part to targeting CD151 ...... 16

2.1. Introduction ...... 16

2.2. Methods ...... 18

2.3. Results ...... 22

2.4. Discussion ...... 25

3. Chapter 3: Development of a bioanalytical method for PK/PD of therapeutic miRNA mimics ...... 34

3.1. Introduction ...... 34

3.2. Materials and Methods ...... 35

3.3. Results ...... 36

3.4. Discussion ...... 38

4. Chapter 4: Regulation of CD44 expression by miR-221 in hepatocellular carcinoma through PI3K-AKT-mTOR pathway ...... 43

4.1. Introduction ...... 43

4.2. Materials and Methods ...... 45

4.3. Results ...... 48

4.4. Discussion ...... 53

5. Chapter 5: ATP-competitive mTOR inhibitors exhibit anti-cancer effects in mesenchymal-like as well as sorafenib resistant hepatocellular carcinoma...... 71

5.1. Introduction ...... 71

5.2. Materials and Methods ...... 72

5.3. Results ...... 75

5.4. Discussion ...... 80

6. Chapter 6: Conclusions and Future Directions ...... 93

List of References………………………………………………………………………………………………………102

xii

List of Tables

Table 1.1 Down regulated miRNAs in HCC ...... 14

Table 1.2 Up regulated miRNAs in HCC ...... 15

Table 3.1 Accuracy and precision of the qPCR assay for miR-199a-3p mimic...... 42

Table 4.1 The primers were used to identify various CD44 isoforms in HCC cell lines. . 60

Table 4.2 List of miRNAs whose expression was affected by anti-miR-221 treatment in

HCC cells...... 66

xiii

List of Figures

Figure 1.1 Biogenesis of miRNAs ...... 13

Figure 2.1 CD151 is a target of miR-199a-3p...... 27

Figure 2.2 CD151 is overexpressed in mesenchymal HCC cell lines...... 28

Figure 2.3 CD151 is not involved in HCC cell proliferation in vitro...... 29

Figure 2.4 Reintroduction of miR-199a-3p and knockdown of CD151 reduces cell migration in vitro...... 30

Figure 2.5 Reintroduction of miR-199a-3p and knockdown of CD151 reduces cell invasion in vitro...... 31

Figure 2.6 miR-199a-3p is reduced in HCC tissues and low miR-199a-1 expression correlates with poor survival...... 32

Figure 2.7 miR-199a-3p and CD151 expression inversely correlates in HCC specimens...... 33

Figure 3.1 Schematic overview of quantification assay for miR-199a-3p by qPCR ...... 40

Figure 3.2 Standard curves of miR-199a-3p quantification ...... 41

Figure 4.1 CD44 is overexpressed in mesenchymal HCC cell lines. (Continued) ...... 57

Figure 4.2 CD44s is the most abundant isoform in HCC cell lines...... 59

xiv

Figure 4.3 There is a direct correlation between CD44 and miR-221 in HCC cell lines. 61

Figure 4.4 CD44 and miR-221 are overexpressed in 3sp (M) of human EMT model. .... 62

Figure 4.5 Anti-miR-221 significantly decreased cell viability in mesenchymal-like HCC cells...... 63

Figure 4.6 Anti-miR-221 reduced CD44 expression in HCC cells at translational level and ectopic expression of miR-221 increased CD44 expression in HCC cells. (Continued) ...... 64

Figure 4.7 There are differently regulated miRs in anti-miR-221 transfected SNU-449 cells...... 67

Figure 4.8 Anti-miR-221 negatively regulates mTOR pathway and ATP site inhibition of mTOR reduces CD44 and vimentin expression in HCC cells at translational level...... 68

Figure 4.9 Summary of CD44 regulation of miR-221 through PI3K-AKT-mTOR pathway in HCC...... 70

Figure 5.1 ATP-competitive mTOR inhibitor shows better anti-proliferative effect in mesenchymal-like HCC cell while rapamycin and its analog slightly decreases HCC cell proliferation in vitro...... 84

Figure 5.2 Allosteric mTOR inhibitors inhibited only phosphorylation of S6K, not phosphorylation of 4EBP-1 and did not affect CD44 and vimentin expression in mesenchymal-like HCC cells...... 85

Figure 5.3 INK128 shows better anti-proliferative effect on mesenchymal-like HCC cells and decreased CD44 and VIM expression in mesenchymal-like HCC cells at translational level...... 86

Figure 5.4 Analysis of sensitivity to sorafenib treatment in HCC cell lines ...... 87

Figure 5.5 INK128 alone or combination with sorafenib displays better anti-proliferative effect in SNU423 cells than everolimus...... 88

Figure 5.6 INK128 inhibits mesenchymal-like HCC cell migration in vitro better than everolimus...... 89

Figure 5.7 CD44 and mTOR Pathway are activated in the acquired sorafenib-resistant HCC cells and INK128 showed greater effects on cell viability in sorafenib resistant huh7 cells than everolimus...... 90

Figure 5.8 Summary of regulation of CD44 by mTOR inhibitors in HCC...... 92

Figure 6.1 Overall proposed mechanisms of miR-199a-3p, miR-221 and ATP-competitive mTOR inhibitor in PI3K-AKT-mTOR pathway to regulate CD44 expression in HCC...... 101

xvi

CHAPTER 1

1. Introduction

1.1. Hepatocellular Carcinoma

Hepatocellular carcinoma (HCC) is the second most common cause of cancer death worldwide, accounting for an estimated 745,000 deaths per year, representing 10% of all

deaths from cancer [1]. HCC is the most predominant type of liver cancer [2]. The

incidence of HCC in the United States is relatively low, however, it is the most rapidly

growing cause of cancer-related death in men in the United States. More importantly, it has

been recently projected that liver cancer will become the third leading cause of cancer-

related death by 2030 in the United States [3]. Major risk factors for HCC include hepatitis

C virus (HCV) or hepatitis B virus (HBV) infection, alcoholic cirrhosis and nonalcoholic

fatty liver disease. There are several treatment options for HCC patients mainly depending

on stage of HCC, available resources, and practitioner expertise [4]. For early stage of HCC,

surgical resection, liver transplantation or local ablation are considered. Transarterial

chemoembolization (TACE) shows limited success for intermediate stage HCC without

invasion or metastasis. However, most patients present with advanced HCC for which the

overall survival of HCC is poor due to rapid tumor progression and metastasis [5]. Recently,

Sorafenib, an oral multikinase inhibitor, is approved for advanced HCC. However,

sorafenib showed clinically modest improvement in overall survival and patients respond

to sorafenib treatment differently [6]. Therefore, there is an urgent need to better

understand the mechanisms of HCC progression and to develop new therapeutic options for advanced or recurrent HCC.

1.2. Non-coding RNAs

Non-coding portions of DNA consist of greater than 98% of the human genome [7].

Many studies have shown that non-coding RNAs (ncRNAs) are responsible for the

regulation of gene expression and play important roles in fundamental biological process

including proliferation, apoptosis, metabolism as well as cancer development [8-12].

ncRNAs are classified into long ncRNAs (lncRNA) and small ncRNAs (sncRNA)

including short-interfering RNAs (siRNAs), microRNAs (miRNAs), and piwi-interacting

RNAs (piRNAs). lncRNAs are more than 200 nucleotides in length while sncRNAs are

approximately 20-30 nucleotides in length. Several studies have shown that lncRNAs are

involved in a wide variety of biology processes [13-15] and lncRNAs are associated with

tumor progression and metastasis [16-19]. Numerous studies have focused on sncRNA and

they have shown that miRNA is the largest fraction of sncRNAs and that it plays a

fundamental role in tumorigenesis and cancer metastasis. It has been shown that miRNAs

negatively regulate their target genes which are responsible for crucial biological process

including metabolism, cell death, cell survival, and tumorigenesis [20].

To date, more than two thousand miRNAs have been identified in humans. miRNAs

are ~22 nucleotides ncRNAs in length and they are mainly processed by two RNase III

proteins, Drosha and Dicer [21,22]. Primary miRNA precursors (pri-miRNAs) are mostly transcribed by RNA-polymerase II. The pri-miRNAs are further processed to precursor

miRNAs (pre-miRNAs) by a nuclear enzyme, Drosha [21] and pre-miRNAs are ~60-70

nucleotides in length. Pre-miRNAs are then actively transported to the cytoplasm by the

nuclear export protein in a Ran-GTP-dependent manner [23]. In the cytoplasm, the terminal

loop of the pre-miRNA is further cleaved by an RNase III endonuclease, Dicer, and the

dsRBD proteins TRBP/PACT [22], which results in the production of ~22 nucleotides

mature miRNA duplexes. The guide strand is preferentially loaded into miRNA-induced

silencing complex (miRISC) with argonaute (AGO) protein. RISC-loaded miRNAs target

mRNAs to silence gene expressions at post-transcriptional level by mRNA degradation or

translational repression [24,25] (Fig. 1.1).

miRNAs primarily suppress gene expression by binding to 3’UTR of the target mRNAs.

This causes either translational repression when the seed sequences on miRNAs are

perfectly matched with their target mRNAs or mRNA degradation when 100% of the

mature miRNA hybridizes to its target mRNA [26]. miRNAs may play an oncogenic or

tumor suppressive role depending on the type of cancer. miRNAs that are up-regulatedin

the cancer compared to benign tissues can be considered as oncogenic miRNAs as they

often target tumor suppressor genes. On the other hand, down-regulated miRNAs in

cancers can serve as tumor suppressive miRNAs which suppress oncogenes. Association

of miRNAs with cancers was first suggested in chronic lymphocytic leukemia (CLL) [27].

miR-15a and miR-16-1 are located on chromosome 13q14 which are frequently deleted or

down-regulated in CLL [27]. TG mice overexpressing miR-21 demonstrated development

of pre-B malignant lymphoid-like phenotype and turning off miR-21 reversed the

symptoms, suggesting the oncogenic role of miR-21 [28]. The involvement of miRNAs in cancer development was also supported by TG mice overexpressing miR-155 which developed acute lymphoblastic leukemia [29].

1.3. miRNAs in HCC

A great number of miRNA profiling studies have shown that numerous miRNAs are differentially expressed in a variety of human cancers [30-38]. Table 1.1 and 1.2 summarize the differently expressed miRNAs and their important targets in HCC from several profiling studies. It is interesting that some miRNAs are reported as consistently deregulated in HCC including miR-221, miR-21, miR-199, miR-122 and miR-101. miR-

221 and miR-21 are up-regulated miRNAs in HCC while miR-199a, miR-122 and miR-

101 are down-regulated miRNAs in HCC.

miR-221 has been reported as the most deregulated miR in HCC [39,40] and it is upregulated in 70%–80% of HCC samples [41]. miR-221 and -222 are encoded in the same polycistonic RNA precursor and share the identical seed sequence. Overexpression of miR-

221 exerts tumor promoting effects by targeting various tumor suppressor genes. miR-221 modulates cell cycle by directly targeting cyclin-dependent kinase inhibitors,

CDKN1B/p27 and CDKN1C/p57 [41]. Phosphatase and tensin homolog (PTEN) [39] and

DNA damage-inducible transcript 4 (DDIT) are validated targets of miR-221 in HCC and

both are negative regulators of PI3K-AKT-mTOR pathway [40]. miR-221 also affects cell

invasion and metastasis by suppressing TIMP3, a tissue inhibitor of metalloproteases [39].

miR-221 promoted growth of HCC cells by increasing the number of cells in S-phase [41]

and expression of miR-221 increased cell proliferation in vivo as well as in vitro [42]. Anti-

miR-221 resulted in increased apoptotic cell death [43]. It has also been reported that

transgenic mice overexpressing miR-221 in the liver promotes carcinogenesis [40].

Previously, our lab published that anti-miR-221 oligonucleotide effectively reduced miR-

221 levels and regulated the target proteins of miR-221 in HCC and enhanced survival in

a clinically relevant orthotopic mouse model of HCC [44].

miR-21 is one of the upregulated miRNAs in several types of cancers including HCC

[31] A large number of targets of miR-21 have been validated and most are tumor suppressors including MAP2K3 [45], TIAM1 [46], Sprouty1 [47], RHOB [48], PTEN

[49,50], PDCD4 [49], and RECK [49]. Inhibition of miR-21 suppressed cell proliferation by up-regulating MAP2K3 expression [45] and overexpression of miR-21 by T3 and subsequent TIAM1 suppression increased cell migration and invasion in vitro [46]. Down- regulation of miR-21 reduced the growth and proliferation of liver cancer cells through targeting Sprouty 1 [47]. Repression of RHOB by miR-21 resulted in a reduction in migration and invasion in vitro [48]. miR-21 modulates the invasiveness of HCC cells by targeting PTEN, PDCD4, and RECK and anti-miR-21 resulted in alterations of the Akt signaling pathway [49]. In mouse xenograft model, inhibition of miR-21 decreased cell proliferation and increased apoptosis [51]. TG mice overexpressing miR-21 developed pre-

B malignant lymphoma which was reversed by turning off miR-21 overexpression [28].

miR-199a-3p expression is decreased in HCC [33,52-54]. The genes that encode miR-

199a-1 and miR-199a-2 are located within introns of the DNM2 and DNM3 genes,

respectively. Previous research has shown that miR-199a-3p regulates expression of cMET

[55,56], mTOR [55], CD44 [57] and PAK4 [58]. Overexpression of miR-199a-3p resulted

in G1-phase cell cycle arrest, reduced invasion, enhanced sensitivity to doxorubicin-

induced apoptosis in HCC cells [55]. The full-scale analysis of miRNomes in human

normal liver, hepatitis liver, and HCC has shown that miR-199a/b-3p is the third most down

regulated miRNA in HCC [59]. Lower miR-199a-3p level was associated with shorter time

to recurrence [55] and HCC patients with low miR-199a-3p expression had poorer survival

compared to those with high miR-199a-3p levels [59]. miR-199a/b-3p inhibited HCC growth through suppressing PAK4/Raf/MEK/ERK pathway both in vitro and in vivo [59]

Interestingly, miR-199a-3p was shown to regulate HBV replication in HCC [60].

miR-122 is the most highly expressed miRNAs in the normal liver [53]. Interestingly, miR-122 is predominantly expressed in adult liver [61]. It plays a critical role in liver metabolism and hepatocyte differentiation by regulating several genes which are involved

in cholesterol synthesis [62] and by targeting aldolase A [63] and CUTL1 [64]. miR-122 is

associated with tumorigenesis by targeting a number of oncogenes such as cyclin G1 [52],

Bcl-w [65], ADAM10 [66], IGF1R [67], CCNG1 [68] and ADAM17 [69]. In addition,

patients with low miR-122 levels correlate with metastasis [70,71]. miR-122 knockout

mice developed hepatic inflammation, fibrosis, and spontaneous tumors which were

similar to HCC [72,73].

The expression of miR-101 is significantly down-regulated in HCC compared to

adjacent benign tissues. The validated targets of miR-101 in HCC include FOS oncogene

[74], Mcl-1[75], DNA methyltransferase 3A (DNMT3A) [76] SOX9 [77], Nemo-like

kinase (NLK) [78], and EZH2 [79]. Introduction of miR-101 inhibited the invasion and

migration of HCC cells in vitro [74]. A miR-101 antisense inhibitor suppressed cell

apoptosis and overexpression of Mcl-1 reversed the proapoptotic effect of miR-101 in vitro

[75]. miR-101 expression was frequently down-regulated in HBV-related HCC tissues

compared to adjacent noncancerous hepatic tissues [76]. miR-101 sensitized tumor cells to

chemotherapeutic treatment such as doxorubicin or 5-fluorouracil and induced apoptosis

[79]. Furthermore, c-Myc physically interacts with EZH2, a target of miR-101 and miR-

101 is epigenetically suppressed by EZH2-containing PRC2 complex in a c-Myc-mediated

manner [80].

1.4. CD44 in cancers

CD44 is a hyaluronic acid receptor and major cell surface glycoprotein which is

involved in a variety of the essential biological processes including cell-cell interactions,

cell adhesion, cell migration and invasion [81]. It has been reported that CD44 also plays

an important role in tumor cell differentiation, invasion, and metastasis [82,83]. CD44 is

known as an important cancer stem cell or tumor initiating cell markers in several

malignancies including HCC [84-87]. CD44 is encoded by a single gene, however, a number of CD44 isoforms are produced by alternative mRNA splicing. The CD44 standard

form (CD44s) is the smallest CD44 isoform while the variant isoforms (CD44v) consist of

various combinations of variant exons (v1-v10). It has been reported that CD44 positive

HCC cells are associated with the epithelial-mesenchymal transition (EMT) which leads to

invasion and metastasis of cancers [88-90]. HCC patients expressing low amounts of CD44

showed significantly better disease-free survival compared to those patients expressing

high amounts of CD44 [91]. Moreover, CD44 has been shown to be responsible for drug-

resistance processes [92]. Recently it was reported that CD44 is also associated with

sorafenib resistance in HCC [93,94]. In spite of a growing number of studies suggesting

the importance of CD44 in HCC, the fundamental roles of CD44 and the mechanism of

CD44 regulation in HCC still remain unclear.

1.5. Sorafenib and the acquired drug resistance in advanced HCC

Sorafenib is a multikinase inhibitor which targets the RAF/MEK/ERK pathway by

inhibiting Raf serine/threonine kinase and cell surface receptor tyrosine kinases including

vascular endothelial growth factor receptor (VEGFR) and platelet-derived growth factor

receptor (PDGFR) [95]. Sorafenib exhibited antitumor activity in PLC/PRF/5 and HepG2

HCC cells in vitro as well as PLC/PRF/5 HCC mouse xenograft model by blocking tumor

angiogenesis, inhibiting tumor cell growth and inducing apoptosis [96]. A multi-center,

double-blinded phase III clinical trial with advanced HCC patients showed that sorafenib

treatment improved median overall survival by 3 months compared to placebo [97]. In

addition, median overall survival rate was prolonged in the sorafenib treatment group

compared to placebo in a multinational phase III, randomized, double-blind clinical trial of

advanced HCC. [98] In addition to advanced HCC, sorafenib is currently approved for

treating advanced renal cell carcinoma and thyroid cancer which is resistant to radioactive

iodine. Even though sorafenib is the only chemotherapeutic agent for the advanced HCC,

sorafenib treatment showed clinically modest improvement and patients respond to

sorafenib treatment differently [6]. Furthermore, the major challenge of sorafenib treatment

is that a number of patients develop resistance to sorafenib treatment [99]. Since sorafenib

is the standard, first-line treatment for advanced HCC, there exists an urgent need to

understand the molecular mechanism of the acquired resistance to sorafenib treatment in order to develop a new therapeutic agent for advanced HCC patients who do not have any other options.

Recent studies demonstrated that several singling pathways play roles in the

development of sorafenib resistance in HCC. The PI3K/AKT signaling pathway is activated in sorafenib resistant Huh7 cells [100]. The investigators developed sorafenib- resistant Huh7 cells by prolonged exposure to sorafenib. Cells were exposed to increasing

concentration of sorafenib up to 10 µM, which is the highest achievable clinically relevant

dose in patients. The knockdown of Akt by siRNA sensitized the resistant Huh7 cells to

sorafenib treatment and the sensitivity of sorafenib-induced apoptosis was enhanced by

combination of Akt inhibitor and sorafenib treatment [100]. The activated epidermal

growth factor receptor (EGFR) mediates the development of resistance to sorafenib in HCC

cells [101]. The repression of EGFR by EGFR inhibitors such as erlotinib or gefitinib or

the anti-EGFR monoclonal antibody cetuximab, along with EGFR siRNA increased the

efficacy of sorafenib treatment. In addition, inhibition of both EGFR and HER-3

phosphorylation enhanced the response to sorafenib treatment in HCC cells [102].

