University of Nevada, Reno

Metabolic Effects of a Grape Seed Procyanidin Extract and its Relation to Bile Acid Homeostasis

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Cell and Molecular Biology

By Rebecca M. Heidker Dr. Marie-Louise Ricketts/Dissertation Advisor May, 2016

Copyright by Rebecca M. Heidker 2016 All rights reserved

THE GRADUATE SCHOOL

We recommend that the dissertation prepared under our supervision by

REBECCA HEIDKER

Entitled

Metabolic Effects Of Grape Seed Procyanidin Extract On Risk Factors Of Cardiovascular Disease

be accepted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Marie-Louise Ricketts, Advisor

Patricia Berinsone, Committee Member

Patricia Ellison, Committee Member

Cynthia Mastick, Committee Member

Thomas Kidd, Graduate School Representative

David W. Zeh, Ph. D., Dean, Graduate School

May, 2016

i

Abstract

Bile acid (BA) recirculation and synthesis are tightly regulated via communication along the gut-liver axis and assist in the regulation of triglyceride (TG) and cholesterol homeostasis. Serum TGs and cholesterol are considered to be treatable risk factors for cardiovascular disease, which is the leading cause of death both globally and in the United

States. While pharmaceuticals are common treatment strategies, nearly one-third of the population use complementary and alternative (CAM) therapy alone or in conjunction with medications, consequently it is important that we understand the mechanisms by which

CAM treatments function at the molecular level. It was previously demonstrated that one such CAM therapy, namely a grape seed procyanidin extract (GSPE), reduces serum TGs via the farnesoid X receptor (Fxr). GSPE treatment also induces the expression of hepatic cholesterol 7α-hydroxylase (Cyp7a1), the rate limiting enzyme for de novo BA synthesis.

Herein, we demonstrate that both gene and protein expression of Cyp7a1 is increased due to the fact that GSPE selectively regulates intestinal Fxr target genes involved in BA uptake and transport. Apical sodium dependent bile acid transporter (Asbt) expression is decreased with a concomitant reduction in fibroblast growth factor 15 (Fgf15), leading to a lack of repression on hepatic Cyp7a1. The subsequent 47% decrease in serum BAs and

69% increase in fecal BA excretion results in a significant reduction in serum TG and cholesterol. These Fxr dependent effects are lost in Fxr-/- mice, clearly demonstrating the critical role of this nuclear receptor. In a subsequent study we confirm that GSPE represses Asbt expression, while the BA sequestrant cholestyramine (CHY) induces expression. Treatment with either GSPE or CHY increases expression of Cyp7a1, with co-administration augmenting the increase. In the liver, GSPE and CHY independently induce expression of genes regulating cholesterol and lipid synthesis; however, when

ii

combined the expression of cholesterogenic and lipogenic genes induced by CHY is attenuated. Taken together these data indicate that GSPE has the potential for use either alone or as a complementary therapy in the treatment of hypertriglyceridemia and hypercholesterolemia. These findings, combined with the ability of low molecular weight procyanidins (LMW-PCNs) to modify intracellular proteins and signaling pathways led us to optimize a protocol for isolating LMW-PCNs from the seeds of grapes grown at the

University of Nevada, Reno (UNR) vineyard. An ethyl acetate based extraction process utilizing whole seeds was found to be both time and cost effective, while preserving the anti-oxidant properties of the procyanidin-rich extract. This protocol will provide the basis for further extractions in order to conduct in vitro and in vivo testing, potentially allowing for the development of a value added product from the UNR vineyards.

iii

Dedication

To my son, Andrew, for providing me with the inspiration to start this journey.

To my family and friends who believed in me and supported me throughout this process.

iv

Acknowledgement

I would like to thank my advisor and mentor, Marie-Louise Ricketts for fostering independence in her students. She has encouraged me to think critically and see my projects through to completion. She has also reminded me on multiple occasions that graduate school is always an up and down journey, and she has stayed with me throughout those ups and downs. I want to thank my labmates for their assistance, friendship and support. I’m lucky to have met and gotten to know each of you, and I’ve learned so much from being around you.

I would also like to thank my committee members, Patricia Bernisone, Thomas Kidd,

Patricia Ellison, and Cynthia Mastick. They have provided me with excellent guidance and suggestions along the way. I appreciate their support more than words can say.

In addition, I need to thank my family for their support. My father, James Heidker, has cooked countless meals for me and my son when I’ve been too busy to keep up. He has always had faith in my ability to complete this process, and has answered more chemistry questions than I count. My mother, Jean Heidker, answered questions about basic assays and the science behind them while I got my feet under my as a research scientist. And last, but not least, my sister, Moira Kolada, taught me the ropes of graduate school at

UNR.

v

List of Tables………………………………………………………………………….…….…..ix

List of Figures…………………………………………………………………………...….…..ix

Chapter 1: Introduction…………………………………………………………………....…1

1.1. Grape seed procyanidin extract and health ...... 2

1.1.1. Human Health Relevance ...... 2

1.1.2. Procyanidins ...... 2

1.1.3. Grape seed procyanidin extract ...... 4

1.1.4. Bioavailability ...... 5

1.1.5. GSPE alleviates cardiovascular disease risk factors ...... 6

1.1.5.1. The impact of procyandins on atherosclerosis ...... 7

1.1.5.2. Effects of grape seed extracts on lipogenesis and diabetes mellitus ...... 8

1.1.5.3. Regulation of dyslipidemia ...... 10

1.2. Grape seed procyanidin extract and nuclear receptors ...... 11

1.2.1 Nuclear receptors ...... 12

1.2.2. Structure of nuclear receptors ...... 14

1.2.3. Classification of nuclear receptors ...... 16

1.2.3.1. Class I nuclear receptors ...... 17

1.2.4. Class II nuclear receptors ...... 18

1.2.4.1. Farnesoid X receptor ...... 19

1.2.5. Class III nuclear receptors ...... 21

1.2.5.1. Small heterodimer partner ...... 21

1.3. Bile acid synthesis ...... 24

1.3.1. Classical bile acid synthesis ...... 28

vi

1.3.2. Alternative bile acid synthesis ...... 29

1.4. Enterohepatic recirculation ...... 30

1.4.1. Bile acid transport in the small intestine ...... 32

1.4.2. Hepatic bile acid transport ...... 33

1.5. Cholesterol and triglyceride synthesis and transport ...... 34

1.5.1. Cholesterol synthesis ...... 34

1.5.2. Hepatic export of cholesterol and triglycerides ...... 36

1.5.3. Intestinal transport of triglycerides and cholesterol ...... 37

1.5.4. Excretion of cholesterol ...... 40

1.6. Summary ...... 40

Chapter 2: Dietary Procyanidins Selectively Modulate Intestinal Farnesoid X

Receptor-regulated Gene Expression to Alter Enterohepatic Bile Acid

Recirculation: Elucidation of a Novel Mechanism to Reduce Triglyceridemia…....45

2.1. Abstract ...... 47

2.2. Introduction ...... 49

2.3. Materials and Methods ...... 51

2.4. Results ...... 56

2.5. Discussion ...... 67

Author Contributions ...... 70

Acknowledgements ...... 70

vii

Chapter 3: Grape Seed Procyanidins and Cholestyramine Differentially Alter Bile

Acid and Cholesterol Homeostatic Gene Expression in Mouse Intestine and

Liver…………………………………………………………………………………………..…71

3.1. Abstract ...... 74

3.2. Introduction ...... 76

3.3. Materials and Methods ...... 79

3.4. Results and Discussion ...... 82

3.5. Conclusion ...... 96

Acknowledgements ...... 98

Author contributions ...... 98

Competing Interests ...... 99

Chapter 4: A Comparative Study of Methods for the Efficient Extraction of Low

Molecular Weight Procyanidins from Three Varieties of Grape Seeds…………….100

4.1. Abstract ...... 102

4.2. Introduction ...... 103

4.3. Materials and Methods ...... 105

4.3. Results and Discussion ...... 110

4.4. Conclusion ...... 123

Acknowledgements ...... 124

viii

Chapter 5: Conclusions and Future Directions………………………………………..125

5.1. Conclusions and Future Directions ...... 126

References……………………………………………………………………………………133

Appendix 1: Supporting Tables……………………………………………………………165

Appendix 2: Supporting Figures………………………………………………………..…168

Appendix 3: A Grape Seed Procyanidin Extract Ameliorates Fructose-Induced

Hypertriglyceridemia in Rats Via Enhanced Fecal Bile Acid and Cholesterol

Excretion and Inhibition of Hepatic Lipogenesis……………………………….………171

Appendix 4: translin is required for metabolic regulation of sleep…………….…...211

Appendix 5: Feeding State, Insulin and NPR-1 Modulate Chemoreceptor Gene

Expression via Integration of Sensory and Circuit Inputs……………………...……256

ix

List of Tables

Table 1. List of Abbreviations ...... xii

Table 2.1. Liver function biochemical parameters after GSPE administration ...... 66

Table 3.1. Average weekly mouse weight (g) during dietary intervention...... 82

Table 4.1: Extract subunit composition determined by acid-catalysis using Reverse- phase HPLC...... 120

List of Figures

Figure 1.1. Procyanidins are a subgroup of flavonoids...... 3

Figure 1.2. The structure of monomeric and dimeric procyanidins...... 4

Figure 1.3. High-performance liquid chromatography (HPLC) chromatograph illustrating the mean degree of polymerization (mDP) of GSPE...... 5

Figure 1.4. Ligand binding induces conformational changes in nuclear receptors (NR) allowing for gene transcription...... 13

Figure 1.5. The primary and tertiary structure of nuclear receptors...... 16

Figure 1.6. Mechanism of action of nuclear receptors by class ...... 18

Figure 1.7. Farnesoid X receptor activation increases the expression of small heterodimer partner to reduce serum triglycerides...... 23

Figure 1.8. Primary and secondary bile acids and their conjugates...... 25

Figure 1.9. Bile acids are synthesized from cholesterol...... 27

Figure 1.10. Enterohepatic recirculation of bile acids...... 31

Figure 1.11. Synthesis of cholesterol from acetyl-CoA...... 35

x

Figure 1.12. Microsomal triglyceride transfer protein is required to lipidate very low density lipoproteins ...... 37

Figure 1.13. Transport of dietary lipids through the enterocyte...... 39

Figure 2.1. GSPE down-regulates FXR-target gene expression in vitro in Caco-2 cells. 58

Figure 2.2. GSPE down-regulates basolateral BA transporters in vitro in Caco-2 cells. .59

Figure 2.3. GSPE selectively modulates intestinal Fxr-regulated gene expression in vivo in an Fxr-dependent manner...... 62

Figure 2.4. GSPE increases BA synthesis and represses lipogenesis in vivo...... 63

Figure 2.5. GSPE decreases intestinal Asbt protein expression leading to increased hepatic Cyp7a1 expression...... 64

Figure 2.6. GSPE administration reduces serum bile acid, triglyceride and cholesterol levels while increasing fecal bile acid output in vivo, in an Fxr-dependent manner...... 65

Figure 3.1. GSPE and cholestyramine differentially alter intestinal bile acid homeostatic gene expression...... 83

Figure 3.2. GSPE and cholestyramine induce the hepatic expression of genes regulating bile acid synthesis...... 85

Figure 3.3. GSPE decreases the expression of intestinal apical cholesterol transporters, but not in combination with cholestyramine...... 87

Figure 3.4. Effects on intestinal cholesterol synthesis and transporter gene expression following treatments...... 88

Figure 3.5. Expression of genes involved in basolateral intestinal cholesterol transport following treatments...... 89

Figure 3.6. Hepatic cholesterol and lipogenic homeostatic gene expression following treatments...... 91

xi

Figure 3.7. Serum Biochemical analysis following treatments...... 93

Figure 3.8. Fecal bile acid, cholesterol and lipid analysis following treatments...... 95

Figure 4.1. Yield of extract (mg extract/g of seeds) from whole and ground seeds using either acetone or ethyl acetate as the extraction solvent...... 113

Figure 4.2. Comparison of total polyphenol and condensed tannin content in extracts by variety of grape seed in whole and ground seeds using either ethyl acetate or acetone extraction...... 115

Figure 4.3. Mean degree of polymerization for extracts prepared from whole and ground seeds using either acetone or ethyl acetate...... 117

Figure 4.4. Low molecular weight procyanidin distribution in each extract...... 118

Figure 4.5: Antioxidant capacity of extracts prepared from whole and ground seeds using either ethyl acetate or acetone extraction for each grape variety...... 122

xii

Table 1. List of Abbreviations ABCA1 ATP-binding cassette, sub-family a, member 1 ABCB11 ATP-binding cassette 11 (synonym for bile salt export pump) ABCG5/8 ATP-binding cassette G5/8 ACAT2 Acyl-coa:cholesterol acytransferase 2 ACC1 Acetyl coa carboxylase 1 AF-1 Activation function 1 (domain) AF-2 Activation function 2 (domain) ALT Alanine aminotransferase AMPK 5' AMP-activated protein kinase ApoA1 Apolipoprotein A1 ApoA5 Apolipoprotein A5 ApoB Apolipoprotein B ApoE Apolipoprotein E AR Androgen receptor ASBT Apical sodium dependent bile acid transporter AST Aspartate aminotransferase BA Bile acid BACS Bile-acyl-coa synthetase BARM Bile acid receptor modulator BiP Immunoglobulin heavy chain-binding protein BSEP Bile salt export pump CA Cholic acid CAD Coronary artery disease CAM Complementary and alternative medicine CDCA Chenodeoxycholic acid cDNA Complementary DNA CE Catechin equivalents CF Cabernet franc CHY Cholestyramine COX2 Cyclooxygenase-2 CPT1a Carnitine palmitoyltransferase 1a CRP C-reactive protein CS Cabernet sauvignon CVD Cardiovascular disease CYP27A1 Sterol 27-hydroxylase CYP7A1 Cholesterol 7α-hydroxylase CYP8B1 Sterol 12α-hydroxylase DBD DNA binding domain DCA Deoxycholic acid DM Diabetes mellitus DPPH 2, 2-diphenyl-1-picrylhydrazyl

xiii

DR Direct repeat

EC50 Efficient concentration 50% EHC Enterohepatic recirculation ER Everted repeat EtOAc Ethyl acetate FASN Fatty acid synthase FFA Free fatty acids FGF15/19 Fibroblast growth factor 15/19 FGFR4 Fibroblast growth factor receptor 4 FXR Farnesoid X receptor FXRE Farnesoid X receptor response element GAE Gallic acid equivalents GAPDH Glyceraldehyde-3-phosphate dehydrogenase GCA Glycocholic acid GCDCA Glycochenodeoxycholic acid GR Glucocorticoid receptor GS Ground seeds GSE Grape seed extract GSPE Grape seed procyanidin extract HAT Histone acetyl transferase HDAC Histone deacetylase HDL High density lipoprotein HFD High fat diet HILIC Hydrophilic liquid chromatography HMG-CoA Β-hydroxy-β-methylglutaryl-coa HMGCR 3-Hydroxy-3-Methylglutaryl-coa (Hmg-coa) reductase HMGCS1 3-hydroxy-3-methyl-glutaryl-coa (Hmg-coa) synthase HPLC High-performance liquid chromatography HSD3β 3β-hydroxy-Δ5-C27-steroid oxidoreductase HSP Heat shock protein HUVEC Human umbilical vein epithelial cells IBABP Ileal bile acid binding protein IDL Intermediate density lipoprotein IR Inverted repeat JNK C-Jun N-terminal kinase LBD Ligand binding domain LCA Lithocholic acid LDL Low density lipoprotein LDLR Low density lipoprotein receptor LMW-PCN Low molecular weight procyanidins LRH-1 Liver receptor homologue 1 LXR Liver X receptor

xiv

MDA Malondialdehyde mDP Mean degree of polymerization miRNA MicroRNA MR Mineralocorticoid receptor MTTP Microsomal triglyceride transfer protein MW Molecular weight N-Cor Nuclear receptor corepressor NEFA Non-esterified fatty acid NPC1L1 Niemann-Pick C1-Like 1 (transporter) NR Nuclear receptor NTCP Sodium/taurocholate co-transporting peptide OPC Oligomeric procyanidins OSTα/β Organic solute transporter α/β Ox-LDL Oxidized low density lipoprotein PIC Preinitiation complex PPARγ Peroxisome proliferator-activated receptor γ PON1 Paraoxonase 1 PR Progesterone receptor qPCR Quantitative polymerase chain reaction RAR Retinoic acid receptor RCT Reverse cholesterol transport RXR Retinoid X receptor SCARB1 Scavenger receptor class b, member 1 SCD1 Stearoyl coa desaturase* SE Semillon SHP Small heterodimer partner SLC10A1 Solute carrier family 10, member A1 (synonym for sodium/taurocholate cotransporting peptide) SLC10A2 Solute carrier family 10, member A2 (synonym for apical sodium dependent bile acid transporter) SMRT Silencing mediator for retinoid and thyroid receptor SPE Solid phase extraction SRC-1 Steroid receptor coactivator 1 SREBF-1c Sterol regulatory element binding transcription factor 1c (gene) SREBP-1c Sterol regulatory element binding protein 1c SREBP2 Sterol regulatory element binding protein 2 STZ Streptozotocin T2DM Type 2 diabetes mellitus TBP TATA binding protein TCA Taurocholic acid TCDCA Taurochenodeoxycholic acid TF Transcription factor TG Triglyceride

xv

TICE Transintestinal cholesterol efflux TNF-α Tumor necrosis factor α UNR University of Nevada, Reno VLCS Very long-chain acyl-coa synthetase VLDL Very low density lipoprotein WS Whole seeds

N.B. Human gene names are capitalized and italicized (FXR), while mouse genes have the first letter capitalized and are in italics (Fxr). Proteins follow the same naming conventions, but are not italicized (FXR or Fxr).

1

Chapter 1

Introduction

2

1.1. Grape seed procyanidin extract and health

1.1.1. Human Health Relevance

Cardiovascular disease (CVD) is the leading cause of death both globally and in the United

States [1, 2]. Over 17 million deaths worldwide were attributed to CVD in 2008, with the number expected to rise to 23.6 million by 2030 [1, 2]. There are seven key risk factors for CVD that are measured by the American Heart Association [3]. These include: smoking, physical activity, diet, body weight, serum cholesterol levels, blood pressure, and blood sugar levels [3]. Serum triglyceride (TG) levels have also been associated with increased risk of coronary artery disease (CAD) [4] and remnants of TG rich chylomicrons and lipoproteins have been shown to convert macrophages into foam cells, making them pro-atherogenic [5-7].

Previously, grape seed procyanidins have demonstrated their ability to modulate multiple

CVD risk factors including dyslipidemia, atherosclerosis, blood pressure, and lipogenesis

(see sections 1.1.5.1 – 1.1.5.3). Considering that grape seed procyanidin extracts are a widely available supplement and over 33% of the population uses complementary and alternative medicine (CAM) for medical problems [8], it is critical that we understand the molecular mechanisms by which dietary procyanidins modulate TG and cholesterol homeostasis.

1.1.2. Procyanidins

Procyanidins, the most abundant phytonutrient in the human diet, are found in plant based foods including grapes, blueberries, cocoa, and green tea [9, 10]. These phytonutrients are consumed in amounts ranging from 90 – 300 mg per day [9, 10], with consumption of polyphenols in certain countries, e.g. Finland, reaching just over 860 mg/day [11].

3

Procyanidins belong to the class of secondary plant metabolites known as phenolic compounds [12]. Phenolic compounds are divided into lignans, phenolic acids, stilbenes, tannins and flavonoids based on the number of phenol rings and the structural elements connecting these rings [12]. Flavonoids can be further separated into flavonols, flavones, flavanones, flavonols, anthocyanidins, and isoflavones [13]. Procyanidins are a subgroup of flavonoids comprised of the monomeric subunits of (+)-catechin and/or its stereoisomer

(-)-epicatechin (Figure 1.1), in polymers varying from 2 to 50 subunits [14].

Figure 1.1. Procyanidins are a subgroup of flavonoids. Flavonoids are divided into 6 subclasses based on their structure. Procyanidins which are comprised of catechins, epicatechins, epigallocatechin and epigallocatechin gallate are a sub-class of flavanols.

Procyanidins share a common ring structure consisting of two aromatic rings (A and B) linked by 3 carbons that form an oxygenated heterocyclic (C ring) (Figure 1.2a) [15].

Polymers of various sizes are comprised of (+)-catechin and/or (-)-epicatechin subunits.

These polymers are also referred to as condensed tannins, a name derived from the oxidative condensation that links C4 of the heterocyclic ring and the C6 or C8 carbons of

4

the attached A and B rings [14]. A-type procyanidins are formed by oxidative condensation, as well as ether bonds between C2 and O7 (Figure 1.2b) [14]. B-type procyanidins contain only oxidative linkages, and are the primary form of procyanidins found in foods [14]. Procyanidin B2 (Figure 1.2c) and B5 (Figure 1.2d) demonstrate the linkages between C4 and C6 or C8 respectively.

Figure 1.2. The structure of monomeric and dimeric procyanidins. The structures represented included: (a) (+)-catechin with the aromatic rings (A, B) and heterocyclic ring (C) labeled, (b) procyanidin A2 dimer, (c) procyanidin B2 dimer, and (d) procyanidin B5 dimer.

1.1.3. Grape seed procyanidin extract

Grape seed extracts have been studied since the 1970s, when Jacques Masquelier found that grape seeds were a rich source of procyanidins [16]. The resulting supplement,

5

Flavan™, was promoted as benefitting multiple conditions, including vascular health, liver cirrhosis, and macular degeneration [16].

The grape seed procyanidin extract (GSPE) used in our studies is rich in polyphenolic compounds, particularly procyanidins [17-19]. HPLC analysis shows that GSPE is abundant in low molecular weight procyanidins including: monomers (68.68 ± 0.02%), dimers (26.16 ± 0.01%) and trimers (5.16 ± 0.02%) (Figure 1.3) [20]. Current studies show that this procyanidin-rich grape seed extract functions as an anti-oxidant, as well as modulating metabolic gene expression (see sections 1.1.5.1 – 1.1.5.3).

Figure 1.3. High-performance liquid chromatography (HPLC) chromatograph illustrating the mean degree of polymerization (mDP) of GSPE. GSPE is composed of low molecular weight procyanidins, including monomers, dimers and trimers [20].

1.1.4. Bioavailability

Low molecular weight procyanidins, such as those found in GSPE, enter enterocytes, however, specific transporters for procyanidins have not been described [14]. It is also possible that these compounds are absorbed and enter the serum by passive diffusion,

6

possibly through a transcellular pathway [14], since passage through the lipid bi-layer is inhibited due to the presence of hydrophilic hydroxyl groups [21]. Several factors, including molecular size, the food matrix, and microbiota have been shown to influence absorption

[14, 21, 22].

Extensive in vitro and in vivo research reviewed in [14] has shown that procyanidin oligomers, from monomers to pentamers, can cross lipophilic membranes and enter cells.

Using Caco-2 cells, a human colorectal adenocarcinoma cell line, it was demonstrated that small procyanidins have a permeability coefficient similar to mannitol [21]. Human and rat studies illustrate that (+)-catechin and (-)-epicatechin are absorbed by the proximal intestine with plasma levels peaking 1.4 to 2 hours after consumption, and up to 82% bioavailability of dimeric procyanidins, as estimated by urinary excretion, [23-25].

1.1.5. GSPE alleviates cardiovascular disease risk factors

Numerous animal studies have demonstrated that GSPE decreases risk factors of CVD

(discussed further in sections 1.1.5.1 – 1.1.5.3). Beneficial effects have been observed in multiple areas, including atherosclerotic risk factors, lipogenesis, and serum lipid profiles.

Human studies have demonstrated less consistent results, although this may be due to poorly designed studies, as demonstrated by the lack of randomized controlled trials and relevant end points [26]. A meta-analysis shows that only 9 studies met the criteria of being randomized controlled trials with end points relating to blood pressure, heart rate, cholesterol levels, TGs, or the inflammatory marker C-reactive protein (CRP) [26].

Populations in these studies included healthy males, adults with type 2 diabetes mellitus

(T2DM), adults with metabolic syndrome, smokers, adults with hypertension, and dyslipidemic patients [27-34]. Treatment consistency was lacking, as a wide variety of products were utilized [26], with doses ranging from 150 mg/day to 2000 mg/day [29, 32].

7

Additionally the time of follow up varied from 2 weeks to 24 weeks [26]. This lack of consistency underscores the need for further research to determine molecular mechanisms underlying the physiological actions of GSPE in order to allow for the determination of appropriate test populations, doses, and treatment times in human subjects.

1.1.5.1. The impact of procyandins on atherosclerosis

Procyanidins decrease atherosclerotic risk factors by relieving oxidative stress, increasing anti-atherosclerotic proteins, and reducing inflammation [14, 30, 35-41]. Antioxidant activities of grape seed procyanidins occur by both direct and indirect mechanisms. Direct antioxidant activities occur when the extract quenches free radicals through direct contact, while indirect antioxidant activities are often mediated by increased transcription of antioxidant genes. Red grape seed procyanidins decrease oxidation and protect liposomes by direct antioxidant activity, with polymeric procyanidins up to decamers displaying increasing efficacy [37], while multiple grape seed extracts exhibit protective antioxidant effects via indirect mechanisms [14]. This is evidenced by attenuated levels of oxidized glutathione and decreased activation of antioxidant enzymes including glutathione peroxidase, glutathione reductase, and glutathione S-transferase in the livers of obese Zucker rats treated with GSPE [38].

Procyanidins also protect against atherosclerosis by decreasing the level of oxidized low density lipoprotein (Ox-LDL), a significant contributor to atherosclerosis [42-44]. Ox-LDL is taken up by macrophages, resulting in foam cell formation and the accumulation of cholesteryl esters in arterial walls [42-44]. Plasma from rats and rabbits treated with grape seed extract (GSE) have proved to be resistant to the oxidative formation of cholesteryl ester hydroperoxides by both copper sulfate and 2,2’-azobis(2-amidinopropane)

8

dihydrochloride, demonstrating that GSE or its metabolites can inhibit formation of Ox-

LDL [39, 40]. Both malondialdehyde (MDA), a peroxidation product of omega-6 fatty acids

(FAs) [40], and the number of Ox-LDL positive macrophage derived foam cells were decreased by GSE treatment [41]. Similarly, glutathione, glutathione peroxidase and catalase activity is increased in rabbits fed a diet containing 1% cholesterol, when supplemented with either 0.2% grape seed or grape peel extract, while MDA was decreased [45]. Humans treated for 12 weeks with 400 mg/day of GSE showed a similar decrease in MDA-modified low density lipoprotein (LDL) [30].

GSE at 50 or 100 ug/ml dose-dependently reduces inflammatory cytokines, including nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), cyclooxygenase-2

(COX-2), and tumor necrosis factor-α (TNF- α), in human umbilical vein cells (HUVEC) with tumor necrosis factor α (TNF-α) induced inflammation [35]. Paraoxonase 1 (PON1), an anti-atherosclerotic component of high density lipoprotein (HDL), is also induced in rats by a GSE treatment of 100 mg/kg/day [36]. These data indicate that multiple varieties of grape seed extracts may activate the body’s natural protective mechanisms, defending against atherosclerosis.

1.1.5.2. Effects of grape seed extracts on lipogenesis and diabetes mellitus

Grape seed extract also improves metabolic risk factors for CVD, such as obesity and other metabolic dysregulations, including T2DM. GSPE has been shown to repress the differentiation of adipocytes in 3T3-L1 cells, due to regulation by the nuclear receptor (NR), peroxisome proliferator-activated receptor γ (Pparγ) [46]. In vivo studies using rats fed a high fat diet (HFD) comprised of 20% fat, show that both water and alcohol based grape seed extracts can decrease liver and adipose tissue weight [47]. Serum lipid and glucose profiles were also improved in these animals, with simultaneous decreases in fat

9

deposition in the liver and heart [47]. Control animals in this study were untreated and fed a diet with no fat [47]. A similar effect can be seen in hamsters fed a HFD and treated with

25 mg/kg/day of GSPE for 30 days [48]. In this study the HFD was comprised of 21% fat compared to the 10% fat in the control diet. These animals exhibited reduced fat and weight gain, along with improved plasmid lipid profiles [48]. A similar study found that hamsters fed a HFD containing 44% fat vs. 17% fat in the control diet, exhibited reduced insulinemia, leptinemia, glycemia, and insulin resistance after 12 weeks of simultaneous

GSE treatment [49]. Adiponectin levels, which mediate insulin sensitivity, were also increased in these animals [49]. Beneficial alterations in glucose and lipid metabolism were observed in female Wistar rats with hyperlipidemia induced by a thirty day cafeteria diet followed by a ten day treatment with GSPE [50]. Cafeteria diets allow the animals to choose freely from items intended to be representative of a western diet, including cheese, bacon, and candy, as well as crackers with foie gras, muffins, carrots, and sweetened milk. The authors report the diet as containing approximately 13.6% fat, 21% carbohydrates, 9% protein, 51.3% water, and 5.1% [50, 51]. A longer study reported that female Wistar rats fed a cafeteria diet for 13 weeks with a subsequent 30 day treatment with GSPE, reduced insulin production [51]. Carnitine palmitoyl transferase 1a (Cpt1a), a marker of β-oxidation, was increased, while Srebf1, the master regulator of lipogenesis and its target gene, fatty acid synthase (Fasn), were decreased [51]. In this study decreased 5' AMP-activated protein kinase (AMPK) levels were reversed by the GSPE treatment, indicating a potential mechanism for their mediation of pancreatic β-cell activity

[51].

10

1.1.5.3. Regulation of dyslipidemia

Grape seed extracts have consistently reduced dyslipidemia in a variety of animal models

[17-19, 48, 50-53]. Elevated serum TG levels can be caused by increased synthesis of TG rich lipoproteins, particularly chylomicrons and very low density lipoprotein (VLDL). TG levels can be attenuated by either decreasing synthesis of these lipoproteins, or by increasing their uptake and clearance from the blood. Rats treated with GSPE after fat loading displayed decreased levels of both VLDL and chylomicrons, however, treatment did not appear to effect clearance of serum TGs [54].

When TGs are removed from circulation they may either be stored intracellularly or metabolized. β-oxidation of TGs is initiated by Cpt1a and creates metabolites, such as acetyl-CoA, that may enter the citric acid cycle or be utilized as substrates for creation of other molecules such as cholesterol. Rats exhibiting hyperlipidemia, induced by the cafeteria diet demonstrated increased Cpt1a expression after treatment with GSPE, indicating increased fatty acid β-oxidation [51]. In the same study, GSPE treatment also downregulated expression of the lipogenic genes, Srebf1 and Fasn [51]. Additionally,

GSPE treatment of rats with hyperlipidemia due to streptozotocin (STZ) induced diabetes mellitus (DM), resulted in reduced cholesterol, TG, LDL, and VLDL levels, combined with increased high density lipoprotein (HDL) levels [55].

GSPE regulation of dyslipidemia can also impact hepatic TG levels. Our lab has demonstrated that a 7 day treatment with GSPE is sufficient to ameliorate elevated serum

TG levels, as well as decreasing hepatic lipid levels, in rats with existing fructose induced hypertriglyceridemia (Appendix 1) [20]. This appears to be induced via decreased hepatic lipogenesis combined with increased BA synthesis. Fecal excretion of cholesterol is also increased, potentially due to transintestinal cholesterol efflux (TICE) [20].