Epithelial–mesenchymal transition (EMT) may also be involved in the

development of sorafenib resistance. It has been shown that sorafenib resistant HepG2 cells

9 underwent EMT [103]. Standard hallmarks of EMT, spindle-like cell morphology, loss of

E-cadherin and KRT1 and increased vimentin expression were observed. The PI3K/AKT pathway inhibitor LY294002 restored the sensitivity to sorafenib treatment. Van Zijl et al. established two different cell populations from HCC of a single patient [104]. One of these primary HCC cell lines displayed a mesenchymal phenotype that was less sensitive to sorafenib treatment compared to the epithelial-like HCC cells. In addition, it was reported that sorafenib resistant HCC cells exhibited EMT process including morphology changes and increased migratory and invasive abilities [93]. They suggested that the acquired sorafenib resistance showed a higher metastatic potential of HCC cells which may increase risk of sorafenib treatment failure for advanced HCC patients.

Cancer stem cells (CSC) or tumor initiating cells (TIC) have been implicated in therapeutic failure [105]. It has been shown that label-retaining cancer cells, a new subpopulation of CSC are relatively resistant to sorafenib [106] and these cells might be responsible for HCC recurrence. Chow et al demonstrated that CD44+ and CD133+ CSC were enriched in sorafenib resistant HCC cells and sorafenib resistance increased the incidence of lung metastasis in an orthotopic mouse model suggesting the possibility of tumor recurrence or metastasis by sorafenib resistant cells [93]. A recent study suggested that CD44+ mesenchymal-like HCC cells were resistant to sorafenib treatment whereas epithelial-like HCC cells were sensitive to sorafenib-induced apoptosis both in vitro and in vivo [94].

1.6. PI3K-AKT-mTOR pathway in sorafenib resistant HCC

The PI3K/AKT/mTOR pathway is an important intracellular signaling pathway which is responsible for cell proliferation, growth, survival, protein synthesis, and glucose metabolism [107]. PI3Ks activates AKT, serine–threonine protein kinase from a variety of growth factors and cytokines [108]. The activated AKT phosphorylates mammalian target of rapamycin (mTOR) which consists of two distinct complexes with unique accessory proteins, mTOR complex 1 (mTORC1) and mTORC2 [109]: regulatory-associated protein of mTOR (RAPTOR) and rapamycin-insensitive companion of mTOR (RICTOR) distinguish mTORC1 and mTORC2, respectively. Activation of mTORC1 phosphorylates its main downstream effectors such as p70S6 kinase (S6K) and eukaryotic translation initiation factor eIF4E-binding protein 1 (4EBP1). Both S6K and 4EBP-1 control protein synthesis by regulating mRNA translation initiation and progression [110]. PTEN is the most significant negative regulator of the PI3K/AKT/mTOR signaling pathway. Several cancer genomic studies have revealed that components of the PI3K pathway are frequently altered in various types of human cancers including HCC [111]. A large number of studies have indicated that PI3K/AKT/mTOR signaling pathway is frequently activated in HCC

[112-114]. mTOR and its downstream effectors, S6K and 4EBP-1 are activated in HCC.

In addition, a recent study showed that the mTOR pathway is significantly more active in high-grade tumors and tumors with poor prognostic features [64]. Therefore, the activation of PI3K/AKT/mTOR pathway may contribute to HCC progression. Due to a number of findings which support the significance of mTOR pathway in sorafenib resistant HCC, a recent phase 3 clinical trial with mTOR inhibitor, everolimus was conducted in advanced

HCC who were resistant or intolerant to sorafenib treatment [115]. Unexpectedly,

everolimus did not improve overall survival compared to placebo treated patients. This

result highlights the need for better understanding of sorafenib resistance in advanced HCC

and alternative strategies for combating this group of patients.

This dissertation is composed of 6 chapters; Chapter 2 shows anti-migration and anti-invasion effect of miR-199a-3p by targeting CD151 in HCC, Chapter 3 reports a validated bioanalytical method to quantify miR-199a-3p in plasma and liver tissues,

Chapter 4 shows that miR-221 regulates CD44 expression through PI3K-AKT-mTOR pathway in HCC, Chapter 5 demonstrates that ATP-competitive mTOR inhibitor shows anti-proliferative and anti-migration effect on mesenchymal-like HCC cells as well as sorafenib resistant HCC cells. Lastly, Chapter 6 discusses conclusion and future direction to develop new therapeutic options for advanced HCC.

Figure 1.1 Biogenesis of miRNAs

Primary transcripts (pri-miRNAs) are processed to precursor miRNAs (pre-miRNAs) by Drosha and pre-miRNAs are then actively transported to the cytoplasm by Exportin-5. In the cytoplasm, pre-miRNA is further cleaved by Dicer to mature miRNA duplexes. The guide strand is preferentially loaded into miRNA-induced silencing complex (miRISC) with argonaute (AGO) protein and it suppresses target gene expressions by mRNA degradation or translational repression.

Table 1.1 Down regulated miRNAs in HCC miRNA Profiling Important targets Functions references Let-7c [40] Bcl-xL , c-Myc [116,117] Apoptosis, proliferation miR-101 [74],[54],[118] FOS, Mcl-1, DNMT3A, Apoptosis, DNA SOX9, NLK and EZH2 methylation [74,75,78,79], miR-122 [52] Bcl-w, ADAM10, Apoptosis, IGF1R, CCNG1, ADAM17 proliferation, [65]-[69] angiogenesis miR-125 [33] MMP11, VEGF-A, SIRT7, Proliferation, Bcl-2 [119-121] metastasis, apoptosis miR-139 [54],[122] ROCK2, c-Fos [123,124] Metastasis miR-148a [74], [118] c-Met, c-Myc [125,126] Tumorigenesis miR-195 [33] cyclin D1, CDK6, E2F3, Cell cycle, LATS2 [127,128] tumorigenesis, apoptosis miR-199a [33], [52], [54] mTOR, PAK4, CD44 Proliferation, [53,55,57] tumorigenesis miR-200a [33], [52] HDAC4 , β-catenin Proliferation, [129,130] metastasis miR-214 [54], [118], HDGF, β-catenin [131,132] Cell growth, [122] angiogenesis, metastasis miR-223 [52] STMN1 [133] Microtubule- regulatory protein miR-29c [118] SIRT1 [134] Tumorigenesis

Table 1.2 Up regulated miRNAs in HCC miRNA Profiling Important targets Functions references miR-18 [33], [54] ER1a [135] Proliferation miR-21 [40], [52], [74], MAP2K3, TIAM1, Metastasis, drug [54], [122] Sprouty1, RHOB, resistance PTEN, PDCD4, RECK [45]-[49] miR-135 [54] FOXM1, MTSS1 Metastasis [136] miR-106 [33], [40] APC [137] Proliferation miR-130b [54] TP53INP1 [138] Cell growth miR-151 [122] FAK, RhoGDIA Migration [139,140] miR-155 [122] SOCS1, APC Proliferation, [141,142] tumorigenesis miR-182 [74], [122] MTSS1 [143] Metastasis miR-183 [74] AKAP12, PDCD4 Tumorigenesis, [144,145] apoptosis miR-186 [122] AKAP12 [144] Tumorigenesis miR-210 [40] VMP1 [146] Metastasis miR-221/222 [33], [40], [52], p27, p57 PTEN, , Apoptosis, [54], [118], [122] DDIT4, Arnt [39]- proliferation, [41] angiogenesis miR-224 [33], [122] Atg5, Smad4 Autophagy, [147,148] tumorigenesis miR-301 [54], [122] Gax [149] Metastasis miR-519 [40] p21,PTEN, AKT3, Proliferation, TIMP2 [150] invasion, apoptosis

CHAPTER 2

2. Anti-invasion and anti-migration effects of miR-199a-3p in

hepatocellular carcinoma are due in part to targeting CD151

2.1. Introduction

Hepatocellular carcinoma (HCC) is the second most common cause of cancer death worldwide, accounting for an estimated 745,000 deaths per year, representing 10% of all deaths from cancer.[1] Major risk factors for HCC include hepatitis C virus (HCV) or hepatitis B virus (HBV) infection, alcoholic cirrhosis and nonalcoholic fatty liver disease.

Resection, local ablation or transplantation are effective for early stage of HCC and other treatments including transarterial chemoembolization (TACE) show limited success for intermediate stage HCC without invasion or metastasis.[151] However, most patients present with advanced HCC for which the overall survival of HCC is poor due to rapid tumor progression and metastasis.[5] Therefore, it is necessary to better understand the mechanisms of HCC metastasis and to develop new therapeutic options for advanced or recurrent HCC.

It has been shown that expression of miRNAs is dysregulated in all cancers.[38] miRNAs may play an oncogenic or tumor suppressive role depending on the type of cancer. 16

miR-199a-3p is a miRNA that shows decreased expression in HCC.[33,52-54] The genes

that encode miR-199a-1 and miR-199a-2 are located within introns of the DNM2 and

DNM3 genes, respectively. Previous research has shown that miR-199a-3p regulates

expression of cMET[55,56], mTOR[55] and PAK4.[58] We previously reported that CD44

is a target of miR-199a-3p in HCC.[152]

CD151 is a member of the tetraspanin protein family that have been linked to

metastasis.[153-155] CD151 is associated with proMMP7 and proMMP9 transcription which facilitates matrix degradation and regulates cell migration. Several studies have

demonstrated that CD151 is involved in the regulation of pathways downstream of the

hepatocyte growth factor (HGF)/c-Met axis[156] and CD151 was remarkably

overexpressed in HCC.[153] High expression levels of CD151 and integrin subunit α6

increased invasiveness of HCC cells [155] and overexpression of CD151 promoted the

expression of MMP9, which is one of the key factors in metastasis through the

PI3K/Akt/GSK-3β/Snail pathway.[154] Recent studies showed that CD151 expression

could be regulated by miRNAs. miR-506 suppressed CD151 in a breast cancer cell line[157]

and miR-124 inhibits invasiveness and metastatic potential of breast cancer cells by

targeting CD151 mRNA.[158] In addition, miR-22 reduces cell proliferation and

invasiveness of gastric cancers by suppressing CD151.[159]

We confirm previous findings that low miR-199a-3p expression is correlated with

poor survival in HCC and that miR-199a-3p is significantly down-regulated in

HCC.[33,52-54] We found that CD151 is a direct target of miR-199a-3p and that

reintroduction of miR-199a-3p to HCC cells strikingly suppressed cell migration and

invasion in vitro in part by targeting CD151.

2.2. Methods

Cell line and Tissue Specimens

The human HCC cell lines SNU-423, SNU-449, PLC/PRF/5 and SK-Hep-1, were

purchased from American Type Tissue Collection (Manassas, VA) or were obtained from

various investigators. SNU-423, SNU-449 cells were cultured in RPMI 1640 medium

(Gibco) with 10% fetal bovine serum (Sigma). PLC/PRF/5 and SK-Hep-1 were cultured in

MEM medium (Gibco) with 10% fetal bovine serum (Sigma). Twenty-five paired HCC

and adjacent non-tumor liver tissues were collected from patients during surgical resections

at Mayo Clinic (Rochester, Minnesota), frozen in liquid nitrogen and stored at -80℃ until

RNA and protein were extracted. Sample collection conformed to the policies and practices

of the facility’s Institutional Review Board.

Transfection of microRNA mimic and siRNA oligonucleotides

SNU-423 and SNU-449 were transfected either with 100 nM of hsa-miR-199a-3p mimic or negative control (Ambion), or with 100 nM of CD151 siRNA or control siRNA

(Thermo Scientific Dharmacon) using lipofectamine 2000 (Invitrogen) and Opti-MEM

medium (Gibco). Cells were transfected with the miRNA mimic or siRNA oligonucleotides

for 72 h prior to extraction of RNA or protein.

RNA extraction, cDNA synthesis and qRT-PCR

Total RNA was extracted from 25 pairs of HCC tumors and adjacent benign liver

tissue samples. Following pulverization in a cold mortar and pestle, total RNA was isolated

from the tissues using Trizol reagent (Life Technologies). cDNA was synthesized

according to the manufacturer’s protocol (Invitrogen). Five hundred ng of total RNA was

used to synthesize cDNA using random primers. cDNA was analyzed for gene expression

using gene specific primers (IDT) and the Express SYBR® GreenER qPCR super mix

(Invitrogen). For the miRNA, cDNA primer with 1000 ng of total RNA was assayed using

the TaqMan® microRNA Assays (Applied Biosystems). Data were normalized to 18S rRNA and the relative expression of genes was presented using the comparative CT method.

Data were multiplied by 106 to simplify presentation. The primers used are as followings;

CD151 : 5’-ACCATGCCTCCAACATCTACA-3’ (forward) and 5’-TGAAGGTCTCCA

ACTTGGTGA-3’ (reverse), CDH1: 5’-CCCACCACGTACAA GGGTC-3’ (forward) and

5’-CTGGGGTATTGGGGGCATC-3’ (reverse), vimentin: 5’-CAGCTAACCAACGACA

AAGCC-3’ (forward) and 5’-ATCCTGTCTGAAAGATTGC AGGG-3’ (reverse), ZEB2:

5’-CCTGGCACAACAACGAGATT-3’ (forward) and 5’-TACTCCTCGATGCTGACTG

CA-3’ (reverse), twist: 5’-GAGCAAGATTCAGACCC TCAA-3’ (forward) and 5’-

ACCTGGTAGAGGAAGTCGATG-3’ (reverse), 18S : 5’-GTAACCCGTTGAACCCCA

TT-3’(forward) and 5’-CCATCCAATCGGTAGTAGCG-3’(reverse).

Dual-Luciferase reporter gene assay

The full length CD151 3’UTR was cloned into the psiCHECK-2 Vector (Promega).

Three nucleotides in the binding sequences of CD151 3’UTR was mutated by QuikChange

XL Site-Directed Mutagenesis Kit (Agilent Technologies) and the mutation was confirmed by sequencing. Luciferase reporter gene assay was performed using the Dual- Luciferase

Reporter Assay System (Promega) according to the manufacturer’s instructions. SNU-449 cells were plated at a density of 100,000 cells/well (24 well) and then incubated for 24 h prior to co-transfection with pre-miR-199a-3p or negative control oligonucleotide (50 nM) and the reporter construct containing WT-CD151 3’UTR or mutated CD151 3’UTR using lipofectamine 2000 (Invitrogen). Reporter gene assays were performed 24 hours post- transfection using the Dual luciferase assay system (Promega). Renilla luciferase activity was normalized for transfection efficiency using the corresponding Firefly luciferase activity. All experiments were performed at least three times.

Cell proliferation assay

PLC/PRF/5, SK-Hep-1, SNU-423 and SNU-449 cells were seeded at 2,000 cells per well in 96-well culture plates one day before transfection. 96 h after transfection of 100 nM CD151 siRNA or control siRNA oligonucleotides, cell proliferation was determined using the WST-1 reagent (Roche) per the manufacturer’s recommendations. All experiments were performed at least in triplicate.

Cell migration assay

The wound healing assay was performed to evaluate cell migration ability in vitro.

SNU-449 cells were transfected with either miR-199a-3p mimic or negative control oligonucleotides, or CD151 siRNA or control siRNA at 100 nM. At 24 h after transfection,

70 µl of the transfected cells (3x105 cells/mL) was placed into each well of an ibidi culture- insert (ibidi, LLC). After overnight incubation, the culture insert was removed to create a 20

cell-free gap in the cell monolayer. The gap closure area was photographed and analyzed

by Tscratch software [160]. The percentage of the gap area closed between the time zero

and the end of the experiment was calculated from at least three independent experiments.

Matrigel invasion assay

In vitro cell invasion assays were conducted using the CytoSelect™ 24-well cell

invasion assay kit (8 μm pore size, Cell Biolabs, Inc). SNU-449 cells were transfected with

either miR-199a-3p mimic or negative control oligonucleotides, or CD151 siRNA or

control siRNA at 100 nM. Forty-eight hr after transfection, the transfected cells were placed

into the upper chamber at a density of 1.5X105 cells per well in 1% FBS containing medium.

Ten percent FBS containing medium was placed in the lower chamber as a chemoattractant.

Cells were incubated at 37℃ for 24 hr and invasive cells were stained and fixed. The

number of cells that invaded through the membrane was counted in at least three different

fields for each experiment.

Protein extraction and immunoblotting

Cell protein lysates in RIPA buffer (Sigma) were separated on NuPAGE 4-12% Bis-

Tris gels (Novex) and electrophoretically transferred to polyvinylidene difluoride membranes (Roche). The blotting was performed for CD151 (Abcam) and β-actin (Abcam) or GAPDH (Santa Cruz Biotechnology) was used as a loading control. Secondary horseradish peroxidase antibody was detected using the ECL Western Blotting Analysis

System (Amersham Biosciences).

Statistical Analysis

The matched samples were compared using paired t-tests and samples subjected to different treatments were compared using student’s 2-sample t-tests. A p- value < 0.05 was considered significant. The Cancer Genome Atlas (TCGA) microRNA-seq expression data and patients’ clinical information (n=141) were downloaded through the TCGA data portal.

Patients were dichotomized into two groups (high and low) according to the median expression of miR-199-1 or miR-199-2. The probabilities of 5-year survival between groups were compared by using the Kaplan-Meier method and log-rank test. Data analysis was performed using SAS 9.4 (SAS, Inc; Cary, NC).

2.3. Results

CD151 is a target of miR-199a-3p in HCC.

To better understand the role of miR-199a-3p in HCC, we searched potential miR-

199a-3p targets using the TargetScan algorithm. The 5’ seed sequence of miR-199a-3p was highly conserved on the CD151 3’UTR (Fig. 2.1A). A luciferase reporter assay was used to confirm the binding of miR-199a-3p to the CD151 3’UTR. Luciferase expression was reduced by greater than 50% by miR-199a-3p mimic (Fig. 2.1B). The luciferase expression was not reduced substantially when the 3’ UTR was mutated (Fig. 2.1B). To further investigate if miR-199a-3p functionally regulates CD151, SNU-423 and SNU-449 cells were transfected with miR-199a-3p mimic or negative control oligonucleotides. Western blotting experiments showed that the protein expression of CD151 was reduced by 60% in

SNU-423 and by 43% in SNU-449 cells compared to control (Fig. 2.1C). qRT-PCR showed that miR-199a-3p mimic reduced CD151 mRNA (Fig. 2.1D). These data indicate that

CD151 is a direct target of miR-199a-3p and that reduced CD151 protein results from

enhanced mRNA degradation.

Attenuation of CD151 does not reduce HCC proliferation.

To better understand the functions of CD151 in HCC, CD151 protein expression

was examined in HCC cell lines by Western blotting. First, we evaluated the expression

of epithelial-mesenchymal transition (EMT) markers including CDH1,vimentin, ZEB2

and twist in HCC cell lines. HepG2, Hep3B and PLC/PRF/5 expresses high CDH1, an

epithelial marker whereas SNU-449, SNU-423 and SK-Hep-1 are mesenchymal-like

HCC cell lines expressing high vimentin, ZEB2 and twist (Fig. 2.2A). Interestingly,

CD151 protein was overexpressed in mesenchymal-like cell lines (SNU-449, SNU-423 and SK-Hep-1) compared to cell lines with epithelial properties (HepG2, Hep3B and

PLC/PRF/5) (Fig. 2.2B). This suggests that the CD151 expression is associated with the mesenchymal phenotype. To determine if CD151 regulates cell proliferation, we

transfected four different HCC cell lines with CD151 or control siRNA. CD151 was

successfully reduced by more than 80% in CD151 siRNA transfected cells (Fig. 2.3A).

Knockdown of CD151 failed to reduce cell proliferation in both CD151 negative

(PLC/PRF/5) and CD151 positive (SK-Hep-1, SNU-423 and SNU-449) cells (Fig. 2.3B).

These results suggest that CD151 is not involved in regulating HCC cellular proliferation.

In vitro cell migration and invasion is inhibited by miR-199a-3p through targeting

CD151.

Next we determined whether miR-199a-3p mimic could inhibit in vitro cell

migration and invasion under conditions of CD151 suppression. CD151 positive SNU- 23

449 cells were transfected with miR-199a-3p mimic under the identical conditions shown

to suppress CD151 mRNA and protein expression (Fig. 2.1C and 2.1D). As a positive

control, wound healing and invasion assays were performed following transfection with

CD151 or control siRNA. Compared to negative control oligonucleotide, wound healing

was significantly decreased after transfection of miR-199a-3p mimic (Fig. 2.4A and

2.4B). Wound healing was also significantly reduced after CD151 siRNA transfection

compared to control siRNA (Fig. 2.4C and 2.4D). In addition, the number of invading

cells was strikingly reduced after transfection with miR-199a-3p mimic (Fig. 2.5A and

2.5B). Cell invasiveness was also significantly suppressed after CD151 siRNA transfection (Fig. 2.5C and 2.5D). These results suggest that suppression of CD151

expression by miR-199a-3p mimic can reduce cell migration and invasion in vitro. miR-199a-3p and CD151 expression inversely correlates in HCC specimens.

The expression of miR-199a-3p was measured in 25 pairs of human HCC tissues and adjacent benign tissues by qRT-PCR. miR-199a-3p was significantly down-regulated in HCC tumor tissues compared to the adjacent benign liver tissues (p<0.01, Fig. 2.6A)

confirming previous results [33,52-54]. The expression of miR-199a-3p in the tumor was

reduced on average by 3.08 fold compared to the paired benign tissue. Next, we

investigated the correlation between miR-199a-3p gene expression and survival by

analyzing data from the TCGA database. miR-199a-1 and miR-199a-2 are two isogenic

genes encoding miR-199a-3p. HCC patients with high miR-199a-1 or miR-199a-2

expression had better survival than those with low miR-199a-1 or miR-199a-2 levels (Fig.

2.6B), confirming the findings of Fornari, et al.[55] CD151 mRNA and protein were also

examined in paired specimens of HCC and adjacent benign liver. CD151 mRNA was

significantly up-regulated by 2.36-fold in HCC tissues compared to paired benign tissues

(Fig. 2.7A). Moreover, CD151 protein expression was strongly overexpressed in HCC

tissues (Fig. 2.7B). Finally, using Pearson correlation analysis, we found a strong inverse

correlation between CD151 mRNA and miR-199a-3p expression in HCC (Fig. 2.7C).

2.4. Discussion

We report that CD151 is regulated by miR-199a-3p in HCC. miR-199a-3p

expression is significantly reduced in HCC[33,52-54] and Fig. 2.5A; CD151 is involved in

HCC invasion and migration.[153,161,162] An explanation for the increase in CD151

protein in HCC has not been identified to our knowledge. While it is possible that enhanced

CD151 levels in HCC arise from increased transcription of the CD151 gene, our data

suggest that the low levels of CD151 in unaffected liver result in part from post-

transcriptional regulation by miR-199a-3p.

An RNA-seq study has reported that miR-199a-3p is the third most downregulated miRNA in HCC.[53] Data presented here further suggest important roles for miR-199a-3p in the development and progression of HCC. HCC patients with low miR-199a-3p expression had poorer survival compared to those with high miR-199a-3p levels (Fig.

2.5B).[55] We previously showed that only those HCC cells that are positive for hyaluronic acid receptor CD44 responded to the anti-proliferative effects of miR-199a-3p.[57] In

addition, miR-199a-3p regulates HBV replication in HCC.[60] These findings, coupled with those reported herein, emphasize the critical role that one deregulated miRNA may

have on the cancer phenotype. Reduced miR-199a-3p could influence oncogenesis at

various stages of development. Increased HBV replication may occur early on by reduced

miR-199a-3p [60], followed by promoting proliferation in a CD44+ manner and finally

increased invasion and metastasis at later stages. Treating HCC with miR-199a-3p

oligonucleotide mimic could conceivably alter HCC formation at various stages of development. This concept is particularly timely as a miR-34 oligonucleotide mimic has recently been used in a phase I trial to treat HCC [163].

In summary, we show that CD151 is involved in regulation of in vitro invasion and metastasis but not proliferation of HCC cell lines. miR-199a-3p, a miRNA that is significantly reduced in HCC, directly targets CD151. These data further implicate miR-

199a-3p in the progression of HCC and suggests that oligonucleotide therapy using a miR-

199a-3p mimic may be effective for treating advanced HCC.

Acknowledgements

This work was supported by NIH grant R21CA170096 and a fellowship from the Eli Lilly

Foundation to JHK. I acknowledge Jinmai Jiang for measuring miR-199a-3p level in HCC specimens by qRT-PCR and Jong-kook Park and Mohamed Badawi for establishing the constructs containing wild-type and mutated CD151 3’UTR, respectively. Twenty-five paired human HCC and adjacent non-tumor liver tissues were provided by Dr. Robert at

Mayo Clinic (Rochester, Minnesota). Survival data from TCGA was analyzed by Xiaokui

Mo.

Figure 2.1 CD151 is a target of miR-199a-3p.

A, Schematic diagram representing the location and conservation of the putative miR- 199a-3p binding site within the 3′UTR of CD151 mRNA. B, Luciferase reporter plasmids containing wild type 3’UTR of CD151 or mutated 3’UTR of CD151 were transiently transfected in SNU449 cell line with either pre-miRNA control or miR-199a-3p at 50 nM. Luciferase expression was measured at 48 h after transfection. Normalized Renilla luciferase activity in cells transfected with negative control oligo (NC) was set at 100%. C, CD151 protein expression in SNU-423 and SNU-449 with negative control oligo or miR- 199a-3p mimic transfection was determined by Western blot. D, Relative CD151 mRNA expression was measured by qRT-PCR in negative control or pre-miR-199a-3p transfected cells.

Figure 2.2 CD151 is overexpressed in mesenchymal HCC cell lines.

A, Several epithelial and mesenchymal markers were analyzed in HCC cell lines by qPCR. B, The CD151 protein expression was assayed by Western blot in several HCC cells.

Figure 2.3 CD151 is not involved in HCC cell proliferation in vitro.

A, SNU423 cells were transfected with either CD151 siRNA or negatvie control siRNA using lipofectamine 2000. At 72h after the transfection, mRNA level of CD151 was measured by qPCR. B, Different HCC cell lines were transfected with 100 nM control siRNA or CD151 siRNA and cell viability was determined by WST-1 assay, 96 h after transfection.

A B

C D

Figure 2.4 Reintroduction of miR-199a-3p and knockdown of CD151 reduces cell migration in vitro.

A and B, Wound healing assays were conducted with negative control and miR-199a-3p mimic transfected SNU449 cells (4X magnification). C and D, Wound healing assays were conducted with control siRNA and CD151 siRNA transfected SNU449 cells (4X magnification). The data are representative of three independent experiments; **p<0.01).

Figure 2.5 Reintroduction of miR-199a-3p and knockdown of CD151 reduces cell invasion in vitro.

A and B, Boyden Chamber Invasion assay was conducted with negative control and miR- 199a-3p mimic transfected SNU449 cells. C and D, Boyden Chamber Invasion assay was conducted with control siRNA and CD151 siRNA transfected SNU449 cells. The number of the invading cells was determined from 5 different fields for each experiment; ** p<0.01, *** p<0.001.

Figure 2.6 miR-199a-3p is reduced in HCC tissues and low miR-199a-1 expression correlates with poor survival.

A, Relative miR-199a-3p expression was measured by qRT-PCR in benign and tumor tissue samples and normalized to 18S RNA. B, Survival data from TCGA liver hepatocellular carcinoma were analyzed by log-rank tests.

Figure 2.7 miR-199a-3p and CD151 expression inversely correlates in HCC specimens.

A, Relative expression of CD151 mRNA was measured by qRT-PCR. B, CD151 protein was determined in HCC specimens compared to benign pair tissues by western blot. C, Correlation of miR-199a-3p and CD151 expression in HCC specimens was examined by Pearson correlation analysis. (r= -0.58905, p < 0.001).

CHAPTER 3

3. Development of a bioanalytical method for PK/PD of therapeutic

miRNA mimics

3.1. Introduction

It has been shown that expression of miRNAs is deregulated in all types of the

cancers [38]. miRNAs may play a oncogenic or tumor suppressive role depending on the

type of cancer. miR-199a-3p is one of the miRNAs whose expression are decreased in HCC

[33,52-54]. It has been shown that miR-199a-3p targets several important oncogenes

including cMET [55,56], mTOR [55] and PAK4 [58]. In addition, we previously reported

that miR-199a-3p mimic reduced cell proliferation, migration and invasion by targeting

CD44 [152] and CD151 as discussed in chapter 2 in HCC. Therefore, the restoring levels

of miR-199a-3p by reintroduction of miR-199a-3p mimic holds great potential as a new

therapeutic option for treating HCC.

Quantitative polymerase chain reaction (qPCR) coupled with reverse transcription qRT-PCR, is one of the most powerful and sensitive tool to quantify gene expression.

Frequently, qRT-PCR is used to quantify small RNA including microRNA (miRNA) [164].

There are two methods to present gene expression data by qPCR [164]. In absolute

quantification, unknown samples can be quantified based on a standard curve from the

prepared known samples. The relative quantification compares the gene expression relative

to another reference gene (internal control).

We previously developed a validated qPCR assay to measure antisense oligonucleotides against to miR-221 for PK/PD studies in an HCC xenograft mouse model

[44]. We investigated the therapeutic efficacy of anti-miR-221 since miR-221 is an

oncogenic and upregulated miRNA in HCC [54,165-167] and it targets several important

tumor suppressors such as p27Kip1 [168-170], p57Kip2 [41,171], phosphatase and tensin

homolog (PTEN) [39]. To quantitatively assay anti-miR-221 levels, the absolute

quantification method was used by generating a validated standard curves in both mouse

plasma and liver homogenate.

We propose to reintroduce miR-199a-3p as a potential therapy for HCC. Therefore,

a new quantitative assay needs to be developed to measure miR-199a-3p levels. The

purpose of this study is to develop a novel quantitative qPCR assay to measure miR-199a-

3p in plasma and liver tissue for future PK/PD study in HCC xenograft mouse model in

order to evaluate the therapeutic effects of miR-199a-3p mimic.

3.2. Materials and Methods

Oligonucleotides

HPLC purified, miR-199a-3p mimic was purchased from IDT. The sequence of miR-

199a-3p mimic was identical to hsa-miR-199a-3p that reported in miRBase;

5’-ACAGUAGUCUGCACAUUGGUUA-3’. Molar concentration of the

oligonucleotides was converted to copy number per volume using Avogadro’s number

(6.02214179×1023 mol-1) according to the International System of Units.

Production of standard curve in mouse plasma and liver tissue

To quantitatively assay the amount of miR-199a-3p in mouse plasma and liver

tissue samples, standard curves were generated from the known concentration of miR-

199a-3p oligonucleotide samples in control plasma and liver homogenate. The

concentrations of miR-199a-3p oligonucleotide range from 105 to 1012 copies per PCR.

Two microliters of the known samples of mouse plasma and RNA extract from liver

homogenates was used to synthesize the first-strand cDNA as described [172] using

primers and probes specific to miR-199a-3p oligonucleotide. TaqMan® microRNA Assay

was performed according to the manufacturer’s protocol (Applied Biosystems).

Validation of the Quantitative analytical method

Accuracy and precision of the PCR assay were determined for both intra- and inter-

day runs. cDNA was synthesized for each intra- and inter-day run to generate standard

curves and measure Ct value for the known samples. Coefficient of variation was

determined as the ratio of the standard deviation to the mean. The percentage relative error

was calculated by comparing mean Ct value obtained by the method to the true value of

the known samples. Coefficient of variation and the percentage relative error were

calculated at three different concentrations of oligonucleotide.

3.3. Results

Quantitative RT-PCR method for miR-199a-3p mimic assay

miR-199a-3p was converted to cDNA by priming with a miR-199a-3p specific

reverse transcription (RT) primer (Fig. 3.1A, reverse transcription step) and qPCR was

then performed using forward primer, reverse primer and TaqMan® MGB Probe. (Fig.

3.1A, PCR step). CT is the PCR cycle threshold where the fluorescent signal of the

reporter dye crosses the threshold. Therefore, CT inversely represents the amount of the target amplicons in the PCR [164]. Fig. 3.1B displays the amplification plot of miR-199a-

3p oligonucleotides in the plasma samples.

The qPCR assay produced a 7 log linear dynamic range of standard curves for both plasma and liver tissue samples.

Standard curve of miR-199a-3p mimic in plasma (A) and in liver tissue (B) were generated by qRT-PCR (Fig. 3.2). They were produced in control plasma and liver homogenate using 105 to 1012 copies of miR-199a-3p oligonucleotide per PCR. The qRT-

PCR assay produced a 7 log linear dynamic range of standard curves for both plasma and liver tissue samples and was sensitive to 105 copies and 106 copies of miR-199a-3p mimic

in plasma and liver homogenate, respectively.

Accuracy and precision of the qPCR assay for miR-199a-3p mimic

Accuracy is the closeness of the analytical measurements to the true values and it

can be evaluated by comparing the analyzed value to the true value of known reference

samples. The International Conference on Harmonization (ICH) define precision as

closeness of agreement (degree of scatter) between a series of measurements obtained from

37 multiple sampling of the same homogeneous sample under the prescribed conditions.

Accuracy and precision of the qRT-PCR assay were determined for both intra- and inter- day runs (Table 3.1). Coefficient of variation is an indication of precision. The percentage relative errors at the different concentrations of oligonucleotide, representing the entire range of samples were analyzed. The accuracy and precision of this bioanalytical method was validated and they stayed all within recommended bioanalytical standard in both plasma and liver tissue samples.

3.4. Discussion

The intensive research effort has been implemented in miRNA-related studies for two decades and they have shown great potential as miRNA-based therapies to treat a variety of diseases. Miravirsen (Santaris Pharma A/S) is the first microRNA antisense oligonucleotide which inhibits miR-122 for treatment of HCV infection and recently its phase 2 study was successfully completed [173]. Mirna Therapeutics is developing miRNA replacement therapies by introducing miR-34a mimic to treat various cancers including

HCC [163]. In addition, our lab also has been developing a novel microvesicle-based delivery system to reintroduce miR-199a-3p in treating HCC.

Bioanalytical methods for oligonucleotide-based therapies are typically performed using liquid chromatography/mass spectrometry (LC/MS) and ELISA based methods.

LC/MS yields good selectivity but insufficient sensitivity to detect low level of oligonucleotides. ELISA techniques provide good sensitivity but it is not selective for some metabolites. Instead of using ELISA or LC/MS, we developed a highly sensitive and reproducible qRT-PCR to measure RNA oligonucleotides. While our assay was developed

for miR-199a-3p mimic, there is no reason that it cannot be applied to other

oligonucleotide-based drugs such as siRNA , antisense or other miRNA mimics.

Here we show that we successfully developed and validated a quantitative analytical method to assay the oligonucleotides in mouse plasma and liver homogenates for mouse HCC model. This qPCR assay was able to produce a 7 log linear dynamic range and was sensitive to 105 copies (0.2 pM). The Coefficient of variation and the relative errors

at the different concentrations of oligonucleotides were all within recommended

bioanalytical standard in both plasma and liver tissue samples.

We used a single stranded synthetic oligonucleotide which is exactly identical to mature miR-199a-3p to produce the standard curve. In our previous study with anti-miR-

221, the standard curves were created with chemically modified antisense oligonucleotide and the lower limit of detection for anti-miR-221 assay was 10 copies per PCR [44]. In this experiment, no chemical modifications were used to enhance the stability of the oligonucleotides. However, the chemical structure of the oligonucleotides would be modified in order to achieve better detection limit in plasma and liver tissues for future

PK/PD study with miR-199a-3p mimic.

Acknowledgements

This work was supported by a fellowship from the Eli Lilly Foundation to JHK.

Figure 3.1 Schematic overview of quantification assay for miR-199a-3p by qPCR

A, mature miR-199a-3p was converted to cDNA by priming with a miR-199a-3p specific reverse transcription (RT) primer (step 1) and qPCR was then performed using forward primer, reverse primer and TaqMan® MGB Probe. B, The amplification plot of miR- 199a-3p level in the plasma samples by qPCR.

Figure 3.2 Standard curves of miR-199a-3p quantification

Standard curve of miR-199a-3p mimic in plasma (A) and in liver tissue (B) were generated by qPCR. They were produced in control plasma and liver homogenate using 105 to 1012 copies of miR-199a-3p oligonucleotide per PCR .

CV % % relative error Conc. intra-day inter-day intra-day inter-day

Plasma 1nM 1.25% 0.72% 1.34±0.13 0.67±0.72 samples

100pM 1.21% 0.35% 1.24±1.04 1.07±0.35

10pM 1.46% 0.36% 1.28±0.89 0.75±0.46

CV % % relative error Conc. intra-day inter-day intra-day inter-day Liver 1nM 0.57% 0.50% 2.17±0.71 1.82±0.51 samples 100pM 0.63% 0.72% 2.70±0.80 2.46±0.73

10pM 0.75% 0.67% 2.33±0.95 1.72±0.68

Table 3.1 Accuracy and precision of the qPCR assay for miR-199a-3p mimic

Accuracy and precision of the qPCR assay were determined for both intra- and interruns. Coefficient of variation is an indication of precision. The percentage relative error at the different concentrations of oligonucleotide were analyzed.

CHAPTER 4

4. Regulation of CD44 expression by miR-221 in hepatocellular

carcinoma through PI3K-AKT-mTOR pathway

4.1. Introduction

MicroRNA (miRNA) is a class of small non-coding RNA which consists of 21-22 nucleotides. miRNAs suppress target expression by binding to the 3’ UTR of the target mRNA ,which leads to translational repression and/or mRNA degradation [12]. It has been shown that expression of miRNAs is deregulated in all types of the cancers [31]. miR-

221/222 is increased in several malignancies, particularly solid tumors including HCC. miRNA profiling studies revealed that miR-221 expression was upregulated in HCC

[54,165-167]. miR-221 and -222 are encoded in the same polycistonic RNA precursor and

share the identical seed sequence. miR-221 targets several important tumor suppressors

including p27Kip1[168-170], p57Kip2 [41,171], phosphatase and tensin homolog (PTEN)

[39], a tissue inhibitor of metalloproteinase-3 (TIMP3) [39], and the DNA damage-

inducible transcript 4 (DDIT4) [166]. It has been also reported that transgenic mice

overexpressing miR-221 in the liver promotes carcinogenesis [174]. Previously our lab

published that anti-miR-221 oligonucleotide effectively reduced miR-221 levels, regulated

the target proteins of miR-221 and enhanced the survival rate in a clinically relevant

orthotopic mouse model of HCC [44]. Thus, inhibition of miR-221 using antisense

oligonucleotide could exert anti-cancer effects by reversing the malignant phenotype of

HCC.

CD44 is a hyaluronic acid receptor and major cell surface glycoprotein which is involved in cell-cell interaction, cell adhesion, cell migration and invasion [81]. CD44 is known as one of the important cancer stem cell (CSC) or tumor initiating cell markers in several malignancies including HCC [84-87]. It has been reported that CD44 is overexpressed in HCC [57] and patients expressing low amounts of CD44 showed significantly better disease-free survival compared to those patients expressing high

amounts of CD44 [91]. Moreover, it was recently reported that CD44 is also associated

with sorafenib resistance in HCC [93,94].

PI3K pathway are frequently altered in various types of human cancers including HCC

[111]. Interestingly, miR-221 could regulate PI3K/Akt/mTOR pathway by directly targeting DDIT4 [166] as well as PTEN [39].

Due to the significance of miR-221 and CD44 in HCC, we wanted to investigate their association and the underlying molecular mechanism of CD44 regulation in HCC. In

this chapter, we report a direct correlation between miR-221 and CD44 expression in HCC

cell lines and inhibition of miR-221 with antisense oligonucleotide negatively regulates

CD44 expression through P13K-AKT-mTOR pathway, one of the most aberrantly

activated significant pathways for HCC pathogenesis.

4.2. Materials and Methods

Cell culture

The human HCC cell lines PLC/PRF/5, Huh7, HepG2, Hep3B, SNU-449, SNU-

423, SNU-387 and SK-Hep-1 were purchased from American Type Tissue Collection

(Manassas, VA) or were obtained from various investigators. Huh7, HepG2, Hep3B and

SK-Hep-1 cells were grown in MEM medium (Gibco) with 10% fetal bovine serum

(Sigma). PLC/PRF/5, SNU-449, SNU423 and SNU-387 cells were cultured in RPMI 1640 medium (Gibco) containing 10% fetal bovine serum (Sigma).