11

One potential mechanism for GSPE’s mediation of hepatic lipoprotein synthesis is the 20

– 25 nucleotide long non-coding RNAs known as microRNAs (miRNAs) and their regulation of gene expression [56, 57]. In the liver miR-33 and miR-122 play key regulatory roles in lipid metabolism [58, 59]. MiR-122 post-transcriptionally regulates the expression of genes responsible for TG synthesis, while miR-33 regulates cholesterol homeostasis

[58, 59]. Silencing of miR-122 results in decreased plasma TG and cholesterol levels [59].

Similarly, inhibition of miR-33 leads to increased HDL and decreased VLDL synthesis [58-

63]. It was found that increased hepatic HDL production is mediated through decreased miR-33, while decreased lipogenesis can be induced by decreased miR-122 [56]. In fact, only three weeks of 5, 25, or 50 mg/kg GSPE supplementation in rats on a HFD was sufficient to decrease miR-33 and miR-122 levels, thereby reducing plasma and liver lipids

[57]. Additionally, procyanidin metabolites found in the serum, including gallic acid, procyanidin monomers and dimers, and several glucuronidated, sulfated, and methylated procyanidin metabolites, have the ability to reduce de novo lipid synthesis in HepG2 cells

[64].

1.2. Grape seed procyanidin extract and nuclear receptors

My research is founded on several key observations that GSPE reduces serum TG levels via nuclear receptors (NRs). Initially, it was discovered that an acute dose of GSPE altered plasma lipid levels and lipoprotein metabolism in male Wistar rats [17]. Similar effects were seen in a study utilizing female rats with hyperlipidemia induced by a HFD for 12 weeks.

The animals were then treated with GSPE for 10 days, resulting in normalized TG and

LDL levels, as well as decreased cholesterol and reduced fatty liver symptoms [50, 53].

Decreases in serum TGs, free fatty acids (FFAs), and LDL occurred in conjunction with increased levels of small heterodimer partner (Shp), an atypical NR that represses lipid

12

biosynthesis [17]. Transcription of Shp is increased by activation of the farnesoid X receptor (Fxr), a crucial regulator of metabolic homeostasis. Fxr is activated by BAs and in turn increases expression of Shp. Shp then functions as a transcriptional repressor to impact BA, cholesterol, and TG homeostasis.

1.2.1 Nuclear receptors

Fxr and Shp belong to the superfamily of nuclear receptors (NRs) [65, 66]. NRs receptors are intracellular receptors, as opposed to being membrane bound [66]. Upon activation by lipophilic molecules including steroid and thyroid hormones, retinoic acid, and other endogenous metabolites, they act as transcription factors (TFs), regulating DNA transcription (discussed in sections 1.2.1 through 1.2.2) [66]. The first NR was described in 1958 by Elwood Jensen in his attempts to determine how estrogen affected reproductive tissue [67]. Upon further investigation, it was found that this receptor existed in two states, cytosolic and nuclear [68]. The cytosolic fraction would interact with estrogen and then translocate to the nucleus, leading to the general mechanistic understanding of how NRs function [68-70]. These discoveries led to what is now known as the nuclear receptor field.

It would take another 20 years for molecular biology to advance far enough to allow for cloning and further exploration of NRs. Currently over 70 different NRs have been identified in mammals, birds, and insects [65], with 48, 49, and 47 members in the human, mouse, and rat genomes, respectively [65, 71].

Nuclear receptors regulate the rate of transcription via several mechanisms [67]. Direct stabilization and recruitment of the preinitiation complex (PIC) is one such mechanism

[67]. The PIC consists of RNA polymerase and six transcription factors: TATA binding protein (TBP), general transcription factor (TF) IIA, TFIIB, TFIID, TFIIE, and TFIIH [72].

NRs interact with intracellular components that regulate the PIC [67]. Gene transcription

13

is negatively regulated by unliganded NRs bound to co-repressors, such as nuclear receptor corepressor (N-CoR) or silencing mediator for retinoid and thyroid receptor

(SMRT). These corepressors prevent transcriptional activation by the NR, effectively silencing transcription (Figure 1.4A) [67]. Upon ligand binding, a conformational change in the NR releases the corepressors and recruits coactivators (Figure 1.4B), such as the steroid receptor coactivator (SRC) family, which includes SRC-1, SRC-2 and nuclear coactivator 2 (NCoA-2) [67]. These coactivators stabilize and recruit the PIC [67].

Chromatin remodeling may also be initiated by NRs through recruitment of histone acetyl transferases (HATs) or histone deacetylases (HDACs), making the DNA more or less accessible for transcription, respectively [67].

Figure 1.4. Ligand binding induces conformational changes in nuclear receptors (NR) allowing for gene transcription. NRs are bound to response elements in the DNA by their DNA binding domain (DBD). (A.) Co-repressors including nuclear receptor corepressor (N- CoR), silencing mediator for retinoid and thyroid receptor (SMRT), and histone deacetylases (HDACs), are bound to the NR when no ligand is present at the ligand binding domain (LBD). These co-repressors prevent the PIC from initiating transcription of the target gene. The preinitiation complex (PIC) is comprised of RNA polymerase II (RNA Pol II), the tata binding protein (TBP), and general transcription factors (TF) IIA, TFIIB, TFIID, TFIIE, and TFIIH. (B.) Upon ligand binding a conformational change is induced, releasing the co-repressors and recruiting co-activators. Co- activators include the steroid receptor coactivator (SRC) family, which includes SRC-1, SRC-2 and

14

nuclear coactivator 2 (NCoA-2), as well as histone acetyl transferases (HATs). The recruitment of co-activators allows the PIC to access the DNA and initiate transcription of the target gene.

1.2.2. Structure of nuclear receptors

Most NRs share common structural components, with a few exceptions [66, 73]. The structure of NRs is illustrated in Figure 1.5. Beginning at the N-terminus is the activation function 1 (AF-1) domain which has transactivation activity [66, 73]. This region, which is constitutively active, is also referred to as the A/B, modulator, or hypervariable domain, and contributes to ligand independent activation by the receptor [66, 73]. The AF-1 domain is followed by the DNA binding domain (DBD), or C domain. The DBD is comprised of two zinc fingers and is highly conserved [66, 73]. The initial zinc finger contains an alpha helix known as the proximal, or P-box, region which recognizes the core half-site of the response element in the DNA with a high level of affinity [66, 73]. The second zinc finger contains an alpha helix known as the distal, or D-box, region which is responsible for dimerization and determination of the spacing between half-sites [66, 73]. The DBD is highly conserved between NRs [67]. The sequence homology of the DBD allowed cloning of new receptors by using low-stringency hybridization techniques [67]. The D or hinge domain follows the DBD, and allows for conformational changes upon ligand binding [66,

73]. The hinge domain may also include a nuclear localization signal and is characteristic of NRs [66, 73]. The final region is the ligand binding or E/F domain. While ligand specificity is varied between NRs, this domain has a common structure of 11 – 13 α- helices surrounding a hydrophobic binding pocket. Ligand dependent activation requires the final activation function 2 (AF-2) in this domain. The AF-1 and AF-2 interact with transcriptional components including, but not limited to co-activators and co-repressors.

15

The ligand binding domain also contains sequences responsible for nuclear localization

[66].

16

Figure 1.5. The primary and tertiary structure of nuclear receptors. The majority of nuclear receptors share a domain structure consisting of the AF-1 (transactivation) domain, followed by the DNA binding domain (DBD), a hinge region, and the ligand binding domain (LBD) which contains the AF-2 region. Modified from [73].

1.2.3. Classification of nuclear receptors

Classification of NRs is based on whether they bind to DNA as homodimers, heterodimers, or monomers [65]. The majority of Class I and II NRs bind to DNA at palindromic repeats known as response elements (REs) [66]. Class I encompasses the classical steroid receptors, including the glucocorticoid, mineralocorticoid, progesterone, androgen, and estrogen receptors, which bind as homodimers [66]. Class II and III most frequently bind to DNA as heterodimers, typically with retinoid X receptor (Rxr) as the heterodimeric partner [66, 73]. Class II NRs began as NRs with known ligands that bound to their REs as heterodimers, while Class III were “orphan” receptors without known ligands [66, 73].

As ligands have been determined for former Class III orphans, many of these receptors have been redefined as Class II receptors [66, 73]. Class IV receptors bind to DNA as monomers, and are orphan receptors without known ligands [66]. In 1999, a second classification system, based on functions and ligands of the NRs was introduced [74]. This

17

nomenclature system divides NRs into seven subfamilies (0-6) based on the DBD and then into groups (A-K) based on the LBD [74].

1.2.3.1. Class I nuclear receptors

Class I (steroid receptors) includes receptors that bind to hormones with a high level of affinity, and include the glucocorticoid, mineralocorticoid, progesterone, androgen, and estrogen receptors [66, 73]. These NRs are generally found in the cytosol of the cell bound to heat shock proteins (HSPs), but unattached to a ligand [66, 73]. The LBD of these NRs plays several roles, including facilitating the NR-HSP complex, which allows for correct protein conformation and prevents translocation to the nucleus when ligands are not present [66, 73]. Upon ligand binding, a conformational change is induced and the NR dissociates from the HSP, forms a homodimer with another receptor, and translocates to the nucleus (Figure 1.6a) [66, 73]. Once in the nucleus the homodimer can bind to the response element (RE) of a target gene and activate transcription via interaction with coactivators and recruitment of the PIC [66, 67, 73].

18

Figure 1.6. Mechanism of action of nuclear receptors by class. (a.) Upon ligand binding Class I or steroid receptors disassociate from heat shock proteins in the cytosol and translocate to the nucleus. (b). Class II nuclear receptors are found in the nucleus constitutively bound to the DNA with their RXR partner. Ligand binding induces conformational changes and transactivation. (c.) Class III or “orphan” receptors may bind to DNA as monomers, homodimers, or heterodimers. Their activity can be constitutive or be regulated by post-translational modifications such as phosphorylation. Reproduced from [73].

1.2.4. Class II nuclear receptors

Class II receptors are also referred to as the endocrine receptors [66, 75]. Class II receptors encompass the thyroid hormone receptor (TR) and the retinoic acid receptor

(RAR) from which the classification was derived, as well the “adopted” or former orphan receptors including Fxr, the liver X receptors (Lxrs), and peroxisome proliferator-activated receptors (Ppars) [76]. These NRs are found in the nucleus as a heterodimer pair with the retinoid X receptor (Rxr), constitutively bound to DNA, where they are transcriptionally inactive due to associations with HDACs and co-repressors [73]. Upon binding to a ligand, the NR is activated, undergoing a conformational change and releasing co-repressors, while recruiting co-activators (Figure 1.6b) [67]. This change can trigger chromatin reorganization by histone acetylation and methylation allowing for the activation of target genes [67].

19

1.2.4.1. Farnesoid X receptor

The farnesoid X receptor (Fxr) is the class II NR most widely recognized for regulating BA synthesis and recirculation [77]. Fxr was originally cloned from mouse liver in a hybridization assay [78]. Without a known ligand it was considered an “orphan” receptor, however, subsequent studies found that the rat homolog was activated by farnesol, giving the receptor its name [79]. BAs were eventually shown to be the endogenous ligands for

Fxr, regulating their own synthesis via feed-back mechanisms involving Fxr [80-82]. Fxr is activated by the binding of BAs, with the potency of bile acids to activate Fxr as follows: chenodeoxycholic acid (CDCA) > deoxycholic acid (DCA) > lithocholic acid (LCA) > cholic acid (CA) [82]. The affinity of the LBD of Fxr for BAs is directly impacted by the hydrophobic face of the particular BA. BAs appear to bind in the ligand binding pocket with their steroid nucleus positioned in the opposite orientation compared to the binding seen with other NRs [83]. It appears that the concave shape created by the hydrophilic and hydrophobic sides of the BAs allows for an ideal fit [83]. This combined with the amphipathic qualities of BAs creates their specificity for Fxr [83]. In spite of this specificity, there is space left in the Fxr binding pocket that is not completely filled by BAs [83]. This is a potential site of interaction for co-agonist ligands [83]. Other ligands for Fxr include androsterone, as well as the synthetic ligands GW4064 and fexaramine [84-86]. Several plant sterols, such as stigmasterol and guggelsterone, have also been found to function as antagonists for Fxr [87, 88].

Fxr functions as a heterodimer with Rxr, binding to Fxr response elements (FXREs) consisting of an inverted repeat (IR) of 6 nucleotides separated by one nucleotide (IR-1), particularly the sequence 5’-AGGTCAnTGACCT-3’. This heteromeric pair may also bind to IR-0, IR-8, everted repeats (ER) separated by 8 nucleotides (ER-8), direct repeats (DR)

20

separated by 1 or 4 nucleotides (DR-1 and DR-4, respectively) [89]. Tissue specific Fxr regulation is highly probable, considering that Chip-seq analysis has shown that only 11% of FXRE sites are shared between the liver and the intestine [90]. Fxr can also bind to a negative FXRE as a monomer, such as in the case of apoliprotein A1 (ApoA1), a major constituent of HDL, resulting in direct repression of transcription [91, 92].

Fxr is expressed in the liver, intestine, gall bladder, kidney, and adrenal glands [79, 93,

94]. Whole body Fxr-/- mice have been generated and confirm that Fxr is the primary regulator of BA homeostasis (Sections 1.3.1 – 1.4.2). When fed a diet supplemented with cholic acid (CA), these animals display increased serum levels of BAs, cholesterol and

TGs, consequential to the lack of Fxr regulation on BA recirculation and synthesis [94]. In order to determine tissue specific effects of Fxr, both liver and intestine specific Fxr-/- mice have been generated [95]. Both the liver and intestine specific knock-out animals have elevated serum BA levels. Tissue specific effects on BA regulation appear to be additive as neither knock-out reaches the same level of serum BA concentrations as the whole body knock-out [95]. Intestinal Fxr is necessary for regulation of ileal bile acid binding protein (Ibabp), which transports BAs across the enterocyte. Intestinal Fxr is also necessary for expression of fibroblast growth factor 15 (Fgf15), which is required for repression of cholesterol 7α-hydroxylase (encoded by Cyp7a1) in the liver (Section 1.3.1).

Hepatic Fxr is responsible for regulating 12α-hydroxylase, (encoded by Cyp8b1) which dictates the BA pool composition (Section 1.3.1). Additionally, hepatic Fxr regulates export of BAs to the gall bladder via the bile salt export pump (Bsep). In addition to BA recirculation and synthesis, hepatic Fxr controls TG and glucose homeostasis via induction of small heterodimer partner (Shp) expression (Section 1.2.4.1).

21

1.2.5. Class III nuclear receptors

Class III NRs have been identified as part of the NR superfamily by structural similarities, but have no identified ligands to date. They are commonly referred to as “orphan” receptors [66, 73]. Class III receptors can bind to REs in the DNA as a monomers, homodimers, or heterodimers [73, 96]. These receptors may also function without a ligand

[67, 97]. One example of this is Nurr1, an “orphan” NR which is essential for development of dopaminergic neurons in the midbrain [96]. Nurr1 binds to DNA as a constitutively active monomer, as well as regulating transcription as a heterodimer with RXR [96]. Activity of

Class III receptors may also be regulated through post-translational modification such as phosphorylation or sumoylation (Figure 1.6c) [73].

1.2.5.1. Small heterodimer partner

Small heterodimer partner (Shp) is an atypical Class III receptor that plays an important role in BA synthesis. Shp was cloned from a hepatic cDNA library using degenerate oligonucleotide probes in 1996, along with a number of other NRs, including the androgen receptor, retinoic acid receptor, and thyroid receptor [98]. Shp differs from other NRs in both its structure and function, in that it is missing the typically conserved DBD of NRs.

Functionally it binds to the AF-2 domain of other NRs to repress gene transcription [98].

Binding appears to be mediated by 2 LxxLL related motifs in this region [99]. Expression of Shp is mediated by multiple NRs, including Fxr, liver homologue receptor 1 (Lrh-1), and liver X receptor (Lxr) [100-102]. Shp displays an auto-regulatory feedback loop in which activation by Fxr increases levels of Shp protein, which then bind to LRH-1, forming a repressive complex at the Shp promoter [103]. Thus Shp has the ability to regulate expression of both other genes and itself [103]. Fxr activation of Shp has been shown to

22

decrease the expression of Srebp-1c [104]. Shp also impacts other metabolic genes, particularly those involved in gluconeogenesis [105].

Hepatic activation of Fxr by BAs negatively regulates TG synthesis via Shp-mediated repression of sterol regulatory element binding factor 1c (Srebf1c) (Figure 1.7A), [104].

Srebp1c is the transcription factor (TF) known as the master regulator of lipogenesis. This

TF activates lipogenic genes including Fasn, acetyl coA carboxylase 1 (Acc1), and stearoyl coA desaturase (Scd1), subsequently increasing TG synthesis [106-109].

These findings led to further studies utilizing GSPE treatment both in vitro using HepG2 cells, a human hepatocellular carcinoma line, and in vivo using C57BL/6 wild type and

Shp-/- mice [18]. GSPE was found to act via Shp-mediated down-regulation of Srebf-1c

(Figure 1.7B), while simultaneously upregulating Cpt1a and apolipoprotein A5 (ApoA5), which are responsible for β-oxidation and serum TG clearance respectively. Cpt-1a initiates β-oxidation catalyzing the transfer of the fatty acyl group onto carnitine, allowing for transport into the mitochondria for β-oxidation [110]. ApoA5 increases TG clearance by targeting VLDL to cell surface proteoglycans that are associated with lipoprotein lipase

[111]. The overall effect of these gene expression changes results in significantly decreased serum TG levels, with the effects being lost in Shp-/- mice [18]. The regulatory effects on Shp were proven to be mediated via GSPE acting as a co-agonist ligand for

Fxr, thereby increasing the activity of this NR, resulting in increased expression of Shp

(Figure 1.7B), [19]. It was later found that Shp mRNA was stabilized at the transcriptional and post-transcriptional levels by another grape seed procyanidin extract, enhancing the effects of the transient increase caused by this extract [112]. The elevated levels of Shp resulted in increased repression of Srebf-1c, and partially explained the mechanism behind the decrease in serum TG levels [19].

23

A. B.

Figure 1.7. Farnesoid X receptor activation increases the expression of small heterodimer partner to reduce serum triglycerides. A. Bile acids bind to farnesoid X receptor (Fxr) to increase expression of small heterodimer partner (Shp). This represses sterol regulatory element binding protein 1c (SREBP1c), which reduces synthesis of triglycerides (TGs). B. GSPE acts as a co-agonist ligand for Fxr, resulting in decreased serum TG levels.

Interestingly, studies performed in male Wistar rats found that Cyp7a1, the gene encoding the rate-limiting enzyme for BA synthesis, was increased [18]. This finding was puzzling, since Cyp7a1 is also a Shp target gene and would be expected to be reduced following

Fxr activation. These results were corroborated when elevated levels of both Cyp7a1 mRNA and protein were seen in Golden Syrian hamsters treated with a grape seed extract

24

[52]. The combination of these findings provided the first clue that BA synthesis may be involved in GSPE’s ability to regulate lipid homeostasis.

1.3. Bile acid synthesis

As previously mentioned, Fxr regulates BA homeostasis, which in turn can regulate cholesterol and TG homeostasis. Communication along the gut-liver axis is critical to this process. Bile acids (BAs) are amphipathic molecules most widely known for their ability to assist in the absorption of lipids, fat soluble vitamins, and cholesterol [110]. Recently

BAs have been acknowledged as having endocrine properties, including regulating their own recirculation and synthesis, as well as mediating TG and cholesterol transport and synthesis [77].

BAs are comprised of a sterol nucleus derived from cholesterol attached to an aliphatic side chain [113] via a metabolic process exclusive to the liver [114]. The sterol backbone yields an α (hydrophilic) face and a β (hydrophobic) face giving BAs their amphipathic properties [115]. After synthesis, the majority of the primary BAs, cholic acid (CA) and chenodeoxycholic acid (CDCA), are conjugated to glycine or taurine before being released into the gall bladder. Microbiota in the intestinal lumen convert the remaining primary BAs into the secondary BAs, deoxycholic acid (DCA) and lithocholic acid (LCA), respectively

[114]. Ninety-eight percent of these secondary BAs are conjugated to an ionized acidic group of glycine and taurine upon return to the liver, before being re-secreted into the gall bladder, yielding a total of eight different conjugated BAs (Figure 1.8) [114, 116].

25

e upone

rimary bile

The primary bile acids, cholic acid and chenodeoxycholic and acid cholic acids, bile primary The

Primary and secondary bile acids and their conjugates. their and acids bile secondary and Primary

. .

1.8

yields the secondaryThesetheconjugatedglycineareacids taurin or deoxycholic acids, bile andbile yields acid. lithocholic acid to

Figure Figure acid acid are conjugated to glycine or taurine in the liver, before being released into acids, the gall bladder. Dehydroxylation of the p recirculation the to liver.

26

Synthesis of BAs is recognized as the primary means of cholesterol catabolism and excretion in mammals [77], wherein cholesterol is converted from an insoluble, hydrophobic molecule into a water soluble molecule with detergent properties [110].

Approximately 90% of active cholesterol metabolism in the body is accounted for by the creation of BAs [114]. Five hundred mg of cholesterol is utilized by the liver for BA synthesis on a daily basis [114]. This conversion of cholesterol into BAs is balanced their facilitation of absorption of dietary cholesterol and lipids [117]. Bile acid synthesis is comprised of four basic steps which include: initiation, sterol ring modification, side chain shortening, and conjugation (Figure 1.9) [110, 118]. To synthesize all 12 BAs (primary, secondary, and conjugates) requires 17 total enzymes [114]. This process is tightly regulated by both feedback and feed forward regulatory loops, governed by Fxr and LXR respectively [114].

27

ation ation

.

Thisprocess comprised is of four steps including: initi

. Bile acids are synthesized from cholesterol. cholesterol. from synthesized are acids Bile .

1.9

hydroxylation,sterol ring modification, side chain shortening, and conjugation

- Figure 7α or

28

1.3.1. Classical bile acid synthesis

Classical, or neutral, BA synthesis is initiated by cholesterol 7α-hydroxylase, the rate- limiting enzyme in this pathway. This enzyme is encoded by the Cyp7a1 gene, which is exclusively expressed in the liver [119-121]. Deficiency in cholesterol 7α-hydroxylase results in a 200% increase in cholesterol synthesis, largely due to the 75% decrease in the BA pool and the consequential inability to absorb dietary cholesterol [122].

Fxr-mediated communication between the intestine and liver is thought to be the primary means of down-regulating BA synthesis; indeed, Fxr-/- mice have been shown to have significantly increased levels of BAs due to the lack of negative feedback regulation on

Cyp7a1 [103]. Cyp7a1 is subject to indirect regulation via Fxr, wherein an abundance of

BAs in the intestine will increase expression of the Fxr target gene fibroblast growth factor

15 (Fgf15 or Fgf19 in the human). Intestinal Fgf15/19 is a negative feedback regulator of

Cyp7a1 which is secreted into portal circulation as a hormone, subsequently activating the

FGF receptor-4 (Fgfr4)/β-klotho complex on the surface of the hepatocytes and down- regulating Cyp7a1 expression via c-Jun N-terminal kinase (Jnk) signaling [123-128]. An influx of BAs into the liver will bind to and activate hepatic Fxr, repressing Cyp7a1 expression via elevated levels of Shp [103]. Positive regulators of Cyp7a1 include Lxr and

LRH-1, in rodents and humans respectively. Lxr is activated by increased sterol levels

[129-131], while LRH-1 is competitively regulated by peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α) and SHP [103, 132]

After 7α-hydroxylation, the ring structure of the molecule is modified [77, 114]. During this process sterol 12α-hydroxylase (encoded by Cyp8b1), dictates the composition of the BA pool, since it is necessary for the synthesis of CA [133]. Without the action of sterol 12α- hydroxylase, CDCA will be the end product. Cyp8b1 is regulated by the hepatic Fxr-Shp

29

mechanism described previously in regards to Cyp7a1 [103]. Sterol 27-hydroxylase

(encoded by Cyp27a1) subsequently oxidizes and shortens the side chain [134-136], with the product of this reaction being activated through conjugation to coenzyme A by very long-chain acyl-CoA synthetase (VLCS) or bile acyl-CoA synthetase (Bacs) [137]. After side chain shortening is completed the choloyl or chenodeoxycholoyl-CoA can be conjugated to glycine or taurine [114]. Conjugation of BAs improves their amphipathic nature, as well as making them unable to cross cell membranes, preventing unintended and damaging absorption into cells and tissues [114]. Conjugation of CA results in glycocholic acid (GCA) and taurocholic acid (TCA), while taurochenodeoxycholic acid

(TCDCA) and glycochenodeoxycholic (GCDCA) are the conjugates of CDCA. After amidation the BAs exit the peroxisome and are transported to the gall bladder [137].

1.3.2. Alternative bile acid synthesis

The alternative, or acidic, pathway utilizes oxysterols, rather than cholesterol as substrates

[137]. Oxysterols are cholesterol derivatives generated by hydroxylation of the side chain at the 27 position by sterol 27-hydroxylase [138]. Oxysterols produced by sterol 27- hydroxylase account for approximately 25% of the BA pool in mice [122, 139], and 5-10% in humans [140]. Since sterol 27-hydroxylase is required to initiate side chain oxidation in both the classical and the alternative BA pathways, loss of this enzyme dramatically disrupts BA synthesis, resulting in impaired cholesterol absorption with consequential increases in cholesterol synthesis [141] .

The oxysterol 7α-hydroxylase, encoded by Cyp7b1, then catalyzes the 7α-hydroxylation of oxysterols that must occur for them to be converted to BAs. Oxysterol 7α-hydroxylase shares 40% protein homology with cholesterol 7α-hydroxylase and has been shown to convert 25 and 27-hydroxycholesterol to intermediates in the BA synthesis pathway [142,

30

143]. Thus oxysterol 7α-hydroxylase is the initiating step for converting oxysterols to BAs

5 [77, 114]. The product of this reaction is oxidized by 3β-hydroxy-Δ -C27-steroid oxidoreductase (HSD3β), activated by VLCS, and then enters the peroxisome for side chain shortening, resulting in chenodeoxycholoyl-CoA [114]. The final conjugated BAs generated by this process are TCDCA and GCDCA [114].

1.4. Enterohepatic recirculation

After synthesis BAs are stored in the gall bladder as a component of bile, which is released postprandially to aid in digestion with subsequent absorption and return to the liver via portal circulation [117]. The steady state pool of BAs undergoes enterohepatic recirculation six to eight times daily [144], with 95% of the BAs being reabsorbed [144] and only 5% being excreted in the feces as acidic steroids [145-147]. Besides assisting in absorption of dietary cholesterol, de novo synthesis of bile acids accounts for catabolism of approximately 0.4 mg/day of cholesterol [148], making enterohepatic recirculation and

BA synthesis important regulatory points in maintaining cholesterol homeostasis.

Enterohepatic recirculation is driven by both mechanical and chemical pumps [117]. The mechanical pumps consist primarily of the release of bile acids from the gall bladder and intestinal peristalsis, while the chemical pumps rapidly remove BAs from the intestinal lumen and return it to the liver [117]. BAs are absorbed passively throughout the majority of the small intestine, but are actively transported into and across the ileal enterocyte, where they are released into portal circulation [147]. Fxr and Shp play an important role in regulating multiple steps in the process of enterohepatic recirculation (Sections 1.3.1 –

1.3.2), with an overview presented in Figure 1.10.

31

Figure 1.10. Enterohepatic recirculation of bile acids. After post-prandial release from the gall bladder, bile acids are actively transported into enterocytes in the distal small intestine by the apical sodium dependent bile acid transporter (Asbt). The ileal bile acid binding protein (Ibabp) transports the bile acids to the basolateral membrane where they are returned to portal circulation by the organic solute transporters α and β (Ostα/β). BAs re-enter the liver via the sodium/taurocholate co-transporting peptide (Ntcp) and are returned to the gall bladder by the bile salt export pump (Bsep). Intestinal and hepatic farnesoid X receptor (Fxr) regulate the expression of bile acid transporters. Intestinal Fxr also increases expression of fibroblast growth factor (Fgf) 15/19, which represses expression of cholesterol 7α-hydroxylase (Cyp7a1) in the liver via the Fgf

32

receptor 4 (Fgfr4)/β-klotho complex, while hepatic activation of Fxr induces small heterodimer partner (Shp), consequently repressing expression of Cyp7a1. 1.4.1. Bile acid transport in the small intestine

In the ileum, BAs are actively and efficiently transported across the brush border membrane through the apical sodium dependent bile acid transporter (Asbt) [149]. Asbt, a member of the solute carrier family (SLC10A2) allows for basaloteral uptake of BAs into the enterocyte via a Na+ gradient and negative intracellular potential [150, 151]. BA activation of Fxr represses Asbt expression, and thereby BA absorption, in a species specific manner [152]. In mouse, Asbt is repressed by Fxr-induced increase in Shp, which inactivates Lrh-1, while in humans FXR activation represses ASBT transcription via modulation of RAR activity [152].

Inside the enterocyte BAs are transported to the basolateral membrane by the ileal bile acid binding protein (Ibabp) [153]. Ibabp is a 14-15 kDa cytosolic binding protein that binds exclusively to BAs [154-157]. Ibabp is thought to mediate the transcellular traffic of BAs

[158, 159], as well as functionally associating with and potentiating the activation of FXR

[160, 161]. The activation of FXR by BAs also causes the FXR/RXRα heterodimer pair to increase expression of IBABP [162].

Diffusion of BAs across the basolateral membrane of the enterocyte and into portal circulation requires co-expression of the organic solute transporter (OST) α, a 340 amino acid protein with seven transmembrane domains, and OSTβ which is comprised of 128 amino acids with a singular transmembrane domain [163]. In agreement with their transport of bile acids, it has been found that OSTα/β is positively regulated through a feed forward induction of expression initiated by activation of Fxr due to an FXRE in their promoter regions [164, 165]. A response element for the nuclear receptor, Lrh-1 indicates

33

that expression may be negatively regulated, allowing for fine tuning of expression levels

[164].

1.4.2. Hepatic bile acid transport

Bile acids must be transported against a concentration gradient from the portal blood into the hepatocytes [166]. The basolateral or sinusoidal membrane of the parenchymal liver cells interfaces with the space of Disse, which has large fenestrae allowing for delivery of albumin bound BAs [167]. After being released from albumin, uptake of BAs is mediated by an active transport process [147]. Uptake is primarily driven by the Fxr target gene,

Na+-dependent taurocholate cotransporting polypeptide (Ntcp), which is responsible for uptake of glycine and taurine conjugated BAs into the hepatocyte [168, 169]. This transporter is a glycoprotein comprised of 349-363 amino acids [170, 171], which is highly expressed on the sinusoidal membrane [147]. As a member of the solute carrier family

(SLC10A1), Ntcp is related to the intestinal Asbt transporter, and moves one molecule of solute for every two Na+ ions [172].