RNA extraction and Quantitative real-time PCR

Total RNA was isolated from HCC cells using miRNeasy® Mini kit (Qiagen).

cDNA was synthesized according to the manufacturer’s protocol (Invitrogen). Five

hundred ng of total RNA was used to synthesize cDNA using random primers. cDNA was

analyzed for gene expression using gene specific primers (IDT) and the Express SYBR®

GreenER qPCR super mix (Invitrogen). For the detection of miR-221, 100 ng of total RNA

was assayed using the TaqMan® microRNA Assays (Applied Biosystems). In order to

identify various isoforms of CD44 in HCC cell lines, primers which can amplify the

specific various exon were designed as shown in Table 1. Data were normalized to 18S

rRNA and the relative gene expression of genes was presented using the comparative CT method. The following primers were used; CD44: 5’- TGCAGTTTGCATTGCAGTC-3’

(forward) and 5’-CATTGCCACTGTTGATCACTAG-3’ (reverse), CDH1: 5’-CCCACCA

CGTACAAGGGTC-3’ (forward) and 5’-CTGGGGTATTGGGGGCATC-3’(reverse), vimentin: 5’-CAGCTAACCAACGACAAAGCC-3’ (forward) and 5’-ATCCTGTCTGA

AAGATTGCAGGG-3’ (reverse), ZEB2: 5’-CCTGGCACAACAACGAGATT-3’

(forward) and 5’-TACTCCTCGATGCTGACTGCA-3’ (reverse), twist: 5’-GAGCAAGA

TTCAGACCCTCAA-3’ (forward) and 5’-ACCTGGTAGAGGAAGTCGATG-3’

(reverse), SNAI2: 5’-TTCCAGACCCTGGTTGCT-3’ (forward) and 5’-CAAATGCTCT

GTTGCAGTGAG-3’ (reverse), 18S : 5’-GTAACCCGTTGAACCCCATT-3’ (forward) and 5’-CCATCCAAT CGGTAGTAGCG-3’(reverse)

Transfection of antisense oligonucleotides

Anti-miR-221 and scrambled negative control oligonucleotides were synthesized

from ThermoFisher. 2′-O-methyl phosphorothioate-modified anti-miR-221 oligo

nucleotide with a 3’ cholesterol labeled was used [44]. SK-Hep-1 and SNU449 were

transfected with either anti-miR-221 or scrambled negative control oligonucleotides using

Lipofectamine 2000 and Opti-MEM medium (Gibco) according to the manufacturer's

protocol. For miRNA profiling, SNU-449 was transfected with 100 nM anti-miR-221 or

scrambled negative control oligo using lipofectamine 2000 (Invitrogen) and Opti-MEM

medium (Gibco). At 72h after transfection, total RNA was extracted using Trizol

(Invitrogen) according to the manufacturer's protocol.

miRNA expression profiling

miRNA profiling was conducted to investigate miRNAs expression in anti-miR-

221 transfected SNU449 cells. The expression of over 900 mature miRNAs were profiled using reverse transcription qPCR as described [175]. Briefly, cDNA from 1 µg of DNase

treated total RNA was prepared using 10 µM of the anti-sense primer and a primer for the

internal control. TaqMan® microRNA Assays (Applied Biosystems) was then performed

according to the manufacturer’s protocol.

Cell proliferation assay

A cell proliferation assay was carried out using the reagent WST-1 (Roche). SK-

Hep-1 and SNU-449 cells were seeded into 96-well plates at the density of 2,000 cells per

well. On the following day, the cells were transfected with either scrambled antisense

oligonucleotide as negative control or anti-miR-221 oligonucleotide. Ten microliters of

WST-1 were then added and incubated for 2 hours. The absorbance of the samples was

measured using a microplate reader at 450 nm. All experiments were carried out at least in

triplicates.

Western blotting

Total protein from SK-Hep-1 and SNU-449 cells was extracted with

radioimmunoprecipitation assay (RIPA) buffer (Sigma). Cell protein lysates (20-30 μg) were separated on NuPAGE 4-12% Bis-Tris gels (Novex) electrophoretically and transferred to polyvinylidene difluoride membranes (Roche). Membranes were blocked for

1 h with 5% Bovine Serum Albumin in Tris-buffered saline containing 0.05% Tween 20 and incubated overnight with primary antibody. The following primary antibodies were

used: anti-CD44 (Cell signaling, #3578), anti-vimentin (Abcam, ab92547), anti-

phophorylated S6K (Cell signaling, #9234), anti-phophorylated 4EBP-1 (Cell signaling,

#2855), anti-GAPDH antibodies (Santa Cruz Biotechnology, sc-32233) as a loading control. A secondary anti-rabbit (Cell Signaling) or anti-mouse immunoglobulin G (IgG) antibody peroxidase conjugate (GE Healthcare) was detected using ECL Western Blotting

Analysis System (Amersham Biosciences).

Statistical analysis

All the samples between treatments were compared using a student’s 2-sample t- tests. All error bars represent the standard deviation of the mean. A p-value < 0.05 was considered significant.

4.3. Results

CD44 expression is increased in mesenchymal like HCC cell lines.

We previously published that miR-199a-3p reduced cell proliferation by up to 60% in a subgroup of CD44 positive HCC cell lines [57]. To expand upon these previous findings, we first analyzed a published data set of gene expression from various HCC cell lines (GSE36133). Some HCC cell lines have high levels of E-cadherin (CDH1) and low vimentin suggesting that they were of an epithelial origin while another group had the opposite expression pattern i.e. low levels of E-cadhein and high vimentin suggesting that they were of an mesenchymal origin (Fig. 4.1A). CD44 expression was low in epithelial

HCC cells and high in mesenchymal HCC cells (Fig. 4.1A). We then measured CD44 expression in the HCC cell lines by qRT-PCR. First, epithelial or mesenchymal phenotypes were evaluated by measuring epithelial or mesenchymal markers in the HCC cell lines. 48

The expression of CDH1 and several mesenchymal markers including vimentin, ZEB2, and twist were measured in 8 different HCC cell lines (Fig. 4.1B). Our results confirm that

CD44 expression is increased in mesenchymal HCC cell lines, compared to epithelial like

HCC cell lines (Fig. 4.1C).

CD44s is the most abundant isoform in HCC cell lines.

CD44 is encoded by a single gene consisting of 20 exons [81]. Various CD44 isoforms are generated by alternative splicing and the expression of each isoform varies

depending on the type of cancers [82,83]. To identify which isoforms are expressed in HCC

cell lines, we analyzed different HCC cell lines by qRT-PCR. The primer which amplifies

the common exons for every isoform are used to detect total CD44 transcripts (Fig. 4.2A).

To detect variant isoforms containing each various exon, the forward primers amplifies

their specific exon. The standard isoform of CD44 (CD44s) is the smallest isoform. To

amplify only CD44s, the forward primer which spans exon 5 and 15 was used. Primers

used to identify various isoforms are presented in Table 1. In HCC cell lines, the variant isoforms are expressed at low amounts compared to total CD44 transcripts. However,

CD44s expression was almost identical to the total CD44 transcripts (Fig. 4.2B). These results demonstrate that the most abundant CD44 isoform in the HCC cell lines is CD44s.

A direct correlation exists between CD44 and miR-221 expression.

The striking correlation between the mesenchymal phenotype and high CD44 expression led us to investigate the cause of the different CD44 expression in HCC cell lines. The Croce lab has discovered that miR-221 is among the most significantly over expressed miRNA in HCC [39,40]. We therefore measured miR-221 levels in the HCC cell 49

lines to see if a correlations exists between miR-221 and CD44 expression. To our surprise,

a direct correlation exists between the expression of CD44 and miR-221 (Fig. 4.3). In mesenchymal-like HCC cell lines, both CD44 and miR-221 are increased while epithelial- like HCC cell lines express low CD44 and miR-221 level.

CD44 and miR-221 are overexpressed in mesenchymal 3sp cells of human HCC .

Another group developed an EMT model of HCC by generating two distinct cell lines from the liver of an HCC patient [104]. They measured several epithelial and mesenchymal markers to confirm that the cell line 3p are of an epithelial origin while 3sp

are mesenchymal cells. From the published gene expression data from those two different cell lines (GSE26391), we confirmed that CD44 expression is low in the 3p epithelial cells and high in the 3sp mesenchymal cells (Fig 4A, p< 0.01). Total RNA from those two cell

lines were generously provided to us by Dr. Wolfgang Mikulits and miR-221 levels in those

two cell lines were measured by qRT-RCR. As we anticipated, miR-221 levels were

significantly lower in 3p, epithelial cells and high in 3sp, mesenchymal cells (Fig. 4.4B,

p<0.001). This result was consistent to what we observed in our HCC cell lines. This

finding confirms a direct correlation between CD44, miR-221 and the mesenchymal

phenotype exists in primary HCC cells that are derived from patients.

Anti-miR-221 significantly decreased cell viability in mesenchymal-like HCC cells.

To determine if inhibition of miR-221 reduces cell proliferation, SK-Hep-1 and

SNU-449 cells were transfected with scrambled antisense oligonucleotides or anti-miR-

221. WST-1 proliferation assay was performed at 48 h and 96 h after transfection. Anti-

miR-221 inhibited cell proliferation in a concentration dependent manner. In SK-hep-1

cells, 25 nM of anti-miR-221 significantly inhibited cell proliferation by 20% at 48 h and

60% at 96 h. Fifty nM of anti-miR-221 decreased cell viability in those same cells by 40%

at 48h and 80% at 96h (Fig. 4.5A). In SNU-449 cells, 25nM of anti-miR-221 inhibited cell

proliferation by 40% at 48 h and 70% at 96h. Fifty nM of anti-miR-221 decreased cell viability by 50% at 48h and 87% at 96 h in these same cells (Fig. 4.5B). These HCC cell lines are mesenchymal-like HCC cells (Fig. 4.1C). Anti-miR-221 reduced cell viability of the mesenchymal HCC cells by decreasing miR-221 level, compared to negative control oligonucleotide.

Anti-miR-221 reduced CD44 expression in HCC cells at translational level and ectopic expression of miR-221 increased CD44 expression in HCC cells.

The direct correlation between CD44 and miR-221 in HCC cells prompted us to determine whether miR-221 regulates CD44 expression in HCC. Two HCC cell lines with high miR-221 and high CD44 were transfected with anti-miR-221 or scrambled negative control to investigate if CD44 expression would be changed by reducing miR-221 levels.

Very surprisingly, CD44 protein expression was decreased in the anti-miR-221 treatment group compared to the scrambled control group (Fig. 4.6A). To confirm that miR-221 levels were reduced by anti-miR-221, mature miR-221 levels were measured by qRT-PCR

(Fig. 4.6B). Next we measured the mRNA level of CD44 in anti-miR-221 transfected HCC

cells. Interestingly, CD44 mRNA was not changed in anti-miR-221 treatment (Fig. 4.6C), even though CD44 protein was decreased with anti-miR-221 treatment. We wanted to further investigate the regulation of CD44 by miR-221 in HCC. To further investigate the

potential regulation of CD44 by miR-221 in HCC, Huh7 cells were transfected with 100nM of miR-221 mimic. Huh7 cells express low miR-221 level and are CD44 negative.

Interestingly, the ectopic expression of miR-221 increased CD44 expression (Fig. 4.6D).

These results suggest that CD44 expression is regulated by miR-221 and anti-miR-221

suppresses CD44 protein expression post-transcriptionally.

miR-profiling reveals that anti-miR-221 upregulates several tumor suppressive miRNAs which targets CD44.

Next we wanted to investigate how miR-221 regulates CD44 expression without

changing the mRNA level. First, we hypothesized that anti-miR-221 regulates other

downstream miRNAs which target CD44 by translation repression instead of mRNA

degradation. To determine which miRNAs are upregulated by anti-miR-221, miR-profiling

in anti-miR-221 treated SNU449 cells was performed. The change in miRNA expression

by anti-miR-221 was presented as the –logP X Fold Change (ASO/SC) in Table 4.2. We

found several interesting upregulated miRNAs (Fig. 4.7). miR-221 was the most

significantly changed miRNA. Other than miR-221, the fold change of miR-1290 and miR-

708 was 7.54 and 15.54, respectively with miR-221 inhibition. Interestingly, CD44 is a

predicted target of miR-708 and it has been reported that miR-708 targets CD44 in prostate

cancer [176]. These findings suggest that anti-miR-221 upregulates miR-708 expression

causing a reduction in CD44 expression in HCC cells.

Anti-miR-221 negatively regulates the mTOR pathway in HCC and mTOR inhibitor

reduces CD44 expression in HCC cells at the translational level.

It has been reported that mR-221 targets PTEN and DDIT which are involved in

PI3K-AKT-mTOR pathway [39,166]. In addition, it was published that CD44 expression

was regulated in a mTOR pathway-dependent manner in prostate cancer [177]. We

hypothesized, therefore that miR-221 indirectly regulates CD44 expression through the

PI3K-AKT-mTOR pathway in HCC. First, we wanted to determine if anti-miR-221

regulates the main downstream genes of mTOR pathway such as 4EBP-1. 4EBP-1 is a key

downstream regulator of protein synthesis. Immunoblotting showed that phosphorylation

of 4EBP-1 was blocked by anti-miR-221 along with suppressed CD44 expression (Fig.

4.8A). Next, we investigated regulation of CD44 expression using an mTOR inhibitor in

HCC cells. The aggressive SNU423 and SNU449 cells were treated with the ATP-

competitive mTOR inhibitor, PP242. The inhibitor decreased CD44 and vimentin

expression (Fig. 4.8B). We then measured CD44 and vimentin mRNA level in PP242

treated cells. Even though immunoblotting showed a great reduction in CD44 and VIM

protein (Fig. 4.8B), there was no change in the mRNA level (Fig. 4.8C). This indicates that

anti-miR-221 negatively regulates the mTOR pathway and CD44 and VIM were regulated

by translational regulators such as 4EBP-1 in mesenchymal HCC cells.

4.4. Discussion

. miR-221 expression is upregulated in the HCC [54,165-167] and transgenic mice

overexpressing miR-221 in the liver promotes carcinogenesis [174]. CD44 is an important

cancer stem cell or tumor initiating cell maker in several malignancies including HCC [84-

87] and HCC patients expressing low CD44 showed significantly better disease-free survival rate compared to high CD44 expression group [91]. In addition, CD44 is

associated with sorafenib resistance in HCC [93,94]. In this study, we found a positive

correlation between miR-221 and CD44 expression in HCC cell lines; both are

overexpressed in mesenchymal-like HCC cell lines compared to epithelial-like HCC cell

lines (Fig. 4.3). Van Zijl et al developed primary HCC cells that express both the epithelial

(3p cells) and mesenchymal (3sp cells) properties [104]. We found that the 3p epithelial

cells express low CD44 and miR-221 while the mesenchymal 3sp cells express high CD44

and miR-221 (Fig. 4.4). This is of particular importance to our study because it

demonstrates that phenotypes that are present in continuous cells lines are also apparent in

primary cell lines from HCC patients.

The correlation between miR-221 and CD44 in HCC led us to investigate whether miR-221 could directly or indirectly regulate CD44 in HCC. Surprisingly, anti-miR-221 reduced CD44 protein expression (Fig. 4.6A) and miR-221 mimic increased CD44 expression (Fig. 4.6D). Since miRNAs typically suppress the expression of their targets,

CD44 cannot be a direct target of miR-221. Since we did not observe any change of CD44 mRNA level in anti-miR-221 transfected cells (Fig. 4.6C), we first hypothesized that anti- miR-221 regulates other downstream tumor suppressive miRNAs which directly target

CD44 by translation repression, not by mRNA degradation. miR-708 is one of the most significantly upregulated miRNAs by anti-miR-221 transfection (Fig. 4.7) and miR-708 directly targets CD44 in prostate cancer [176]. In addition, we considered PI3K-AKT-

mTOR pathway to explain CD44 regulation of miR-221 because miR-221 directly targets

PTEN and DDIT4 in HCC which modulates PI3K-AKT-mTOR pathway [39,166] and

CD44 expression was regulated by mTOR-dependent manner in prostate cancer [177].

PTEN is an important tumor suppressor in HCC and the most significant negative regulator of the PI3K/AKT/mTOR signaling pathway [178]. DDIT4 is also associated with

PI3K/AKT/mTOR signaling pathway regulating TSC1/2, a downstream tumor suppressors of AKT [179]. Since miR-708 also directly targets AKT as well as CD44 [176], we hypothesized that miR-221 regulates CD44 expression through PI3K-AKT-mTOR pathway by directly targeting PTEN and DDIT4 and by regulating miR-708 which directly targets AKT and CD44. To confirm CD44 regulation through the PI3K/AKT/mTOR signaling pathway, we treated mesenchymal-like, CD44 positive SNU423 and SNU449 cells with the mTOR inhibitor, PP242. The inhibition of the mTOR pathway indeed decreased CD44 expression at the translational level which is identical to regulation of

CD44 by anti-miR-221 (Fig. 4.8B). Since we demonstrated the suppressed CD44 expression by PP242 in HCC, this ATP-competitive mTOR inhibitors will be further investigated in Chapter 5. Since CD44 is associated with sorafenib resistance [93,94] and

PI3K-AKT-mTOR pathway is abnormally active in sorafenib resistance [100], the regulation of CD44 by ATP-competitive mTOR inhibitor may show therapeutic potentials for sorafenib resistant HCC. In summary, miR-221 directly targets PTEN and DDIT4 or indirectly regulates miR-708 which targets AKT and CD44. miR-221 regulates CD44 expression by modulating PI3K-AKT-mTOR pathway at the translational level in HCC

(summarized in Fig. 4.9).

In this study, we report that both mesenchymal-like HCC cell lines and mesenchymal primary HCC cells from the patient express high miR-221 and high CD44. miRNAs are stably circulating in the blood stream [180] and CD44 has been shown to be

responsible for drug-resistance processes [92] including sorafenib resistance in HCC

[93,94]. Therefore, the signature of circulating miR-221 and CD44 can be used to predict prognosis as biomarkers in treating HCC patients.

Acknowledgements

Total RNA from 3p epithelial cells and 3sp mesenchymal cells were generously provided

by Wolfgang Mikulits. miRNA-profiling of anti-miR-221 transfected SNU449 cells was performed by Jinmai Jiang.

Figure 4.1 CD44 is overexpressed in mesenchymal HCC cell lines. (Continued) 57

Figure 4.1: Continued

A, CDH1, vimentin and CD44 expression were examined from GSE36133 data set. B, Eight different HCC cell lines were evaluated measuring the relative gene expression including an epithelial marker (CDH1) and mesenchymal markers such as vimentin, ZEB2, and twist. C, CD44 expression was measured in 8 different HCC cell lines by qRT-PCR.

Figure 4.2 CD44s is the most abundant isoform in HCC cell lines.

A, Schematic of the primers used for detecting each CD44 isoform. The primers for total CD44 were annealed to common exons while CD44s was primed with a specific forward primer spanning the exons. B, several CD44 isoforms were measured in 8 different HCC cell lines by qRT-PCR.

Forward 5’- TGCAGTTTGCATTGCAGTC-3’ CD44 total Reverse 5’- CATTGCCACTGTTGATCACTAG -3’

Forward 5’- CTACCAGAGACCAAGACACATTC-3’ CD44s Reverse 5’- CTGTTGACTGCAATGCAAACT-3’

Forward 5’- GTAGACAGAAATGGCACCACTG-3’ CD44 v5 Reverse 5’- CATTGCCACTGTTGATCACTAG -3’

Forward 5’-TCCAGGCAACTCCTAGTAGTACAAC-3’ CD44 v6 Reverse 5’- CATTGCCACTGTTGATCACTAG -3’

Forward 5’- GACTCCAGTCATAGTATAACGCTTCA -3’ CD44 v8 Reverse 5’- CATTGCCACTGTTGATCACTAG -3’

Forward 5’- ACAGGTGGAAGAAGAGACCCA-3’ CD44 v10 Reverse 5’- CATTGCCACTGTTGATCACTAG -3’

Table 4.1 The primers were used to identify various CD44 isoforms in HCC cell lines.