Secretion of BAs into the canaliculi is the rate limiting step in the transport of BAs from the liver to the gall bladder [173]. The bile salt export pump (Bsep) or ATP-binding cassette

B11 (Abcb11) is a 160 kDa protein, belonging to the B-family of the super family of ATP- binding cassette transporters [174]. Bsep has a high affinity for transport of both conjugated and unconjugated BAs, and is the primary generator of canalicular secretion of BAs [174]. BA activation of Fxr positively regulates transcription of Bsep [175, 176].

After return to the gall bladder BAs are ready to begin the process of enterohepatic recirculation again.

34

1.5. Cholesterol and triglyceride synthesis and transport

BAs that are not recovered via enterohepatic recirculation must be replenished via de novo synthesis. Therefore, elevated BA excretion can lower intracellular cholesterol pools, resulting in an increased need for cholesterol synthesis. Cholesterogenesis can in turn decrease serum TGs, as β-oxidation of TGs provides acetyl-CoA, a necessary substrate for the synthesis of cholesterol. Cholesterogenesis occurs in four main stages: synthesis of mevalonate from acetate, conversion of mevalonate to activated isoprenes, condensation of isoprenes to form squalene, and conversion of squalene to a four ring steroid nucleus (Figure 1.11) [110, 118].

1.5.1. Cholesterol synthesis

Acetyl-CoA can be generated from either glucose metabolism or fatty acid β-oxidation

[177]. Two acetyl-CoA molecules are condensed by thiolase to form acetoacetyl-CoA

[110, 118]. HMG-CoA synthase then catalyzes the condensation of acetoacetyl-CoA with a third molecule of acetyl-CoA, yielding β-hydroxy-β-methylglutaryl-CoA (HMG-CoA).

HMG-CoA is reduced to mevalonate by HMG-CoA reductase (HMGCR) [110, 118]. This reaction is irreversible, as well as being the rate limiting and committed step in cholesterol synthesis [178].

35

thispathway.

in

Subsequentlymevalonate is convertedto

CoAgenerated from glucose or either acid fatty

-

Acetyl

CoA.

-

CoAreductase the is rate limitingstep

-

. * * . HMG

ol

. Synthesis of cholesterol from acetyl from of cholesterol . Synthesis

1.11

Figure metabolismconverted is to mevalonatethrough series a of reactions. enzymatic squalene,lanosterol, finally cholester and

36

HMGCR transcription and activity are highly regulated by the TF sterol regulatory element binding protein 2 (SREBP-2) [179]. Proteolytic cleavage of SREBF-2 is repressed by cholesterol and oxysterols preventing activation, while a decrease in sterol levels allows for activity. Active SREBP-2 increases transcription of genes in the cholesterol synthesis pathway [179]. HMGCR activation is down-regulated through phosphorylation by AMPK

[180], while oxysterols increase ubiquitination of HMGCR and inhibit SREBP activation

[181].

The mevalonate produced by HMGCR is converted to activated isoprenes, which are condensed to form squalene, the 4 ring steroid nucleus of cholesterol [110, 118]. In animals, squalene is converted to lanosterol, and finally cholesterol. After hepatic synthesis. the cholesterol that is not used to synthesize BAs is either exported as biliary cholesterol or esterified by acyl-CoA:cholesterol acytransferase 2 (ACAT2) and incorporated into lipoproteins for export to peripheral tissues [182, 183].

1.5.2. Hepatic export of cholesterol and triglycerides

Cholesterol and TGs not utilized in the liver must be exported to peripheral tissues via synthesis and secretion of very low density lipoprotein (VLDL) particles [184]. Microsomal triglyceride transfer protein (MTTP) is essential in this process, since it helps to transfer polar and neutral lipids to the VLDL particle (Figure 1.12) [185]. After being released into circulation for delivery to peripheral tissues, TGs are removed from the VLDL particle, resulting in the formation of intermediate density lipoproteins (IDLs) [185]. These particles are enriched in cholesterol and are considered to be pro-atherogenic [184]. With further distribution of TGs, LDL particles are formed, with small dense LDL particles being considered pro-atherogenic [184]. Small dense LDL is associated with hypertriglyceridemia [184].

37

Figure 1.12. Microsomal triglyceride transfer protein is required to lipidate very low density lipoproteins. Acyl-CoA:cholesterol acytransferase 2 (ACAT2) esterifies cholesterol that is also added to the very low density lipoprotein (VLDL). After lipidation the VLDL is transported to the Golgi and is then released into circulation. Figure reproduced with modifications from [185].

1.5.3. Intestinal transport of triglycerides and cholesterol

The intestine is also an important regulatory point for absorption, excretion, and de novo synthesis of cholesterol and triglycerides (Figure 1.13) [185, 186]. Intestinal cholesterol synthesis occurs in the same manner as hepatic steroidogenesis and accounts for a substantial portion of newly synthesized cholesterol in the body [187]. The Niemann-Pick

C1-Like 1 (Npc1l1) transporter has been identified as a transporter for cholesterol uptake

[188]. Npc1l1 was identified as a target affected by ezetimibe, a pharmaceutical which decreases cholesterol absorption [189, 190]. This transporter has a cysteine rich globular

N-terminus, which is presumed to respond to both cholesterol and phytosterols [191, 192].

Upon binding to cholesterol, Npc1l1 delivers sterols to the endoplasmic reticulum for esterification by Acat2, which preferentially utilizes cholesterol as a substrate [183].

38

Intestinal lipid transport from both the basolateral and the apical side of the enterocyte is also mediated by the scavenger receptor class b, member 1 (Scarb1), which is upregulated in response to fat and insulin [193]. Cholesterol esters are incorporated into lipid droplets and then chylomicrons for export from the enterocyte. Remaining phytosterols and cholesterol sterols are returned to the membrane for export via the heterodimeric efflux pump ATP-binding cassette (ABC) G5/8 [194]. Phytosterols and stanol esters have been found to increase expression of Abcg5/8 in mice, thereby increasing cholesterol efflux from enterocytes [194]. This may be a species specific effect since the opposite effect is seen in hamsters treated with stanol esters [195, 196].

Hydrolyzed TGs in the lumen of the small intestine combine with BAs to form micelles which enter the enterocyte [110] where they are reassembled and incorporated into chylomicrons [186]. Scarb1 also appears to play a role in the synthesis of chylomicrons

[193]. After synthesis, chylomicrons are transported in a vectorial manner to the basolateral membrane where they are excreted into the lymphatic system [197, 198].

39

Figure 1.13. Transport of dietary lipids through the enterocyte. After hydrolysis of triglycerides, dietary lipids and cholesterol enter the enterocyte via micelles and the Niemann-Pick C1-like (NPC1L1) or scavenger receptor b1 (SCARB1) transporters, respectively. Cholesterol is esterified by Acetyl-CoA Acetyltransferase 2 (ACAT2) and fatty acids are conjugated to Acyl-CoA. Lipid droplets are formed and then incorporated into chylomicrons for export into the lymphatic system. Basolateral SCARB1 also transports cholesterol from high density lipoprotein (HDL) into the enterocyte. Reproduced with modifications from [185].

40

1.5.4. Excretion of cholesterol

Reverse cholesterol transport (RCT) is the pathway by which HDL returns cholesterol derived from arterial walls and peripheral tissues to the liver to be eliminated by biliary excretion [199, 200], accounting for about 800 – 1,300 mg of cholesterol/day in humans

[201, 202]. Transintestinal cholesterol efflux (TICE) removes cholesterol from circulation, into and across the enterocyte, where it is released into the lumen of the small intestine, and then excreted in the feces [203]. TICE is estimated to be responsible for up to 30% of fecal cholesterol excretion, potentially accounting for 350 mg/day [204]. Decreased reabsorption of BAs increases the rate of TICE, with elevated levels of BAs in the intestinal lumen acting as cholesterol acceptors [203]. Additionally, Fxr regulates both hepatic and intestinal genes involved in this process, including Abcg5/8, Scarb1, and Mttp [205]. Since

GSPE is known to be a co-agonist ligand for Fxr [19], it is possible that GSPE may stimulate TICE.

1.6. Summary

In summary, GSPE has been demonstrated to be a co-agonist ligand for Fxr, thereby increasing Shp mediated repression of Srebf-1 [18, 19]. This results in a significant decrease in serum TG levels [18, 19]. Previous in vitro studies in our lab demonstrated that GSPE regulates human intestinal FXR targets, including ASBT, IBABP, OSTα/β, and

FGF19, in a gene selective manner, which will be discussed further in Chapter 2. GSPE is also known to increase the expression of Cyp7a1, likely enhancing BA synthesis and excretion [17, 52]. Cholesterol, which can be derived from catabolism of TGs, provides the necessary substrate for synthesis of BAs [177].

41

The main hypothesis of this dissertation is that grape seed procyanidins alter bile acid recirculation and synthesis via gene selective modulation of intestinal Fxr target genes, consequentially altering cholesterol and triglyceride homeostasis.

Aim 1: Determine the effects of GSPE on the regulation of intestinal Fxr target genes.

Chapter 2 focuses on elucidating the mechanisms by which GSPE alters the expression of genes associated with BA absorption, transport, and synthesis. These studies were designed to provide insight into the mechanisms by which this compound exerts its hypotriglyceridemic and hypocholesterolemic effects. The NR, Fxr, mediates signaling along the gut-liver communication axis in order to regulate BA recirculation and synthesis.

This regulation in turn affects cholesterol and TG homeostasis. We hypothesized that intestinal modulation of BA recirculation may explain the increased expression in Cyp7a1, as well as providing a potential mechanism for the observed hypotriglyceridemic effects.

As described above, Fxr is the primary BA responsive NR in the intestine, therefore we speculated that these effects may be Fxr-dependent. The experiments presented herein expand upon the existing knowledge regarding GSPE’s therapeutic effects by describing its actions in a systemic setting.

The initial in vitro studies for this project were completed in Caco-2 cells by Gianella

Caiozzi, a Master’s student in Dr. Ricketts’ lab [206]. Her findings illustrate that intestinal bile acid transporter expression was altered by GSPE in vitro. The studies detailed in this dissertation utilize C57BL/6 and Fxr-/- mice to assess Fxr target gene expression and physiological changes after a 14 hour dose of GSPE, in order to determine the critical role of Fxr in these observations.

42

Aim 2: Determine whether GSPE functions in the same manner as a bile acid binding resin, and assess the effects of co-administration with CHY and GSPE on genes regulating BA, TG, and cholesterol homeostasis.

Chapter 3 assesses the differences in gene expression between animals treated with

GSPE, cholestyramine (CHY), or a combination of CHY+GSPE. The findings in Chapter

2 illustrate that GSPE functions as a gene selective BA receptor modulator (BARM). This, in combination with the findings that GSPE increases TICE in hypertriglyceridemic rats

[20], led us to question if GSPE functioned by the same mechanisms as a BA sequestrant.

We also explored mechanisms by which GSPE could regulate BA acid synthesis through the classical and the alternative pathways in further detail. Tissue specific effects such as those exerted by hepatic and intestinal Fxr can regulate Cyp7a1 and Cyp8b1, which are responsible for BA synthesis and BA pool composition respectively. Having seen gene selective effects in the Chapter 2, we explored the possibility that GSPE could differentially alter the expression of genes responsible for BA synthesis.

Additionally, we considered that increased levels of intracellular BAs in enterocytes have been linked to decreased synthesis of cholesterol by these cells [207]. Therefore we wished to determine whether a GSPE-induced decrease in BA recirculation could alter the expression of genes regulating cholesterol synthesis and transport in the intestine. We also sought to determine the combinatorial effects of CHY+GSPE in the liver. Due to the decreased TG levels previously observed with GSPE treatment, we hypothesized that there may be beneficial effects when CHY and GSPE are used in combination.

These experiments examine alterations in expression of genes regulating bile acid, cholesterol, and TG synthesis and transport both in the intestine and in the liver.

43

Aim 3: Evaluate the composition, yield, and anti-oxidant properties of procyanidins resulting from different extraction techniques in order to identify a time and cost effective extraction method for low molecular weight procyandins.

The goal of the studies in Chapter 4 is to efficiently isolate the low molecular weight procyanidins (LMW-PCNs), which have been previously demonstrated to be more bioavailable [21, 23, 24], and which may prove to be an effective supplement. The beneficial metabolic alterations seen in Chapters 2 and 3 led us to a collaboration with Dr.

Grant Cramer’s lab. The Cramer lab studies how gene expression in grapes impacts stress tolerance and wine characteristics, both of which can be altered by procyanidins

[208].

Grape seeds and pomace, generated from the wine-making process, are potentially rich sources of procyanidins, with grape seeds containing 4-6% phenolic content [209].

Extraction methods vary widely and the extensive variety of solvents and techniques used for the extraction of procyanidins from grape seeds are reviewed in [210, 211]. Solvents are particularly important in determining the type, solubility, and polymerization of procyanidins that are extracted [210, 211]. The most widely used extraction solvents include methanol, ethanol, acetone, water, and ethyl acetate [210]. Depending on the solvent, waxes, fats, terpenes, and chlorophylls may be by-products of the process requiring post-extraction clean-up, using methods such as solvent based separation or column chromatography [12, 13]. These processes may affect the yield and effectiveness of the end product [210, 211].

Low molecular weight procyanidins (LMW-PCNs) have been demonstrated to be more bioavailable, with the ability to regulate metabolic homeostatic gene expression (see

44

sections 1.1.4 – 1.1.5.3); however, there is little information concerning which extraction methods yield high levels of LMW-PCNs in a form that can be easily utilized for both in vitro and in vivo studies, or as a potential health supplement. Acetone based solvents and ground seeds are a widely utilized extraction process [210]. This system is known for the high yields of procyanidins, however, it isolates all procyanidins without any size differentiation [210]. Ethyl acetate (EtOAc) based solvent systems are less popular for complete extraction of procyanidins, as the overall yield is substantially less than acetone based systems; however, the less polar EtOAc is reported to target LMW-PCNs [212].

Efficient extraction techniques that specifically enrich for low molecular weight procyanidins could provide a value added product from the waste generated during the wine-making process.

Experiments were designed to determine whether grape variety, pre-extraction processing, and extraction solvent system could alter the amount, mean degree of polymerization and anti-oxidant effectiveness of extractable procyanidins. This study was also intended to determine if LMW-PCNs could be isolated in a time and cost-effective manner, which could be scaled up in order to conduct future studies utilizing extracts from grapes grown at the University of Nevada, Reno vineyard.

As a whole, this dissertation explores how GSPE acts to selectively regulate expression of intestinal Fxr target genes, resulting in decreased serum TG and cholesterol levels.

Additionally, the differences between GSPE and CHY regulation of BA, TG and cholesterol homeostasis are examined. Finally, conventional extraction techniques are compared in order to find a simple, cost-effective method of specifically isolating LMW-PCNs. These studies expand the existing knowledge of the mechanisms by which GSPE functions in the body and may be produced from local grapes.

45

Chapter 2

Dietary Procyanidins Selectively Modulate Intestinal Farnesoid X Receptor-

regulated Gene Expression to Alter Enterohepatic Bile Acid Recirculation:

Elucidation of a Novel Mechanism to Reduce Triglyceridemia

Published in Molecular Nutrition and Food Research, April 2016, Vol. 60:727-736

Gianella Caiozzi completed the in vitro studies for this research article and conducted the

WT animal experiments in conjunction with Marie-Louise Ricketts. Rebecca Heidker and

Marie-Louise Ricketts conducted the Fxr-/- animal experiments. Rebecca Heidker conducted western blots, qPCR, serum, and fecal assays, and performed statistical analysis.

46

Dietary Procyanidins Selectively Modulate Intestinal Farnesoid X Receptor- regulated Gene Expression to Alter Enterohepatic Bile Acid Recirculation:

Elucidation of a Novel Mechanism to Reduce Triglyceridemia

Rebecca M. Heidker#, Gianella C. Caiozzi#$ and Marie-Louise Ricketts*

Department of Agriculture, Nutrition and Veterinary Sciences, University of Nevada Reno,

Reno, Nevada, 89557.

$Current Address: Hospital de Urgencia Asistencia Pública, Portugal 125, Santiago, Chile

#These authors contributed equally to this work

*Corresponding Author: Dr. Marie-Louise Ricketts, Ph.D., Department of Agriculture,

Nutrition and Veterinary Sciences, University of Nevada, Reno, 1664 N. Virginia St, MS

202, Reno, Nevada, 89557

Fax: 775-784-1375, Email: [email protected]

Abbreviations: ALT: alanine aminotransferase; Asbt: apical sodium-dependent bile acid transporter; AST: aspartate aminotransferase; BA: bile acid; BARM: bile acid receptor modulator; BiP: immunoglobulin heavy chain-binding protein; Bsep: bile salt export pump;

CAM: complementary and alternative medicine; CDCA: chenodeoxycholic acid; Cpt1a: carnitine palmitoyltransferase 1a; CVD: cardiovascular disease; Cyp7a1; cytochrome

P450 cholesterol 7α-hydroxylase; Fgf15/19: fibroblast growth factor 15/19; Fxr: farnesoid x receptor; GSPE: grape seed procyanidin extract; Hmgcr: 3-hydroxy-3-methyl-glutaryl-

CoA (Hmg-CoA) reductase; Hmgcs1: 3-hydroxy-3-methyl-glutaryl-CoA (Hmg-CoA) synthase; Ibabp: ileal bile acid binding protein; Ntcp: Sodium-taurocholate co-transporting

47

polypeptide; Ostα/β: organic solute transporters alpha/beta; Srebp1c: sterol regulatory element-binding protein 1c; Shp: small heterodimer partner; TG: triglyceride; T2D: type 2 diabetes; WT: wild type.

Key words: Bile acids, enterohepatic recirculation, Fxr, procyanidins, triglycerides

2.1. Abstract

Scope: Understanding the molecular basis by which dietary procyanidins modulate triglyceride and cholesterol homeostasis has important implications for the use of natural products in the treatment and prevention of cardiovascular disease.

Methods: To determine whether modulation of bile acid (BA) homeostasis contributes to the hypotriglyceridemic action of grape seed procyanidin extract (GSPE) we examined the effect on genes regulating BA absorption, transport and synthesis in vitro, in Caco-2 cells, and in vivo, in wild type (C57BL/6) and farnesoid x receptor knockout (Fxr-/-) mice.

Results: We provide novel evidence demonstrating that GSPE is a naturally occurring gene-selective bile acid receptor modulator (BARM). Mechanistically, GSPE down- regulates genes involved in intestinal BA absorption and transport in an Fxr-dependent manner, resulting in decreased enterohepatic BA recirculation. This correlates with increased fecal BA output, decreased serum triglyceride and cholesterol levels, increased hepatic cholesterol 7α-hydroxylase (Cyp7a1), and decreased intestinal fibroblast growth factor 15 (Fgf15) expression. GSPE also increased hepatic HmgCoA reductase (Hmgcr) and synthase (Hmgcs1) expression, while concomitantly decreasing sterol regulatory element-binding protein 1c (Srebp1c).

48

Conclusion: GSPE selectively regulates intestinal Fxr-target gene expression in vivo, and modulation of BA absorption and transport is a critical regulatory point for the consequential hypotriglyceridemic effects of GSPE.

49

2.2. Introduction

Cardiovascular disease (CVD) is the number one cause of death worldwide [2].

Hypercholesterolemia and mild to moderate hypertriglyceridemia are important risk factors for CVD [213]. Within the body, cholesterol homeostasis is maintained via endogenous biosynthesis (regulated by 3-hydroxy-3-methyl-glutaryl-CoA (Hmg-CoA) reductase; hmgcr); uptake (via the low-density lipoprotein receptor (ldlr)); and elimination (in the form of bile acids (BAs)) [214], which represents the primary mechanism to lower serum cholesterol levels. BAs facilitate the absorption of dietary fats and fat-soluble vitamins

[215], and undergo enterohepatic recirculation, with ~95% reabsorbed daily from the distal ileum, while the remaining 5% are excreted in the feces [147]. This 5% is then replenished via hepatic de novo biosynthesis from cholesterol [215].

Efficient enterohepatic recirculation is achieved via coordinated regulation along the gut- liver axis and is tightly controlled by nuclear receptors (NRs) [216]. Farnesoid x receptor

(Fxr) is the major BA-responsive NR critical for the maintenance of BA homeostasis [80,

82, 216-218]. Notably, intestinal Fxr is crucial for appropriate BA signaling under normal physiological conditions [219]. Absorption of BAs occurs via active transport in the distal ileum through the apical sodium-dependent bile acid transporter (Asbt) [149]. Once inside the enterocyte BAs are bound and transported to the basolateral membrane of the enterocyte by ileal bile acid-binding protein (Ibabp) [153], and then secreted into portal circulation via the organic solute transporters alpha and beta (Ostα/β) [220]. Additionally,

BAs, via Fxr, induce the expression of fibroblast growth factor 15 (Fgf15) in the intestine, a hormone which is then secreted into portal circulation [95, 125]. Fgf15 circulates to the liver to suppress BA biosynthesis [125], which is mediated via binding to, and activation of, Fgf receptor 4 (Fgfr4) complexed with β-Klotho [126], which then stimulates the c-jun

50

N-terminal kinase (Jnk) pathway, eventually suppressing Cyp7a1, encoding cholesterol

7α-hydroxylase, the rate-limiting enzyme in the classical pathway for BA synthesis [124,

125, 221]. When ileal Fxr is activated by BAs, Asbt is down-regulated [222], while Ibabp,

Ostα/β and Fgf15/19 are induced [125, 128, 162, 221, 223]. These Fxr-mediated effects lead to reduced BA uptake at the luminal membrane of the enterocyte, increased transport into portal circulation, and reduced hepatic BA synthesis [124, 125, 221]. Fundamentally, the tight regulation exerted by these gut-liver Fxr-BA feedback mechanisms regulates the

BA pool size and composition [95], ultimately maintaining cholesterol and BA homeostasis.

High cholesterol is one of the major controllable risk factors for coronary heart disease, heart attack and stroke. Dietary intervention and lifestyle modifications are often initial treatment strategies for dyslipidemia [224], but patients may subsequently be prescribed pharmaceuticals to treat these disorders. Complementary and alternative medicine (CAM) therapies, including plant derived extracts, are popular alternatives for a variety of conditions, including dyslipidemia, with 40% of adults reporting the use of CAM.

Elucidating the molecular mechanisms by which natural products and bioactive dietary components exert beneficial effects against CVD risk factors is of fundamental importance.

Grape seed procyanidin extract (GSPE) is a procyanidin-rich compound isolated from the seeds of white grapes, vitis vinifera. Bioactive procyanidins have been reported to exert beneficial health effects with respect to metabolic syndrome, type 2 diabetes and CVD

[50]. We previously showed that GSPE is a BA-dependent co-agonist ligand for Fxr [19], and that it reduces serum triglyceride (TG) levels via a pathway involving Fxr, small

51

heterodimer partner (Shp) and sterol regulatory element-binding protein 1c (Srebp1c) in the liver [18, 19].

Since GSPE is a co-agonist ligand for Fxr [19], we would expect Cyp7a1 to be repressed following GSPE administration. Intriguingly, however, previous studies in rats [17] and hamsters [52] reported increased Cyp7a1 expression following administration with grape seed extracts, after 5 hours and 6 weeks, respectively. Consequently, we hypothesized that GSPE may selectively modulate intestinal Fxr-regulated gene expression, leading to reduced enterohepatic BA recirculation, which would then necessitate increased Cyp7a1 expression. In order to delineate the underlying molecular mechanism, we systematically assessed the molecular regulatory effects of GSPE on Fxr-target genes important for BA homeostasis in vitro, using Caco-2 cells, and in vivo using wild-type and Fxr-/- mice, to gain further insight regarding how the induction of Cyp7a1 may contribute to the hypotriglyceridemic actions of GSPE. Herein, we now demonstrate that GSPE acts as a gene-selective bile acid receptor modulator (BARM), inhibiting intestinal BA absorption, leading to decreased enterohepatic BA recirculation and increased fecal BA output. By inhibiting BA absorption, transport and enterohepatic recirculation, GSPE induces the utilization of endogenous TG and cholesterol sources to facilitate replenishment of BAs lost via the feces, thereby reducing serum TG and cholesterol levels in order to sustain metabolic homeostasis.

2.3. Materials and Methods

2.3.1 Chemicals and antibodies.

All chemicals were obtained from Thermo Fisher Scientific unless otherwise stated. Grape

Seed Procyanidin Extract (GSPE) was obtained from Les Dérives Résiniques et

Terpéniques (Dax, France), and contains monomeric catechins (polyhydroxyflavan-3-ol)

52

(16.55%), dimeric (18.77%), trimeric (16%), tetrameric (9.3%), and oligomeric procyanidins (5–13 units) (35.7%), as well as phenolic acids (4.22%), as previously described [17-19]. The flavanol and phenolic acid composition of the GSPE used in this study was previously analyzed by reverse-phase high-performance liquid chromatography-mass spectrometry and is reported in reference [225]. The β-actin antibody was obtained from Sigma Aldrich (A5441), and the mouse anti-immunoglobulin heavy chain-binding protein (BiP) antibody was obtained from Enzo Life Sciences. The anti-Cyp7a1 antibody was kindly provided by Dr. D. Russell (UT Southwestern, Dallas), and the anti-Asbt antibody was kindly provided by Dr. P. Dawson (Emory University,

Atlanta).

2.3.2 Cell culture

Caco-2 cells (HTB-37TM), originally isolated from a 72 year old male Caucasian, were purchased from ATCC® and used between passage numbers 5-20 for these studies. Cells were maintained in 10 cm Corning cell culture dishes in Dulbecco’s Modified Eagles medium (DMEM) supplemented with 20% fetal bovine serum (FBS) and 1% L-glutamine, and cultured at 37˚C and 5% CO2. Once the cells reached confluence, they were sub- cultured into 6 well plates, at 1 x 106 cells per well for subsequent experiments. The cells were allowed to reach confluence and grown an additional 10-days post-confluence, with replacement of fresh media every 48 hours. Cells were then grown for an additional 24 hours, after which the media was removed and replaced with DMEM supplemented with

1% L-glutamine and 0.5% charcoal-stripped FBS. A lower concentration of FBS was used to minimize the effect of bile salts commonly found in FBS, which may otherwise cause interference when assessing the effects of GSPE. After 24 hours media was replaced, cells were treated for time points ranging from 1 to 24 hours with either water or DMSO,

53

100 M chenodeoxycholic acid (CDCA), GSPE (20, 50 or 100 mg/L), or a combination of both CDCA and GSPE in DMEM supplemented with 1% L-glutamine and 0.5% charcoal- stripped FBS. Similar results were obtained from at least three independent experiments, performed in triplicate.

2.3.3. Animal studies

Mice were housed under standard conditions and all experimental procedures were approved by the local Institutional Committee for Care and Use of Laboratory Animals

(IACUC) at the University of Nevada, Reno (Protocol # 00502). Age-matched groups of 8- to 10-wk-old male mice were used in all experiments (n=6 per experimental group). Animal cohort sizes were determined based on previous similar studies [18, 19]. Wild-type

(C57BL/6) and Fxr-/- mice (Jackson Laboratory), have been described previously [94].

The correct genotype was verified for all mice using previously reported primer sequences and reaction conditions [94]. All animals were housed in the Laboratory of Animal Medicine at the University of Nevada, Reno and provided standard rodent chow and water ad libitum. Mice were orally gavaged with either vehicle (water), or GSPE (250 mg per kg) and 14 hours later blood was collected from the orbital plexus under isoflurane anesthesia, as previously described [18, 19]. The dose of procyanidins used is one-fifth of the no- observed-adverse-effect level (NOAEL) described for GSPE in male rats [226], and we previously showed that this dose reduces serum TG levels in C57BL/6 mice [18, 19].

Intestines and livers were snap-frozen in liquid nitrogen and stored at –80oC until use.

Gene expression changes in the liver and intestine were assessed following GSPE administration for 14 hours. To assess Fgf15 expression at additional time points, experiments were performed as detailed above, and mice were terminated at 2-, 4-, or 8 hours post-administration with vehicle or GSPE (250 mg/kg). To measure Cyp7a1 protein

54

levels, mice were gavaged with vehicle or GSPE (250 mg/kg) for 3 consecutive days and terminated on day 3 at 11:00 am, after the final gavage at 09:00 am.

2.3.4. RNA isolation, cDNA synthesis and real-time QPCR analysis.

Total RNA was extracted from tissues and cells using TRIzol (Life Technologies) according to the manufacturer’s instructions. Complimentary DNA (cDNA) was reverse transcribed using superscript III reverse transcriptase (Life Technologies), and real-time quantitative polymerase chain reaction (qPCR) was used to determine gene expression changes. The reaction mix comprised 4 l 10x buffer, 3.6 l 50mM MgCl2, 150 M dNTPs,

0.5 μM of each primer, 0.125 μM of probe, 1.25 U Taq polymerase and 10 μl of cDNA (10 ng/l), and was made up to a final reaction volume of 40 μl with water. The cycling conditions used in the amplification of each gene were: step 1: 95oC for 60 secs (1 cycle); step 2: 95oC for 15 secs and step 3: 60oC for 60 seconds, with steps 2 and 3 repeated for

40 cycles. qPCR was performed using a CFX96 Real-Time System (BioRad). Forward and reverse primers and probes were designed using the Oligo Architect Software (Sigma-

Aldrich) and obtained from Sigma-Aldrich. Primer and probe sequences can be found in

Supporting Information Table 1. Expression of β-actin (Applied Biosystems), cyclophilin and Gapdh were used as endogenous controls. Target gene expression was normalized to the average of the three endogenous control genes and the ΔΔCt method was used to calculate the fold change in gene expression. Each sample was analyzed in triplicate.

2.3.5. Western blot analysis

Frozen intestines were homogenized in modified RIPA lysis buffer (50 mM Tris-HCl (pH

7.4), 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl and 1 mM EDTA) containing protease inhibitors (Roche, Indianapolis). Equal amounts of total cellular proteins (15 μg) were separated in a 10% SDS-page gel, transferred to PVDF membrane, probed using a

55

rabbit anti-Asbt antibody [149] at a dilution of 1:1000 and detected by chemiluminescence using a Clarity ECL kit (BioRad). The blots were also probed using a mouse anti-β-actin antibody (1:80,000) as a control for protein loading. We first performed Western analysis for all 5 sections of the small intestine and found that Asbt expression was exclusively located in the fifth segment (the most distal portion), in agreement with previous reports

[149]. Therefore, Western analysis using only the 5th segment of the small intestine for each sample is presented.

To assess hepatic Cyp7a1 protein expression, microsomal membranes were prepared from frozen liver samples as previously reported [142]. A rabbit-generated polyclonal antibody that recognizes amino acids 476-490 of the murine cholesterol 7α-hydroxylase

[142] was used to detect the Cyp7a1 protein, at a dilution of 1:1000. A polyclonal antibody against the immunoglobulin heavy chain-binding protein (BiP), at a dilution of 1:1000, was used as a control for protein loading, as previously reported [142, 149].

2.3.6. Plasma analyses

Serum triglyceride and total cholesterol levels were measured enzymatically (InfinityTM kits, Thermo Scientific) according to the manufacturers’ instructions using 1.5 l serum and 150 l of reagent. Bile acid concentrations in serum (20 l per sample) were measured enzymatically using the Total Bile Acids Assay kit from Diazyme Laboratories. Alanine aminotransferase (ALT: Cat. No.: A526-120) and aspartate aminotransferase (AST: Cat.

No.: A561-120) were measured using colorimetric based kits from Teco Diagnostic, according to the manufacturers’ instructions, using 100 l of sample and 500 l of reagent.

All analyses were performed in triplicate using a Biotek Synergy HT microplate reader.

56

2.3.7. Fecal bile acid output measurement

To determine fecal bile acid excretion, mice were placed in clean cages prior to the start of the experiment and feces were manually collected at the end of the 14 hour experiment, air-dried and weighed. A modified version of the method reported previously [227] was used to measure the bile acid content. Briefly, 0.2 g of dried feces were mixed with 2 ml of 2 mg/ml sodium borohydrate in ethanol and left at room temperature for 1 hour.

Hydrochloric acid and sodium hydroxide were added and samples were vortexed and left to digest for 12 hours under reflux. The samples were then filtered and dried under nitrogen. Samples were re-suspended in milli-Q water and filtered through Sep-Pak C18 cartridges, washed and eluted with methanol and dried under nitrogen. Samples were re- dissolved in 1 ml methanol and bile acid concentrations were measured enzymatically using the Total Bile Acids Assay kit from Diazyme Laboratories.

2.3.8. Statistical Analysis

One-way analysis of variance (ANOVA) with Tukey post-hoc analysis was employed to detect significant differences between groups. Student’s t-test was employed when comparing differences between vehicle and GSPE treatment for Asbt and Cyp7a1 protein expression in mouse liver. Treatment differences were considered statistically significant at p<0.05. All statistical analyses were performed using GraphPad Prism version 6.05 for

Windows, GraphPad Software (San Diego, CA). Data represent mean ± SEM, n=3-4

(Caco-2 cells) or n=6 mice per treatment, per group, analyzed in triplicate.

2.4. Results

2.4.1. GSPE selectively modulates intestinal Fxr-target gene expression in vitro.

The effects of GSPE on intestinal FXR-target gene expression were first determined in vitro using human colorectal Caco-2 cells. ASBT expression was reduced by CDCA and

57

dose-dependently by GSPE treatment compared to control (Fig. 2.1A). Consistent with

GSPE acting as a co-agonist ligand for FXR, co-administration with GSPE + CDCA further reduced ASBT expression in a dose-dependent manner compared to CDCA alone (Fig.

2.1A). CDCA-treatment increased IBABP expression compared to control, while co- treatment with GSPE dose-dependently inhibited the CDCA-induced increase (Fig. 2.1B).

No significant differences were observed following treatment with GSPE alone. FGF19 expression (the human homolog to murine Fgf15) was transiently induced by treatment with either CDCA or GSPE individually, compared to control (Fig. 2.1C), with a maximal effect observed at 4 hours (Supporting Information Fig. 2.1A). In contrast, compared to

CDCA alone, co-treatment with CDCA + GSPE resulted in a significant reduction in FGF19 expression (Fig. 2.1C and Supporting Information Fig. 2.1B). Basolateral BA transporter expression (OST/) was increasingly induced over time with CDCA, compared to control

(Fig. 2.2A and B), while co-treatment with GSPE + CDCA dose-dependently inhibited the

CDCA-induced increase (Fig. 2.2A and B). Consistently, GSPE treatment alone repressed

OST/ expression in a dose-dependent manner, compared to control (data not shown).

58

Figure 2.1. GSPE down-regulates FXR-target gene expression in vitro in Caco-2 cells. Caco-2 cells were treated with either a negative control (water or DMSO), GSPE, CDCA, or in combination, as indicated. Relative gene expression is shown for (A) ASBT and (B) IBABP after 24 hours and (C) FGF19 expression after 4 hours. (Negative control, open bars; GSPE (20, 50 or 100 mg/L) (grey bars), CDCA (100 μM) (black bars), or in combination (hatched bars). Statistical differences are shown as: *p<0.05, ***p<0.001, ****p<0.0001. Asterisks above the bars show comparison to the control unless otherwise indicated.

59

Figure 2.2. GSPE down-regulates basolateral BA transporters in vitro in Caco-2 cells. Time course for (A) OSTα and (B) OSTβ gene expression over 12 hours (Negative control: ; 100 μM CDCA: ; 100 μM CDCA + 20 mg/L GSPE: ; 100 μM CDCA + 50 mg/L GSPE: ; 100 μM CDCA + 100 mg/L GSPE: ). Statistical differences are shown as: **p<0.01, ****p<0.0001.

60

2.4.2. GSPE alters the expression of genes involved in BA absorption, transport and synthesis in vivo.

Our in vitro results indicate that GSPE selectively modulates intestinal FXR-target gene expression, as demonstrated by reduced ASBT, IBABP and FGF19 expression, thus supporting our initial hypothesis. This prompted us to determine whether these effects also occur in vivo. To clarify the molecular mechanism by which GSPE exerts these effects, studies were conducted using C57BL/6 (wild-type, WT) and Fxr-/- mice to determine the effects on hepatic and intestinal Fxr-target gene expression following treatment via oral gavage with an acute dose of GSPE (250 mg/kg).

Consistent with our in vitro results showing that treatment with GSPE + CDCA reduced

FXR-target gene expression, GSPE administration in vivo reduced intestinal Asbt (Fig.

2.3A), Ibabp (Fig. 2.3B) and Fgf15 expression (Fig. 2.3C) in WT mice after 14 hours, with no effect in Fxr-/-. Due to the transient increase in FGF19 expression observed in vitro at

4 hours with GSPE alone (Fig. 2.1C and Supporting Information Fig. 2.1A) we wondered whether a transient induction in intestinal Fgf15 expression in vivo could have occurred at an earlier time point. Consequently, additional experiments were conducted, whereby mice were treated with GSPE for 2-, 4- and 8 hours. GSPE decreased intestinal Fgf15 expression at each time point compared to control, with significance being reached at 4 hours (p≤0.001) (data not shown). In contrast to our in vitro results, no changes in vivo in intestinal basolateral BA transporter expression, including Ostα/β (Fig. 2.3D and E) or

Mrp3 (Fig. 2.3F), were observed following GSPE treatment. Hepatic Cyp7a1 expression was increased following GSPE administration (Fig. 2.4A), and consistent with our previous reports [18, 19], a significant decrease in hepatic Srebp1c expression in WT, but not Fxr-

/- mice was observed (Fig. 2.4B), indicating reduced lipogenesis. Consistent with the

61

observed changes in gene expression, intestinal Asbt protein levels were reduced following GSPE administration in WT mice (Fig. 2.5A), while hepatic Cyp7a1 protein expression was increased (Fig. 2.5B). Also, in agreement with our previous reports [18,

19], hepatic carnitine palmitoyltransferase 1a (Cpt1a) expression was increased in WT mice, indicating increased β-oxidation (data not shown). We did not observe any changes in hepatic BA transporter expression, including Bsep and Ntcp, following GSPE administration (Supporting Information Fig. 2.2). Furthermore, serum levels of BA (Fig.

2.6A), TG (Fig. 2.6B), and cholesterol (Fig. 2.6C), were markedly decreased following

GSPE administration in WT mice, while fecal BA output was markedly increased (Fig.

2.6D). Notably, these GSPE-induced changes were abrogated in GSPE-treated Fxr-/- mice, thereby establishing the Fxr-dependence of these effects. Importantly, GSPE did not alter markers for hepatocellular injury, including alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in this study, which remained within normal limits (Table

2.1).

62

Figure 2.3. GSPE selectively modulates intestinal Fxr-regulated gene expression in vivo in an Fxr-dependent manner. Relative gene expression is shown for (A) Asbt, (B) Ibabp, (C) Fgf15, (D) Ostα, (E) Ostβ, and (F) Mrp3. Statistical differences are shown as: *p<0.05, **p<0.01, ***p<0.001. Asterisks above the bars show comparison to WT-VEH unless otherwise indicated.

63

Figure 2.4. GSPE increases BA synthesis and represses lipogenesis in vivo. Relative gene expression is shown 14 hours after administration for (A) Cyp7a1 and (B) Srebp1c. Statistical differences are shown as: *p<0.05, **p<0.01, ****p<0.0001. Asterisks above the bars show comparison to WT-VEH unless otherwise indicated.

64

Figure 2.5. GSPE decreases intestinal Asbt protein expression leading to increased hepatic Cyp7a1 expression. Relative protein expression is shown for (A) Asbt, 14 hours after administration and, (B) Cyp7a1, 3 days after administration. Protein quantification is represented normalized to -actin or BiP, as indicated. Statistical differences are shown as: **p<0.01. Asterisks above the bars indicate comparison to VEH.

65

Figure 2.6. GSPE administration reduces serum bile acid, triglyceride and cholesterol levels while increasing fecal bile acid output in vivo, in an Fxr- dependent manner. Serum was analyzed for (A) bile acid (BA) (B) triglyceride (TG), (C) cholesterol (CHOL), and (D) fecal bile acid (BA) excretion, 14 hours after administration. Statistical differences are shown as: *p<0.05, **p<0.01. Asterisks above the bars indicate comparison to WT- VEH.

66

Table 2.1. Liver function biochemical parameters after GSPE administration

WT Fxr -/-

Normal Reference Range VEH GSPE VEH GSPE (units/L)

ALT 34.71 ± 6.66 45.38 ± 6.95 19.39 ± 3.14 28.68 ± 7.97 17 - 77 (units/L) AST 33.64 ± 4.46 38.88 ± 9.22 26.80 ± 3.60 34.22 ± 2.83 54 - 298 (units/L)

Data represent mean ± SEM, n = 6 per treatment, per group. ALT: Alanine aminotransferase; AST: Aspartate aminotransferase.

67

2.5. Discussion

Our novel findings demonstrate, for the first time, that GSPE is a naturally occurring gene- selective bile acid receptor modulator (BARM), and provide evidence for a new mechanism by which it could lower serum triglyceride and cholesterol. Specifically, GSPE selectively modulates genes associated with intestinal BA absorption and transport, in an

Fxr-dependent manner, resulting in decreased enterohepatic BA recirculation and increased fecal BA output. Ultimately these changes induce triglyceride catabolism, increase cholesterol and BA biosynthesis (via increased Cyp7a1), consequently leading to reduced serum cholesterol and TG levels.

Development of synthetic bile acid receptor modulators was previously described [228], and the tea catechin, epigallocatechin-3-gallate (EGCG) was shown to be a unique Fxr modulator by activating Fxr in a tissue- and gene-specific manner [229]. We now show that GSPE modulates gene expression similarly in both human-based in vitro and mouse- based in vivo studies. In particular, our in vivo studies provide further insight into the complex gene-regulatory actions of GSPE along the gut-liver axis and identify it as a novel naturally occurring BARM. We propose that the unique intestinally-mediated effects induced by GSPE, resulting in decreased BA absorption and enterohepatic recirculation, represent an additional potential mechanism underlying the already recognized hypotriglyceridemic action of this extract. Individuals with hyperlipidemia benefit from decreased BA absorption and increased BA biosynthesis [230] and, based on the results presented herein, we propose that GSPE may be a beneficial natural therapy against hypertriglyceridemia due to its ability to modulate BA absorption and homeostasis.

In the current study we used an acute dose of GSPE in order to gain insight into its’ molecular targets, subsequently revealing a novel Fxr-dependent mechanism of action.

68

Using a translation of animal to human doses based on metabolic efficiency (energy expenditure) [231] and estimating the intake for a 60-kg human, the dose used herein corresponds to ~703 mg. The average proanthocyanidin intake for US adults over 19 years of age is reported to be 95 mg/d [10], while the mean total intake of polyphenols from consumption of fruits, berries, cereals, and vegetables by Finnish adults is 863±415 mg/d [11]. Therefore, increased consumption of procyanidins to reach the levels used in this study may be achieved via increased dietary intake of procyanidin-rich foods and/or supplementation.

Intestinal absorption of BAs is a critical step in the maintenance of both BA and cholesterol homeostasis [145], and appropriate function of Asbt is crucial for enterohepatic BA recirculation [232]. Asbt inhibition reduces circulating BA levels, leading to increased BA biosynthesis, and ultimately reducing cholesterol levels [145], as evidenced in Asbt-/- mice

[149]. Inhibitors of BA absorption also reduce plasma cholesterol [149]. Therefore, the down-regulation in Asbt observed herein suggests that GSPE may lower cholesterol by directly altering intestinal BA absorption. This notion is supported by the fact that GSPE impairs intestinal BA uptake and transport, ultimately leading to a 47% decrease in serum

BA levels, increased Cyp7a1 expression and decreased serum cholesterol levels.

It is well known that Asbt abrogation also leads to reduced serum TG levels, while simultaneously lowering hepatic Srebp1c [233], consistent with our observations following

GSPE administration. Reduced serum BA levels and increased fecal BA excretion necessitates not only increased BA biosynthesis, consistent with the observed increase in

Cyp7a1, but also increased β-oxidation, through increased Cpt1a expression [18, 54]. We, therefore, propose that reduced enterohepatic BA recirculation may explain, at least in part, the increased -oxidation observed following GSPE administration.

69

Furthermore, GSPE decreased not only serum BA and cholesterol levels, but also induced

HmgCoA-reductase and synthase expression, while simultaneously increasing fecal BA output. Taken together, these results indicate that reduced enterohepatic BA recirculation increases the conversion of cholesterol into BA, via increased Cyp7a1, while also coordinately increasing cholesterol synthesis in order to facilitate continued BA biosynthesis to replace those lost via fecal excretion.

In summary, we now show that the physiological changes consequential to GSPE administration are dependent upon Fxr and result in decreased enterohepatic BA recirculation, a property not previously associated with this natural product. The initial event triggering reduced enterohepatic BA recirculation and the subsequent metabolic events is mediated via Asbt, a key control point for BA entry into the enterocyte. These results indicate that mechanistically GSPE, via Fxr, induces a distinct coordinated metabolic response that inhibits intestinal BA absorption and transport, induces cholesterol and BA synthesis, inhibits lipogenesis and promotes TG catabolism.

Collectively our studies have uncovered GSPE as a potential new therapeutic avenue to manipulate TG and cholesterol levels through intestinally-based down-regulation of target- genes controlled by the nuclear receptor Fxr. Oral administration with the synthetic Fxr agonist, fexaramine, was recently reported to mediate beneficial metabolic changes via intestinal Fxr activation, without direct effects on hepatic Fxr-target genes [234]. The study presented herein now broadens the scope of knowledge regarding selective Fxr modulators and the potential for further advancement in alternative natural therapeutic strategies in the control of metabolic dysregulation, particularly hypertriglyceridemia and hypercholesterolemia, both significant risk factors associated with the development of cardiovascular disease.

70

Author Contributions

MLR conceived and designed the study; RMH, GCC and MLR performed the experiments and analyzed the data; RMH performed statistical analysis; MLR and GCC wrote the manuscript.

Acknowledgements

We would like to thank Nicholas Davis, Kelvin Rodriguez and Brian Wong for technical assistance during the course of the study. Funding was provided by the USDA National

Institute of Food and Agriculture (Hatch-NEV0738 and Multistate project W-3122:

Beneficial and Adverse Effects of Natural Chemicals on Human Health and Food Safety) to MLR. GCC was the recipient of a CONICYT Bicentennial Becas-Chile Scholarship.

The authors have declared no conflict of interest.

71

Chapter 3

Grape Seed Procyanidins and Cholestyramine Differentially Alter Bile Acid and

Cholesterol Homeostatic Gene Expression in Mouse Intestine and Liver

Published in PLoS ONE 11(4): e0154305. doi: 10.1371/journal.pone.0154305

Gianella Caiozzi completed the in vivo studies for this research article. Rebecca Heidker conducted qPCR, serum and fecal assays, and performed statistical analysis.

72

Grape Seed Procyanidins and Cholestyramine Differentially Alter Bile Acid and

Cholesterol Homeostatic Gene Expression in Mouse Intestine and Liver

Rebecca M. Heidker, Gianella C. Caiozzi$ and Marie-Louise Ricketts*

Department of Agriculture, Nutrition and Veterinary Sciences, University of Nevada

Reno, Reno, Nevada, USA

$Current Address: Hospital de Urgencia Asistencia Pública, Portugal 125, Santiago, Chile

*Corresponding author

Email: [email protected] (MLR)

Abbreviated Title: GSPE and CHY differentially alter metabolic gene expression

73

Abbreviations

BA Bile acid

CHY Cholestyramine

GSPE Grape seed procyanidin extract

TG Triglyceride

74

3.1. Abstract

Bile acid (BA) sequestrants, lipid-lowering agents, may be prescribed as a monotherapy or combination therapy to reduce the risk of coronary artery disease. Over 33% of adults in the United States use complementary and alternative medicine strategies, and we recently reported that grape seed procyanidin extract (GSPE) reduces enterohepatic BA recirculation as a means to reduce serum triglyceride (TG) levels. The current study was therefore designed to assess the effects on BA, cholesterol and TG homeostatic gene expression following co-administration with GSPE and the BA sequestrant, cholestyramine (CHY).

Eight-week old male C57BL/6 mice were treated for 4 weeks with either a control or 2%

CHY-supplemented diet, after which, they were administered vehicle or GSPE for 14 hours. Liver and intestines were harvested and gene expression was analyzed. BA, cholesterol, non-esterified fatty acid and TG levels were also analyzed in serum and feces.

Results reveal that GSPE treatment alone, and co-administration with CHY, regulates BA, cholesterol and TG metabolism differently than CHY administration alone. Notably, GSPE decreased intestinal apical sodium-dependent bile acid transporter (Asbt) gene expression, while CHY significantly induced expression. Administration with GSPE or CHY robustly induced hepatic BA biosynthetic gene expression, especially cholesterol 7α- hydroxylase (Cyp7a1), compared to control, while co-administration further enhanced expression. Treatment with CHY induced both intestinal and hepatic cholesterologenic gene expression, while co-administration with GSPE attenuated the CHY-induced increase in the liver but not intestine. CHY also induced hepatic lipogenic gene expression, which was attenuated by co-administration with GSPE. Consequently, a 25% decrease in serum TG levels was observed in the CHY+GSPE group, compared to the CHY group.

75

Collectively, this study presents novel evidence demonstrating that GSPE provides additive and complementary efficacy as a lipid-lowering combination therapy in conjunction with CHY by attenuating hepatic cholesterol synthesis, enhancing BA biosynthesis and decreasing lipogenesis, which warrants further investigation.

76

3.2. Introduction

Currently one in every four deaths in the US is attributable to cardiovascular disease

(CVD) [1]. Regulation of two controllable CVD-associated risk factors, namely serum cholesterol and triglyceride levels, is tightly linked to BA homeostasis. BAs, in addition to their established role in digestion, function as signaling molecules with systemic endocrine effects. BAs regulate not only their own uptake and synthesis, but also cholesterol and triglyceride homeostasis [80, 103, 104]. Consequently, modifications in BA-activated signaling pathways have become an attractive therapeutic target for treating hypercholesterolemia and hypertriglyceridemia. Identifying potential gene regulatory interactions between pharmaceutical interventions and natural treatments used in the amelioration of risk factors associated with CVD is important.

BAs are synthesized from cholesterol in the liver, secreted into bile, stored in the gall bladder, and post-prandially released to facilitate dietary lipid and fat-soluble vitamin absorption. They are reabsorbed in the terminal ileum and returned to the liver via the portal vein, in a process called enterohepatic recirculation [149]. Reuptake of BAs is facilitated via the apical sodium-dependent bile acid transporter (Asbt) [147], the expression of which is inversely regulated via BA activation of the farnesoid x receptor

(Fxr) [222]. BAs are then transported to the basolateral membrane by ileal bile acid binding protein (Ibabp) [153] and released into portal circulation through the organic solute transporters α/β (Ost ) [220]. Typically 95% of the BAs are returned to the liver and eventually released back into the gall bladder, with the remaining 5% being replenished via endogenous biosynthesis from cholesterol [147].

The Cyp7a1 gene, encoding cholesterol 7α-hydroxylase (the rate limiting enzyme in the classical (or neutral) pathway for BA biosynthesis [235]) is regulated via the gut-liver axis

77

by intestinally-derived fibroblast growth factor 15 (Fgf15) [125]. Fgf15 is induced via BA activation of Fxr, secreted into portal circulation, and upon reaching the liver, binds to Fgf receptor 4 (Fgfr4), signaling through c-Jun N-terminal kinase (Jnk) to repress Cyp7a1 expression [127]. When BA levels are depleted, Fgf15 expression is decreased and

Cyp7a1 is increased to initiate BA synthesis [124, 125]. Cyp8b1, encoding sterol 12α- hydroxylase, introduces a hydroxyl group at position 12 of the steroid nucleus, leading to the generation of cholic acid (CA) [236, 237]. Cyp7a1 governs the BA pool size, whereas

Cyp8b1 is crucial for determining the BA pool composition [133, 238]. The classical pathway for BA synthesis accounts for at least 75% of the total BA pool [77]. Sterol 27- hydroxylase, encoded by the Cyp27a1 gene, is important for the production of both CA and chenodeoxycholic acid (CDCA) [239]. In the alternative (or acidic) pathway, oxysterols generated by sterol 27-hydroxylase are hydroxylated at the 7α position by oxysterol 7α- hydroxylase (Cyp7b1), before eventually being converted to CDCA [143]. Increased conversion of cholesterol into BAs ultimately leads to a decrease in intracellular cholesterol stores [240]. This results in increased low density lipoprotein (LDL) receptor

(Ldlr) expression, leading to increased LDL uptake and decreased plasma LDL levels

[240, 241].

To maintain homeostasis, the body must replenish intracellular cholesterol pools via increased cholesterol synthesis, which occurs largely in the liver and intestine [187, 242].

Synthesis of cholesterol is controlled by the transcription factor sterol regulatory element binding protein 2 (encoded by the Srebf2 gene), which positively regulates cholesterol synthesis via 3-hydroxy-3-methylglutaryl-CoA synthase 1 (Hmgcs1) and 3-hydroxy-3- methylglutaryl-CoA reductase (Hmgcr) [243]. Newly synthesized cholesterol is esterified by acetyl-CoA acetyltransferase 2 (Acat2) [244], and loaded onto apolipoprotein (apo)-B

78

containing lipoproteins (chylomicrons in the intestine and VLDL or LDL in the liver) via microsomal triglyceride transfer protein (Mttp) [245-247]. Scavenger receptor class b, member 1 (Scarb1) is important for dietary cholesterol uptake and has been implicated in increased chylomicron synthesis in the intestine [193]. Additionally, intestinal ATP-binding cassette, sub-family a, member 1 (Abca1) mediates the transfer of cholesterol and phospholipids to apolipoprotein A1 and apolipoprotein E (ApoE), facilitating the formation of nascent HDL [248].

BAs also regulate TG homeostasis via Fxr activation, leading to increased expression of small heterodimer partner (Shp), which ultimately represses sterol regulatory element binding protein 1c (Srebp1c, encoded by the Srebf1c gene) [104]. Diminished expression of Srebp1c leads to repressed lipogenic gene expression, including fatty acid synthase

(Fasn), acetyl CoA carboxylase 1 (Acc1), and stearoyl CoA desaturase (Scd1).

BA sequestrants have been used for over 40 years as a means to impact lipoprotein metabolism and lower serum cholesterol levels [240]. These agents bind BAs in the intestine and reduce transhepatic BA flux, leading to the accelerated conversion of cholesterol into BAs [249]. The consequential reduction in intracellular cholesterol stores initiates the activation of HMGCoA reductase, leading to increased de novo cholesterol synthesis. BA sequestrants may be prescribed to patients as a monotherapy or combination therapy with statins or other lipid-lowering agents to provide a more aggressive LDL-lowering regimen [250, 251]. CHY therapy may modestly increase TG levels, however, concentrations do not generally exceed the upper limit for the normal range [240]. Dramatic increases in TG levels usually occur during BA sequestrant therapy in individuals with a metabolic defect affecting the catabolism of TG-containing lipoproteins

[240], and are not indicated for those patients with pre-existing hypertriglyceridemia [252].

79

We previously showed that GSPE functions in an Fxr-dependent manner [19], reduces enterohepatic BA recirculation, resulting in decreased serum cholesterol and triglyceride levels [206], and attenuates fructose-induced hypertriglyceridemia [20]. Currently over

33% of adults in the US utilize complementary and alternative medicine strategies [8], therefore it is possible that patients may take a grape seed extract in combination with a

BA sequestrant, such as CHY. Consequently, this study was designed to gain further insight into the molecular regulatory effects of GSPE and CHY on BA, cholesterol and TG homeostatic gene expression when administered alone and in combination.

3.3. Materials and Methods

All chemicals were obtained from ThermoFisher Scientific (Picastaway, NJ) unless otherwise stated. Grape Seed Procyanidin Extract (GSPE) was obtained from Les Dérives

Résiniques et Terpéniques (Dax, France), and is comprised of procyanidin monomers

(68.68 ± 0.02%), dimers (26.16 ± 0.01%) and trimers (5.16 ± 0.02%) [20].

3.3.1. Animal care, diets and treatments

Mice were housed under standard conditions and all experimental procedures were approved by the local Institutional Committee for Care and Use of Laboratory Animals

(IACUC) at the University of Nevada, Reno (Protocol# 00502). Age-matched groups of male C57BL/6 mice were used in all experiments, and were housed in the Laboratory of

Animal Medicine (LAM) at the University of Nevada, Reno and provided access to chow and water ad libitum. Mice were purchased from Charles River Laboratories (Wilmington,

MA) at 7 weeks of age and allowed to acclimate in the LAM for one week. At 8-weeks of age the mice were given either a control (standard chow, Harlan Teklad rodent diet 2019) or a 2% cholestyramine-supplemented diet (Harlan Teklad diet: TD.110785) for 4 weeks

(n=18 per group). Body weight for each mouse was recorded weekly. After 4 weeks, the

80

mice in each group were randomly assigned to one of two treatment groups and orally gavaged with either vehicle (water) or GSPE (250 mg/kg) and terminated 14 hours later

(n=9 per experimental group). The four treatment groups were as follows: 1. CON: Control diet for 4 weeks followed by oral gavage with vehicle (water) for 14 hrs; 2. GSPE: Control diet for 4 weeks followed by oral gavage with 250 mg/kg GSPE for 14 hrs; 3. CHY: 2% cholestyramine-supplemented diet for 4 weeks followed by oral gavage with vehicle for 14 hrs; and 4. CHY+GSPE: 2% cholestyramine-supplemented diet for 4 weeks followed by oral gavage with 250 mg/kg GSPE for 14 hrs. The dose of procyanidins used is one-fifth of the no-observed-adverse-effect level (NOAEL) described for GSPE in male rats [226] and we previously showed that this dose reduces serum TG levels in normolipidemic

C57BL/6 mice [18, 19, 206] and fructose-induced hypertriglyceridemic rats [20]. Blood was collected from the orbital plexus under isoflurane anesthesia, and intestines and livers were snap-frozen in liquid nitrogen and stored at –80°C until use. At the start of the 14 hr experiment mice were placed into clean cages, and feces were manually collected at the end of the study, air-dried and weighed.

3.3.2. RNA isolation and gene expression analysis

Total RNA was extracted from tissues using TRIzol (Life Technologies) according to the manufacturer’s protocol. Complementary DNA (cDNA) was reverse transcribed using superscript III reverse transcriptase (Life Technologies), and real-time quantitative polymerase chain reaction (qPCR) was used to determine gene expression changes. qPCR was performed using a CFX96 Real-Time System (BioRad). Forward and reverse primers and probes were designed using Oligo Architect Software (Sigma-Aldrich) and obtained from Sigma-Aldrich or Integrated DNA Technologies. Primer and probe sequences can be found in Supplemental Table 3.1. Expression of cyclophilin,

81

glyceraldehyde-3-phosphate dehydrogenase (Gapdh) and TATA-binding protein (Tbp) and were used as endogenous controls. Target gene expression was normalized to the average of two or three endogenous control genes (intestine: Gapdh and Tbp; liver: cyclophillin, Gapdh and Tbp), and the ΔΔCt method was used to calculate the fold change in gene expression. Each sample was analyzed in duplicate.

3.3.3. Plasma biochemical analyses

Serum triglyceride and total cholesterol levels were measured enzymatically using

InfinityTM kits (ThermoFisher) according to the manufacturers’ instructions using 1.5 l serum and 150 L of reagent. Serum bile acid concentrations (20 L per sample) were measured enzymatically using the Total Bile Acids Assay kit from Diazyme Laboratories.

Alanine aminotransferase (ALT: (SGPT) Reagent Set, Cat. No.: A526-120) and aspartate aminotransferase (AST: (SGOT) Reagent Set, Cat. No.: A561-120) were measured using colorimetric based kits from Teco Diagnostic, according to the manufacturers’ instructions, using 100 L of sample and 500 L of reagent. All analyses were performed in triplicate using a Biotek Synergy HT microplate reader.

3.3.4. Measurement of fecal bile acid, cholesterol, non-esterified fatty acid and total lipid excretion

To determine fecal bile acid excretion, a modified version of the method reported by

Modica and colleagues [227] was used to measure the bile acid content, as previously described [20, 206]. Fecal cholesterol and non-esterified fatty acids were extracted as previously described [20], and cholesterol levels were measured using a colorimetric

InfinityTM cholesterol assay kit and non-esterified fatty acids were quantified using a Wako diagnostics HR Series NEFA-HR (2) assay. Total fecal lipids were assessed as previously described [20] and results are expressed as mg lipid/g dry fecal weight.

82

3.3.5. Statistical Analysis

One-way analysis of variance (ANOVA) with Holm-Sidak post-hoc analysis was employed to detect significant differences between groups. Treatment differences were considered statistically significant at p<0.05. All statistical analyses were performed using GraphPad

Prism version 6.05 for Windows, GraphPad Software (San Diego, CA).

3.4. Results and Discussion

Each individual mouse was weighed weekly during the 4 week dietary intervention period, and as shown in Table 3.1, the mice fed the 2% CHY-supplemented diet showed no significant differences in body weight compared to the control group at any time during the study.

Table 3.1. Average weekly mouse weight (g) during dietary intervention. Week # 0 1 2 3 4

Control diet 23.7 ± 0.2 24.4 ± 0.3 25.2 ± 0.3 25.8 ± 0.3 26.5 ± 0.4

2% Cholestyramine 23.4 ± 0.3 24.5 ± 0.3 25.1 ± 0.3 25.5 ± 0.4 26.4 ± 0.4

Data represent mean ± SEM, n=18 per diet.

83

3.4.1. GSPE and cholestyramine differentially modulate bile acid uptake and transport

Our first aim was to determine the effects of GSPE, CHY and co-administration with

CHY+GSPE on intestinal BA uptake and transporter gene expression in order to elucidate any differences and/or interactions at the transcriptional level.

As shown in Figure 3.1A, apical intestinal BA transport is regulated differently by GSPE and CHY. In agreement with our previous report [206], Asbt expression was significantly reduced by GSPE treatment, indicating decreased BA transport into the intestine. In contrast, CHY treatment robustly induced Asbt expression. Decreased apical BA uptake in both the CHY and CHY+GSPE groups, resulting from the BA binding action of this resin, is the probable explanation for the observed increase in Asbt expression. GSPE administration also caused a decrease in both Ibabp (Figure 3.1B) and Fgf15 expression

(Figure 3.1C), consistent with previous reports [206], while CHY and CHY+GSPE further reduced the levels of both of these genes.