Figure 4.3 There is a direct correlation between CD44 and miR-221 in HCC cell lines.

A, CD44 and B, miR-221 expression were determined in different HCC cell lines by qRT- PCR.

Figure 4.4 CD44 and miR-221 are overexpressed in 3sp (M) of human EMT model.

A. CD44 expression was examined in 3p, epithelial cells and in 3sp, mesenchymal cells (GSE26391, p<0.01). B. miR-221 level was measured in 3p, epithelial cells and in 3sp, mesenchymal cells by qRT-PCR (p<0.001) and data is presented as multiplied by 106.

Figure 4.5 Anti-miR-221 significantly decreased cell viability in mesenchymal-like HCC cells.

A and B, SK-Hep-1 and SNU-449 were transfected with negative scrambled oligonucleotide or anti-miR-221 at 25nM and 50nM for 48h and 96h. Cell viability was determined by WST-1 assay. (**; p<0.01, ***; p<0.001) 63

48h 96h

Figure 4.6 Anti-miR-221 reduced CD44 expression in HCC cells at translational level and ectopic expression of miR-221 increased CD44 expression in HCC cells. (Continued)

A. SK-Hep-1 and SNU-449 cells were transfected with anti-miR-221 for 48 h and 96 h. CD44 expression was determined by immunoblotting. B. miR-221 level was measured by qRT-PCR in anti-miR-221 transfected cells. C. CD44 mRNA level was measured by qRT- PCR. D. Huh7 cells were transfected with 100nM of miR-221 mimic or negative control for 72h. CD44 expression was determined by immunoblotting.

Figure 4.6: Continued

48h 96h

-logP × FC Fold Change miRNA (ASO/SC) (ASO/SC)

hsa-miR-221 109.56 0.0286

hsa-miR-1290 34.88 7.54

hsa-miR-708 23.55 15.54

hsa-let-7i* 13.01 4.59

hsa-miR-1276 12.57 4.85

hsa-miR-148a 11.98 11.72

hsa-miR-579 10.37 10.53

hsa-miR-650 10.35 3.50

hsa-miR-586 8.30 4.08

hsa-miR-601 8.05 2.70

Table 4.2 List of miRNAs whose expression was affected by anti-miR-221 treatment in HCC cells.

SNU-449 was transfected with either anti-miR-221 or scrambled negative control for 48h. miRNA are listed by –logP × Fold Change.

Figure 4.7 There are differently regulated miRs in anti-miR-221 transfected SNU- 449 cells.

X axis represents Ct values of each miR in scrambled negative control group while Y axis represents Ct values of each miR in anti-miR-221 transfected group. All the experiments were conducted in triplicates.

Figure 4.8 Anti-miR-221 negatively regulates mTOR pathway and ATP site inhibition of mTOR reduces CD44 and vimentin expression in HCC cells at translational level.

A. SNU449 cells were transfected with anti-miR-221 or scrambled negative control. Phosphorylated 4EBP-1, main downstream gene of mTOR pathway was determined by immunoblotting. B. SNU-423 and SNU-449 were treated with PP242, ATP-competitive inhibitor for 48h and CD44, vimentin, both phosphorylated 4EBP-1 and S6K were determined by immunoblotting. C. mRNA level of CD44 and vimentin was determined by qPCR in PP242 treated HCC cells.

Figure 4.8

Figure 4.9 Summary of CD44 regulation of miR-221 through PI3K-AKT-mTOR pathway in HCC.

miR-221 regulates CD44 expression through PI3K-AKT-mTOR pathway in two ways. miR-221 directly targets PTEN and DDIT4, tumor suppressors which are involved in PI3K-AKT-mTOR pathway. This results in increased CD44 expression. On the other hand, miR-221 indirectly negatively regulates miR-708 which directly targets AKT and CD44. (Solid lines indicate direct regulation while dot lines represent indirect regulation.)

CHAPTER 5

5. ATP-competitive mTOR inhibitors exhibit anti-cancer effects in

mesenchymal-like as well as sorafenib resistant hepatocellular

carcinoma.

5.1. Introduction

Sorafenib is oral multikinase inhibitor which targets RAF/MEK/ERK pathway by

inhibiting Raf serine/threonine kinase and cell surface receptor tyrosine kinases including

vascular endothelial growth factor receptor and platelet-derived growth factor receptor [95].

Even though sorafenib is the standard, first-line treatment for the advanced HCC, sorafenib treatment showed clinically modest improvement and patients respond differently to sorafenib [6]. Furthermore, the major challenge of sorafenib treatment is that a number of patients develop resistance to sorafenib treatment [99]. There exists an urgent need to

develop better therapeutic agents for treating advanced HCC patients.

The PI3K/AKT/mTOR pathway is an important intracellular signaling pathway

which is responsible for cell proliferation, growth, survival, protein synthesis, and glucose

metabolism [107]. Several studies have indicated that the PI3K/AKT/mTOR signaling

pathway is abnormally activated in HCC [112-114]. In addition, a recent study showed that

the mTOR pathway is significantly more active in high-grade tumors and tumors with poor

prognostic features [64]. It was recently demonstrated that PI3K/AKT/mTOR signaling is

activated in the sorafenib resistant Huh7 cells compared to wild type Huh7 cells [100]. A multicenter, randomized phase III clinical trial was recently conducted with the allosteric mTOR inhibitor, everolimus [115]. However, everolimus failed to show better overall survival in patients with advanced HCC who were resistant or intolerant to sorafenib. This highlights the urgent need to better understand the molecular mechanism of sorafenib resistance and to develop alternative strategies for treating this group of advanced HCC patients

Here we report here that the ATP-competitive mTOR inhibitors suppress CD44 expression by blocking phosphorylation of eukaryotic translation initiation factor eIF4E- binding protein 1 (4EBP-1) in HCC cells while allosteric mTOR inhibitors do not. The

ATP-competitive mTOR inhibitor, INK128 showed better anti-proliferative and anti- migration effects on the mesenchymal-like HCC cells and sorafenib resistant HCC cells than the allosteric mTOR inhibitor, everolimus. In this study, we suggest that ATP- competitive mTOR inhibitors would be more effective in treating the advanced HCC patients who are insensitive or resistant to sorafenib by reducing CD44 expression.

5.2. Materials and Methods

Cell culture

The human HCC cell lines Huh7, HepG2, SNU387, SNU423 and SNU449 were purchased from American Type Tissue Collection (Manassas, VA) or were obtained from various investigators. Huh7 and HepG2 cells were grown in MEM medium (Gibco) with 72

10% fetal bovine serum (Sigma). SNU387, SNU423 and SNU449 cells were cultured in

RPMI 1640 medium (Gibco) containing 10% fetal bovine serum (Sigma).

RNA extraction and Quantitative RT-PCR

Total RNA was isolated from ATP-competitive mTOR inhibitor treated cells using

miRNeasy® Mini kit (Qiagen). cDNA was synthesized according to the manufacturer’s protocol

(Invitrogen). Five hundred ng of total RNA was used to synthesize cDNA using random primers.

cDNA was analyzed for gene expression using gene specific primers (IDT) and the Express

SYBR® GreenER qPCR super mix (Invitrogen). Data were normalized to 18S rRNA and the

relative expression of genes was presented using the comparative CT method. The following primers were used; CD44: 5’- TGCAGTTTGCATTGCAGTC-3’ (forward) and 5’-

CATTGCCACTGTTGATCACTAG-3’ (reverse), Vimentin: 5’-

CAGCTAACCAACGACAAAGCC-3’ (forward) and 5’-ATCCTGTCTGAAAGATTGCAGG

G-3’ (reverse), 18S : 5’-GTAAC CCGTTGAACCCCATT-3’(forward) and 5’-

CCATCCAATCGGTAGTAGCG-3’(reverse)

Western blotting

Total protein from Huh7, sorafenib resistant Huh7, SNU423 and SNU449 were extracted with radioimmunoprecipitation assay (RIPA) buffer (0.15mM NaCl, 0.05mM

Tris-HCl, pH 7.5, 1% Triton, 0.1% SDS, 0.1% sodium deoxycholate and 1% Nonidet P40).

Cell protein lysates (20-30 μg) were separated on NuPAGE 4-12% Bis-Tris gels (Novex) electrophoretically and transferred to polyvinylidene difluoride membranes (Roche).

Membranes were blocked for 1 h with 5% Bovine Serum Albumin in Tris-buffered saline containing 0.05% Tween 20 and incubated overnight with primary antibody. The following 73

primary antibodies were used: anti-CD44 (Cell signaling, #3578), anti-vimentin (Abcam,

ab92547), anti-total S6K (Cell signaling, # 2708 ), anti-phophorylated S6K (Cell signaling,

#9234), anti-total 4EBP-1 (Cell signaling, #9644), anti-phophorylated 4EBP-1(Cell

signaling, #2855), anti-GAPDH antibodies (Santa Cruz Biotechnology, sc-32233) and anti-

β actin (Cell Signaling, 4970S) as a loading control. A secondary anti-rabbit (Cell Signaling)

or anti-mouse immunoglobulin G (IgG) antibody peroxidase conjugate (GE Healthcare)

was detected using ECL Western Blotting Analysis System (Amersham Biosciences).

Cell proliferation assay

Huh7, sorafenib resistant Huh7, HepG2, SNU-423 and SNU449 cells were seeded

at 3,000 cells per well in a 96-well culture plates one day before treatment of several mTOR

inhibitors and sorafenib. Cell viability was determined by the WST-1 reagent (Roche) at

48 h or 72 h after treatment of rapamycin, everolimus, PP242 and INK128 or 1% DMSO

as negative control according to the manufacturer’s recommendations. All experiments

were performed at least in triplicate.

Wound healing assay

The wound healing assay was performed to evaluate cell migration ability in vitro.

SNU-423 cells were treated with either INK128 or everolimus at 500 nM or 1% DMSO as

negative control. At 24 h after treatment or transfection, 70 µl of the treated cells (3x105

cells/mL) was placed into each well of ibidi culture-insert (ibidi, LLC). After an overnight

incubation, the culture insert was removed to create a cell-free gap in a monolayer of the

cells. The gap closure area was photographed and analyzed by Tscratch software [160].

The percentage of the gap closure area based on the initial point at time zero was calculated

from at least three independent experiments.

Statistical analysis

The data of wound healing assay between three different treatments were

compared using ANOVA All error bars represent the standard deviation of the mean. A p-

value < 0.05 was considered significant.

5.3. Results

PP242 shows better anti-proliferative effect in mesenchymal HCC cells compared to

allosteric mTOR inhibitors, rapamycin and everolimus

We reported that PP242 decreased CD44 expression at the translational level by

blocking both phosphorylation of 4EBP-1 and S6K (Chapter 4, Fig. 4.8). To investigate the

effect of mTOR inhibitors on HCC cell proliferation, we treated Huh7, HepG2, SNU423 and SNU449 HCC cell lines with rapamycin, everolimus and PP242 for 48 h. Rapamycin and its analog, everolimus are allosteric mTOR inhibitors while PP242 is an ATP- competitive mTOR inhibitor. Rapamycin and everolimus produced flat concentration response curves even at concentrations of 100 ng/ml and 500 nM, respectively (Fig. 5.1A

and B) while PP242 exhibited better anti-proliferative activity than rapamycin and

everolimus (Fig. 5.1C). Interestingly, SNU423 and SNU449 responded much better to

PP242 treatment than did Huh7 and HepG2 cells. These results are significant since

SNU423 and SNU449 cells display mesenchymal characteristics while Huh7 and HepG2

cells are more epithelial in nature (Chapter 4, Fig 4.1B).

PP242 reduces CD44 and Vimentin expression in HCC cells while rapamycin and

everolimus do not. .

Next, we wanted to investigate possible mechanisms for the improved sensitivity

of mesenchymal-like HCC cells to PP242 treatment compared to rapamycin and

everolimus. We have already shown that PP242 suppressed CD44 expression in SNU423

and SNU449 cells at the translational level (Chapter 4, Fig 4.8). The mesenchymal-like

HCC cell lines SNU423 and SNU449 were treated with either rapamycin or everolimus. In

contrast to PP242 treatment, rapamycin and everolimus did not change CD44 and vimentin

protein expression in both mesenchymal-like HCC cell lines (Fig. 5.2). We next evaluated

the main downstream target genes of the mTOR signaling pathway, S6K and 4EBP1. Both

S6K and 4EBP-1 control protein synthesis by regulating mRNA translation initiation and

progression [110]. Interestingly, rapamycin and everolimus blocked phosphorylation of

S6K but did not inhibit phosphorylation of 4EBP-1 (Fig. 5.2). However, PP242, inhibited

both phosphorylation of S6K and 4EBP-1, which resulted in reduced CD44 expression in

HCC cells (Chapter 4, Fig. 4.8). These results suggest that inhibition of phosphorylated

4EBP-1 by PP242 is a main factor to regulate CD44 expression in HCC cells.

INK128 represses cell viability and decreases CD44 and VIM expression in sorafenib insensitive HCC cells.

We observed that ATP-competitive mTOR inhibitors such as PP242 had great anti-

proliferative effect in mesenchymal like HCC cells and it reduced CD44 and vimentin

expression at the translational level. We decided to use INK128 for further investigation

instead of PP242. INK128, a derivative of PP242, has improved drug-like properties

compared to PP242 (e.g. oral availability) and is currently being investigated in clinical trials for several cancers including breast cancer, prostate cancer, thyroid cancer and lung cancer (clinicaltrials.gov). As we observed with PP242, INK128 shows better anti- proliferative effects on the mesenchymal-like HCCs SNU423 and SNU449 compared to

Huh7 (Fig. 5.3A). In addition, INK128 decreased CD44 and vimentin protein expression at reduced concentrations such as 500nM (Fig. 5.3B) compared to PP242 at 2.5 µM

(Chapter 4, Fig. 4.8B) and successfully inhibited phosphorylation of both downstream

proteins, S6K and 4EBP-1 (Fig. 5.3B). We furthermore investigated whether INK128

altered the expression of those genes transcriptionally or post-translationally. We measured

CD44 and vimentin mRNA in SNU423 cells treated with 500 nM of INK128. There was no change at the mRNA level (Fig. 5.3C) even though western blotting revealed a great reduction in CD44 and vimentin protein expression by INK128 (Fig. 5.3B). These results suggest that CD44 and vimentin protein expression are regulated by 4EBP-1 in mesenchymal-like HCC cells.

Analysis of sensitivity to sorafenib treatment in HCC cell lines.

Our findings of CD44 working with an activated mTOR pathway in sorafenib resistant HCC led us to evaluate the sensitivity of several HCC cell lines to sorafenib treatment. This will allow us to determine the ideal HCC cell lines for further mTOR inhibitor experiments. Several HCC cell lines were treated with different concentrations of sorafenib for 72 h. Interestingly, epithelial-like HCC cells including Huh7 and HepG2 are sensitive to sorafenib treatment (Fig. 5.4A) (IC50 of Huh7 and HepG2 are 3.98 µM and

5.92 µM, respectively) while mesenchymal-like HCC cells SNU387 and SNU423 are 77

relatively insensitive to sorafenib (IC50 of SNU387 and SNU423 are 8.26 µM and 9.04 µM,

respectively) (Fig. 5.4B). A prior study showed that Huh7 and HepG2 were sensitive to

sorafenbib while SNU387 and SNU423 were not based upon IC50 [181]. These results are

supported by us confirming that Huh7 and HepG2 respond better to sorafenib compared to

SNU387 and SNU423. Moreover, Huh7 and HepG2 are CD44 negative while SNU387 and

SNU423 are CD44 positive (Chapter 4, Fig. 4.1C) suggesting that CD44 expression and

mesenchymal characteristics are major factors contributing to the enhanced sensitivity to

sorafenib treatment in HCC.

INK128 alone or in combination with sorafenib shows better anti-proliferative effect on

sorafenib insensitive HCC cells than everolimus.

Huh7 and SNU423 cells were treated with INK128 or everolimus for 72 h and the effect on cell viability was determined by WST-1 assay. INK128 inhibited SNU423 cell proliferation better than everolimus suggesting that blocking phosphorylation of 4EBP-1

reduced CD44 protein expression (Fig. 5.5A). The favorable anti-proliferative effects of

INK128 in sorafenib insensitive, mesenchymal-like HCC cells led us to compare the effect

of the combination of sorafenib and INK128 on cell proliferation. Cells treated with

sorafenib and everolimus combination was used as a control. SNU423 was co-treated with

increasing concentrations of sorafenib in the presence of 100 nM INK128 or everolimus.

Combining sorafenib and everolimus produced a modest effect of cell proliferation

compared to sorafenib alone (Fig. 5.5B). On the other hand the sorafenib and INK128

combination produced a dramatic reduction in cell proliferation compared to sorafenib

alone. The better anti-proliferative effect of the combination of sorafenib at various

concentration and 100nM INK128 was observed compared to the combination with 100nM

everolimus since INK128 alone showed approximately 60% reduction on cell viability

(Fig 5.5A and Fig. 5.5B).

INK128 suppresses cell migration in vitro.

Since INK128 inhibited the invasion related genes including CD44 and vimentin

(Fig. 5.4B), wound healing assay was conducted in SNU423 cells to determine the drug’s

effect on in vitro cell migration. SNU423 cells were treated with 1% DMSO (negative

control), 500 nM everolimus or 500 nM INK128. Blue lines display the starting point at

time 0 (Fig. 5.6A). At 30 h after the cells began to migrate, the DMSO treated cells almost

completely covered the open gap area while INK128 treated cells decreased cell movement

by 50% (Fig. 5.6B). Everolimus inhibited migration of the mesenchymal-like HCC cells by only 20% (Fig. 5.6B). This indicates that INK128 showed better anti-migration effect than everolimus in sorafenib insensitive, mesenchymal-like HCC cells.

INK128 shows greater effects on cell viability in sorafenib resistant huh7 cells.

We found that the ATP-competitive mTOR inhibitors PP242 and INK128 negatively regulates CD44 protein expression by suppressing phosphorylation of 4EBP-1 in sorafenib insensitive, CD44 positive, mesenchymal-like HCC cells. Therefore, we wanted to evaluate the CD44 and mTOR pathways in HCC cells with acquired sorafenib

resistance. Sorafenib resistant Huh7 cells were developed by long-term exposure to

sorafenib treatment. Interestingly, CD44 and vimentin expression were increased in both the pool and clone of sorafenib resistant cells (Fig. 5.7A). We also measured phosphorylation of mTOR and the main downstream effectors of mTOR pathway, S6K and 79

4EBP-1. Immunoblotting showed that mTOR pathway is activated in sorafenib resistant

Huh7 cells. Sorafenib resistant Huh7 cells were treated with everolimus and INK128 to

determine their anti-proliferative effects on HCC cells with acquired sorafenib resistance.

Everolimus produced a flat dose response curve and slightly decreased cell viability up to

40% in the sorafenib resistant Huh7 cells (Fig. 5.7B). However, INK128 showed greater

anti-proliferative effects on both sorafenib resistant and wild type huh7 cells (Fig. 5.7B).

This suggests that the acquired sorafenib resistance did not interfere with the effects of mTOR inhibitors and INK128 holds promising therapeutic potential in treating sorafenib resistant advanced HCC.

5.4. Discussion

A number of studies have suggested several potential contributors to the development of sorafenib resistance in HCC including cells undergoing epithelial– mesenchymal transition (EMT) [93,103,104], enrichment of CSC [93,94,106] and activation of various signaling pathways such as TGF-β, JAK-STAT, and

PI3K/AKT/mTOR signaling pathway [100] [182]. In chapter 4, we showed that CD44 is overexpressed in mesenchymal-like HCC cells (Chapter 4, Fig. 4.1). In addition, 3sp,

mesenchymal cells expressed significantly higher CD44 compared to the 3p, epithelial

cells (Chapter 4. Fig 4A). More interestingly, 3sp mesenchymal cells were less sensitive to

sorafenib treatment than 3p epithelial cells [104]. This finding supports our results in this

chapter showing that ATP-competitive mTOR inhibitor exhibits better anti-cancer effects

in mesenchymal-like HCC cells as well as sorafenib resistant HCC cells by suppressing

CD44 expression. Therefore, our both work and published data point to a significant role

for CD44 and in innate and acquired sorafenib resistance.