Figure 3.1. GSPE and cholestyramine differentially alter intestinal bile acid homeostatic gene expression. Gene expression changes were analyzed for (A) Asbt, (B) Ibabp, and (C) Fgf15. Statistical differences are shown as: *p≤0.05, ** p≤0.01, **** p≤0.0001.

84

3.4.2. Cholestyramine and GSPE collectively increase hepatic bile acid biosynthesis

Based on the finding that BA uptake into the intestine is differentially altered by CHY and

GSPE through modulation of Asbt expression, we next examined their effect on hepatic

BA biosynthetic gene expression. GSPE treatment upregulated Cyp7a1 expression

(Figure 3.2A) while CHY induced expression 8-fold compared to the control, facilitating increased BA biosynthesis to replenish those lost via the feces following administration.

Interestingly, the CHY+GSPE group displayed a nearly 13-fold increase in Cyp7a1 expression, compared to control, suggesting that GSPE, in combination with CHY, exerts an additive effect on Cyp7a1 regulation. This may be linked to the reduced Asbt expression induced by GSPE in the intestine. Previous studies showed that Cyp8b1 expression increases concomitant with Cyp7a1 expression [253]. In agreement, Cyp8b1 expression was increased by CHY and CHY+GSPE treatment. However, Cyp8b1 expression was not significantly affected by GSPE treatment alone in this study (Figure

3.2B). Cyp27a1 expression was not significantly altered by treatment with either GSPE or

CHY alone, but was increased by CHY+GSPE, compared to control (Figure 3.2C). Cyp7b1 expression was decreased following CHY or GSPE treatment, but no change was observed in the CHY+GSPE group, compared to control (Figure 3.2D). Overall the data indicates that BA biosynthesis is induced by all treatments compared to control.

85

Figure 3.2. GSPE and cholestyramine induce the hepatic expression of genes regulating bile acid synthesis. Gene expression was analyzed for (A) Cyp7a1, (B) Cyp8b1, (C) Cyp27a1, and (D) Cyp7b1. Statistical differences are shown as: *p≤0.05, ** p≤0.01, ***p≤0.001, **** p≤0.0001.

86

3.4.3. Intestinal cholesterol transport and synthesis are differentially regulated by GSPE and cholestyramine

BA and cholesterol homeostasis are tightly regulated along the gut-liver axis and based on the observed differences in intestinal BA uptake and hepatic BA biosynthesis, we next examined the effect on intestinal apical cholesterol transport and synthesis. GSPE administration significantly reduced Abcg5 expression (Figure 3.3A), while Abcg8 expression was not significantly changed (Figure 3.3B). Reduced Abcg5 expression following GSPE treatment may lead to reduced transport of intracellular cholesterol into the lumen of the intestine.

GSPE significantly decreased the expression of Npc1l1 (Figure 3.3C), a crucial transporter for dietary cholesterol uptake, whereas CHY and CHY+GSPE had no such effect. These contrasting effects suggest that the cholesterol flux into the enterocyte may not be the regulatory step to control cholesterol absorption in the presence of CHY, in agreement with previous reports [254]. Curcumin, another dietary polyphenol, was also reported to decrease Npc1l1 expression [255]. Therefore, it is possible that GSPE, by inhibiting Npc1l1 expression, functions in a similar manner to inhibit intestinal cholesterol uptake, however, the exact mechanism by which this occurs warrants further investigation.

87

Figure 3.3. GSPE decreases the expression of intestinal apical cholesterol transporters, but not in combination with cholestyramine. Gene expression was analyzed (A) Abcg5, (B) Abcg8, and (C) Npc1l1. Statistical differences are shown as: *p≤0.05, ** p≤0.01.

As shown in Figure 3.4A, Srebf2 expression was unchanged by any of the treatments, whereas CHY significantly increased the expression of genes responsible for intestinal cholesterol synthesis, including Hmgcs1 and Hmgcr (Figures 3.4B and C). Next, we investigated whether there were any changes in the expression of genes regulating cholesterol esterification and basolateral transport. Expression of Acat2 was increased only in the presence of both GSPE and CHY (Figure 4D), as was Mttp expression (Figure

3.4E). Scarb1 expression was also increased by CHY and CHY+GSPE, compared to control (Figure 3.4F). Collectively, these results suggest that the CHY-treated animals are attempting to take in more cholesterol from both dietary and endogenous sources via increased Scarb1 expression, possibly as a compensatory mechanism consequential to significantly reduced luminal BA levels following CHY treatment. The results also indicate that there may be increased cholesterol synthesis within the enterocyte. Previous reports have suggested the presence of a substance within bile that normally inhibits intestinal steroidogenesis [207]. Therefore, a substantial decrease in BA uptake following CHY treatment would likely initiate increased cholesterol synthesis within the enterocyte. Newly synthesized cholesterol could then be esterified by Acat2 and subsequently loaded onto

88

chylomicrons for export into the lymphatic system in the CHY+GSPE treated animals, which is consistent with previous reports showing that cholesterol synthesized in the gut enters the lymph, eventually becoming part of the circulating cholesterol pool [256].

Alternatively, CHY-treatment is known to cause intestinal cellular damage [257, 258] and since newly synthesized cholesterol is primarily used for structural purposes [207] it could be used to protect the intestine against CHY-induced damage and to help maintain intestinal cell membrane integrity.

Figure 3.4. Effects on intestinal cholesterol synthesis and transporter gene expression following treatments. Gene expression was analyzed for (A) Srebf2, (B) Hmgcs1, (C) Hmgcr, (D) Acat2, (E) Mttp, and (F) Scarb1. Statistical differences are shown as: *p≤0.05, **** p≤0.0001.

89

Basolateral cholesterol transporter gene expression was also evaluated in the intestine.

The expression of Abca1 and ApoA1 remained unchanged following any of the treatments

(Figures 3.5A and B), whereas Ldlr expression was increased following CHY and

CHY+GSPE treatment (Figure 3.5C).

Figure 3.5. Expression of genes involved in basolateral intestinal cholesterol transport following treatments. Gene expression was analyzed for (A) Abca1, (B) ApoA1, and (C) Ldlr. Statistical differences are shown as: *p≤0.05, ** p≤0.01.

The small intestine is central to the regulation of whole-body cholesterol balance in mammals and is the second most active site for cholesterol synthesis [146, 259, 260].

Enterocytes are unusual in that they have three, rather than two, sources of cholesterol.

Enterocytes uniquely absorb free cholesterol from the gut lumen, and they also share two ubiquitous sources with other cells, namely endogenous de novo synthesis and uptake of

LDL-derived cholesterol from plasma. Increased cholesterol synthesis combined with increased uptake of LDL, via the Ldlr, in both the CHY-treated groups, could theoretically be a protective mechanism to maintain cholesterol homeostasis.

90

3.4.4. GSPE counteracts the cholestyramine-induced increase in hepatic cholesterol and triglyceride synthesis

After confirming that CHY alters intestinal cholesterol synthesis, we next examined the effect on hepatic cholesterol synthesis. As shown in Figure 3.6A, the expression of Srebf2 remained unchanged following any treatments, while Hmgcs1 expression was significantly increased by CHY, but not GSPE treatment, compared to control (Figure 3.6A and B).

Intriguingly, treatment with GSPE in combination with CHY attenuated the CHY-induced increase in Hmgcs1 expression (Figure 3.6B). Hmgcr and Ldlr expression also followed a similar pattern with GSPE attenuating the CHY-induced increase (Figure 3.6C and D).

The expression of Srebf1c was significantly increased in the CHY-treated group, consistent with previous reports [254]. In this particular study, although trending downwards, GSPE did not significantly decrease Srebf1c expression (Figure 3.6E).

Interestingly however, combined treatment with CHY+GSPE attenuated the CHY-induced increase returning levels back to control. To determine whether this impacted Srebp1c- target gene expression, we next examined the expression of Fasn, Acc1, and Scd1. In agreement with increased Srebf1c expression, their expression was also induced following CHY-treatment, which was again attenuated following CHY+GSPE treatment

(Figures 3.6F, G, and H). Additionally, expression of ApoA5, which has been shown to increase plasma TG clearance and decrease VLDL synthesis [261, 262] was increased by GSPE, but not by CHY or CHY+GSPE (Figure 3.6I).

The evidence presented herein collectively suggests that the combined treatment with

CHY+GSPE may reverse the CHY-induced increase in hepatic cholesterol and triglyceride synthesis. The effects exerted by GSPE, may be initiated via the increased requirement for BA biosynthesis, consequential to decreased intestinal Asbt expression. This would be

91

consistent with the fact that Asbt inhibition triggers a feed forward upregulation in hepatic

BA synthesis [263, 264].

Figure 3.6. Hepatic cholesterol and lipogenic homeostatic gene expression following treatments. Gene expression was analyzed for (A) Srebf2, (B) Hmgcs1, (C) Hmgcr, (D) Ldlr, (E) Srebf1c, (F) Acc1, (G) Fasn, (H) Scd1, and (I) ApoA5. Statistical differences are shown as: *p≤0.05, ** p≤0.01, ***p≤0.001, **** p≤0.0001.

92

3.4.5. GSPE and cholestyramine decrease serum bile acid, triglyceride and non- esterified fatty acid levels and increase fecal bile acid and lipid excretion

Following gene expression analysis, we looked at the consequential physiological effects.

Serum BA levels were significantly reduced following treatment with either GSPE or CHY

(Figure 3.7A), and were further reduced in the CHY+GSPE group, compared to control.

As shown in Figure 3.7B, no changes in serum cholesterol levels were observed by any treatment regime, which is in agreement with previous reports showing that serum cholesterol levels are unlikely to be altered by CHY in a normolipidemic state [254].

However, serum TG levels were significantly decreased by all treatments compared to control, with GSPE exerting a 34% decrease; CHY a 56% decrease; and CHY+GSPE a

66.7% decrease compared to control (Figure 3.7C). Combined treatment with CHY+GSPE exerted a 25% additional decrease in serum TG levels compared to CHY alone. Serum

NEFAs were also decreased in all three treatment groups, compared to control (Figure

3.7D). No detrimental effects were exerted in the liver by any of the treatments, as evidenced by the fact that alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were unchanged (Figure 3.7E and F).

93

Figure 3.7. Serum Biochemical analysis following treatments. Serum analysis was performed for (A) bile acids (BA), (B) cholesterol (CHOL), (C) triglyceride (TG), (D) non-esterified fatty acids (NEFA), (E) alanine aminotransferase (ALT), and (F) aspartate aminotransferase (AST). Normal upper and lower limits for ALT and AST are represented by the dashed lines in (E) and (F). Statistical differences are shown as: *p≤0.05, **p≤0.01, ***p≤0.001, **** p≤0.0001.

94

Finally, the effect on fecal BA and lipid excretion was determined. Fecal BA excretion was significantly increased by administration with GSPE, CHY and CHY+GSPE (Figure 3.8A) in agreement with the observed reduction in serum BA levels (Figure 3.7A). Total fecal lipids were also increased by all treatments compared to control (Figure 3.8B). Consistent with the observed decrease in Abcg5 expression (Figure 3.3A), fecal cholesterol excretion was also decreased by GSPE (Figure 3.8C), possibly because cholesterol is being conserved to synthesize BAs. Fecal NEFA levels were also unchanged following GSPE administration in the control-fed animals, however, CHY treatment caused a significant increase in fecal NEFA excretion (Figure 3.8D), consistent with the reduced serum NEFA levels (Figure 3.7D). Colestilan, another BA sequesterant, also causes increased NEFA incorporation into biliary secretions subsequently increasing fecal excretion [265], therefore, CHY may cause the observed effect via a similar mechanism.

95

Figure 3.8. Fecal bile acid, cholesterol and lipid analysis following treatments. Feces were analyzed for (A) bile acids (BA), (B) total lipids, (C) cholesterol (CHOL), and (D) non-esterified fatty acids (NEFA). Statistical differences are shown as: *p≤0.05, **p≤0.01, **** p≤0.0001.

96

3.5. Conclusion

Collectively, the data shows that GSPE and CHY, both independently and when combined differentially alter the expression of genes controlling BA, cholesterol and triglyceride homeostasis. Beginning in the intestine, GSPE decreases BA uptake by inhibiting Asbt expression, thereby limiting BA absorption via gene regulatory mechanisms. In contrast,

CHY, by sequestering BAs, induces Asbt expression. Ultimately, both mechanisms of action lead to reduced serum BA levels and concomitant increased fecal BA excretion.

Importantly, CHY induces genes associated with cholesterol synthesis both in the intestine and liver. In comparison, GSPE co-administration selectively attenuates the CHY-induced increase in cholesterol synthetic gene expression in the liver, but not intestine. In addition, the findings suggest that cholesterol transport into the lumen of the intestine from the enterocyte, as well as from the lumen into the enterocyte is decreased by GSPE, but not

CHY.

CHY and GSPE both increase BA biosynthesis independently, with a significant increase in Cyp7a1 expression. In the presence of CHY+GSPE, Cyp27a1 expression is significantly induced, as are Cyp7a1 and Cyp8b1, which would theoretically lead to an increase in the production of both CA and CDCA. In the presence of GSPE only, neither

Cyp8b1 nor Cyp27a1 were induced; while CHY increased Cyp8b1 expression. Whether these gene changes lead to consequential changes in the BA pool composition requires further detailed analysis.

CHY increases hepatic lipogenic gene expression, whereas co-administration with GSPE attenuates these changes. Ultimately, both CHY and GSPE alone reduce serum TG levels, but they are reduced even further following co-administration, which is probably

97

due to the combination of increased BA biosynthesis and decreased lipogenesis induced by GSPE.

Although we did not evaluate the protein expression levels of these gene products in this study, it is possible not only to conclude that intraluminal availability of BAs alters the expression of various genes relating to BA and lipid metabolism in the presence of CHY, but also that GSPE exerts independent effects to modulate BA and lipid metabolism resulting in physiological effects such as reduced lipogenesis and consequently further decreasing serum TG levels.

Due to the fact that BA sequestrants are not metabolized, there are no reported drug-drug interactions [241]. However, BA sequestrants are positively charged and they may bind non-specifically to co-administered drugs, particularly those that are acidic, ultimately reducing their bioavailability [241]. The differential effects exerted by GSPE both in the intestine and liver in the presence of CHY clearly indicate that CHY does not interfere with the absorption of GSPE nor its subsequent molecular actions.

Although BA sequestrant monotherapy effectively lowers LDL-cholesterol, combined therapy, e.g. with statins, is common due to their complementary mechanisms of action for those patients who require more aggressive lipid-lowering therapy. BA depletion leads to increased HMG CoA-reductase activity, therefore, interfering with this enzyme results in additive and complementary effects on the lipid profile. Results presented herein show that GSPE exerts beneficial effects by decreasing HMG CoA-reductase gene expression, selectively in the liver, when combined with CHY. Therefore combination therapy with CHY and GSPE may prove particularly efficacious and beneficial in the amelioration of CVD, clearly warranting further investigation. Although statins are the first-line drug to treat

98

hypercholesterolemia, some patients are statin intolerant, for example those suffering from rhabdomyolysis or certain liver diseases, and they may benefit from combined therapy with CHY and GSPE. Furthermore, patients with hypertriglyceridemia who would not otherwise be prescribed CHY may benefit from the addition of GSPE with CHY since

GSPE exerts a hypotriglyceridemic effect. Clearly further studies are needed to determine whether CHY in combination with GSPE as a lipid-lowering therapy can improve cardiovascular outcomes, slow atherosclerotic progression or reduce plaque build-up.

In conclusion, this study provides novel and innovative insight into the molecular regulatory interactions between GSPE and CHY. A natural product, such as GSPE, that can induce Cyp7a1 gene expression, inhibit uptake of BAs produced in the process, and reduce lipogenesis may be valuable as a potential combinational therapy with CHY for the treatment of dyslipidemia.

Acknowledgements

The authors would like to thank Brian Wong and Tania Pike for their valuable assistance during the animal study and Kelvin Rodriguez for technical assistance with biochemical analysis. Funding was provided by the University of Nevada, Reno and USDA National

Institute of Food and Agriculture (Hatch-NEV0738 and Multistate project W-3122:

Beneficial and Adverse Effects of Natural Chemicals on Human Health and Food Safety) to M.L.R. G.C.C was the recipient of a CONICYT Bicentennial Becas-Chile Scholarship.

This work is dedicated to the memory of Catherine Ricketts.

Author contributions

Conceived and designed the experiments: MLR; Performed the experiments: RMH, GCC and MLR; Analyzed the data: RMH and MLR; Wrote the paper: RMH and MLR.

99

Competing Interests

The authors have declared that no competing interests exist.

100

Chapter 4

A Comparative Study of Methods for the Efficient Extraction of Low Molecular

Weight Procyanidins from Three Varieties of Grape Seeds

Marie-Louise Ricketts conceived the initial idea for this study. Rebecca Heidker and

Kelvin Rodriguez designed and conducted the extraction processes and experiments

cooperatively. Rebecca Heidker conducted the statistical analysis for this study.

101

A Comparative Study of Methods for the Efficient Extraction of Low Molecular

Weight Procyanidins from Three Varieties of Grape Seeds

Rebecca M. Heidker1#, Kelvin Rodriguez1#, Patricia A. Ellison2, Grant R. Cramer2 and

Marie-Louise Ricketts1*

1Department of Agriculture, Nutrition and Veterinary Sciences and 2Department of

Biochemistry and Molecular Biology, CABNR, University of Nevada Reno, Reno, 89557,

USA

#Heidker RM. and Rodriguez K. contributed equally to this work.

*Corresponding author: Dr. Marie-Louise Ricketts, Ph.D.

Department of Agriculture, Nutrition and Veterinary Sciences

College of Agriculture, Biotechnology and Natural Resources

University of Nevada, Reno

1664 N. Virginia St, MS 202

Reno, Nevada, 89557, USA

Tel: 775-784-6442

Fax: 775-784-1375

Email: [email protected]

Running Title: Extraction of low molecular weight procyanidins from grape seeds

102

4.1. Abstract

Procyanidins, a subclass of flavonoids, have emerged as health promoting compounds.

Low molecular weight procyanidins, comprised of (+)-catechin and (-)-epicatechin are absorbed via the intestine and alleviate oxidative stress, via both direct and indirect mechanisms. Several extraction methods have been described, however, there has been little focus regarding which methods are cost effective and time efficient, whilst yielding extracts containing high levels of low molecular weight procyanidins. This study was therefore designed to identify an efficient extraction method, which would produce a final extract enriched in low molecular weight procyanidins. We compared acetone and ethyl acetate solvent systems using both whole and ground seeds. Our results demonstrate that an ethyl acetate solvent extraction system using whole seeds generates a higher yield of extract, that is naturally high in monomeric and dimeric procyanidins, and which displays significant antioxidant capacity.

Keywords: Anti-oxidant, grape seed, polyphenols, procyanidins, extraction

103

4.2. Introduction

Procyanidins, the most abundant phytonutrients in the human diet, have emerged as important health promoting compounds [266, 267]. These versatile secondary plant metabolites, which protect the plant from many environmental stressors, including ultraviolet light, dramatic changes in temperature, drought, and soil salinity, have been linked to beneficial effects on human health [208]. Procyanidins are a subclass of flavonoids, which share a chemical structure consisting of two aromatic rings (A and B), linked by 3 carbons, forming an oxygenated heterocycle (C ring) [15]. Flavonoids can be further divided into six sub-classes including: flavonols, flavones, isoflavones, flavanones, anthocyanidins, and procyanidins [12]. Polymeric procyanidins, commonly known as condensed tannins, are composed of 2 to 50 monomeric subunits of (+)-catechin and/or

(-)-epicatechin, linked via oxidative condensation.

Monomers and small polymeric fractions of procyanidins, such as dimers and trimers, are readily absorbed via the intestine, while compounds with a larger degree of polymerization show significantly limited absorption [21, 268]. Low molecular weight procyanidins

(including gallic acid, catechins, and epicatechins) have been shown to be multifunctional in the body. For example, they are known to scavenge antioxidants and free radicals [37], as well as regulating signaling proteins, ultimately modulating inflammation and metabolism [269]. Both monomeric and dimeric procyanidins can directly impact cell signaling pathways by either binding to enzymes, inhibiting ligand binding, or by regulating gene expression via interaction with DNA binding sites [270-272]. Additionally, procyanidins regulate cell-signaling processes by effects on phosphatases, kinases, or calcium signaling [273-276]. Procyanidins target metabolic pathways to induce beneficial

104

effects, e.g. decreased post-prandial lipidemia, reduced lipogenesis, anti-hyperglycemic effects and increased insulin sensitivity [18-20, 46, 277-279].

Grape seeds contain 4-6% phenolic content and are therefore a rich source of procyanidins [209]. More than 70 million tons of grapes were grown worldwide in 2011

[280], producing 28 million tons of wine, and resulting in 222,861 tons of waste, comprised of seeds and skins, also known as pomace [280]. Approximately 38-52% of pomace dry matter generated during wine making is comprised of seeds [281]. Extracts from grape seeds and pomace are potential rich sources of procyanidins. However, extraction methods vary widely, including separation of the seeds, the solvents used, and post- extraction processing methods, which may be used to enrich for specific compounds, and thereby, facilitate utilization of the resultant extracts.

The various solvents and techniques used for the extraction of procyanidins from grape seeds are extensive and are reviewed in [210, 211]. The polarity of the solvent used in the extraction process dictates which types of procyanidins are isolated, as well as their degree of polymerization and solubility. In addition the solvent system determines which other substances, e.g. waxes, fats, terpenes, and chlorophylls are extracted. The most widely used extraction solvents include methanol, ethanol, acetone, water, and ethyl acetate [210]. Many extraction processes are time consuming and result in the extraction of both large and small procyanidins, which then require further processing, e.g. column chromatography, in order to enrich the preparation for compounds of interest and to remove any undesirable components.

Interestingly, however, there has been little attention regarding which methods require minimal effort and supplies, whilst yielding extracts containing high levels of low molecular

105

weight procyanidins in a form that can easily be dried, used for both in vitro and in vivo studies, or as a potential health supplement. Efficient extraction techniques that specifically enrich for low molecular weight procyanidins could provide a value added product from the waste generated during the wine-making process.

This study was therefore designed to identify a time efficient extraction method, requiring minimal post-extraction processing, that would produce a final extract enriched in low molecular weight procyanidins. Using seeds from three varieties of grapes (Cabernet

Franc (CF), Cabernet Sauvignon (CS) and Semillon (SE)) grown at the vineyard located at the University of Nevada Reno, we investigated the effect of variables, including the solvent system (acetone or ethyl acetate), seed state (ground or whole seeds) and analyzed the resultant extracts. Extracts were evaluated for (i) ease of processing and yield of usable product; (ii) total phenolic content and the mean degree of polymerization; and (iii) antioxidant capacity.

4.3. Materials and Methods

4.3.1. Materials

All solvents and reagents used in this study were of high-performance liquid chromatography (HPLC) grade. All reagents were purchased from Thermo Fisher

Scientific (Pittsburgh, PA) unless otherwise stated. Proanthocyanidin standards including

A2, B1, B2, and C1 were purchased from Chromadex (Irvine, CA). Catechin-hydrate, epicatechin, vanillin and Folin-Ciocalteu reagent were purchased from Sigma-Aldrich (St.

Louis, MO). Gallic acid was purchased from Macron Chemical (Center Valley, PA);

Sephadex LH-20 was from GE Health Sciences (Pittsburgh, PA); acetonitrile was from

106

Pharmco-AAPER (Brookfield, CT); sodium acetate was from Mallinckrodt Chemicals (St.

Louis, MO); and hydrochloric acid was from EMD-Millipore (Billerica, MA).

4.3.2. Sample preparation

Cabernet Franc (CF), Cabernet Sauvignon (CS), and Semillon (SE) grape pomace, following pressing for wine-making, were obtained from the University of Nevada, Reno vineyard (39° 30' 49" N, 119° 44' 27" W), Reno, Nevada, USA. Any remaining flesh and skins were removed manually and the seeds were washed using distilled, deionized water.

The seeds were then dried at 55oC for 2-3 days until the weight remained constant. A

Secura coffee mill (SP-7415) was used to grind the seeds.

4.3.3. Organic Solvent Extraction

4.3.3.1. Acetone Extraction

Extracts were prepared using a modification of the method previously described by

Kennedy et al., [282]. Whole or ground seeds (30 g) were soaked in 4 volumes (120 ml) of an acetone: water: acetic acid (70:29.5:0.5; v/v/v) solution overnight at room temperature and then filtered using Whatman #1 filter paper. Organic solvents were removed by rotary evaporation and the samples were washed 3-6 times with hexane to remove any lipids. Small molecular weight procyanidins were enriched using a Sephadex

LH-20 column. Briefly, the column was equilibrated in 50% methanol containing 0.5% acetic acid. Mobile phases consisted of (A) methanol: water: acetic acid (50: 49.5: 0.5, v/v/v) and (B) acetone: water: acetic acid (70: 29.5: 0.5, v/v/v). The extract was loaded using solvent A and the column was washed with five column volumes of solvent A, and then eluted with two column volumes of solvent B. The purified samples were rotary evaporated to remove methanol and washed with hexane to remove residual lipids.

107

4.3.3.2. Ethyl Acetate Extraction

Extracts were prepared as previously described [283]. Briefly, whole or ground seeds (30 g) were soaked in 4 volumes (120 ml) of 90% ethyl acetate at room temperature while shaking, for 24 hours. Extracts were filtered through Miracloth, followed by Whatman #1 filter paper. Ethyl acetate was removed by rotary evaporation and the samples were washed 3-5 times with hexane to remove lipids and dried under vacuum.

4.3.4. Solid phase extraction

Elimination of sugars and other secondary metabolites from the acetone extracts was performed as previously described, with slight modifications [284]. Briefly, 170 ml of the acetone extract was concentrated under vacuum and re-suspended in 4 ml of 2.5% acetic acid in filtered water. Sep-Pak C18 cartridges were primed with 2 ml of methanol, followed by 4 ml of 2.5% acetic acid. The samples were loaded onto the column and washed with

8 ml of 2.5% acetic acid. Procyanidins were eluted in 2 ml of acetone: water (6:4, v/v) containing 2.5% acetic acid. The eluate was collected and dried under vacuum.

4.3.5. Assessment of subunit composition

Subunit composition was assessed using acid catalysis, as previously described [282].

Five milligrams of purified procyanidin samples were dissolved in 1 ml phloroglucinol solution (5 g phloroglucinol (1,3,5-trihydroxybenzene), 1 g ascorbic acid, and 0.5 ml of 10

N hydrochloric acid, to a total volume of 100 ml in methanol) in a 2-ml borosilicate glass vial. This solution was incubated in a 50oC water bath for 20 minutes and then cooled to room temperature. One ml of 40 mM sodium acetate buffer and 200 μl procyanidin solution were combined and filtered through a 0.45 µm filter. Analysis was performed using an

Agilent 1100 HPLC system consisting of a quaternary pump, a solvent degasser, an autosampler, a thermostat column compartment, a fluorescence detector, and

108

ChemStation for data collection (Agilent Technologies, Palo Alto, Calif., U.S.A.). Mobile phases for the HPLC consisted of (A) acetic acid (1%, v/v) in HPLC-grade water and (B)

100% HPLC-grade methanol. Using a Grace Vydac 201TP C18 reversed phase column

(Columbia, MD) with an injection volume of 20 µl, and a flow rate of 0.5 ml/min, the 70- min linear gradient was as follows: 5% B for 10 min; 5% to 20% B for 20 min; 20% to 40%

B for 25 min; 90% B for 10 min to wash the column; and, 5% B for 10 min to re-equilibrate the column. Peak detection was at 280 nm.

4.3.6. Analysis of total polyphenolic content

Total polyphenol content in the extracts was determined using the Folin-Ciocalteu colorimetric reaction method, as previously described [285]. Gallic acid was used as the calibration standard. Concentrations were determined using a linear standard curve and absorbance was measured at 765 nm using a Biotek Synergy HT plate reader. The phenol concentration in each extract is expressed as µg gallic acid equivalents per ml (µg/ml

GAE).

4.3.7. Assessment of condensed tannin (procyanidin) content

Condensed tannins were measured using a vanillin assay, as previously described [286].

Briefly, 250 µl of each sample (50 µg/ml, resuspended in methanol), catechin standard

(30, 60, 90 and 120 µg/ml), or blank (methanol) were treated with either 625 µl of 100% methanol or 625 µl of 1% vanillin in methanol, and 625 µl of 9M HCl was then added to all tubes. The tubes were incubated for 15 minutes at 30°C. Absorbance was measured at

500 nm using a Biotek Synergy HT plate reader, and the concentrations were determined using a linear standard curve. The final absorbance was calculated as follows: (Abs. of sample or standard in vanillin - Abs. of blank in vanillin) - (Abs. of sample in methanol -

109

Abs. of blank in methanol). Condensed tannin concentration in the extract is expressed as µg catechin equivalents per ml (µg/ml CE).

4.3.8. Polymer size evaluation

Separations based on the degree of polymerization were conducted using a Develosil Diol column (250 × 4.6, 5 μm, Phenomenex, Torrence, Calif., U.S.A.) as previously described

[287]. Analysis was performed using an Agilent 1100 HPLC system as described above

(Agilent Technologies, Palo Alto, Calif., U.S.A.). Samples were dissolved in methanol at a concentration of 0.1 mg/ml and filtered through a 0.45 µm PTFE syringe filter prior to injection (10 µl per sample). Mobile phases consisted of (A) acetonitrile: acetic acid (98:2, v/v) and (B) methanol: water: acetic acid (95:3:2, v/v/v). A flow rate of 1 mL/min was maintained for 75 minutes. The gradient was as follows: 0 to 3 min: 7% B isocratic; 3 to

60 min: 7% to 37.6% B linear; 60 to 63 min: 37.6% to 100% linear; 63 to 70 min: 100% B isocratic; 70 to 75 min: 7% B linear followed by 10 minute re-equilibration of the column.

Procyanidin peaks were monitored by fluorescence detection with excitation at 230 nm and emission at 321 nm.

4.3.9. Phenolic identification via HPLC-MS Analysis

HPLC-ESI-MS chromatographic analyses were performed by the Mass Spectrometry

Core lab at the University of Illinois at Urbana-Champaign, using a Waters Synapt G2-Si

ESI/LC-MS in the positive ion mode, as previously described [288].

4.3.10. Analysis of 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical-scavenging activity

In order to assess the antioxidant capacity of the extracts, their radical-scavenging activity was determined using DPPH, according to the procedure described by [289]. Briefly, each sample was diluted with methanol ranging from 0.01,1 mg/ml. Sample or blank (10 µl)

110

were combined with 200 µl of 100 µM DPPH and the absorbance was measured at 515 nm after 30 minutes. Absorbance of the DPPH solution in methanol without any antioxidant was also measured as a control. Each extract was analyzed in duplicate, and the average values were plotted to obtain the EC50 against DPPH via linear regression.

The activity of catechin, a well-established antioxidant, was used as a standard over the same range of concentrations. A low absorbance value indicates effective free radical scavenging ability. The radical-scavenging activity was calculated as the percentage of inhibition according to the following equation: % inhibition = [(absorbance of control − absorbance of sample)/absorbance of control)] × 100. All spectrophotometric data were acquired using a Biotek Synergy HT plate reader. Results are expressed as mg of sample per ml (mg/ml).

4.3.11. Statistical analysis

All experiments were performed in triplicate, unless otherwise stated. Differences were analyzed by variety of grape seed used, solvent system, and by seed state (whole or ground). Statistical analysis was performed using JMP®, Version <12.1> (SAS Institute

Inc., Cary, NC, USA, 1989-2007).

4.3. Results and Discussion

4.3.1. Extraction Solvent System

For this study two simple solvent based extraction methods were selected, namely acetone and ethyl acetate (EtOAc). Solvents play an important role in optimizing the extraction technique. Polyphenolic compounds are typically soluble in water; however, solvents such as alcohols, acetone, and EtOAc are often used in conjunction with water, due to their ability to degrade the seed coat, and thereby aid in the release of procyanidins into the solvent. Acetone (70%) is widely used as an extraction solvent, because it

111

generally yields the greatest amount of procyanidins, compared to other solvent systems

[290]. In contrast, extraction protocols using the less polar solvent, EtOAc, tend to yield lower levels of total procyanidins, but have been speculated to enrich for low molecular weight procyanidins (LMW-PCNs), including epicatechin-gallate and epicatechins, due to the greater polarity of larger procyanidin polymers [212]. While the overall effectiveness of these solvents for extracting total procyanidins was previously compared, the final product was frequently only used for analytical purposes [290]. It is highly desirable to optimize the extraction protocol in order to generate a powdered extract, comprised mainly of bioavailable LMW-PCNs, in sufficient amounts that can subsequently be utilized for both in vitro (cell culture) and in vivo (animal model) experiments, with the ultimate aim for use as a dietary supplement, thus becoming a value added product from the wine making industry.

4.3.2. Ease of processing and yield

Since our ultimate goal is to create an extract enriched in LMW-PCNs, we therefore initially assessed the amount of extract produced by each method. The time spent on each extraction protocol is an important consideration, due to the fact that longer extraction processes lead to the potential for increased oxidation, consequently decreasing the effectiveness of the final product. With these goals in mind, our aim was to determine which of the above methods would yield an extract containing greater amounts of LMW-

PCNs with the least amount of processing.

Whole and ground seeds were soaked in 90% EtOAc with shaking for 24 hours. After evaporation of the organic solvent, and three hexane washes to remove residual lipids, the whole seed (WS) EtOAc extracts could be dried under vacuum to a light powder. In comparison, the ground seed (GS) EtOAc extraction method resulted in the presence of

112

substantially more lipids and other compounds, which required five to six hexane washes before drying to a powder, with no further processing required. The extraction protocol using EtOAc for both the WS and GS required approximately 45 or 48 hours, respectively.

The acetone extraction protocol using WS and GS was performed by soaking in an acetone: water: ascorbic acid solution (70: 29.5: 0.5, v/v/v) for 24 hours, followed by evaporation of the organic solvents. Since this process extracts high molecular weight

PCNs, in addition to LMW-PCNs, the resulting extracts were subjected to column chromatography in order to enrich the LMW-PCN content. Organic solvents were evaporated from the enriched extracts, followed by three to six washes with hexane, to remove lipids. After defatting the GS extract we attempted to dry a portion under vacuum and found that it dried to a sticky residue. A similar residue has been described by other groups and may be due to the presence of sugars or other secondary metabolites [287].

The WS-acetone extract was then dried by evaporation under vacuum, in preparation for further cleanup by solid phase extraction (SPE). Following SPE, the acetone extracts were dried to a lipid and sugar-free powder. Interestingly, the WS-acetone extracts could be dried to a powdered form after the initial lipid removal step. However, initial assessment revealed very low levels of LMW-PCNs indicating the need for further enrichment, which was achieved by using LH20. The acetone extraction process, including enrichment and cleanup takes 72 or 96 hours, for whole and ground seeds respectively.

We noted that it takes twice as many wash-steps to remove the majority of the lipids from the GS extracts, compared to WS, regardless of the solvent system; indicating that grinding facilitates increased extraction of lipids, as well as other less desirable compounds. This is not surprising since lipids are soluble in acetone and to a lesser degree in EtOAc. It may also be the case that the increased surface area and access to

113

the interior of the seeds facilitated by grinding allows for greater extraction of these compounds.

The GS-EtOAc extraction yielded an average of ~0.89 mg of extract per g of seeds, while the WS-EtOAc extraction resulted in ~4.16 mg/g of seeds (Fig. 4.1). A similar pattern was seen with the acetone extracts, with the average yield for the GS extracts, after SPE, being

~2.64 mg/g of seeds, while the WS extracts produced ~5.13 mg/g (Fig. 4.1). These findings indicate that the PCN content is potentially reduced during the enrichment and

cleaning processes.

Figure 4.1. Yield of extract (mg extract/g of seeds) from whole and ground seeds using either acetone or ethyl acetate as the extraction solvent. Results are expressed as the average for all three varieties of grape seed, mean ± SEM, n=6. Results not sharing a common letter are statistically different, p< 0.05.

114

4.3.3. Total phenolic and procyanidin content

Since procyanidins are a subclass of phenolic compounds, the extracts were analyzed for total phenolic content. The total phenol concentration, reported as µg gallic acid equivalents per ml (µg/ml GAE), ranged between 109 and 2426 mg GAE in the various extracts (Fig. 4.2A). EtOAc extracts from whole seeds produce the highest levels of phenols (Fig. 4.2A), regardless of the grape variety used. Using either solvent system, an extremely high variability in the level of extracted phenols is observed when using ground seeds. This may be due, in part, to the fact that the GS extracts require increased cleanup before analysis, thereby leading to the loss of these compounds.

Overall, irrespective of grape variety, EtOAc extraction results in significantly higher levels of condensed tannins (Fig. 4.2B). GS extracts contain higher levels of condensed tannins, or procyanidins, compared to their WS counter-parts, particularly when using EtOAc as the extraction solvent. The increased procyanidin content in the WS-EtOAc extracts also correlates with elevated total polyphenol content, indicating that a large portion of the polyphenols present in the WS-EtOAc extracts are indeed comprised of procyanidins.

Intriguingly, the phenol and tannin concentrations were inversely correlated in the ground seeds, again suggesting that the more extensive cleanup required for the GS extracts may result in a loss of PCNs in the final product. A least squares fit analysis to assess the effects of variety, solvent and grinding revealed that the solvent used has the most impact on resultant monomer and dimer yield, while the combination of grinding and solvent system has the most impact on the trimer content in the final extracts.

115

Figure 4.2. Comparison of total polyphenol and condensed tannin content in extracts by variety of grape seed in whole and ground seeds using either ethyl acetate or acetone extraction. (A) Total polyphenol concentration expressed as µg gallic acid equivalents per ml (µg/ml GAE), and (B) Condensed tannin content expressed as µg catechin equivalents per ml (µg/ml CE). Grape varieties are Cabernet Franc (CF), Cabernet Sauvignon (CS), and Semillon (SE). Results are expressed as mean ± SEM, n=3. Results not sharing a common letter are statistically different, p<0.05.

116

4.3.4. Mean degree of polymerization and determination of distribution of procyanidins based on molecular weight

Having confirmed the presence of PCNs, we next sought to determine the mean degree of polymerization (mDP) of the procyanidins present in each extract. This was achieved by cleavage of the interflavonoid bond using acid-catalysis, followed by reverse phase

(RP) HPLC [282]. Our results demonstrate that the mDP in the acetone extracts, which had been enriched for LMW-PCNs using column chromatography, ranged between 1.13 and 1.21, indicative of a high monomer content (Fig. 4.3). Similar results were seen in the

EtOAc extracts, with a mDP ranging from 1.32 to 1.39 (Fig. 4.3). Absorption of procyanidins across cell membranes is greatly dependent upon their mDP [21, 291]. The low mDP observed for each extract isolated in this study suggests that they would be

highly bioavailable in vivo.

117

Figure 4.3. Mean degree of polymerization for extracts prepared from whole and ground seeds using either acetone or ethyl acetate. Results not sharing a common letter are statistically different, p<0.05, n=6. We next evaluated the distribution of PCNs based on their molecular size. This was achieved using hydrophilic liquid chromatography (HILIC) HPLC to separate the intact

PCNs by average molecular weight (MW), as previously described [287]. Results were quantified as g (+)-catechin equivalents (g CE) (Fig. 4.4A).

Our results indicate that there were significantly more monomers and dimers present in the EtOAc extracts for nearly all varieties of grape seeds tested (Fig. 4.4A); with the one exception being the CS GS-acetone extract. Trimers ranged from non-detectable, to very low levels. These results are in agreement with the mDP determined by acid catalysis. In addition to the distribution of the LMW-PCNs, we also evaluated interactions between the solvent extraction system and the state of the seeds, i.e. whether they were ground or whole. In the case of monomers there was little variation between groups, except in the case of WS-acetone extracts, which contained significantly less monomers. Dimers showed the largest variation due to the solvent system, with EtOAc generating substantially increased levels. Trimers had the lowest yield and, due to undetectable levels in several of the extracts, there was no correlation between the solvent and seed state; however, WS-EtOAc extraction produced the highest yield of trimers.

118

Figure 4.4. Low molecular weight procyanidin distribution in each extract. (A) Distribution of low molecular weight procyanidins (LMW-PCNs) in each extract prepared from whole (black circle) and ground (black diamond) seeds using either acetone or ethyl acetate. HILIC -HPLC was used to determine the content of (B) monomers, (C) dimers, and (D) trimers in whole and ground seeds using either acetone or ethyl acetate extraction. Results are expressed as µg catechin equivalents (CE), mean ± SEM, n=3. Results not sharing a common letter are statistically different, p<0.05. Grape varieties are Cabernet Franc (CF), Cabernet Sauvignon (CS), and Semillon (SE).

4.3.5. Subunit composition

Bioavailability of LMW-PCNs varies not only based to their degree of polymerization, but also their acylation status. PCNs are frequently acylated with gallic acid, generating

119

gallocatechins. Galloylation has been shown to decrease the bioavailability of PCNs due to biliary excretion of these compounds [292]. Based on this, we next assessed the subunit composition of the extracts, using acid catalysis. The data indicates that the extension subunits are comprised of 4α and 4β linkages to (+)-catechin and (-)-epicatechin (Table

4.1), with the terminal subunits, as expected, being a mix of (+)-catechin and (-)- epicatechin. The presence of 4α and 4β linkages is indicative that the extract contains a mixture of B1, B2, B3, and B4 dimeric procyanidins. Interestingly, B1 and B2 in particular, are known to be present in human plasma following consumption of procyanidins [293,

294].

To further identify the components present in the extracts, HPLC-ESI-MS was employed.

Consistent with the results above, HPLC-ESI-MS analysis in the positive ion mode revealed that the extracts are complex mixtures containing monomeric catechin and/or epicatechin and procyanidin dimers, and trimers. Dimer gallates were identified in the extracts prepared using EtOAc; while gallocatechins were identified in the CF and CS extracts isolated using acetone. Further in vitro and in vivo testing may be required to determine whether these differences affect the bioactivity of the extracts.

120

4.2

0.18

0.19

0.32

0.26

0.12

0.19

0.87

0.32

0.84

1.36

0.36

±

±

±

±

±

±

±

±

±

±

±

±

Ground

20.8

78.95

96.81

82.38

17.33

80.91

17.73

138.93

201.01

102.47

119.68

189.41

EtOAc

Results are

1.41

0.64

2.48

2.23

4.46

4.36

1.14

1.68

1.07

3.17

0.86

0.67

±

±

±

±

±

±

±

±

±

±

±

±

Whole

235

137.5

63.76

58.78

57.59

165.69

191.11

271.43

148.88

176.23

168.27

150.92

phase HPLC. phase

-

CS

CF

Sem

0.12

1.56

0.58

0.33

8.34

1.23

0.15

0.06

2.87

1.08

0.59

±

±

±

±

±

±

±

±

±

±

±

nd

39

Ground

85.39

55.75

45.35

84.71

47.34

96.25

68.95

catalysis using Reverse using catalysis

Acetone

-

104.79

266.02

216.88

2.89

1.57

2.74

1.93

0.31

0.26

0.73

0.19

0.14

0.26

0.42

±

±

±

±

±

±

±

±

±

±

±

nd

Whole

81.5

108.7

33.33

14.57

39.98

51.24

19.02

97.66

51.26

17.78

104.03

g catechin g equivalents (CE), mean SEM, ± Grapen=3. varieties Cabernet are Franc (CF), Cabernet Sauvignon(CS), and



(-)-Epicatechin

(+)-Catechin

(–)-Epicatechin-(4β→2)-phloroglucinol

(+)-Catechin-(4α→2)-phloroglucinol

(-)-Epicatechin

(+)-Catechin

(–)-Epicatechin-(4β→2)-phloroglucinol

(+)-Catechin-(4α→2)-phloroglucinol

(-)-Epicatechin

(+)-Catechin

(–)-Epicatechin-(4β→2)-phloroglucinol

(+)-Catechin-(4α→2)-phloroglucinol

Cleavage product

Table 4.1: Extract subunit composition determined by acid by determined composition subunit Extract 4.1: Table Semillon (SE). Semillon expressedas

121

4.3.6. Antioxidant Capacity

Preparation of procyanidin rich extracts that undergo as little oxidation as possible during the extraction protocol is critical for their subsequent utilization. PCNs not only function in the body as regulators of cell signaling, but they also act directly as antioxidants [37]. To determine the antioxidant capacity of the extracts, a DPPH assay was employed. DPPH is a stable free radical used to determine the efficient concentration (EC50), or the amount of antioxidant required to reduce the initial concentration of DPPH by 50%. The lower the

EC50 value, the higher the antioxidant power of the compound [289]. Catechin, a known antioxidant and monomeric subunit of procyanidins, was used as a standard.

122

Figure 4.5: Antioxidant capacity of extracts prepared from whole and ground seeds using either ethyl acetate or acetone extraction for each grape variety. Data are expressed as EC50 (mg/ml) for each extract, compared to a catechin standard (line represents catechin EC50 = 0.1938 ± 0.028 mg/ml). EC50 is determined by the amount of extract required to quench 50% of the free-radical DPPH. A lower EC50 value indicates a higher antioxidant capacity. Grape varieties are Cabernet Franc (CF), Cabernet Sauvignon (CS), and Semillon (SE). Results not sharing a common letter are statistically different, p<0.05, n=3.

The EtOAc extracts demonstrated significantly higher antioxidant capabilities compared to acetone extracts (Fig. 4.5). The EtOAc extracts, regardless of whether the seeds were ground or whole, performed as well as, or better than, the catechin standard. The acetone extracts had EC50 values significantly higher than either the catechin standard or the

123

EtOAc extracts, indicating a loss of antioxidant ability. It may be possible that the extended post-extraction processing required for the acetone extracts increases their oxidation, thereby decreasing their resultant antioxidant capacity.

4.4. Conclusion

In conclusion, our results show that the use of whole seeds results in a higher yield of extract compared to that obtained when using ground seeds. In addition, the resulting concentrations of polyphenols and condensed tannins positively correlate and are more consistent in the extracts prepared using EtOAc, but not acetone, regardless of whether the seeds were whole or ground. EtOAc extracts from both whole and ground seeds, as well as acetone extracts generated from ground seeds, produced comparable levels of monomeric procyanidins; while dimers were notably higher in the EtOAc extracts as compared to the acetone extracts. Antioxidant capacity was significantly higher in all of the EtOAc extracts, regardless of seed variety or state, compared to the acetone extracts.

Our results demonstrate that EtOAc extraction using whole seeds provides a simple method to isolate a LMW-PCN-rich extract, requiring little clean-up beyond lipid removal by hexane washing. While similar results can be obtained through enrichment and clean- up of an acetone based extract, the EtOAc extraction protocol has the overall benefit of being quick, as well as maintaining antioxidant function of the extracts. In comparison to the multi-step acetone extraction, WS-EtOAc extraction also generates a significantly higher yield of dried extract. Food grade EtOAc is readily available, making this an ideal solvent for extracts that will subsequently be used in vivo in animal models or as a supplement for human consumption. Taken together, these data lead us to conclude that the WS-EtOAc extraction technique is a preferable method, facilitating generation of a dry powdered extract suitable for use in biological studies and/or as a supplement.

124

Acknowledgements

This project was supported by a USDA-Nevada Agricultural Experiment Station grant, project #: NEV0749 to MLR. The funding source had no role in the study design; in the collection, analysis and interpretation of data; in writing the report or in the decision to submit this article for publication. The authors would like to thank Drs. James Kennedy,

California State University, Fresno, CA, for helpful advice on extraction procedures, and

Isaac Jondiko, Maseno University College, Kenya, for helpful discussions in the early stages of this project. We would also like to thank Miss Brittani Trovato for her invaluable assistance in seed cleaning.

The authors have declared no conflict of interest.

125

Chapter 5

Conclusions and Future Directions

126

5.1. Conclusions and Future Directions

Cardiovascular disease (CVD) is a primary cause of death, both in the United States and globally [2, 295]. Multiple risk factors, including gender, age, and genetics are not controllable, however, hypercholesterolemia and hypertriglyceridemia can be regulated.

Elevated triglycerides are primarily treated with lifestyle changes that are difficult for many people to implement and maintain. Pharmaceutical treatments for hypertriglyceridemia are limited and primarily include fibrates and statins [296]. Statins are also the primary pharmaceutical intervention for hypercholesterolemia, however, these medications can have adverse side-effects such as rhabdomyolysis and liver damage [297]. Due to these challenges, BA recirculation and synthesis has become an attractive therapeutic target, since modulation of these pathways affects the activity of NRs such as Fxr and Shp, thereby regulating cholesterol and triglyceride homeostasis.

GSPE had previously shown the ability to decrease serum cholesterol and triglycerides in a number of different studies. Multiple studies have evaluated these effects, as well as the impact of GSPE on atherosclerotic factors including oxidized LDL and cytokines, but there are few studies that examine the link between GSPE, lipid homeostasis, and BA recirculation. In independent studies Del Bas, et al., and Jiao and colleagues showed an increase in Cyp7a1 protein and gene expression [17, 52], but this result was puzzling considering GSPE acts as an Fxr co-agonist ligand, increasing Shp expression [19]. The discovery that BA activation of Fxr in the intestine induces expression of Fgf15/19, which subsequently represses hepatic Cyp7a1, attenuating BA synthesis [125], allowed for a new perspective on this dilemma. In addition, both synthetic and natural compounds had been shown to selectively modulate BA receptors such as Fxr [228, 229, 234].

127

In Chapter 2 this dissertation demonstrated that GSPE can reduce BA recirculation by selectively altering Fxr target gene expression in the intestine. Repression of Asbt seen in this study indicated that fewer BAs could be actively transported into the enterocyte.

Additionally, we see decreased expression of the binding protein Ibabp, indicative of diminished return of BAs to the basolateral membrane for release into portal circulation.

Consequential to reduced BAs in the enterocyte, intestinal Fgf15/19 levels are attenuated resulting in the previously noted increases in BA synthesis, as evidenced by elevated hepatic Cyp7a1. Physiological results include increased fecal BA excretion with simultaneously decreased serum BA, TG, and cholesterol levels.

One particularly intriguing finding was that the Fxr-/- animals, which already display elevated Cyp7a1 levels, showed a further increase in Cyp7a1 when treated with GSPE.

This suggests that that GSPE could directly regulate Cyp7a1 expression and does not simply relieve the negative feedback on this gene. Lxr has been shown to positively regulate Cyp7a1 expression [129-131], however studies revealed that grape seed proanthocyanidins do not affect Lxrα protein levels [52]. Future studies with a potential focus on the epigenetic effects of GSPE, including microRNAs (miRNAs) and histone acetylation, are necessary to elucidate the mechanism behind this increase. In primary human hepatocytes (PHH) expression of microRNAs (miRNA) 122a and 422a are increased by CDCA, the synthetic FXR agonist GW4064, and by FGF19 [298]. There is a putative binding site for both of these miRNAs in the 3’-UTR of human CYP7A1, where they may work to destabilize CYP7A1 mRNA [298]. Inhibition of these microRNAs by miRNA-mimics (Mirs) in PHH increases expression of CYP7A1 mRNA [298]. Interestingly, it has previously been shown that procyanidins, including GSPE, can repress expression of miR122 in both Fao (rat hepatoma) and HepG2 (human hepatocarcinoma) cells [56,

128

299]. Additionally, acetylation of Histone 3 is a marker of activated transcription of Cyp7a1

[300]. Although not in a hepatic cell line, it has been demonstrated that grape seed procyanidin treatment decreased methylated H3K9, which is correlated with silenced gene expression, while simultaneously increasing the levels of acetylated H3K9, which is involved in activation of gene expression [301]. Therefore, it is possible that induction of

CYP7A1 expression is epigenetically regulated, making this an important avenue for future investigation.

In Chapter 3 we determined if GSPE functioned in the same manner as a BA sequestrant by comparing it to CHY, as well as studying the combined effects. We demonstrated that

GSPE regulates BA, cholesterol and TG metabolism differently from the BA sequestrant

CHY. Confirming our previous findings, GSPE decreased BA recirculation by inhibiting expression of Asbt, thereby limiting reabsorption via the transporter, rather than by sequestering BAs in the manner analogous to CHY. Hepatic BA synthesis is also regulated differentially by these compounds. While treating with either GSPE or CHY increases Cyp7a1, the combination also induces Cyp27a1 and Cyp8b1, potentially increasing the synthesis of both CA and CDCA. Similar to the previous study, this results in increased fecal excretion of BAs and lipids with a concomitant decrease in serum BAs and TG levels.

As reviewed in [302] there is a reciprocal relationship, with cross-talk between BAs and the microbiota, wherein increased BA levels can alter the gut microbiota and the microbe population can influence the composition of the BA pool. High levels of BAs encourage the proliferation of BA-tolerant bacteria, including Bilophila wadsworthia, Escherichia coli, and Listeria monocytogenes, and bacteria such as certain Lactobacillus and

Bifidobacterium that express bile salt hydrolase [303]. GSE treatment for sixteen weeks in

129

IL10-deficient mice increased levels of both Lactobacilli and Bacteroides [304]. Lactobacilli can alter the BA pool composition by increasing amounts of secondary BAs and their conjugates [303]; however, Bacteroides have limited bile salt hydrolase activity [305].

Increased levels of Bacteroides together with decreased levels of Lactobacilli have been linked to decreased activation of Fxr via metabolites of conjugated BAs [306, 307], resulting in decreased symptoms of nonalcoholic fatty liver disease [307]. Therefore it should be considered that GSPE may alter the microbiota resulting in similar decreases in metabolites from hydrolyzed BAs, potentially providing an additional mechanism to explain our previous findings that GSPE can reduce hepatic TG deposits [20].

Additionally, the protein coupled BA receptor, TGR5, is primarily activated by secondary

BAs, especially LCA [308]. Activation of TGR5 has been linked to metabolic processes which impact TG homeostasis, including increased glucagon like peptide 1 (GLP1) release

[309]. Activation of Glp-1 receptors on the pancreas induces insulin secretion [310], which potentiates activation of Srebp1 [108, 311]. For these reasons, it is possible that GSPE altered BA recirculation could have additional mechanisms of altering TG homeostasis, warranting further study.

In Chapter 3 we demonstrated that the cholesterol uptake transporter Npc1l1 was reduced by GSPE treatment while Abcg5/8, which exports cholesterol, was increased. The driving force behind these changes remains unclear; however alterations in the microbe population by the increased BA excretion levels may provide a possible explanation.

Lactobacillus acidophilus 4356 decreases expression of the cholesterol transporter

Npc1l1 in rats [312]. In a separate study, two strains of Lactobacillus promoted cholesterol excretion through upregulation in Abcg5/8 [313], which correlates with our results in GSPE treated mice. Considering that the BA pool can increase certain Lactobacillus strains, it is

130

possible that these changes could be mediated via modulation of the microbiome or vice versa.

Hypertriglyceridemia is a counter-indication to the use of BA sequestrants as a treatment in patients with existing hypercholesterolemia [252]. If a patient does not tolerate statins, treating these conditions can prove challenging. In agreement with previous studies [254], we showed that genes responsible for the regulation of cholesterol synthesis are induced by CHY in both the intestine and the liver. Combining GSPE with CHY resulted in attenuation of this increase in the liver, but not in the intestine. Additionally, CHY induces the expression of hepatic genes responsible for lipogenesis, which is able to be repressed by co-administration with GSPE. The results from this study provide the groundwork for future work examining the use of GSPE as a complementary therapy to BA sequestrants in these patients. Further studies would need to be undertaken to determine whether the preliminary results seen here are translated into a model organism presenting with elevated levels of both cholesterol and TGs. Golden Syrian hamsters with diet induced obesity and hypercholesterolemia could be a potential model for preliminary studies.

These animals have been previously utilized to investigate alterations in lipoprotein metabolism since they have an atherogenic lipoprotein profile that is similar to humans

[314]. Due to the lack of genetic manipulation they provide insight into the complex network of polygenetic interaction, providing more readily translatable data [314]. Studies inducing dyslipidemia with subsequent GSPE treatment for varying lengths of time would need to be completed, as preliminary studies in our lab have been short term, ranging from 14 hours to 7 days.

As previously mentioned, treating with the combination of GSPE and CHY induces

Cyp7a1, Cyp27a1 and Cyp8b1, potentially increasing the synthesis of both CA and CDCA.

131

It is also known that CHY preferentially binds to CDCA, leading to an imbalanced BA pool over time [315], shifting the balance toward CA, DCA and their conjugates. Elevated levels of cholate can increase cholesterol levels in both the serum and liver, as well as enhancing biliary and fecal excretion of cholesterol [316]. It is possible that GSPE treatment in conjunction with CHY could alter this shift in the balance of BAs by increasing the alternative BA synthesis pathway, thereby creating more CDCA and LCA, which could modify the effects over a longer period of treatment. As previously discussed, LCA is a potent ligand for TGR5 and could have additive metabolic effects. Long term effects also need to be examined because the composition of the BA pool influences NR signaling, due to the fact that CDCA is the most effective ligand for FXR followed by LCA

(synthesized from CDCA) and DCA (synthesized from CA) [80, 82, 317]. Potential negative effects also warrant examination since long term exposure of intestinal mucosa to elevated levels of BAs can have detrimental effects due to the BA’s amphipathic and cytotoxic properties [318]. Future directions should include detailed analysis to characterize both the BA pool composition and its long term effects.

In Chapter 4 we demonstrate that an ethyl acetate (EtOAc) extraction using whole seeds is a simple, yet cost and time effective method to isolate low molecular weight procyanidins. Low molecular weight procyanidins have demonstrated the potential to be absorbed into the body, mediating signaling processes [14, 319]. The extraction technique that we developed maintains the antioxidant function of the extracts, while readily generating a yield of 4.16 mg of dried extract /g of seeds. These data lead us to believe that an EtOAc extraction from whole seeds may be an avenue of future in vitro and in vivo testing.

Initial evaluation of our extracts will determine whether they alter BA, TG and cholesterol

132

homeostasis via similar mechanisms to the commercially purchased GSPE currently utilized in our lab. In vitro transactivation assays can be used to assess the ability of our extracts to act as an FXR co-agonist ligand. Alterations in expression of genes responsible for regulating BA, TG, and cholesterol synthesis can first be evaluated in vitro; however, as in vitro and in vivo results are not always consistent, in vivo studies also need to be conducted. Beneficial results in these studies open the possibility of scaling up the extraction process. The end goal of successful in vitro and in vivo testing would be to scale up the protocol to a commercial level in order to provide a value added product to the UNR vineyards in the form of a grape seed extract supplement.

The results from this dissertation support the hypothesis that GSPE can mediate TG and cholesterol levels by selectively altering FXR target genes regulating BA recirculation.

Taken together the initial chapters indicate that GSPE may provide an ideal complementary treatment for BA sequestrants, especially in situations where hypertriglyceridemia is a consideration. The final chapter of this dissertation expands the impact of our research to include optimizing the extraction of low molecular weight procyanidins. Combined with the positive health impacts of GSPE, this may translate into a product that will improve the quality of life for Nevada residents.

133

References

134

1. Centers for Disease Control and Prevention NCfHS: Centers for Disease Control and Prevention, National Center for Health Statistics. Underlying Cause of Death 1999-2014 on CDC WONDER Online Database. In Multiple Cause of Death Files, 1999-2014, 2015 edition: Vital Statistics Cooperative Program; 2015. 2. World Health Organization: The top 10 causes of death. Fact sheet N°310 2014, 2016. 3. Grundy SM, Pasternak R, Greenland P, Smith JS, Fuster V: Assessment of cardiovascular risk by use of multiple-risk-factor assessment equations: A statement for healthcare professionals from the American Heart Association and the American College of Cardiology. Journal of the American College of Cardiology 1999, 34:1348-1359. 4. Do R, Willer CJ, Schmidt EM, Sengupta S, Gao C, Peloso GM, Gustafsson S, Kanoni S, Ganna A, Chen J, et al: Common variants associated with plasma triglycerides and risk for coronary artery disease. Nat Genet 2013, 45:1345- 1352. 5. Zilversmit DB: A proposal linking atherogenesis to the interaction of endothelial lipoprotein lipase with triglyceride-rich lipoproteins. Circ Res 1973, 33:633-638. 6. Mamo JC, Proctor SD, Smith D: Retention of chylomicron remnants by arterial tissue; importance of an efficient clearance mechanism from plasma. Atherosclerosis 1998, 141 Suppl 1:S63-69. 7. Mahley RW, Innerarity TL, Rall SC, Jr., Weisgraber KH: Lipoproteins of special significance in atherosclerosis. Insights provided by studies of type III hyperlipoproteinemia. Ann N Y Acad Sci 1985, 454:209-221. 8. Clarke T, Black, LI, Stussman, BJ, Barnes, PM, Nahin, RL: Trends in the Use of Complementary Health Approaches Among Adults: United States, 2002- 2012. In National Health Statistics Reports. pp. 16. Hyattsville, MD: National Center for Health Statistics; 2015:16. 9. Vogiatzoglou A, Mulligan AA, Luben RN, Lentjes MA, Heiss C, Kelm M, Merx MW, Spencer JP, Schroeter H, Kuhnle GG: Assessment of the dietary intake of total flavan-3-ols, monomeric flavan-3-ols, proanthocyanidins and theaflavins in the European Union. Br J Nutr 2014, 111:1463-1473.