We report here that ATP-competitive mTOR inhibitors negatively regulate CD44 translation by blocking phosphorylation of 4EBP-1, a key downstream protein in the

mTOR pathway in HCC. Furthermore we show better anti-proliferative and anti-migratory

effects of these agents in sorafenib insensitive, mesenchymal-like HCC cells as well as

sorafenib resistant HCC cells. We suggest that regulation of CD44 by modulating

phosphorylation of 4EBP-1 is an important potential factor which leads to the development

of resistance to sorafenib treatment in HCC since CD44 is involved in sorafenib resistance

[93,94] and PI3K/AKT/mTOR signaling pathway is activated in sorafenib resistant Huh7

cells [100]. In this study, we also confirmed that CD44 is increased and several components

of mTOR pathway are activated in sorafenib resistant Huh7 cells (Fig. 5.7A).

Rapamycin and everolimus are allosteric mTOR inhibitors which blocked

phosphorylation of S6K, not 4EBP-1 (Fig. 5.2A and 5.2B). It has been reported that

rapamycin inhibited phosphorylation of 4EBP-1 at initial treatment but phosphorylated 4E-

BP1 was recovered within 6h [183]. We also did not see inhibition of phosphorylation of

4EBP-1 at 48h treatment of the allosteric mTOR inhibitors. PP242 and INK128 are ATP-

competitive mTOR inhibitors and they blocked both phosphorylation of S6K and 4EBP-1

(Chapter 4, Fig. 4.8 and Chapter 5, Fig. 5.3B). The ATP-competitive mTOR inhibitors

successfully suppressed CD44 expression in sorafenib insensitive, mesenchymal-like HCC

cells while rapamycin and its analog, everolimus did not (summarized in Fig. 5.8).

Moreover, CD44 has been reported to phosphorylate AKT in chronic lymphocytic

leukemia [184], which also supports the role of CD44 as a fundamental target in sorafenib

insensitive and resistant HCC.

In this study, we suggest that the recent failure of phase III clinical trial with everolimus may be explained since everolimus does not inhibit CD44 expression [115].

We showed that CD44 is increased in mesenchymal-like, sorafenib insensitive and resistant

HCC cells. However, it requires more intensive research to identify CD44 as one of the main determinants of sorafenib resistance in HCC. The effect of gain or loss of CD44 function needs to be further investigated by establishing stably CD44 overexpressing or knocked-down HCC cells in the future. As we are currently developing a sorafenib resistant

HCC orthotopic mouse model, the potential use of INK128 alone or in combination with sorafenib will be evaluated in vivo.

We show here that ATP-competitive mTOR inhibitors exhibit better anti- proliferative and anti-migratory effects in sorafenib resistant and mesenchymal-like HCC cells. ATP-competitive mTOR inhibitors should be considered as promising therapeutic agents in sorafenib insensitive and resistant HCC by regulating the aberrantly activated

PI3K/AKT/mTOR pathway as well as CD44. These data suggest substantial clinical implications may be developed from our results for treating advanced HCC patients whose treatment options are limited.

Acknowledgements

Sorafenib resistant huh7 cells were developed by long-term exposure to sorafenib treatment

in Dr. Jacob lab. Sorafenib resistant huh7 cells were maintained under 8µM of sorafenib.

Cell proliferation assay in sorafenib resistant huh7 cells was conducted by Ryan Reyes in

Dr. Jacob lab.

A B

Figure 5.1 ATP-competitive mTOR inhibitor shows better anti-proliferative effect in mesenchymal-like HCC cell while rapamycin and its analog slightly decreases HCC cell proliferation in vitro.

Four different HCC cell lines were treated with allosteric mTOR inhibitors, rapamycin and everolimus (A and B), and PP242, ATP-competitive mTOR inhibitor (C) at various concentrations for 48 h. Cell viability was determined by WST-1 assay.

Figure 5.2 Allosteric mTOR inhibitors inhibited only phosphorylation of S6K, not phosphorylation of 4EBP-1 and did not affect CD44 and vimentin expression in mesenchymal-like HCC cells.

A and B, Two mesenchymal-like HCC cell lines were treated with either rapamycin or everolimus at different concentrations. CD44, vimentin and downstream effectors of mTOR pathway were evaluated by immunoblotting.

A B

Figure 5.3 INK128 shows better anti-proliferative effect on mesenchymal-like HCC cells and decreased CD44 and VIM expression in mesenchymal-like HCC cells at translational level.

A, Huh7, SNU449 and SNU423 were treated with INK128 at various concentrations for 72 h. Cell viability was determined by WST-1 assay. B, SNU423 was treated with 3 different concentrations of INK128 for 72 h. CD44, vimentin and downstream effectors of mTOR pathway were evaluated by immunoblotting. C, mRNA level of CD44 and vimentin were measured by qPCR in 500nM of INK128 treated SNU423 cells.

Figure 5.4 Analysis of sensitivity to sorafenib treatment in HCC cell lines

A, HepG2 and Huh7 and B, SNU387 and SNU423 were treated at various concentration

of sorafenib for 72 h. IC50s of different HCC cell lines to sorafenib treatment were determined by WST-1 assay.

Figure 5.5 INK128 alone or combination with sorafenib displays better anti- proliferative effect in SNU423 cells than everolimus.

A, Huh7 and SNU423 were treated with INK128 for 72 h. Huh7 is sensitive to sorafenib while SNU423 is representative of sorafenib insensitive HCC cells. Cell viability was determined by WST-1 assay. B, The combination treatment of sorafenib and 100nM everolimus or 100nM INK128 was evaluated in SNU423 by WST-1 assay.

Figure 5.6 INK128 inhibits mesenchymal-like HCC cell migration in vitro better than everolimus.

SNU423 cells were treated with 1% DMSO as a negative control, 500nM everolimus or 500nM INK128. Blue lines display the starting line at time 0. At 30 h after cells started moving, the gap open areas were photographed and measured. (*p<0.05,** p<0.01, *** p<0.001)

Figure 5.7 CD44 and mTOR Pathway are activated in the acquired sorafenib- resistant HCC cells and INK128 showed greater effects on cell viability in sorafenib resistant huh7 cells than everolimus.

A, Sorafenib resistant Huh7 cells were developed by long-term exposure to sorafenib treatment. Protein lysates from resistant Huh7 cells at 8µM of sorafenib and wild-type Huh7 cells were evaluated by immunoblotting. B, Sorafenib resistant Huh7 cells and wild- type Huh7 cells were treated with either everolimus or INK128 for 72 h. Cell viability was determined by WST-1 assay.

Figure 5.7

Figure 5.8 Summary of regulation of CD44 by mTOR inhibitors in HCC.

Allosteric mTOR inhibitors including rapamycin and everolimus partially blocked phosphorylation of S6K, not 4EBP-1 while ATP-competitive mTOR inhibitors including PP242 and INK128 inhibited phosphorylation of both S6K and 4EBP-1. Inhibition of phosphorylation of 4EBP-1 resulted in reduced CD44 expression which may contribute to development of sorafenib resistance in HCC.

CHAPTER 6

6. Conclusions and Future Directions

Since the first miRNA was discovered in 1993 [185], a large number of studies have shown that numerous miRNAs are differentially expressed in a variety of human cancers and are involved in tumorigenesis [30-38] Despite the relatively short period time since their discovery, miRNA-based therapeutics have been intensively developed and have already entered clinical trials. This rapid progression shows that miRNA-based therapeutic agents hold great potential in treating diseases such as cancers. Miravirsen (Santaris

Pharma A/S) is a LNA-modified DNA phosphorothioate antisense oligonucleotide that inhibits miR-122, a liver-specific miRNA which plays an important role in hepatitis C virus

(HCV) replication [186]. It is the first miRNA-targeted drug to enter clinical trials and recently phase 2 studies in patients with Hepatitis C was successfully completed to assess the safety and tolerability [173]. On the contrary, the down-regulated tumor suppressive miRNAs can be restored by introducing miRNA mimics. Mirna Therapeutics, Inc. is currently developing miRNA replacement therapy, MRX34. MRX34 are designed to deliver miR-34 mimic to a wide variety of cancers including HCC. It is the first miRNA mimic to enter a clinical trial and its phase 1 clinical study is expected to be completed in late 2015 (clinicaltrials.gov).

Due to promising features of miRNAs in treating cancers, we have been investigating the anti-tumor effects of two important miRNAs in HCC, miR-199a-3p and miR-221. In our miR-199a-3p study (Chapter 2), we identified CD151 as a direct target of miR-199a-3p in HCC and the suppressed CD151 expression by ectopic expression of miR-

199a-3p decreased cell migration and invasion in vitro. CD151 is a tetraspanin membrane protein that has been associated with metastasis [153-155]. Overexpression of CD151 promoted the expression of MMP9 which facilitates metastasis [154] and high expression of CD151 and integrin subunit α6 increased invasiveness of HCC cells [155]. These are supported by our findings that knockdown of CD151 expression by siRNA transfection did not alter cell proliferation in HCC cell lines (Chapter 2, Fig. 2.3B) while the suppressed

CD151 expression decreased migration and invasiveness of HCC cells (Chapter 2, Fig 2.4 and 2.5). All the in vitro significant findings of miR-199a-3p in HCC represent encouraging prospects for in vivo evaluation of this miRNA. Our laboratory is currently developing novel microvesicle (MV)-based therapeutics to introduce miR-199a-3p which is designed to be preferentially loaded into MVs for treating HCC. In the near future, we will be able to evaluate the effects of miR-199a-3p replacement in an HCC orthotopic mouse model.

The validated analytical quantitative method described in Chapter 3 could be utilized for a

PK-PD project with the MV-loaded miRNA-based therapy.

We previously demonstrated that miR-199a-3p directly targets CD44 which is associated with cell-cell interactions, cell adhesion, cell migration and invasion [81]. CD44 is also known as an important CSC marker in several malignancies including HCC [84-87].

Here we report that CD44 is differentially expressed in HCC; CD44 is low in epithelial-

94 like HCC cells while it is high in mesenchymal-like HCC cells. Interestingly, the expression of miR-221, the most significantly upregulated miRNA in HCC, is correlated with CD44 expression in HCC. We showed that anti-miR-221 reduced CD44 protein expression and miR-221 mimic increased CD44 expression. To explain the mechanism of

CD44 regulation by miR-221, we identified miR-708 as one of the most significantly upregulated miRNAs in anti-miR-221 transfected HCC cells by profiling over 900 miRNAs. Surprisingly, miR-708 directly targets CD44 and AKT in prostate cancer [176].

Therefore miR-708 could suppress CD44 expression by directly targeting CD44 and by modulating the PI3K-AKT-mTOR pathway with reduced AKT expression. In addition, we hypothesized that miR-221 regulates CD44 expression through PI3K-AKT-mTOR pathway as miR-221 directly targets fundamental components of PI3K-AKT-mTOR signaling pathway such as PTEN [39] and DDIT4 [166] in HCC. To investigate CD44 regulation through PI3K/AKT/mTOR signaling pathway, we treated two CD44 positive

SNU423 and SNU449 cells with the mTOR inhibitor, PP242. The inhibition of mTOR pathway indeed decreased CD44 expression at the translational level and this finding suggests that anti-miR-221 reduces CD44 protein expression by directly targeting the components of PI3K/AKT/mTOR signaling pathway.

Recently, a phase 3 clinical trial with the mTOR inhibitor, everolimus was conducted in advanced HCC who were resistant or intolerant to sorafenib treatment [115].

However, everolimus failed to improve overall survival compared to placebo group. This failure emphasizes the urgent need to identify the underlying mechanisms that might contribute to development of sorafenib resistance and investigate an alternative systemic

95 therapeutic option for those who are resistant and intolerant to sorafenib treatment. In chapter 5, we report that ATP-competitive mTOR inhibitor, INK128 exhibited better anti- cancer effects on mesenchymal-like HCC cells as well as sorafenib resistant HCC cells compared to rapamycin analog, everolimus. We suggest that INK128 decreased cell proliferation and cell migration ability by suppressing CD44 expression at the translational level. The regulation of CD44 by INK128 represents a fundamental finding in sorafenib resistance since it has been reported that CSCs including CD44 were enriched in sorafenib resistant HCC cells [93] and mesenchymal-like HCC cells expressing CD44 were resistant to sorafenib treatment [94]. Furthermore, we showed that 3sp mesenchymal HCC cells expressed significantly higher CD44 compared to the 3p epithelial cells (Chapter 4. Fig 4) and 3sp were more resistant to sorafenib than 3p [104]. We also confirmed that INK128 did not change CD44 mRNA even though it strikingly decreased CD44 protein expression

(Chapter 5, Fig. 5.3C). This result strongly suggests the significance of 4EBP-1 as a main regulator of CD44 expression in HCC because 4EBP-1 is a negative regulator of protein synthesis by modulating mRNA translation initiation and progression. In addition, it is remarkable that INK128 showed better anti-proliferative activity on more aggressive,

CD44 positive, mesenchymal-like HCC cell lines than epithelial-like HCC cells (Chapter

5, Fig 5.3A) whereas sorafenib exhibited its effects in PLC/PRF/5 and HepG2 HCC cells which are CD44 negative, epithelial-like HCC cell lines [96]. Since we showed the great potential of ATP-competitive mTOR inhibitor, INK128 in mesenchymal-like HCC cells as well as sorafenib resistant Huh7 in vitro, the anti-cancer effects of INK128 in vivo study need to be investigated in sorafenib resistant HCC mouse model. The use of INK128 alone

96 or in combination with sorafenib could be evaluated assessing tumor doubling time and survival rate in sorafenib resistant orthotopic mouse model.

Even though sorafenib is currently the only standard, first-line treatment for advanced HCC, sorafenib treatment showed clinically modest improvement of overall survival up to 3 months longer than placebo [6]. Since median overall survival of sorafenib treatment remains less than a year [97,98] and advanced HCC patients differently respond to sorafenib [6], the sensitivity of response to the targeted therapy may be a significant factor to achieve better prognosis of advanced HCC as well as development of drug resistance. Therefore, a better understanding of the mechanisms of response to sorafenib treatment is needed. In addition, molecular biomarkers need to be investigated and validated to predict sorafenib sensitivity. Several studies have indicated that the

PI3K/AKT/mTOR signaling pathway is frequently activated in HCC [112-114] and in sorafenib resistant Huh7 cells [100]. We report that CD44 is overexpressed in sorafenib resistant Huh7 cells and mesenchymal-like HCC cells which are sorafenib insensitive.

Therefore, our findings support the potential use of CD44 and other mTOR downstream effectors including phosphorylated 4EBP-1 as biomarkers for determining susceptibility to the current therapy for advanced HCC patients.

It has been reported that miRNAs could sensitize HCC cells to sorafenib treatment including miR-193b, miR-338-3p and miR-222 in HCC [187-189]. The involvement of miR-222 in sorafenib resistance is particularly interesting to us because miR-221 and miR-

222 share the same seed sequence and we showed that miR-221 is overexpressed in mesenchymal-like HCC cells (Chapter 4, Fig 4.3B) as well as in 3sp, mesenchymal HCC 97

cells (Chapter 4, Fig 4.4B) which are more insensitive to sorafenib [104]. We are currently

developing sorafenib resistant cells by long-term exposure of sorafenib with gradually

increasing concentrations. Once sorafenib resistant cells are developed under 10 µM of

sorafenib, which is the clinically achievable maximum concentration, it would be

noteworthy to identify miRNAs which are associated with the development of sorafenib

resistance by miRNA profiling of sorafenib resistant HCC cells. Since the investigation of

the deregulated miRNAs in sorafenib resistant HCC cells has not been studied, it would

serve to better understand the association of miRNAs with sorafenib resistance and to

develop miRNA-based therapeutics for sorafenib resistant HCC patients.

Moreover, miRNAs are stably encapsulated in MVs and MVs have been shown to

be associated with chemoresistance by transferring genetic materials to recipient cells

[190,191]. Recently, it has been reported that extracellular vesicles induced sorafenib

resistance by transferring lncRNA in HCC [192]. Since our lab established the validated

procedures to isolate MVs from cells, we can explore characteristics of MVs from sorafenib resistant HCC cells; 1) to identify miRNAs in MVs from sorafenib resistant cells and in recipient cells to investigate which miRNAs can be transferred via MVs. 2) to

evaluate if MVs from resistant cells can prompt the acquired resistance in wild-type

sorafenib sensitive cells.

As endogenous miRNAs are stably circulating in the blood stream, miRNAs show

great potential as biomarkers [180]. An increasing number of studies have demonstrated

the potential of miRNAs as biomarker including miR-21 [193], miR-143 [194] for a variety of cancers [195-197]. Interestingly, it was reported that circulating miRNAs may also be

used to predict prognosis of diseases [198,199]. Since miR-221 is overexpressed in

mesenchymal-like, sorafenib insensitive HCC cells and it regulates CD44 expression in vitro, the signature of miR-221 alone or in combination with CD44 or phosphorylated

4EBP-1 needs to be evaluated in the specimens of advanced HCC patients who do not respond well or develop the acquired resistance to sorafenib.

Our findings with miR-199a-3p and miR-221 in HCC suggest that either a miR-

199a-3p mimic oranti-miR-221 alone or the combination of both could be effective for treating HCC patients. These miRNAs modulate a variety of targets including oncogenes and tumor suppressors [39,55,166] which regulate the PI3K-AKT-mTOR pathway in HCC.

It is interesting that mTOR is a validated target of miR-199a-3p [55] and we previously reported that miR-199a-3p directly targets CD44 in HCC [57]. In chapter 4, we showed that miR-221 regulates CD44 expression by modulating PI3K-AKT-mTOR pathway and regulation of CD44 is mTOR pathway dependent in HCC. In addition, anti-miR-221 increased miR-708 which directly targets CD44 and AKT [176] . CD151, reported as a direct target of miR-199-3p here, can activate PI3K pathway by interacting with integrin in response to laminin-5 in HCC [161]. In addition, Chapter 5 showed that ATP- competitive mTOR inhibitor reduced CD44 expression in mesenchymal-like HCC cells.

The proposed mechanisms of miR-199a-3p, miR-221 and ATP-competitive mTOR inhibitor in PI3K-AKT-mTOR pathway are summarized in Fig. 6.1.

Overall, our findings can serve to better understand the underlying molecular mechanisms of the development of sorafenib resistance in HCC and will contribute to

99 develop new alternative strategies for treating advanced HCC who are intolerant or resistant to the current therapy.

100

Figure 6.1 Overall proposed mechanisms of miR-199a-3p, miR-221 and ATP- competitive mTOR inhibitor in PI3K-AKT-mTOR pathway to regulate CD44 expression in HCC.

miR-199a-3p directly targets several oncogenes while miR-221 negatively regulates various tumor suppressors. ATP-competitive mTOR inhibitor blocks phosphorylation of both p70S6K and 4EBP-1 which leads to inhibition of CD44 protein expression in HCC.