135

10. Wang Y, Chung SJ, Song WO, Chun OK: Estimation of Daily Proanthocyanidin Intake and Major Food Sources in the U.S. Diet. Journal of Nutrition 2011, 141:447-452. 11. Ovaskainen ML, Torronen R, Koponen JM, Sinkko H, Hellstrom J, Reinivuo H, Mattila P: Dietary intake and major food sources of polyphenols in Finnish adults. J Nutr 2008, 138:562-566. 12. Bravo L: Polyphenols: chemistry, dietary sources, metabolism, and nutritional significance. Nutr Rev 1998, 56:317-333. 13. Hui C, Qi X, Qianyong Z, Xiaoli P, Jundong Z, Mantian M: Flavonoids, flavonoid subclasses and breast cancer risk: a meta-analysis of epidemiologic studies. PLoS One 2013, 8:e54318. 14. Ou KQ, Gu LW: Absorption and metabolism of proanthocyanidins. Journal of Functional Foods 2014, 7:43-53. 15. Manach C, Scalbert A, Morand C, Remesy C, Jimenez L: Polyphenols: food sources and bioavailability. Am J Clin Nutr 2004, 79:727-747. 16. Schwitters B: Dr. Masquelier's Mark on Health. Alfa Omega Editrice; 2004. 17. Del Bas JM, Fernandez-Larrea J, Blay M, Ardevol A, Salvado MJ, Arola L, Blade C: Grape seed procyanidins improve atherosclerotic risk index and induce liver CYP7A1 and SHP expression in healthy rats. FASEB J 2005, 19:479- 481. 18. Del Bas JM, Ricketts ML, Baiges I, Quesada H, Ardevol A, Salvado MJ, Pujadas G, Blay M, Arola L, Blade C, et al: Dietary procyanidins lower triglyceride levels signaling through the nuclear receptor small heterodimer partner. Mol Nutr Food Res 2008, 52:1172-1181. 19. Del Bas JM, Ricketts ML, Vaque M, Sala E, Quesada H, Ardevol A, Salvado MJ, Blay M, Arola L, Moore DD, et al: Dietary procyanidins enhance transcriptional activity of bile acid-activated FXR in vitro and reduce triglyceridemia in vivo in a FXR-dependent manner. Mol Nutr Food Res 2009, 53:805-814. 20. Downing LE, Heidker RM, Caiozzi GC, Wong BS, Rodriguez K, Del Rey F, Ricketts M-L: A Grape Seed Procyanidin Extract Ameliorates Fructose- Induced Hypertriglyceridemia in Rats via Enhanced Fecal Bile Acid and

136

Cholesterol Excretion and Inhibition of Hepatic Lipogenesis. PLoS ONE 2015, 10:e0140267. 21. Deprez S, Mila I, Huneau JF, Tome D, Scalbert A: Transport of proanthocyanidin dimer, trimer, and polymer across monolayers of human intestinal epithelial Caco-2 cells. Antioxid Redox Signal 2001, 3:957-967. 22. Serafini M, Bugianesi R, Maiani G, Valtuena S, De Santis S, Crozier A: Plasma antioxidants from chocolate - Dark chocolate may offer its consumers health benefits the milk variety cannot match. Nature 2003, 424:1013-1013. 23. Bell JRC, Donovan JL, Wong R, Waterhouse AL, German JB, Walzem RL, Kasim-Karakas SE: (+)-Catechin in human plasma after ingestion of a single serving of reconstituted red wine. American Journal of Clinical Nutrition 2000, 71:103-108. 24. Rein D, Lotito S, Holt RR, Keen CL, Schmitz HH, Fraga CG: Epicatechin in Human Plasma: In Vivo Determination and Effect of Chocolate Consumption on Plasma Oxidation Status. The Journal of Nutrition 2000, 130:2109S-2114S. 25. Stoupi S, Williamson G, Viton F, Barron D, King LJ, Brown JE, Clifford MN: In Vivo Bioavailability, Absorption, Excretion, and Pharmacokinetics of C-14 Procyanidin B2 in Male Rats. Drug Metabolism and Disposition 2010, 38:287- 291. 26. Feringa HH, Laskey DA, Dickson JE, Coleman CI: The effect of grape seed extract on cardiovascular risk markers: a meta-analysis of randomized controlled trials. J Am Diet Assoc 2011, 111:1173-1181. 27. van Mierlo LA, Zock PL, van der Knaap HC, Draijer R: Grape polyphenols do not affect vascular function in healthy men. J Nutr 2010, 140:1769-1773. 28. Kar P, Laight D, Rooprai HK, Shaw KM, Cummings M: Effects of grape seed extract in Type 2 diabetic subjects at high cardiovascular risk: a double blind randomized placebo controlled trial examining metabolic markers, vascular tone, inflammation, oxidative stress and insulin sensitivity. Diabet Med 2009, 26:526-531. 29. Sivaprakasapillai B, Edirisinghe I, Randolph J, Steinberg F, Kappagoda T: Effect of grape seed extract on blood pressure in subjects with the metabolic syndrome. Metabolism 2009, 58:1743-1746.

137

30. Sano A, Uchida R, Saito M, Shioya N, Komori Y, Tho Y, Hashizume N: Beneficial effects of grape seed extract on malondialdehyde-modified LDL. J Nutr Sci Vitaminol (Tokyo) 2007, 53:174-182. 31. Ward NC, Hodgson JM, Croft KD, Burke V, Beilin LJ, Puddey IB: The combination of vitamin C and grape-seed polyphenols increases blood pressure: a randomized, double-blind, placebo-controlled trial. J Hypertens 2005, 23:427-434. 32. Clifton PM: Effect of Grape Seed Extract and Quercetin on Cardiovascular and Endothelial Parameters in High-Risk Subjects. J Biomed Biotechnol 2004, 2004:272-278. 33. Vigna GB, Costantini F, Aldini G, Carini M, Catapano A, Schena F, Tangerini A, Zanca R, Bombardelli E, Morazzoni P, et al: Effect of a standardized grape seed extract on low-density lipoprotein susceptibility to oxidation in heavy smokers. Metabolism 2003, 52:1250-1257. 34. Preuss HG, Wallerstedt D, Talpur N, Tutuncuoglu SO, Echard B, Myers A, Bui M, Bagchi D: Effects of niacin-bound chromium and grape seed proanthocyanidin extract on the lipid profile of hypercholesterolemic subjects: a pilot study. J Med 2000, 31:227-246. 35. Chao CL, Chang NC, Weng CS, Lee KR, Kao ST, Hsu JC, Ho FM: Grape seed extract ameliorates tumor necrosis factor-alpha-induced inflammatory status of human umbilical vein endothelial cells. Eur J Nutr 2011, 50:401- 409. 36. Kiyici A, Okudan N, Gokbel H, Belviranli M: The effect of grape seed extracts on serum paraoxonase activities in streptozotocin-induced diabetic rats. J Med Food 2010, 13:725-728. 37. Lotito SB, Actis-Goretta L, Renart ML, Caligiuri M, Rein D, Schmitz HH, Steinberg FM, Keen CL, Fraga CG: Influence of oligomer chain length on the antioxidant activity of procyanidins. Biochem Biophys Res Commun 2000, 276:945-951. 38. Fernandez-Iglesias A, Pajuelo D, Quesada H, Diaz S, Blade C, Arola L, Salvado MJ, Mulero M: Grape seed proanthocyanidin extract improves the hepatic glutathione metabolism in obese Zucker rats. Mol Nutr Food Res 2014, 58:727-737.

138

39. Koga T, Moro K, Nakamori K, Yamakoshi J, Hosoyama H, Kataoka S, Ariga T: Increase of antioxidative potential of rat plasma by oral administration of proanthocyanidin-rich extract from grape seeds. J Agric Food Chem 1999, 47:1892-1897. 40. Ayala A, Muñoz MF, Argüelles S: Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal. Oxidative Medicine and Cellular Longevity 2014, 2014:1-31. 41. Yamakoshi J, Kataoka S, Koga T, Ariga T: Proanthocyanidin-rich extract from grape seeds attenuates the development of aortic atherosclerosis in cholesterol-fed rabbits. Atherosclerosis 1999, 142:139-149. 42. Witztum JL, Steinberg D: Role of oxidized low density lipoprotein in atherogenesis. J Clin Invest 1991, 88:1785-1792. 43. Steinbrecher UP, Parthasarathy S, Leake DS, Witztum JL, Steinberg D: Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids. Proc Natl Acad Sci U S A 1984, 81:3883-3887. 44. Morel DW, DiCorleto PE, Chisolm GM: Endothelial and smooth muscle cells alter low density lipoprotein in vitro by free radical oxidation. Arteriosclerosis 1984, 4:357-364. 45. Choi CS, Chung HK, Choi MK, Kang MH: Effects of grape pomace on the antioxidant defense system in diet-induced hypercholesterolemic rabbits. Nutr Res Pract 2010, 4:114-120. 46. Pinent M, Blade MC, Salvado MJ, Arola L, Hackl H, Quackenbush J, Trajanoski Z, Ardevol A: Grape-seed derived procyanidins interfere with adipogenesis of 3T3-L1 cells at the onset of differentiation. Int J Obes (Lond) 2005, 29:934- 941. 47. Arora P, Ansari S, Nazish I: Study of antiobesity effects of ethanolic and water extracts of grapes seeds. J Complement Integr Med 2011, 8. 48. Caimari A, del Bas JM, Crescenti A, Arola L: Low doses of grape seed procyanidins reduce adiposity and improve the plasma lipid profile in hamsters. Int J Obes (Lond) 2013, 37:576-583. 49. Decorde K, Teissedre PL, Sutra T, Ventura E, Cristol JP, Rouanet JM: Chardonnay grape seed procyanidin extract supplementation prevents

139

high-fat diet-induced obesity in hamsters by improving adipokine imbalance and oxidative stress markers. Mol Nutr Food Res 2009, 53:659- 666. 50. Baiges I, Palmfeldt J, Blade C, Gregersen N, Arola L: Lipogenesis is decreased by grape seed proanthocyanidins according to liver proteomics of rats fed a high fat diet. Mol Cell Proteomics 2010, 9:1499-1513. 51. Castell-Auvi A, Cedo L, Pallares V, Blay M, Pinent M, Ardevol A: Grape seed procyanidins improve beta-cell functionality under lipotoxic conditions due to their lipid-lowering effect. J Nutr Biochem 2013, 24:948-953. 52. Jiao R, Zhang Z, Yu H, Huang Y, Chen ZY: Hypocholesterolemic activity of grape seed proanthocyanidin is mediated by enhancement of bile acid excretion and up-regulation of CYP7A1. J Nutr Biochem 2010, 21:1134-1139. 53. Quesada H, del Bas JM, Pajuelo D, Diaz S, Fernandez-Larrea J, Pinent M, Arola L, Salvado MJ, Blade C: Grape seed proanthocyanidins correct dyslipidemia associated with a high-fat diet in rats and repress genes controlling lipogenesis and VLDL assembling in liver. International Journal of Obesity 2009, 33:1007-1012. 54. Quesada H, Diaz S, Pajuelo D, Fernandez-Iglesias A, Garcia-Vallve S, Pujadas G, Salvado MJ, Arola L, Blade C: The lipid-lowering effect of dietary proanthocyanidins in rats involves both chylomicron-rich and VLDL-rich fractions. Br J Nutr 2012, 108:208-217. 55. Mansouri E, Khorsandi L, Zare Moaiedi M: Grape Seed Proanthocyanidin Extract Improved some of Biochemical Parameters and Antioxidant Disturbances of Red Blood Cells in Diabetic Rats. Iran J Pharm Res 2015, 14:329-334. 56. Baselga-Escudero L, Blade C, Ribas-Latre A, Casanova E, Salvado MJ, Arola L, Arola-Arnal A: Grape seed proanthocyanidins repress the hepatic lipid regulators miR-33 and miR-122 in rats. Mol Nutr Food Res 2012, 56:1636- 1646. 57. Baselga-Escudero L, Pascual-Serrano A, Ribas-Latre A, Casanova E, Salvado MJ, Arola L, Arola-Arnal A, Blade C: Long-term supplementation with a low dose of proanthocyanidins normalized liver miR-33a and miR-122 levels in high-fat diet-induced obese rats. Nutr Res 2015, 35:337-345.

140

58. Horie T, Ono K, Horiguchi M, Nishi H, Nakamura T, Nagao K, Kinoshita M, Kuwabara Y, Marusawa H, Iwanaga Y, et al: MicroRNA-33 encoded by an intron of sterol regulatory element-binding protein 2 (Srebp2) regulates HDL in vivo. Proc Natl Acad Sci U S A 2010, 107:17321-17326. 59. Esau C, Davis S, Murray SF, Yu XX, Pandey SK, Pear M, Watts L, Booten SL, Graham M, McKay R, et al: miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab 2006, 3:87-98. 60. Rottiers V, Naar AM: MicroRNAs in metabolism and metabolic disorders. Nat Rev Mol Cell Biol 2012, 13:239-250. 61. Ramirez CM, Goedeke L, Fernandez-Hernando C: "Micromanaging" metabolic syndrome. Cell Cycle 2011, 10:3249-3252. 62. Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M: Silencing of microRNAs in vivo with 'antagomirs'. Nature 2005, 438:685- 689. 63. Najafi-Shoushtari SH, Kristo F, Li Y, Shioda T, Cohen DE, Gerszten RE, Naar AM: MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science 2010, 328:1566-1569. 64. Guerrero L, Margalef M, Pons Z, Quinones M, Arola L, Arola-Arnal A, Muguerza B: Serum metabolites of proanthocyanidin-administered rats decrease lipid synthesis in HepG2 cells. J Nutr Biochem 2013, 24:2092-2099. 65. Bunce CM, Campbell MJ, SpringerLink: Nuclear receptors : current concepts and future challenges. 66. Aranda A, Pascual A: Nuclear hormone receptors and gene expression. Physiol Rev 2001, 81:1269-1304. 67. Burris TP, McCabe ERB: Nuclear receptors and genetic disease. San Diego, Calif.: Academic Press; 2001. 68. Gorski J, Shyamala G, Toft D: Interrelationships of nuclear and cytoplasmic estrogen receptors. Curr Top Dev Biol 1969, 4:149-167. 69. Gorski J, Notides A, Toft D, Smith DE: Mechanism of sex steroid action. Clin Obstet Gynecol 1967, 10:17-28. 70. Gorski J, Toft D, Shyamala G, Smith D, Notides A: Hormone receptors: studies on the interaction of estrogen with the uterus. Recent Prog Horm Res 1968, 24:45-80.

141

71. Zhang Z, Burch PE, Cooney AJ, Lanz RB, Pereira FA, Wu J, Gibbs RA, Weinstock G, Wheeler DA: Genomic analysis of the nuclear receptor family: new insights into structure, regulation, and evolution from the rat genome. Genome Res 2004, 14:580-590. 72. Kornberg RD: The molecular basis of eukaryotic transcription. Proc Natl Acad Sci U S A 2007, 104:12955-12961. 73. Glass CK, Ogawa S: Combinatorial roles of nuclear receptors in inflammation and immunity. Nat Rev Immunol 2006, 6:44-55. 74. Nuclear Receptors Nomenclature C: A unified nomenclature system for the nuclear receptor superfamily. Cell 1999, 97:161-163. 75. Andersson AM, Granqvist CG, Stevens JR: Electrochromic Li(x)WO(3)/poymer laminate/Li(y)V(2)O(5) device: toward an all-solid-state smart window. Appl Opt 1989, 28:3295-3302. 76. Zhao Y, Bruemmer D: NR4A orphan nuclear receptors: transcriptional regulators of gene expression in metabolism and vascular biology. Arterioscler Thromb Vasc Biol 2010, 30:1535-1541. 77. Thomas C, Pellicciari R, Pruzanski M, Auwerx J, Schoonjans K: Targeting bile- acid signalling for metabolic diseases. Nat Rev Drug Discov 2008, 7:678-693. 78. Seol W, Choi HS, Moore DD: Isolation of proteins that interact specifically with the retinoid X receptor: two novel orphan receptors. Mol Endocrinol 1995, 9:72-85. 79. Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T, Noonan DJ, Burka LT, McMorris T, Lamph WW, et al: Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995, 81:687-693. 80. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B: Identification of a nuclear receptor for bile acids. Science 1999, 284:1362-1365. 81. Wang H, Chen J, Hollister K, Sowers LC, Forman BM: Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999, 3:543-553. 82. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Willson TM, Zavacki AM, Moore DD, Lehmann JM: Bile acids: natural ligands for an orphan nuclear receptor. Science 1999, 284:1365- 1368.

142

83. Mi LZ, Devarakonda S, Harp JM, Han Q, Pellicciari R, Willson TM, Khorasanizadeh S, Rastinejad F: Structural basis for bile acid binding and activation of the nuclear receptor FXR. Mol Cell 2003, 11:1093-1100. 84. Wang S, Lai K, Moy FJ, Bhat A, Hartman HB, Evans MJ: The nuclear hormone receptor farnesoid X receptor (FXR) is activated by androsterone. Endocrinology 2006, 147:4025-4033. 85. Maloney PR, Parks DJ, Haffner CD, Fivush AM, Chandra G, Plunket KD, Creech KL, Moore LB, Wilson JG, Lewis MC, et al: Identification of a chemical tool for the orphan nuclear receptor FXR. J Med Chem 2000, 43:2971-2974. 86. Downes M, Verdecia MA, Roecker AJ, Hughes R, Hogenesch JB, Kast-Woelbern HR, Bowman ME, Ferrer JL, Anisfeld AM, Edwards PA, et al: A chemical, genetic, and structural analysis of the nuclear bile acid receptor FXR. Mol Cell 2003, 11:1079-1092. 87. Carter BA, Taylor OA, Prendergast DR, Zimmerman TL, Von Furstenberg R, Moore DD, Karpen SJ: Stigmasterol, a soy lipid-derived phytosterol, is an antagonist of the bile acid nuclear receptor FXR. Pediatr Res 2007, 62:301- 306. 88. Urizar NL, Liverman AB, Dodds DT, Silva FV, Ordentlich P, Yan Y, Gonzalez FJ, Heyman RA, Mangelsdorf DJ, Moore DD: A natural product that lowers cholesterol as an antagonist ligand for FXR. Science 2002, 296:1703-1706. 89. Zhu Y, Li F, Guo GL: Tissue-specific function of farnesoid X receptor in liver and intestine. Pharmacol Res 2011, 63:259-265. 90. Thomas AM, Hart SN, Kong B, Fang J, Zhong XB, Guo GL: Genome-wide tissue-specific farnesoid X receptor binding in mouse liver and intestine. Hepatology 2010, 51:1410-1419. 91. Laffitte BA, Kast HR, Nguyen CM, Zavacki AM, Moore DD, Edwards PA: Identification of the DNA binding specificity and potential target genes for the farnesoid X-activated receptor. J Biol Chem 2000, 275:10638-10647. 92. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, Fruchart JC, Dallongeville J, Hum DW, Kuipers F, Staels B: Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002, 109:961-971.

143

93. Lu TT, Repa JJ, Mangelsdorf DJ: Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J Biol Chem 2001, 276:37735-37738. 94. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ: Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000, 102:731-744. 95. Kim I, Ahn SH, Inagaki T, Choi M, Ito S, Guo GL, Kliewer SA, Gonzalez FJ: Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine. J Lipid Res 2007, 48:2664-2672. 96. Aarnisalo P, Kim CH, Lee JW, Perlmann T: Defining requirements for heterodimerization between the retinoid X receptor and the orphan nuclear receptor Nurr1. J Biol Chem 2002, 277:35118-35123. 97. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM: The nuclear receptor superfamily: the second decade. Cell 1995, 83:835-839. 98. Seol W, Choi HS, Moore DD: An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimerizes with other receptors. Science 1996, 272:1336-1339. 99. Johansson L, Bavner A, Thomsen JS, Farnegardh M, Gustafsson JA, Treuter E: The orphan nuclear receptor SHP utilizes conserved LXXLL-related motifs for interactions with ligand-activated estrogen receptors. Mol Cell Biol 2000, 20:1124-1133. 100. Hoeke MO, Heegsma J, Hoekstra M, Moshage H, Faber KN: Human FXR regulates SHP expression through direct binding to an LRH-1 binding site, independent of an IR-1 and LRH-1. PLoS One 2014, 9:e88011. 101. Chong HK, Infante AM, Seo YK, Jeon TI, Zhang Y, Edwards PA, Xie X, Osborne TF: Genome-wide interrogation of hepatic FXR reveals an asymmetric IR-1 motif and synergy with LRH-1. Nucleic Acids Res 2010, 38:6007-6017. 102. Zhang Y, Hagedorn CH, Wang L: Role of nuclear receptor SHP in metabolism and cancer. Biochim Biophys Acta 2011, 1812:893-908. 103. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME, et al: A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000, 6:517-526.

144

104. Watanabe M, Houten SM, Wang L, Moschetta A, Mangelsdorf DJ, Heyman RA, Moore DD, Auwerx J: Bile acids lower triglyceride levels via a pathway involving FXR, SHP, and SREBP-1c. J Clin Invest 2004, 113:1408-1418. 105. Yamagata K, Daitoku H, Shimamoto Y, Matsuzaki H, Hirota K, Ishida J, Fukamizu A: Bile acids regulate gluconeogenic gene expression via small heterodimer partner-mediated repression of hepatocyte nuclear factor 4 and Foxo1. J Biol Chem 2004, 279:23158-23165. 106. Shimomura I, Shimano H, Horton JD, Goldstein JL, Brown MS: Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. Journal of Clinical Investigation 1997, 99:838-845. 107. Shimano H, Yahagi N, Amemiya-Kudo M, Hasty AH, Osuga J, Tamura Y, Shionoiri F, Iizuka Y, Ohashi K, Harada K, et al: Sterol regulatory element- binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes. J Biol Chem 1999, 274:35832-35839. 108. Foretz M, Guichard C, Ferre P, Foufelle F: Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci U S A 1999, 96:12737-12742. 109. Foretz M, Pacot C, Dugail I, Lemarchand P, Guichard C, Le Liepvre X, Berthelier-Lubrano C, Spiegelman B, Kim JB, Ferre P, Foufelle F: ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene expression by glucose. Mol Cell Biol 1999, 19:3760-3768. 110. Voet D, Voet JG: Biochemistry. 4th edn. Hoboken, NJ: John Wiley & Sons; 2011. 111. Merkel M, Heeren J: Give me A5 for lipoprotein hydrolysis! J Clin Invest 2005, 115:2694-2696. 112. Inoue J, Tanaka M, Nanmoku M, Yashiro T, Sato R: Stabilization of small heterodimer partner mRNA by grape seed procyanidins extract in cultured hepatocytes. Mol Nutr Food Res 2011, 55:1052-1058. 113. Houten SM, Watanabe M, Auwerx J: Endocrine functions of bile acids. EMBO J 2006, 25:1419-1425. 114. Russell DW: The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem 2003, 72:137-174.

145

115. Hofmann AF: Bile Acids: The Good, the Bad, and the Ugly. News Physiol Sci 1999, 14:24-29. 116. Russell DW, Setchell KD: Bile acid biosynthesis. Biochemistry 1992, 31:4737- 4749. 117. Arias IM, Boyer JL: The liver : biology and pathobiology. 5th edn. Philadelphia: Lippincott Williams & Wilkins; 2009. 118. Lehninger AL, Nelson DL, Cox MM: Lehninger principles of biochemistry. 5th edn. New York: W.H. Freeman; 2008. 119. Noshiro M, Nishimoto M, Morohashi K, Okuda K: Molecular cloning of cDNA for cholesterol 7 alpha-hydroxylase from rat liver microsomes. Nucleotide sequence and expression. FEBS Lett 1989, 257:97-100. 120. Li YC, Wang DP, Chiang JY: Regulation of cholesterol 7 alpha-hydroxylase in the liver. Cloning, sequencing, and regulation of cholesterol 7 alpha- hydroxylase mRNA. J Biol Chem 1990, 265:12012-12019. 121. Jelinek DF, Andersson S, Slaughter CA, Russell DW: Cloning and regulation of cholesterol 7 alpha-hydroxylase, the rate-limiting enzyme in bile acid biosynthesis. J Biol Chem 1990, 265:8190-8197. 122. Schwarz M, Russell DW, Dietschy JM, Turley SD: Marked reduction in bile acid synthesis in cholesterol 7alpha-hydroxylase-deficient mice does not lead to diminished tissue cholesterol turnover or to hypercholesterolemia. J Lipid Res 1998, 39:1833-1843. 123. Hughes SE: Differential expression of the fibroblast growth factor receptor (FGFR) multigene family in normal human adult tissues. J Histochem Cytochem 1997, 45:1005-1019. 124. Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF, Donahee M, Wang DY, Mansfield TA, Kliewer SA, et al: Definition of a novel growth factor- dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev 2003, 17:1581-1591. 125. Inagaki T, Choi M, Moschetta A, Peng L, Cummins CL, McDonald JG, Luo G, Jones SA, Goodwin B, Richardson JA, et al: Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2005, 2:217-225.

146

126. Xie MH, Holcomb I, Deuel B, Dowd P, Huang A, Vagts A, Foster J, Liang J, Brush J, Gu Q, et al: FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine 1999, 11:729-735. 127. Yu C, Wang F, Jin C, Huang X, McKeehan WL: Independent repression of bile acid synthesis and activation of c-Jun N-terminal kinase (JNK) by activated hepatocyte fibroblast growth factor receptor 4 (FGFR4) and bile acids. J Biol Chem 2005, 280:17707-17714. 128. Song KH, Li T, Owsley E, Strom S, Chiang JY: Bile acids activate fibroblast growth factor 19 signaling in human hepatocytes to inhibit cholesterol 7alpha-hydroxylase gene expression. Hepatology 2009, 49:297-305. 129. Forman BM, Ruan B, Chen J, Schroepfer GJ, Jr., Evans RM: The orphan nuclear receptor LXRalpha is positively and negatively regulated by distinct products of mevalonate metabolism. Proc Natl Acad Sci U S A 1997, 94:10588-10593. 130. Janowski BA, Willy PJ, Devi TR, Falck JR, Mangelsdorf DJ: An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 1996, 383:728-731. 131. Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL, Sundseth SS, Winegar DA, Blanchard DE, Spencer TA, Willson TM: Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 1997, 272:3137-3140. 132. Shin DJ, Osborne TF: Peroxisome proliferator-activated receptor-gamma coactivator-1alpha activation of CYP7A1 during food restriction and diabetes is still inhibited by small heterodimer partner. J Biol Chem 2008, 283:15089-15096. 133. Li-Hawkins J, Gafvels M, Olin M, Lund EG, Andersson U, Schuster G, Bjorkhem I, Russell DW, Eggertsen G: Cholic acid mediates negative feedback regulation of bile acid synthesis in mice. J Clin Invest 2002, 110:1191-1200. 134. Jonsson AK, Andersson L, Rask L: Complete sequences of DQA1 and DQB1 cDNA clones corresponding to the DQw4 specificity. Immunogenetics 1989, 30:232-234.

147

135. Forsgren P, Modig J, Gerdin B, Axelsson B, Dahlback M: Intrapulmonary deposition of aerosolized Evans blue dye and liposomes in an experimental porcine model of early ARDS. Ups J Med Sci 1990, 95:117-136. 136. Pikuleva IA, Babiker A, Waterman MR, Bjorkhem I: Activities of recombinant human cytochrome P450c27 (CYP27) which produce intermediates of alternative bile acid biosynthetic pathways. J Biol Chem 1998, 273:18153- 18160. 137. Ferdinandusse S, Houten SM: Peroxisomes and bile acid biosynthesis. Biochim Biophys Acta 2006, 1763:1427-1440. 138. Cali JJ, Russell DW: Characterization of human sterol 27-hydroxylase. A mitochondrial cytochrome P-450 that catalyzes multiple oxidation reaction in bile acid biosynthesis. J Biol Chem 1991, 266:7774-7778. 139. Schwarz M, Russell DW, Dietschy JM, Turley SD: Alternate pathways of bile acid synthesis in the cholesterol 7alpha-hydroxylase knockout mouse are not upregulated by either cholesterol or cholestyramine feeding. J Lipid Res 2001, 42:1594-1603. 140. Pullinger CR, Eng C, Salen G, Shefer S, Batta AK, Erickson SK, Verhagen A, Rivera CR, Mulvihill SJ, Malloy MJ, Kane JP: Human cholesterol 7alpha- hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J Clin Invest 2002, 110:109-117. 141. Repa JJ, Lund EG, Horton JD, Leitersdorf E, Russell DW, Dietschy JM, Turley SD: Disruption of the sterol 27-hydroxylase gene in mice results in hepatomegaly and hypertriglyceridemia. Reversal by cholic acid feeding. J Biol Chem 2000, 275:39685-39692. 142. Li-Hawkins J, Lund EG, Turley SD, Russell DW: Disruption of the oxysterol 7alpha-hydroxylase gene in mice. J Biol Chem 2000, 275:16536-16542. 143. Schwarz M, Lund EG, Lathe R, Bjorkhem I, Russell DW: Identification and characterization of a mouse oxysterol 7alpha-hydroxylase cDNA. J Biol Chem 1997, 272:23995-24001. 144. Peters AM, Walters JR: Recycling rate of bile acids in the enterohepatic recirculation as a major determinant of whole body 75SeHCAT retention. Eur J Nucl Med Mol Imaging 2013, 40:1618-1621.

148

145. Alrefai WA, Gill RK: Bile acid transporters: structure, function, regulation and pathophysiological implications. Pharm Res 2007, 24:1803-1823. 146. Dietschy JM: Mechanisms for the intestinal absorption of bile acids. J Lipid Res 1968, 9:297-309. 147. Dawson PA, Lan T, Rao A: Bile acid transporters. J Lipid Res 2009, 50:2340- 2357. 148. Cohen DE: Balancing cholesterol synthesis and absorption in the gastrointestinal tract. J Clin Lipidol 2008, 2:S1-3. 149. Dawson PA, Haywood J, Craddock AL, Wilson M, Tietjen M, Kluckman K, Maeda N, Parks JS: Targeted deletion of the ileal bile acid transporter eliminates enterohepatic cycling of bile acids in mice. J Biol Chem 2003, 278:33920- 33927. 150. Wong MH, Oelkers P, Craddock AL, Dawson PA: Expression cloning and characterization of the hamster ileal sodium-dependent bile acid transporter. J Biol Chem 1994, 269:1340-1347. 151. Shneider BL, Dawson PA, Christie DM, Hardikar W, Wong MH, Suchy FJ: Cloning and molecular characterization of the ontogeny of a rat ileal sodium-dependent bile acid transporter. J Clin Invest 1995, 95:745-754. 152. Neimark E, Chen F, Li X, Shneider BL: Bile acid-induced negative feedback regulation of the human ileal bile acid transporter. Hepatology 2004, 40:149- 156. 153. Praslickova D, Torchia EC, Sugiyama MG, Magrane EJ, Zwicker BL, Kolodzieyski L, Agellon LB: The ileal lipid binding protein is required for efficient absorption and transport of bile acids in the distal portion of the murine small intestine. PLoS One 2012, 7:e50810. 154. Oelkers P, Dawson PA: Cloning and chromosomal localization of the human ileal lipid-binding protein. Biochim Biophys Acta 1995, 1257:199-202. 155. Zimmerman AW, van Moerkerk HT, Veerkamp JH: Ligand specificity and conformational stability of human fatty acid-binding proteins. Int J Biochem Cell Biol 2001, 33:865-876. 156. Sacchettini JC, Hauft SM, Van Camp SL, Cistola DP, Gordon JI: Developmental and structural studies of an intracellular lipid binding protein expressed in the ileal epithelium. J Biol Chem 1990, 265:19199-19207.