101

References

1. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, et al. (2015) Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer 136: E359-386. 2. El-Serag HB, Rudolph KL (2007) Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology 132: 2557-2576. 3. Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM, et al. (2014) Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res 74: 2913-2921. 4. El-Serag HB (2011) Hepatocellular carcinoma. N Engl J Med 365: 1118-1127. 5. Aravalli RN, Steer CJ, Cressman EN (2008) Molecular mechanisms of hepatocellular carcinoma. Hepatology 48: 2047-2063. 6. Xie BR, Wang DH, Spechler SJ (2012) Sorafenib for Treatment of Hepatocellular Carcinoma: A Systematic Review. Digestive Diseases and Sciences 57: 1122- 1129. 7. Alexander RP, Fang G, Rozowsky J, Snyder M, Gerstein MB (2010) Annotating non- coding regions of the genome. Nat Rev Genet 11: 559-571. 8. Holley CL, Topkara VK (2011) An introduction to small non-coding RNAs: miRNA and snoRNA. Cardiovasc Drugs Ther 25: 151-159. 9. Mattick JS, Makunin IV (2006) Non-coding RNA. Hum Mol Genet 15 Spec No 1: R17-29. 10. Huarte M, Guttman M, Feldser D, Garber M, Koziol MJ, et al. (2010) A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell 142: 409-419. 102

11. Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, et al. (2011) A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell 147: 358-369. 12. Croce CM (2009) Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 10: 704-714. 13. Yazgan O, Krebs JE (2007) Noncoding but nonexpendable: transcriptional regulation by large noncoding RNA in eukaryotes. Biochem Cell Biol 85: 484-496. 14. Umlauf D, Fraser P, Nagano T (2008) The role of long non-coding RNAs in chromatin structure and gene regulation: variations on a theme. Biol Chem 389: 323-331. 15. Mercer TR, Dinger ME, Mattick JS (2009) Long non-coding RNAs: insights into functions. Nat Rev Genet 10: 155-159. 16. Kotake Y, Nakagawa T, Kitagawa K, Suzuki S, Liu N, et al. (2011) Long non-coding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15(INK4B) tumor suppressor gene. Oncogene 30: 1956-1962. 17. Khalil AM, Guttman M, Huarte M, Garber M, Raj A, et al. (2009) Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A 106: 11667-11672. 18. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, et al. (2010) Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature 464: 1071-1076. 19. Kim K, Jutooru I, Chadalapaka G, Johnson G, Frank J, et al. (2013) HOTAIR is a negative prognostic factor and exhibits pro-oncogenic activity in pancreatic cancer. Oncogene 32: 1616-1625. 20. Garzon R, Calin GA, Croce CM (2009) MicroRNAs in Cancer. Annu Rev Med 60: 167-179. 21. Lee Y, Ahn C, Han J, Choi H, Kim J, et al. (2003) The nuclear RNase III Drosha initiates microRNA processing. Nature 425: 415-419.

103

22. Chendrimada TP, Gregory RI, Kumaraswamy E, Norman J, Cooch N, et al. (2005) TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436: 740-744. 23. Yi R, Qin Y, Macara IG, Cullen BR (2003) Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17: 3011-3016. 24. Lee Y, Jeon K, Lee JT, Kim S, Kim VN (2002) MicroRNA maturation: stepwise processing and subcellular localization. EMBO J 21: 4663-4670. 25. Kim VN, Han J, Siomi MC (2009) Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol 10: 126-139. 26. Heo I, Kim VN (2009) Regulating the regulators: posttranslational modifications of RNA silencing factors. Cell 139: 28-31. 27. Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, et al. (2002) Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 99: 15524-15529. 28. Medina PP, Nolde M, Slack FJ (2010) OncomiR addiction in an in vivo model of microRNA-21-induced pre-B-cell lymphoma. Nature 467: 86-90. 29. Costinean S, Zanesi N, Pekarsky Y, Tili E, Volinia S, et al. (2006) Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)- miR155 transgenic mice. Proc Natl Acad Sci U S A 103: 7024-7029. 30. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, et al. (2005) MicroRNA expression profiles classify human cancers. Nature 435: 834-838. 31. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, et al. (2006) A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103: 2257-2261. 32. Budhu A, Jia HL, Forgues M, Liu CG, Goldstein D, et al. (2008) Identification of metastasis-related microRNAs in hepatocellular carcinoma. Hepatology 47: 897- 907. 33. Murakami Y, Yasuda T, Saigo K, Urashima T, Toyoda H, et al. (2006) Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non- tumorous tissues. Oncogene 25: 2537-2545.

104

34. Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, et al. (2008) MicroRNA expression signature of human sarcomas. Oncogene 27: 2015-2026. 35. Navarro A, Gaya A, Martinez A, Urbano-Ispizua A, Pons A, et al. (2008) MicroRNA expression profiling in classic Hodgkin lymphoma. Blood 111: 2825-2832. 36. Dyrskjot L, Ostenfeld MS, Bramsen JB, Silahtaroglu AN, Lamy P, et al. (2009) Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro. Cancer Res 69: 4851-4860. 37. Calin GA, Ferracin M, Cimmino A, Di Leva G, Shimizu M, et al. (2005) A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med 353: 1793-1801. 38. Calin GA, Croce CM (2006) MicroRNA signatures in human cancers. Nat Rev Cancer 6: 857-866. 39. Garofalo M, Di Leva G, Romano G, Nuovo G, Suh SS, et al. (2009) miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell 16: 498-509. 40. Pineau P, Volinia S, McJunkin K, Marchio A, Battiston C, et al. (2010) miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A 107: 264-269. 41. Fornari F, Gramantieri L, Ferracin M, Veronese A, Sabbioni S, et al. (2008) MiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinoma. Oncogene 27: 5651-5661. 42. Yuan Q, Loya K, Rani B, Mobus S, Balakrishnan A, et al. (2013) MicroRNA-221 overexpression accelerates hepatocyte proliferation during liver regeneration. Hepatology 57: 299-310. 43. Gramantieri L, Fornari F, Ferracin M, Veronese A, Sabbioni S, et al. (2009) MicroRNA-221 targets Bmf in hepatocellular carcinoma and correlates with tumor multifocality. Clin Cancer Res 15: 5073-5081. 44. Park JK, Kogure T, Nuovo GJ, Jiang JM, He L, et al. (2011) miR-221 Silencing Blocks Hepatocellular Carcinoma and Promotes Survival. Cancer Res 71: 7608- 7616.

105

45. Xu G, Zhang Y, Wei J, Jia W, Ge Z, et al. (2013) MicroRNA-21 promotes hepatocellular carcinoma HepG2 cell proliferation through repression of mitogen- activated protein kinase-kinase 3. BMC Cancer 13: 469. 46. Huang YH, Lin YH, Chi HC, Liao CH, Liao CJ, et al. (2013) Thyroid hormone regulation of miR-21 enhances migration and invasion of hepatoma. Cancer Res 73: 2505-2517. 47. Jin XL, Sun QS, Liu F, Yang HW, Liu M, et al. (2013) microRNA 21-mediated suppression of Sprouty1 by Pokemon affects liver cancer cell growth and proliferation. J Cell Biochem 114: 1625-1633. 48. Connolly EC, Van Doorslaer K, Rogler LE, Rogler CE (2010) Overexpression of miR-21 promotes an in vitro metastatic phenotype by targeting the tumor suppressor RHOB. Mol Cancer Res 8: 691-700. 49. Liu C, Yu J, Yu S, Lavker RM, Cai L, et al. (2010) MicroRNA-21 acts as an oncomir through multiple targets in human hepatocellular carcinoma. J Hepatol 53: 98- 107. 50. Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, et al. (2007) MicroRNA- 21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 133: 647-658. 51. Si ML, Zhu S, Wu H, Lu Z, Wu F, et al. (2007) miR-21-mediated tumor growth. Oncogene 26: 2799-2803. 52. Gramantieri L, Ferracin M, Fornari F, Veronese A, Sabbioni S, et al. (2007) Cyclin G1 is a target of miR-122a, a microRNA frequently down-regulated in human hepatocellular carcinoma. Cancer Res 67: 6092-6099. 53. Hou J, Lin L, Zhou W, Wang Z, Ding G, et al. (2011) Identification of miRNomes in human liver and hepatocellular carcinoma reveals miR-199a/b-3p as therapeutic target for hepatocellular carcinoma. Cancer Cell 19: 232-243. 54. Jiang J, Gusev Y, Aderca I, Mettler TA, Nagorney DM, et al. (2008) Association of MicroRNA expression in hepatocellular carcinomas with hepatitis infection, cirrhosis, and patient survival. Clin Cancer Res 14: 419-427.

106

55. Fornari F, Milazzo M, Chieco P, Negrini M, Calin GA, et al. (2010) MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res 70: 5184-5193. 56. Kim S, Lee UJ, Kim MN, Lee EJ, Kim JY, et al. (2008) MicroRNA miR-199a* regulates the MET proto-oncogene and the downstream extracellular signal- regulated kinase 2 (ERK2). J Biol Chem 283: 18158-18166. 57. Henry JC, Park JK, Jiang J, Kim JH, Nagorney DM, et al. (2010) miR-199a-3p targets CD44 and reduces proliferation of CD44 positive hepatocellular carcinoma cell lines. Biochem Biophys Res Commun 403: 120-125. 58. Hou J, Lin L, Zhou W, Wang Z, Ding G, et al. Identification of miRNomes in human liver and hepatocellular carcinoma reveals miR-199a/b-3p as therapeutic target for hepatocellular carcinoma. Cancer Cell 19: 232-243. 59. Hou J, Lin L, Zhou W, Wang Z, Ding G, et al. (2011) Identification of miRNomes in human liver and hepatocellular carcinoma reveals miR-199a/b-3p as therapeutic target for hepatocellular carcinoma. Cancer Cell 19: 232-243. 60. Zhang GL, Li YX, Zheng SQ, Liu M, Li X, et al. (2010) Suppression of hepatitis B virus replication by microRNA-199a-3p and microRNA-210. Antiviral Res 88: 169-175. 61. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, et al. (2002) Identification of tissue-specific microRNAs from mouse. Curr Biol 12: 735-739. 62. Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, et al. (2005) Silencing of microRNAs in vivo with 'antagomirs'. Nature 438: 685-689. 63. Esau C, Davis S, Murray SF, Yu XX, Pandey SK, et al. (2006) miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab 3: 87-98. 64. Xu H, He JH, Xiao ZD, Zhang QQ, Chen YQ, et al. (2010) Liver-enriched transcription factors regulate microRNA-122 that targets CUTL1 during liver development. Hepatology 52: 1431-1442. 65. Lin CJ, Gong HY, Tseng HC, Wang WL, Wu JL (2008) miR-122 targets an anti- apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. Biochem Biophys Res Commun 375: 315-320.

107

66. Ergun S, Ulasli M, Igci YZ, Igci M, Kirkbes S, et al. (2015) The association of the expression of miR-122-5p and its target ADAM10 with human breast cancer. Mol Biol Rep 42: 497-505. 67. Wang B, Wang H, Yang Z (2012) MiR-122 inhibits cell proliferation and tumorigenesis of breast cancer by targeting IGF1R. PLoS One 7: e47053. 68. Fornari F, Gramantieri L, Giovannini C, Veronese A, Ferracin M, et al. (2009) MiR- 122/cyclin G1 interaction modulates p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res 69: 5761-5767. 69. Chen YJ, Chang LS (2013) Hydroquinone-induced miR-122 down-regulation elicits ADAM17 up-regulation, leading to increased soluble TNF-alpha production in human leukemia cells with expressed Bcr/Abl. Biochem Pharmacol 86: 620-631. 70. Tsai WC, Hsu PW, Lai TC, Chau GY, Lin CW, et al. (2009) MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology 49: 1571-1582. 71. Coulouarn C, Factor VM, Andersen JB, Durkin ME, Thorgeirsson SS (2009) Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. Oncogene 28: 3526-3536. 72. Hsu SH, Wang B, Kota J, Yu J, Costinean S, et al. (2012) Essential metabolic, anti- inflammatory, and anti-tumorigenic functions of miR-122 in liver. J Clin Invest 122: 2871-2883. 73. Tsai WC, Hsu SD, Hsu CS, Lai TC, Chen SJ, et al. (2012) MicroRNA-122 plays a critical role in liver homeostasis and hepatocarcinogenesis. J Clin Invest 122: 2884-2897. 74. Li S, Fu H, Wang Y, Tie Y, Xing R, et al. (2009) MicroRNA-101 regulates expression of the v-fos FBJ murine osteosarcoma viral oncogene homolog (FOS) oncogene in human hepatocellular carcinoma. Hepatology 49: 1194-1202. 75. Su H, Yang JR, Xu T, Huang J, Xu L, et al. (2009) MicroRNA-101, down-regulated in hepatocellular carcinoma, promotes apoptosis and suppresses tumorigenicity. Cancer Res 69: 1135-1142.

108

76. Wei X, Xiang T, Ren G, Tan C, Liu R, et al. (2013) miR-101 is down-regulated by the hepatitis B virus x protein and induces aberrant DNA methylation by targeting DNA methyltransferase 3A. Cell Signal 25: 439-446. 77. Zhang Y, Guo X, Xiong L, Kong X, Xu Y, et al. (2012) MicroRNA-101 suppresses SOX9-dependent tumorigenicity and promotes favorable prognosis of human hepatocellular carcinoma. FEBS Lett 586: 4362-4370. 78. Shen Q, Bae HJ, Eun JW, Kim HS, Park SJ, et al. (2014) MiR-101 functions as a tumor suppressor by directly targeting nemo-like kinase in liver cancer. Cancer Lett 344: 204-211. 79. Xu L, Beckebaum S, Iacob S, Wu G, Kaiser GM, et al. (2014) MicroRNA-101 inhibits human hepatocellular carcinoma progression through EZH2 downregulation and increased cytostatic drug sensitivity. J Hepatol 60: 590-598. 80. Wang L, Zhang X, Jia LT, Hu SJ, Zhao J, et al. (2014) c-Myc-mediated epigenetic silencing of MicroRNA-101 contributes to dysregulation of multiple pathways in hepatocellular carcinoma. Hepatology 59: 1850-1863. 81. Ponta H, Sherman L, Herrlich PA (2003) CD44: from adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol 4: 33-45. 82. Marhaba R, Zoller M (2004) CD44 in cancer progression: adhesion, migration and growth regulation. J Mol Histol 35: 211-231. 83. Hill A, McFarlane S, Johnston PG, Waugh DJ (2006) The emerging role of CD44 in regulating skeletal micrometastasis. Cancer Lett 237: 1-9. 84. Ho DW, Yang ZF, Yi K, Lam CT, Ng MN, et al. (2012) Gene expression profiling of liver cancer stem cells by RNA-sequencing. PLoS One 7: e37159. 85. Wilson GS, Hu Z, Duan W, Tian A, Wang XM, et al. (2013) Efficacy of using cancer stem cell markers in isolating and characterizing liver cancer stem cells. Stem Cells Dev 22: 2655-2664. 86. Yang ZF, Ngai P, Ho DW, Yu WC, Ng MN, et al. (2008) Identification of local and circulating cancer stem cells in human liver cancer. Hepatology 47: 919-928.

109

87. Zhu Z, Hao XF, Yan MX, Yao M, Ge C, et al. (2010) Cancer stem/progenitor cells are highly enriched in CD133(+)CD44(+) population in hepatocellular carcinoma. International Journal of Cancer 126: 2067-2078. 88. Mima K, Okabe H, Ishimoto T, Hayashi H, Nakagawa S, et al. (2012) CD44s regulates the TGF-beta-mediated mesenchymal phenotype and is associated with poor prognosis in patients with hepatocellular carcinoma. Cancer Res 72: 3414- 3423. 89. Okabe H, Ishimoto T, Mima K, Nakagawa S, Hayashi H, et al. (2014) CD44s signals the acquisition of the mesenchymal phenotype required for anchorage- independent cell survival in hepatocellular carcinoma. Br J Cancer 110: 958-966. 90. Polyak K, Weinberg RA (2009) Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits. Nat Rev Cancer 9: 265-273. 91. Tovuu LO, Imura S, Utsunomiya T, Morine Y, Ikemoto T, et al. (2013) Role of CD44 expression in non-tumor tissue on intrahepatic recurrence of hepatocellular carcinoma. Int J Clin Oncol 18: 651-656. 92. Tamada M, Nagano O, Tateyama S, Ohmura M, Yae T, et al. (2012) Modulation of glucose metabolism by CD44 contributes to antioxidant status and drug resistance in cancer cells. Cancer Res 72: 1438-1448. 93. Chow AK, Ng L, Lam CS, Wong SK, Wan TM, et al. (2013) The Enhanced metastatic potential of hepatocellular carcinoma (HCC) cells with sorafenib resistance. PLoS One 8: e78675. 94. Fernando J, Malfettone A, Cepeda EB, Vilarrasa-Blasi R, Bertran E, et al. (2014) A mesenchymal-like phenotype and expression of CD44 predict lack of apoptotic response to sorafenib in liver tumor cells. Int J Cancer. 95. Wilhelm SM, Carter C, Tang L, Wilkie D, McNabola A, et al. (2004) BAY 43-9006 exhibits broad spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis. Cancer Res 64: 7099-7109. 96. Liu L, Cao Y, Chen C, Zhang X, McNabola A, et al. (2006) Sorafenib blocks the RAF/MEK/ERK pathway, inhibits tumor angiogenesis, and induces tumor cell

110

apoptosis in hepatocellular carcinoma model PLC/PRF/5. Cancer Res 66: 11851- 11858. 97. Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, et al. (2008) Sorafenib in advanced hepatocellular carcinoma. N Engl J Med 359: 378-390. 98. Cheng AL, Kang YK, Chen Z, Tsao CJ, Qin S, et al. (2009) Efficacy and safety of sorafenib in patients in the Asia-Pacific region with advanced hepatocellular carcinoma: a phase III randomised, double-blind, placebo-controlled trial. Lancet Oncol 10: 25-34. 99. Gauthier A, Ho M (2013) Role of sorafenib in the treatment of advanced hepatocellular carcinoma: An update. Hepatol Res 43: 147-154. 100. Chen KF, Chen HL, Tai WT, Feng WC, Hsu CH, et al. (2011) Activation of phosphatidylinositol 3-kinase/Akt signaling pathway mediates acquired resistance to sorafenib in hepatocellular carcinoma cells. J Pharmacol Exp Ther 337: 155- 161. 101. Ezzoukhry Z, Louandre C, Trecherel E, Godin C, Chauffert B, et al. (2012) EGFR activation is a potential determinant of primary resistance of hepatocellular carcinoma cells to sorafenib. Int J Cancer 131: 2961-2969. 102. Blivet-Van Eggelpoel MJ, Chettouh H, Fartoux L, Aoudjehane L, Barbu V, et al. (2012) Epidermal growth factor receptor and HER-3 restrict cell response to sorafenib in hepatocellular carcinoma cells. J Hepatol 57: 108-115. 103. van Malenstein H, Dekervel J, Verslype C, Van Cutsem E, Windmolders P, et al. (2013) Long-term exposure to sorafenib of liver cancer cells induces resistance with epithelial-to-mesenchymal transition, increased invasion and risk of rebound growth. Cancer Lett 329: 74-83. 104. van Zijl F, Mall S, Machat G, Pirker C, Zeillinger R, et al. (2011) A human model of epithelial to mesenchymal transition to monitor drug efficacy in hepatocellular carcinoma progression. Mol Cancer Ther 10: 850-860. 105. Marquardt JU, Thorgeirsson SS (2010) Stem cells in hepatocarcinogenesis: evidence from genomic data. Semin Liver Dis 30: 26-34.

111

106. Xin HW, Ambe CM, Hari DM, Wiegand GW, Miller TC, et al. (2013) Label- retaining liver cancer cells are relatively resistant to sorafenib. Gut 62: 1777- 1786. 107. Vivanco I, Sawyers CL (2002) The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2: 489-501. 108. Liu P, Cheng H, Roberts TM, Zhao JJ (2009) Targeting the phosphoinositide 3- kinase pathway in cancer. Nat Rev Drug Discov 8: 627-644. 109. Zoncu R, Efeyan A, Sabatini DM (2011) mTOR: from growth signal integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol 12: 21-35. 110. Ma XM, Blenis J (2009) Molecular mechanisms of mTOR-mediated translational control. Nat Rev Mol Cell Biol 10: 307-318. 111. Zhou Q, Lui VW, Yeo W (2011) Targeting the PI3K/Akt/mTOR pathway in hepatocellular carcinoma. Future Oncol 7: 1149-1167. 112. Sahin F, Kannangai R, Adegbola O, Wang J, Su G, et al. (2004) mTOR and P70 S6 kinase expression in primary liver neoplasms. Clin Cancer Res 10: 8421-8425. 113. Villanueva A, Chiang DY, Newell P, Peix J, Thung S, et al. (2008) Pivotal role of mTOR signaling in hepatocellular carcinoma. Gastroenterology 135: 1972-1983, 1983 e1971-1911. 114. Sieghart W, Fuereder T, Schmid K, Cejka D, Werzowa J, et al. (2007) Mammalian target of rapamycin pathway activity in hepatocellular carcinomas of patients undergoing liver transplantation. Transplantation 83: 425-432. 115. Andrew X. Zhu M, PhD; Masatoshi Kudo,MD, PhD; Eric Assenat,MD, PhD; Stéphane Cattan, MD;, Yoon-Koo Kang M, PhD; Ho Yeong Lim, MD, PhD; Ronnie T. P. Poon, MD, PhD; Jean-Frederic Blanc,MD, PhD;, Arndt Vogel MC- LC, MD, PhD; Etienne Dorval, MD; Markus Peck-Radosavljevic, MD;, Armando Santoro MBD, MD, PhD; Junji Furuse,MD, PhD; Annette Jappe, RN; Kevin Perraud, MS;, Oezlem Anak MDBS, MD; Li-Tzong Chen, MD, PhD (2014) Effect of Everolimus on Survival in Advanced Hepatocellular Carcinoma After Failure of Sorafenib The EVOLVE-1 Randomized Clinical Trial JAMA 312: 57- 67.

112

116. Zhu XM, Wu LJ, Xu J, Yang R, Wu FS (2011) Let-7c microRNA expression and clinical significance in hepatocellular carcinoma. J Int Med Res 39: 2323-2329. 117. Shimizu S, Takehara T, Hikita H, Kodama T, Miyagi T, et al. (2010) The let-7 family of microRNAs inhibits Bcl-xL expression and potentiates sorafenib-induced apoptosis in human hepatocellular carcinoma. J Hepatol 52: 698-704. 118. Li W, Xie L, He X, Li J, Tu K, et al. (2008) Diagnostic and prognostic implications of microRNAs in human hepatocellular carcinoma. Int J Cancer 123: 1616-1622. 119. Bi Q, Tang S, Xia L, Du R, Fan R, et al. (2012) Ectopic expression of MiR-125a inhibits the proliferation and metastasis of hepatocellular carcinoma by targeting MMP11 and VEGF. PLoS One 7: e40169. 120. Kim JK, Noh JH, Jung KH, Eun JW, Bae HJ, et al. (2013) Sirtuin7 oncogenic potential in human hepatocellular carcinoma and its regulation by the tumor suppressors MiR-125a-5p and MiR-125b. Hepatology 57: 1055-1067. 121. Zhao A, Zeng Q, Xie X, Zhou J, Yue W, et al. (2012) MicroRNA-125b induces cancer cell apoptosis through suppression of Bcl-2 expression. J Genet Genomics 39: 29-35. 122. Wang Y, Lee AT, Ma JZ, Wang J, Ren J, et al. (2008) Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target. J Biol Chem 283: 13205-13215. 123. Fan Q, He M, Deng X, Wu WK, Zhao L, et al. (2013) Derepression of c-Fos caused by microRNA-139 down-regulation contributes to the metastasis of human hepatocellular carcinoma. Cell Biochem Funct 31: 319-324. 124. Wong CC, Wong CM, Tung EK, Au SL, Lee JM, et al. (2011) The microRNA miR- 139 suppresses metastasis and progression of hepatocellular carcinoma by downregulating Rho-kinase 2. Gastroenterology 140: 322-331. 125. Zhang JP, Zeng C, Xu L, Gong J, Fang JH, et al. (2014) MicroRNA-148a suppresses the epithelial-mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signaling. Oncogene 33: 4069-4076.

113

126. Han H, Sun D, Li W, Shen H, Zhu Y, et al. (2013) A c-Myc-MicroRNA functional feedback loop affects hepatocarcinogenesis. Hepatology 57: 2378-2389. 127. Xu T, Zhu Y, Xiong Y, Ge YY, Yun JP, et al. (2009) MicroRNA-195 suppresses tumorigenicity and regulates G1/S transition of human hepatocellular carcinoma cells. Hepatology 50: 113-121. 128. Yang X, Yu J, Yin J, Xiang Q, Tang H, et al. (2012) MiR-195 regulates cell apoptosis of human hepatocellular carcinoma cells by targeting LATS2. Pharmazie 67: 645- 651. 129. Yuan JH, Yang F, Chen BF, Lu Z, Huo XS, et al. (2011) The histone deacetylase 4/SP1/microrna-200a regulatory network contributes to aberrant histone acetylation in hepatocellular carcinoma. Hepatology 54: 2025-2035. 130. Liu J, Ruan B, You N, Huang Q, Liu W, et al. (2013) Downregulation of miR-200a induces EMT phenotypes and CSC-like signatures through targeting the beta- catenin pathway in hepatic oval cells. PLoS One 8: e79409. 131. Shih TC, Tien YJ, Wen CJ, Yeh TS, Yu MC, et al. (2012) MicroRNA-214 downregulation contributes to tumor angiogenesis by inducing secretion of the hepatoma-derived growth factor in human hepatoma. J Hepatol 57: 584-591. 132. Wang X, Chen J, Li F, Lin Y, Zhang X, et al. (2012) MiR-214 inhibits cell growth in hepatocellular carcinoma through suppression of beta-catenin. Biochem Biophys Res Commun 428: 525-531. 133. Wong QW, Lung RW, Law PT, Lai PB, Chan KY, et al. (2008) MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1. Gastroenterology 135: 257-269. 134. Bae HJ, Noh JH, Kim JK, Eun JW, Jung KH, et al. (2014) MicroRNA-29c functions as a tumor suppressor by direct targeting oncogenic SIRT1 in hepatocellular carcinoma. Oncogene 33: 2557-2567. 135. Liu WH, Yeh SH, Lu CC, Yu SL, Chen HY, et al. (2009) MicroRNA-18a prevents estrogen receptor-alpha expression, promoting proliferation of hepatocellular carcinoma cells. Gastroenterology 136: 683-693.

114

136. Liu S, Guo W, Shi J, Li N, Yu X, et al. (2012) MicroRNA-135a contributes to the development of portal vein tumor thrombus by promoting metastasis in hepatocellular carcinoma. J Hepatol 56: 389-396. 137. Shen G, Jia H, Tai Q, Li Y, Chen D (2013) miR-106b downregulates adenomatous polyposis coli and promotes cell proliferation in human hepatocellular carcinoma. Carcinogenesis 34: 211-219. 138. Ma S, Tang KH, Chan YP, Lee TK, Kwan PS, et al. (2010) miR-130b Promotes CD133(+) liver tumor-initiating cell growth and self-renewal via tumor protein 53-induced nuclear protein 1. Cell Stem Cell 7: 694-707. 139. Luedde T (2010) MicroRNA-151 and its hosting gene FAK (focal adhesion kinase) regulate tumor cell migration and spreading of hepatocellular carcinoma. Hepatology 52: 1164-1166. 140. Ding J, Huang S, Wu S, Zhao Y, Liang L, et al. (2010) Gain of miR-151 on chromosome 8q24.3 facilitates tumour cell migration and spreading through downregulating RhoGDIA. Nat Cell Biol 12: 390-399. 141. Yan XL, Jia YL, Chen L, Zeng Q, Zhou JN, et al. (2013) Hepatocellular carcinoma- associated mesenchymal stem cells promote hepatocarcinoma progression: role of the S100A4-miR155-SOCS1-MMP9 axis. Hepatology 57: 2274-2286. 142. Zhang Y, Wei W, Cheng N, Wang K, Li B, et al. (2012) Hepatitis C virus-induced up-regulation of microRNA-155 promotes hepatocarcinogenesis by activating Wnt signaling. Hepatology 56: 1631-1640. 143. Wang J, Li J, Shen J, Wang C, Yang L, et al. (2012) MicroRNA-182 downregulates metastasis suppressor 1 and contributes to metastasis of hepatocellular carcinoma. BMC Cancer 12: 227. 144. Goeppert B, Schmezer P, Dutruel C, Oakes C, Renner M, et al. (2010) Down- regulation of tumor suppressor A kinase anchor protein 12 in human hepatocarcinogenesis by epigenetic mechanisms. Hepatology 52: 2023-2033. 145. Li J, Fu H, Xu C, Tie Y, Xing R, et al. (2010) miR-183 inhibits TGF-beta1-induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells. BMC Cancer 10: 354.

115

146. Ying Q, Liang L, Guo W, Zha R, Tian Q, et al. (2011) Hypoxia-inducible microRNA-210 augments the metastatic potential of tumor cells by targeting vacuole membrane protein 1 in hepatocellular carcinoma. Hepatology 54: 2064- 2075. 147. Lan SH, Wu SY, Zuchini R, Lin XZ, Su IJ, et al. (2014) Autophagy suppresses tumorigenesis of hepatitis B virus-associated hepatocellular carcinoma through degradation of microRNA-224. Hepatology 59: 505-517. 148. Scisciani C, Vossio S, Guerrieri F, Schinzari V, De Iaco R, et al. (2012) Transcriptional regulation of miR-224 upregulated in human HCCs by NFkappaB inflammatory pathways. J Hepatol 56: 855-861. 149. Zhou P, Jiang W, Wu L, Chang R, Wu K, et al. (2012) miR-301a is a candidate oncogene that targets the homeobox gene Gax in human hepatocellular carcinoma. Dig Dis Sci 57: 1171-1180. 150. Fornari F, Milazzo M, Chieco P, Negrini M, Marasco E, et al. (2012) In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol 227: 275-285. 151. Raoul JL, Sangro B, Forner A, Mazzaferro V, Piscaglia F, et al. Evolving strategies for the management of intermediate-stage hepatocellular carcinoma: available evidence and expert opinion on the use of transarterial chemoembolization. Cancer Treat Rev 37: 212-220. 152. Henry JC, Park JK, Jiang J, Kim JH, Nagorney DM, et al. miR-199a-3p targets CD44 and reduces proliferation of CD44 positive hepatocellular carcinoma cell lines. Biochem Biophys Res Commun 403: 120-125. 153. Ke AW, Shi GM, Zhou J, Wu FZ, Ding ZB, et al. (2009) Role of overexpression of CD151 and/or c-Met in predicting prognosis of hepatocellular carcinoma. Hepatology 49: 491-503. 154. Shi GM, Ke AW, Zhou J, Wang XY, Xu Y, et al. CD151 modulates expression of matrix metalloproteinase 9 and promotes neoangiogenesis and progression of hepatocellular carcinoma. Hepatology 52: 183-196.

116

155. Ke AW, Shi GM, Zhou J, Huang XY, Shi YH, et al. CD151 amplifies signaling by integrin alpha6beta1 to PI3K and induces the epithelial-mesenchymal transition in HCC cells. Gastroenterology 140: 1629-1641 e1615. 156. Klosek SK, Nakashiro K, Hara S, Shintani S, Hasegawa H, et al. (2005) CD151 forms a functional complex with c-Met in human salivary gland cancer cells. Biochem Biophys Res Commun 336: 408-416. 157. Arora H, Qureshi R, Park WY (2013) miR-506 regulates epithelial mesenchymal transition in breast cancer cell lines. PLoS One 8: e64273. 158. Han ZB, Yang Z, Chi Y, Zhang L, Wang Y, et al. MicroRNA-124 Suppresses Breast Cancer Cell Growth and Motility by Targeting CD151. Cell Physiol Biochem 31: 823-832. 159. Wang X, Yu H, Lu X, Zhang P, Wang M, et al. (2014) MiR-22 suppresses the proliferation and invasion of gastric cancer cells by inhibiting CD151. Biochem Biophys Res Commun 445: 175-179. 160. Geback T, Schulz MM, Koumoutsakos P, Detmar M (2009) TScratch: a novel and simple software tool for automated analysis of monolayer wound healing assays. Biotechniques 46: 265-274. 161. Ke AW, Shi GM, Zhou J, Huang XY, Shi YH, et al. (2011) CD151 amplifies signaling by integrin alpha6beta1 to PI3K and induces the epithelial- mesenchymal transition in HCC cells. Gastroenterology 140: 1629-1641 e1615. 162. Shi GM, Ke AW, Zhou J, Wang XY, Xu Y, et al. (2010) CD151 modulates expression of matrix metalloproteinase 9 and promotes neoangiogenesis and progression of hepatocellular carcinoma. Hepatology 52: 183-196. 163. Beg MS, Borad, M., Sachdev, J., Hong, D.S., Smith, S., Bader, A., Stoudemire, J., Kim, S., Brenner, A. (2014) Multicenter phase I study of MRX34, a first-in-class microRNA miR-34 mimic liposomal injection. . Proc Amer Assoc Cancer Res 55: CT327. 164. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3: 1101-1108.

117

165. Budhu A, Jia HL, Forgues M, Liu CG, Goldsteir D, et al. (2008) Identification of metastasis-related microRNAs in hepatocellular carcinoma. Hepatology 47: 897- 907. 166. Pineau P, Volinia S, McJunkin K, Marchio A, Battiston C, et al. (2010) miR-221 overexpression contributes to liver tumorigenesis. Proceedings of the National Academy of Sciences of the United States of America 107: 264-269. 167. Wang Y, Lee ATC, Ma JZI, Wang JB, Ren JW, et al. (2008) Profiling MicroRNA expression in hepatocellular carcinoma reveals MicroRNA-224 up-regulation and apoptosis inhibitor-5 as a MicroRNA-224-specific target. Journal of Biological Chemistry 283: 13205-13215. 168. Galardi S, Mercatelli N, Giorda E, Massalini S, Frajese GV, et al. (2007) miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27(Kip1)*. Journal of Biological Chemistry 282: 23716-23724. 169. le Sage C, Nagel R, Egan DA, Schrier M, Mesman E, et al. (2007) Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. Embo Journal 26: 3699-3708. 170. Visone R, Russo L, Pallante P, De Martino I, Ferraro A, et al. (2007) MicroRNAs (miR)-221 and miR-222, both overexpressed in human thyroid papillary carcinomas, regulate p27(Kip1) protein levels and cell cycle. Endocrine-Related Cancer 14: 791-798. 171. Medina R, Zaidi SK, Liu CG, Stein JL, vanWijnen AJ, et al. (2008) MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. Cancer Res 68: 2773- 2780. 172. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, et al. (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33: e179. 173. Janssen HL, Reesink HW, Lawitz EJ, Zeuzem S, Rodriguez-Torres M, et al. (2013) Treatment of HCV infection by targeting microRNA. N Engl J Med 368: 1685- 1694.

118

174. Callegari E, Elamin BK, Giannone F, Milazzo M, Altavilla G, et al. (2012) Liver tumorigenicity promoted by microRNA-221 in a mouse transgenic model. Hepatology 56: 1025-1033. 175. Schmittgen TD, Lee EJ, Jiang J, Sarkar A, Yang L, et al. (2008) Real-time PCR quantification of precursor and mature microRNA. Methods 44: 31-38. 176. Saini S, Majid S, Shahryari V, Arora S, Yamamura S, et al. (2012) miRNA-708 control of CD44(+) prostate cancer-initiating cells. Cancer Res 72: 3618-3630. 177. Hsieh AC, Liu Y, Edlind MP, Ingolia NT, Janes MR, et al. (2012) The translational landscape of mTOR signalling steers cancer initiation and metastasis. Nature 485: 55-61. 178. Di Cristofano A, Pandolfi PP (2000) The multiple roles of PTEN in tumor suppression. Cell 100: 387-390. 179. DeYoung MP, Horak P, Sofer A, Sgroi D, Ellisen LW (2008) Hypoxia regulates TSC1/2-mTOR signaling and tumor suppression through REDD1-mediated 14-3- 3 shuttling. Genes Dev 22: 239-251. 180. Hydbring P, Badalian-Very G (2013) Clinical applications of microRNAs. F1000Res 2: 136. 181. Masuda M, Chen WY, Miyanaga A, Nakamura Y, Kawasaki K, et al. (2014) Alternative mammalian target of rapamycin (mTOR) signal activation in sorafenib-resistant hepatocellular carcinoma cells revealed by array-based pathway profiling. Mol Cell Proteomics 13: 1429-1438. 182. Zhai B, Sun XY (2013) Mechanisms of resistance to sorafenib and the corresponding strategies in hepatocellular carcinoma. World J Hepatol 5: 345-352. 183. Choo AY, Yoon SO, Kim SG, Roux PP, Blenis J (2008) Rapamycin differentially inhibits S6Ks and 4E-BP1 to mediate cell-type-specific repression of mRNA translation. Proc Natl Acad Sci U S A 105: 17414-17419. 184. Herishanu Y, Gibellini F, Njuguna N, Hazan-Halevy I, Farooqui M, et al. (2011) Activation of CD44, a receptor for extracellular matrix components, protects chronic lymphocytic leukemia cells from spontaneous and drug induced apoptosis through MCL-1. Leuk Lymphoma 52: 1758-1769.

119

185. Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75: 843-854. 186. Lanford RE, Hildebrandt-Eriksen ES, Petri A, Persson R, Lindow M, et al. (2010) Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science 327: 198-201. 187. Xu H, Zhao L, Fang Q, Sun J, Zhang S, et al. (2014) MiR-338-3p inhibits hepatocarcinoma cells and sensitizes these cells to sorafenib by targeting hypoxia- induced factor 1alpha. PLoS One 9: e115565. 188. Mao K, Zhang J, He C, Xu K, Liu J, et al. (2014) Restoration of miR-193b sensitizes Hepatitis B virus-associated hepatocellular carcinoma to sorafenib. Cancer Lett 352: 245-252. 189. Liu K, Liu S, Zhang W, Ji B, Wang Y, et al. (2014) miR222 regulates sorafenib resistance and enhance tumorigenicity in hepatocellular carcinoma. Int J Oncol 45: 1537-1546. 190. Chen WX, Liu XM, Lv MM, Chen L, Zhao JH, et al. (2014) Exosomes from drug- resistant breast cancer cells transmit chemoresistance by a horizontal transfer of microRNAs. PLoS One 9: e95240. 191. O'Brien K, Rani S, Corcoran C, Wallace R, Hughes L, et al. (2013) Exosomes from triple-negative breast cancer cells can transfer phenotypic traits representing their cells of origin to secondary cells. Eur J Cancer 49: 1845-1859. 192. Takahashi K, Yan IK, Kogure T, Haga H, Patel T (2014) Extracellular vesicle- mediated transfer of long non-coding RNA ROR modulates chemosensitivity in human hepatocellular cancer. FEBS Open Bio 4: 458-467. 193. Lawrie CH, Gal S, Dunlop HM, Pushkaran B, Liggins AP, et al. (2008) Detection of elevated levels of tumour-associated microRNAs in serum of patients with diffuse large B-cell lymphoma. Br J Haematol 141: 672-675. 194. Mitchell PS, Parkin RK, Kroh EM, Fritz BR, Wyman SK, et al. (2008) Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A 105: 10513-10518.

120

195. Heneghan HM, Miller N, Kelly R, Newell J, Kerin MJ (2010) Systemic miRNA-195 differentiates breast cancer from other malignancies and is a potential biomarker for detecting noninvasive and early stage disease. Oncologist 15: 673-682. 196. Huang Z, Huang D, Ni S, Peng Z, Sheng W, et al. (2010) Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer. Int J Cancer 127: 118-126. 197. Xing L, Todd NW, Yu L, Fang H, Jiang F (2010) Early detection of squamous cell lung cancer in sputum by a panel of microRNA markers. Mod Pathol 23: 1157- 1164. 198. Boeri M, Verri C, Conte D, Roz L, Modena P, et al. (2011) MicroRNA signatures in tissues and plasma predict development and prognosis of computed tomography detected lung cancer. Proc Natl Acad Sci U S A 108: 3713-3718. 199. Keller A, Leidinger P, Bauer A, Elsharawy A, Haas J, et al. (2011) Toward the blood-borne miRNome of human diseases. Nat Methods 8: 841-843.

121