149

157. Gong YZ, Everett ET, Schwartz DA, Norris JS, Wilson FA: MOLECULAR- CLONING, TISSUE DISTRIBUTION, AND EXPRESSION OF A 14-KDA BILE ACID-BINDING PROTEIN FROM RAT ILEAL CYTOSOL. Proceedings of the National Academy of Sciences of the United States of America 1994, 91:4741- 4745. 158. Lin MC, Kramer W, Wilson FA: Identification of cytosolic and microsomal bile acid-binding proteins in rat ileal enterocytes. J Biol Chem 1990, 265:14986- 14995. 159. Kramer W, Girbig F, Gutjahr U, Kowalewski S, Jouvenal K, Muller G, Tripier D, Wess G: Intestinal bile acid absorption. Na(+)-dependent bile acid transport activity in rabbit small intestine correlates with the coexpression of an integral 93-kDa and a peripheral 14-kDa bile acid-binding membrane protein along the duodenum-ileum axis. J Biol Chem 1993, 268:18035-18046. 160. Fang C, Filipp FV, Smith JW: Unusual binding of ursodeoxycholic acid to ileal bile acid binding protein: role in activation of FXRalpha. J Lipid Res 2012, 53:664-673. 161. Nakahara M, Furuya N, Takagaki K, Sugaya T, Hirota K, Fukamizu A, Kanda T, Fujii H, Sato R: Ileal bile acid-binding protein, functionally associated with the farnesoid X receptor or the ileal bile acid transporter, regulates bile acid activity in the small intestine. Journal of Biological Chemistry 2005, 280:42283-42289. 162. Grober J, Zaghini I, Fujii H, Jones SA, Kliewer SA, Willson TM, Ono T, Besnard P: Identification of a bile acid-responsive element in the human ileal bile acid-binding protein gene. Involvement of the farnesoid X receptor/9-cis- retinoic acid receptor heterodimer. J Biol Chem 1999, 274:29749-29754. 163. Seward DJ, Koh AS, Boyer JL, Ballatori N: Functional complementation between a novel mammalian polygenic transport complex and an evolutionarily ancient organic solute transporter, OSTalpha-OSTbeta. J Biol Chem 2003, 278:27473-27482. 164. Frankenberg T, Rao A, Chen F, Haywood J, Shneider BL, Dawson PA: Regulation of the mouse organic solute transporter alpha-beta, Ostalpha- Ostbeta, by bile acids. Am J Physiol Gastrointest Liver Physiol 2006, 290:G912-922.

150

165. Lee H, Zhang Y, Lee FY, Nelson SF, Gonzalez FJ, Edwards PA: FXR regulates organic solute transporters alpha and beta in the adrenal gland, kidney, and intestine. J Lipid Res 2006, 47:201-214. 166. Lidofsky SD, Fitz JG, Weisiger RA, Scharschmidt BF: Hepatic taurocholate uptake is electrogenic and influenced by transmembrane potential difference. Am J Physiol 1993, 264:G478-485. 167. Meier PJ: Molecular mechanisms of hepatic bile salt transport from sinusoidal blood into bile. Am J Physiol 1995, 269:G801-812. 168. Boyer JL, Ng OC, Ananthanarayanan M, Hofmann AF, Schteingart CD, Hagenbuch B, Stieger B, Meier PJ: Expression and characterization of a functional rat liver Na+ bile acid cotransport system in COS-7 cells. Am J Physiol 1994, 266:G382-387. 169. Cattori V, Eckhardt U, Hagenbuch B: Molecular cloning and functional characterization of two alternatively spliced Ntcp isoforms from mouse liver1. Biochim Biophys Acta 1999, 1445:154-159. 170. Hagenbuch B, Meier PJ: Molecular cloning, chromosomal localization, and functional characterization of a human liver Na+/bile acid cotransporter. J Clin Invest 1994, 93:1326-1331. 171. Kullak-Ublick GA, Ismair MG, Kubitz R, Schmitt M, Haussinger D, Stieger B, Hagenbuch B, Meier PJ, Beuers U, Paumgartner G: Stable expression and functional characterization of a Na+-taurocholate cotransporting green fluorescent protein in human hepatoblastoma HepG2 cells. Cytotechnology 2000, 34:1-9. 172. Weinman SA: Electrogenicity of Na(+)-coupled bile acid transporters. Yale J Biol Med 1997, 70:331-340. 173. Stieger B: The role of the sodium-taurocholate cotransporting polypeptide (NTCP) and of the bile salt export pump (BSEP) in physiology and pathophysiology of bile formation. Handb Exp Pharmacol 2011:205-259. 174. Stieger B, Meier Y, Meier PJ: The bile salt export pump. Pflugers Arch 2007, 453:611-620. 175. Misra S, Varticovski L, Arias IM: Mechanisms by which cAMP increases bile acid secretion in rat liver and canalicular membrane vesicles. Am J Physiol Gastrointest Liver Physiol 2003, 285:G316-324.

151

176. Misra S, Ujhazy P, Varticovski L, Arias IM: Phosphoinositide 3-kinase lipid products regulate ATP-dependent transport by sister of P-glycoprotein and multidrug resistance associated protein 2 in bile canalicular membrane vesicles. Proc Natl Acad Sci U S A 1999, 96:5814-5819. 177. Salway JG: Metabolism at a glance. 3rd edn. Malden, Mass.: Blackwell Pub.; 2004. 178. Siperstein MD, Guest MJ: Studies on the site of the feedback control of cholesterol synthesis. J Clin Invest 1960, 39:642-652. 179. Nohturfft A, Yabe D, Goldstein JL, Brown MS, Espenshade PJ: Regulated step in cholesterol feedback localized to budding of SCAP from ER membranes. Cell 2000, 102:315-323. 180. Omkumar RV, Darnay BG, Rodwell VW: Modulation of Syrian hamster 3- hydroxy-3-methylglutaryl-CoA reductase activity by phosphorylation. Role of serine 871. J Biol Chem 1994, 269:6810-6814. 181. Goldstein JL, DeBose-Boyd RA, Brown MS: Protein sensors for membrane sterols. Cell 2006, 124:35-46. 182. Dikkers A, Tietge UJ: Biliary cholesterol secretion: more than a simple ABC. World J Gastroenterol 2010, 16:5936-5945. 183. Rudel LL, Lee RG, Cockman TL: Acyl coenzyme A : cholesterol acyltransferase types 1 and 2: structure and function in atherosclerosis. Current Opinion in Lipidology 2001, 12:121-127. 184. Feingold KR, Grunfeld C: Introduction to Lipids and Lipoproteins. In Endotext. Edited by De Groot LJ, Beck-Peccoz P, Chrousos G, Dungan K, Grossman A, Hershman JM, Koch C, McLachlan R, New M, Rebar R, et al. South Dartmouth (MA)2000 185. Ikonen E: Cellular cholesterol trafficking and compartmentalization. Nat Rev Mol Cell Biol 2008, 9:125-138. 186. Abumrad NA, Davidson NO: Role of the gut in lipid homeostasis. Physiol Rev 2012, 92:1061-1085. 187. Dietschy JM, Gamel WG: Cholesterol synthesis in the intestine of man: regional differences and control mechanisms. J Clin Invest 1971, 50:872- 880.

152

188. Davis HR, Jr., Zhu LJ, Hoos LM, Tetzloff G, Maguire M, Liu J, Yao X, Iyer SP, Lam MH, Lund EG, et al: Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis. J Biol Chem 2004, 279:33586-33592. 189. Garcia-Calvo M, Lisnock J, Bull HG, Hawes BE, Burnett DA, Braun MP, Crona JH, Davis HR, Jr., Dean DC, Detmers PA, et al: The target of ezetimibe is Niemann-Pick C1-Like 1 (NPC1L1). Proc Natl Acad Sci U S A 2005, 102:8132- 8137. 190. Altmann SW, Davis HR, Jr., Zhu LJ, Yao X, Hoos LM, Tetzloff G, Iyer SP, Maguire M, Golovko A, Zeng M, et al: Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption. Science 2004, 303:1201-1204. 191. Kwon HJ, Abi-Mosleh L, Wang ML, Deisenhofer J, Goldstein JL, Brown MS, Infante RE: Structure of N-terminal domain of NPC1 reveals distinct subdomains for binding and transfer of cholesterol. Cell 2009, 137:1213- 1224. 192. Betters JL, Yu L: Transporters as drug targets: discovery and development of NPC1L1 inhibitors. Clin Pharmacol Ther 2010, 87:117-121. 193. Hayashi AA, Webb J, Choi J, Baker C, Lino M, Trigatti B, Trajcevski KE, Hawke TJ, Adeli K: Intestinal SR-BI is upregulated in insulin-resistant states and is associated with overproduction of intestinal apoB48-containing lipoproteins. Am J Physiol Gastrointest Liver Physiol 2011, 301:G326-337. 194. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ: Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. Journal of Biological Chemistry 2002, 277:18793-18800. 195. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC, Hobbs HH: Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 2002, 110:671-680. 196. Lu K, Lee MH, Yu H, Zhou Y, Sandell SA, Salen G, Patel SB: Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8. J Lipid Res 2002, 43:565-578.

153

197. Davidson NO, Shelness GS: APOLIPOPROTEIN B: mRNA editing, lipoprotein assembly, and presecretory degradation. Annu Rev Nutr 2000, 20:169-193. 198. Hesse D, Jaschke A, Chung B, Schurmann A: Trans-Golgi proteins participate in the control of lipid droplet and chylomicron formation. Biosci Rep 2013, 33:1-9. 199. Dietschy JM, Turley SD: Control of cholesterol turnover in the mouse. J Biol Chem 2002, 277:3801-3804. 200. Rader DJ, Alexander ET, Weibel GL, Billheimer J, Rothblat GH: The role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis. J Lipid Res 2009, 50 Suppl:S189-194. 201. Grundy SM, Metzger AL: A physiological method for estimation of hepatic secretion of biliary lipids in man. Gastroenterology 1972, 62:1200-1217. 202. Mitchell JC, Stone BG, Logan GM, Duane WC: Role of cholesterol synthesis in regulation of bile acid synthesis and biliary cholesterol secretion in humans. J Lipid Res 1991, 32:1143-1149. 203. Temel RE, Brown JM: A new model of reverse cholesterol transport: enTICEing strategies to stimulate intestinal cholesterol excretion. Trends Pharmacol Sci 2015, 36:440-451. 204. Cheng SH, Stanley MM: Secretion of cholesterol by intestinal mucosa in patients with complete common bile duct obstruction. Proc Soc Exp Biol Med 1959, 101:223-225. 205. Lambert G, Amar MJ, Guo G, Brewer HB, Jr., Gonzalez FJ, Sinal CJ: The farnesoid X-receptor is an essential regulator of cholesterol homeostasis. J Biol Chem 2003, 278:2563-2570. 206. Heidker RM, Caiozzi GC, Ricketts ML: Dietary procyanidins selectively modulate intestinal farnesoid X receptor-regulated gene expression to alter enterohepatic bile acid recirculation: elucidation of a novel mechanism to reduce triglyceridemia. Mol Nutr Food Res 2016, 60:727-736. 207. Dietschy JM, Siperstein MD: Cholesterol synthesis by the gastrointestinal tract: localization and mechanisms of control. J Clin Invest 1965, 44:1311- 1327.

154

208. Di Ferdinando M, Brunetti C, Agati G, Tattini M: Multiple functions of polyphenols in plants inhabiting unfavorable Mediterranean areas. Environmental and Experimental Botany 2014, 103:107-116. 209. Wadhwa MB, MPS: Utilization of fruit and vegetable wastes as livestock feed and as substrates for generation of other value-added products. (Makkar HPS ed.: Food and Agriculture Organization of the United Nations; 2013. 210. Naczk M, Shahidi F: Extraction and analysis of phenolics in food. J Chromatogr A 2004, 1054:95-111. 211. Ignat I, Volf I, Popa VI: A critical review of methods for characterisation of polyphenolic compounds in fruits and vegetables. Food Chem 2011, 126:1821-1835. 212. Lea AGH, Bridle P, Timberlake CF, Singleton VL: The Procyanidins of White Grapes and Wines. American Journal of Enology and Viticulture 1979, 30:289- 300. 213. Berglund L, Brunzell JD, Goldberg AC, Goldberg IJ, Sacks F, Murad MH, Stalenhoef AF, Endocrine s: Evaluation and treatment of hypertriglyceridemia: an Endocrine Society clinical practice guideline. J Clin Endocrinol Metab 2012, 97:2969-2989. 214. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ: Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000, 6:507-515. 215. Lefebvre P, Cariou B, Lien F, Kuipers F, Staels B: Role of bile acids and bile acid receptors in metabolic regulation. Physiol Rev 2009, 89:147-191. 216. Matsubara T, Li F, Gonzalez FJ: FXR signaling in the enterohepatic system. Mol Cell Endocrinol 2013, 368:17-29. 217. Stroeve JH, Brufau G, Stellaard F, Gonzalez FJ, Staels B, Kuipers F: Intestinal FXR-mediated FGF15 production contributes to diurnal control of hepatic bile acid synthesis in mice. Lab Invest 2010, 90:1457-1467. 218. Gonzalez FJ: Nuclear receptor control of enterohepatic circulation. Compr Physiol 2012, 2:2811-2828.

155

219. Houten SM, Volle DH, Cummins CL, Mangelsdorf DJ, Auwerx J: In vivo imaging of farnesoid X receptor activity reveals the ileum as the primary bile acid signaling tissue. Mol Endocrinol 2007, 21:1312-1323. 220. Dawson PA, Hubbert M, Haywood J, Craddock AL, Zerangue N, Christian WV, Ballatori N: The heteromeric organic solute transporter alpha-beta, Ostalpha-Ostbeta, is an ileal basolateral bile acid transporter. J Biol Chem 2005, 280:6960-6968. 221. Kok T, Hulzebos CV, Wolters H, Havinga R, Agellon LB, Stellaard F, Shan B, Schwarz M, Kuipers F: Enterohepatic circulation of bile salts in farnesoid X receptor-deficient mice: efficient intestinal bile salt absorption in the absence of ileal bile acid-binding protein. J Biol Chem 2003, 278:41930- 41937. 222. Li H, Chen F, Shang Q, Pan L, Shneider BL, Chiang JY, Forman BM, Ananthanarayanan M, Tint GS, Salen G, Xu G: FXR-activating ligands inhibit rabbit ASBT expression via FXR-SHP-FTF cascade. Am J Physiol Gastrointest Liver Physiol 2005, 288:G60-66. 223. Landrier JF, Eloranta JJ, Vavricka SR, Kullak-Ublick GA: The nuclear receptor for bile acids, FXR, transactivates human organic solute transporter-alpha and -beta genes. Am J Physiol Gastrointest Liver Physiol 2006, 290:G476-485. 224. Pejic RN, Lee DT: Hypertriglyceridemia. J Am Board Fam Med 2006, 19:310- 316. 225. Baselga-Escudero L, Blade C, Ribas-Latre A, Casanova E, Salvado MJ, Arola L, Arola-Arnal A: Chronic supplementation of proanthocyanidins reduces postprandial lipemia and liver miR-33a and miR-122 levels in a dose- dependent manner in healthy rats. J Nutr Biochem 2014, 25:151-156. 226. Yamakoshi J, Saito M, Kataoka S, Kikuchi M: Safety evaluation of proanthocyanidin-rich extract from grape seeds. Food Chem Toxicol 2002, 40:599-607. 227. Modica S, Murzilli, S. and Moschetta, A. : Characterizing Bile Acid and Lipid Metabolism in the Liver and Gastrointestinal Tract of Mice. Current Protocols in Mouse Biology 2011, 1:289–321.

.

156

228. Dussault I, Beard R, Lin M, Hollister K, Chen J, Xiao JH, Chandraratna R, Forman BM: Identification of gene-selective modulators of the bile acid receptor FXR. J Biol Chem 2003, 278:7027-7033. 229. Li G, Lin W, Araya JJ, Chen T, Timmermann BN, Guo GL: A tea catechin, epigallocatechin-3-gallate, is a unique modulator of the farnesoid X receptor. Toxicol Appl Pharmacol 2012, 258:268-274. 230. Vergnes L, Lee JM, Chin RG, Auwerx J, Reue K: Diet1 functions in the FGF15/19 enterohepatic signaling axis to modulate bile acid and lipid levels. Cell Metab 2013, 17:916-928. 231. Rucker R, Storms D: Interspecies comparisons of micronutrient requirements: metabolic vs. absolute body size. J Nutr 2002, 132:2999-3000. 232. Kullak-Ublick GA, Stieger B, Meier PJ: Enterohepatic bile salt transporters in normal physiology and liver disease. Gastroenterology 2004, 126:322-342. 233. Lundasen T, Andersson EM, Snaith M, Lindmark H, Lundberg J, Ostlund- Lindqvist AM, Angelin B, Rudling M: Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice. PLoS One 2012, 7:e37787. 234. Fang S, Suh JM, Reilly SM, Yu E, Osborn O, Lackey D, Yoshihara E, Perino A, Jacinto S, Lukasheva Y, et al: Intestinal FXR agonism promotes adipose tissue browning and reduces obesity and insulin resistance. Nat Med 2015, 21:159-165. 235. Ishibashi S, Schwarz M, Frykman PK, Herz J, Russell DW: Disruption of cholesterol 7alpha-hydroxylase gene in mice. I. Postnatal lethality reversed by bile acid and vitamin supplementation. J Biol Chem 1996, 271:18017- 18023. 236. Bernhardsson C, Björkhem I, Danielsson H, Wikvall K: 12α-Hydroxylation of 7α-hydroxy-4-cholesten-3-one by a reconstituted system from rat liver microsomes. Biochemical and Biophysical Research Communications 1973, 54:1030-1038. 237. Eggertsen G, Olin M, Andersson U, Ishida H, Kubota S, Hellman U, Okuda KI, Björkhem I: Molecular cloning and expression of rabbit sterol 12alpha- hydroxylase. J Biol Chem 1996, 271:32269-32275.

157

238. Pandak WM, Bohdan P, Franklund C, Mallonee DH, Eggertsen G, Bjorkhem I, Gil G, Vlahcevic ZR, Hylemon PB: Expression of sterol 12alpha-hydroxylase alters bile acid pool composition in primary rat hepatocytes and in vivo. Gastroenterology 2001, 120:1801-1809. 239. Chiang JY: Regulation of bile acid synthesis. Front Biosci 1998, 3:d176-193. 240. Shepherd J: Mechanism of action of bile acid sequestrants and other lipid- lowering drugs. Cardiology 1989, 76 Suppl 1:65-71; discussion 71-64. 241. Insull W: Clinical utility of bile acid sequestrants in the treatment of dyslipidemia: a scientific review. South Med J 2006, 99:257-273. 242. Dietschy JM, Weis HJ: Cholesterol synthesis by the gastrointestinal tract. Am J Clin Nutr 1971, 24:70-76. 243. Hua X, Yokoyama C, Wu J, Briggs MR, Brown MS, Goldstein JL, Wang X: SREBP-2, a second basic-helix-loop-helix-leucine zipper protein that stimulates transcription by binding to a sterol regulatory element. Proc Natl Acad Sci U S A 1993, 90:11603-11607. 244. Cases S, Novak S, Zheng YW, Myers HM, Lear SR, Sande E, Welch CB, Lusis AJ, Spencer TA, Krause BR, et al: ACAT-2, a second mammalian acyl- CoA:cholesterol acyltransferase. Its cloning, expression, and characterization. J Biol Chem 1998, 273:26755-26764. 245. Wetterau JR, Aggerbeck LP, Laplaud PM, McLean LR: Structural properties of the microsomal triglyceride-transfer protein complex. Biochemistry 1991, 30:4406-4412. 246. Wetterau JR, Combs KA, Spinner SN, Joiner BJ: Protein disulfide isomerase is a component of the microsomal triglyceride transfer protein complex. J Biol Chem 1990, 265:9800-9807. 247. Wetterau JR, Zilversmit DB: Purification and characterization of microsomal triglyceride and cholesteryl ester transfer protein from bovine liver microsomes. Chem Phys Lipids 1985, 38:205-222. 248. Brunham LR, Kruit JK, Iqbal J, Fievet C, Timmins JM, Pape TD, Coburn BA, Bissada N, Staels B, Groen AK, et al: Intestinal ABCA1 directly contributes to HDL biogenesis in vivo. J Clin Invest 2006, 116:1052-1062. 249. Kobayashi M, Ikegami H, Fujisawa T, Nojima K, Kawabata Y, Noso S, Babaya N, Itoi-Babaya M, Yamaji K, Hiromine Y, et al: Prevention and treatment of

158

obesity, insulin resistance, and diabetes by bile acid-binding resin. Diabetes 2007, 56:239-247. 250. Out C, Groen AK, Brufau G: Bile acid sequestrants: more than simple resins. Current Opinion in Lipidology 2012, 23:43-55. 251. Hou R, Goldberg AC: Lowering low-density lipoprotein cholesterol: statins, ezetimibe, bile acid sequestrants, and combinations: comparative efficacy and safety. Endocrinol Metab Clin North Am 2009, 38:79-97. 252. Crouse JR, 3rd: Hypertriglyceridemia: a contraindication to the use of bile acid binding resins. Am J Med 1987, 83:243-248. 253. Vlahcevic ZR, Eggertsen G, Björkhem I, Hylemon PB, Redford K, Pandak WM: Regulation of sterol 12alpha-hydroxylase and cholic acid biosynthesis in the rat. Gastroenterology 2000, 118:599-607. 254. Kamisako T, Ogawa H, Yamamoto K: Effect of cholesterol, cholic acid and cholestyramine administration on the intestinal mRNA expressions related to cholesterol and bile acid metabolism in the rat. J Gastroenterol Hepatol 2007, 22:1832-1837. 255. Feng D, Ohlsson L, Duan RD: Curcumin inhibits cholesterol uptake in Caco-2 cells by down-regulation of NPC1L1 expression. Lipids Health Dis 2010, 9:40. 256. Lindsey CA, Jr., Wilson JD: Evidence for a Contribution by the Intestinal Wall to the Serum Cholesterol of the Rat. J Lipid Res 1965, 6:173-181. 257. Cassidy MM, Lightfoot FG, Grau LE, Roy T, Story JA, Kritchevsky D, Vahouny GV: Effect of bile salt-binding resins on the morphology of rat jejunum and colon. A scanning electron microscopy study. Dig Dis Sci 1980, 25:504-512. 258. Cassidy MM, Lightfoot FG, Grau L, Satchitanandum S, Vahouny GV: Lipid accumulation in jejunal and colonic mucosa following chronic cholestyramine (Questran) feeding. Dig Dis Sci 1985, 30:468-476. 259. Dietschy JM: The role of bile salts in controlling the rate of intestinal cholesterogenesis. J Clin Invest 1968, 47:286-300. 260. Srere PA, Chaikoff IL, Treitman SS, Burstein LS: THE EXTRAHEPATIC SYNTHESIS OF CHOLESTEROL. Journal of Biological Chemistry 1950, 182:629-634.

159

261. O'Brien PJ, Alborn WE, Sloan JH, Ulmer M, Boodhoo A, Knierman MD, Schultze AE, Konrad RJ: The novel apolipoprotein A5 is present in human serum, is associated with VLDL, HDL, and chylomicrons, and circulates at very low concentrations compared with other apolipoproteins. Clinical Chemistry 2005, 51:351-359. 262. van der Vliet H, Schaap F, Levels JH, Ottenhoff R, Looije N, Wesseling JG, Groen AK, Chamuleau RA: Serum triglyceride and cholesterol levels are reduced in mice with adenoviral overexpression of apolipoprotein A-V. Hepatology 2002, 36:339A-339A. 263. Li H, Xu G, Shang Q, Pan L, Shefer S, Batta AK, Bollineni J, Tint GS, Keller BT, Salen G: Inhibition of ileal bile acid transport lowers plasma cholesterol levels by inactivating hepatic farnesoid X receptor and stimulating cholesterol 7 alpha-hydroxylase. Metabolism 2004, 53:927-932. 264. West KL, Zern TL, Butteiger DN, Keller BT, Fernandez ML: SC-435, an ileal apical sodium co-dependent bile acid transporter (ASBT) inhibitor lowers plasma cholesterol and reduces atherosclerosis in guinea pigs. Atherosclerosis 2003, 171:201-210. 265. Sugimoto-Kawabata K, Shimada H, Sakai K, Suzuki K, Kelder T, Pieterman EJ, Cohen LH, Havekes LM, Princen HM, van den Hoek AM: Colestilan decreases weight gain by enhanced NEFA incorporation in biliary lipids and fecal lipid excretion. Journal of Lipid Research 2013, 54:1255-1264. 266. Auger C, Al-Awwadi N, Bornet A, Rouanet JM, Gasc F, Cros G, Teissedre PL: Catechins and procyanidins in Mediterranean diets. Food Research International 2004, 37:233-245. 267. Gu L, Kelm MA, Hammerstone JF, Beecher G, Holden J, Haytowitz D, Gebhardt S, Prior RL: Concentrations of proanthocyanidins in common foods and estimations of normal consumption. J Nutr 2004, 134:613-617. 268. Choy YY, Jaggers GK, Oteiza PI, Waterhouse AL: Bioavailability of Intact Proanthocyanidins in the Rat Colon after Ingestion of Grape Seed Extract. Journal of Agricultural and Food Chemistry 2013, 61:121-127. 269. Steffen Y, Gruber C, Schewe T, Sies H: Mono-O-methylated flavanols and other flavonoids as inhibitors of endothelial NADPH oxidase. Arch Biochem Biophys 2008, 469:209-219.

160

270. Erlejman AG, Jaggers G, Fraga CG, Oteiza PI: TNFalpha-induced NF-kappaB activation and cell oxidant production are modulated by hexameric procyanidins in Caco-2 cells. Arch Biochem Biophys 2008, 476:186-195. 271. Mackenzie GG, Adamo AM, Decker NP, Oteiza PI: Dimeric procyanidin B2 inhibits constitutively active NF-kappa B in Hodgkin's lymphoma cells independently of the presence of I kappa B mutations. Biochemical Pharmacology 2008, 75:1461-1471. 272. Mackenzie GG, Delfino JM, Keen CL, Fraga CG, Oteiza PI: Dimeric procyanidins are inhibitors of NF-kappaB-DNA binding. Biochem Pharmacol 2009, 78:1252-1262. 273. Lee JS, Kang SU, Hwang HS, Pyun JH, Choung YH, Kim CH: Epicatechin protects the auditory organ by attenuating cisplatin-induced ototoxicity through inhibition of ERK. Toxicol Lett 2010, 199:308-316. 274. Kang NJ, Lee KW, Lee DE, Rogozin EA, Bode AM, Lee HJ, Dong Z: Cocoa procyanidins suppress transformation by inhibiting mitogen-activated protein kinase kinase. J Biol Chem 2008, 283:20664-20673. 275. Schroeter H, Bahia P, Spencer JP, Sheppard O, Rattray M, Cadenas E, Rice- Evans C, Williams RJ: (-)Epicatechin stimulates ERK-dependent cyclic AMP response element activity and up-regulates GluR2 in cortical neurons. J Neurochem 2007, 101:1596-1606. 276. Verstraeten SV, Mackenzie GG, Oteiza PI, Fraga CG: (-)-Epicatechin and related procyanidins modulate intracellular calcium and prevent oxidation in Jurkat T cells. Free Radic Res 2008, 42:864-872. 277. Campana G, Pasini P, Roda A, Spampinato S: Regulation of ileal bile acid- binding protein expression in Caco-2 cells by ursodeoxycholic acid: Role of the farnesoid X receptor. Biochemical Pharmacology 2005, 69:1755-1763. 278. Pinent M, Blade MC, Salvado MJ, Arola L, Ardevol A: Metabolic fate of glucose on 3T3-L1 adipocytes treated with grape seed-derived procyanidin extract (GSPE). Comparison with the effects of insulin. J Agric Food Chem 2005, 53:5932-5935. 279. Al-Awwadi NA, Araiz C, Bornet A, Delbosc S, Cristol JP, Linck N, Azay J, Teissedre PL, Cros G: Extracts enriched in different polyphenolic families normalize increased cardiac NADPH oxidase expression while having

161

differential effects on insulin resistance, hypertension, and cardiac hypertrophy in high-fructose-fed rats. J Agric Food Chem 2005, 53:151-157. 280. FAOSTAT. Food and Agriculture Organization of the United Nations; Statistics Division; 2011. 281. Ghafoor K, Choi YH, Jeon JY, Jo IH: Optimization of ultrasound-assisted extraction of phenolic compounds, antioxidants, and anthocyanins from grape (Vitis vinifera) seeds. J Agric Food Chem 2009, 57:4988-4994. 282. Kennedy JA: Proanthocyanidins: Extraction, Purification, and Determination of Subunit Composition by HPLC. Current Protocols in Food Analytical Chemistry: John Wiley & Sons, Inc.; 2001. 283. Pekić B, Kovač V, Alonso E, Revilla E: Study of the extraction of proanthocyanidins from grape seeds. Food Chemistry 1998, 61:201-206. 284. Ramirez-Coronel MA, Marnet N, Kolli VS, Roussos S, Guyot S, Augur C: Characterization and estimation of proanthocyanidins and other phenolics in coffee pulp (Coffea arabica) by thiolysis-high-performance liquid chromatography. J Agric Food Chem 2004, 52:1344-1349. 285. Waterhouse AL: Determination of Total Phenolics. In Current Protocols in Food Analytical Chemistry. John Wiley & Sons, Inc.; 2001 286. Nakamura Y, Tsuji S, Tonogai Y: Analysis of Proanthocyanidins in Grape Seed Extracts, Health Foods and Grape Seed Oils. Journal of Health Science 2003, 49:45. 287. Kelm MA, Johnson JC, Robbins RJ, Hammerstone JF, Schmitz HH: High- performance liquid chromatography separation and purification of cacao (Theobroma cacao L.) procyanidins according to degree of polymerization using a diol stationary phase. J Agric Food Chem 2006, 54:1571-1576. 288. Prior RL, Lazarus SA, Cao G, Muccitelli H, Hammerstone JF: Identification of procyanidins and anthocyanins in blueberries and cranberries (Vaccinium spp.) using high-performance liquid chromatography/mass spectrometry. J Agric Food Chem 2001, 49:1270-1276. 289. Brand-Williams W, Cuvelier ME, Berset C: Use of a free radical method to evaluate antioxidant activity. LWT - Food Science and Technology 1995, 28:25-30.

162

290. Kallithraka S, Garcia-Viguera C, Bridle P, Bakker J: Survey of solvents for the extraction of grape seed phenolics. Phytochemical Analysis 1995, 6:265-267. 291. Spencer JPE, Schroeter H, Shenoy B, Srai SKS, Debnam ES, Rice-Evans C: Epicatechin is the primary bioavailable form of the procyanidin dimers B2 and B5 after transfer across the small intestine. Biochemical and Biophysical Research Communications 2001, 285:588-593. 292. Van Amelsvoort JMM, Van Het Hof KH, Mathot JNJJ, Mulder TPJ, Wiersma A, Tijburg LBM: Plasma concentrations of individual tea catechins after a single oral dose in humans. Xenobiotica 2001, 31:891-901. 293. Holt RR, Lazarus SA, Sullards MC, Zhu QY, Schramm DD, Hammerstone JF, Fraga CG, Schmitz HH, Keen CL: Procyanidin dimer B2 epicatechin-(4 beta- 8)-epicatechin in human plasma after the consumption of a flavanol-rich cocoa. American Journal of Clinical Nutrition 2002, 76:798-804. 294. Sano A, Yamakoshi J, Tokutake S, Tobe K, Kubota Y, Kikuchi M: Procyanidin B1 is detected in human serum after intake of proanthocyanidin-rich grape seed extract. Bioscience Biotechnology and Biochemistry 2003, 67:1140-1143. 295. Underlying cause of death 1999-2014 [http://wonder.cdc.gov/ucd-icd10.html] 296. Vrablik M, Ceska R: Treatment of hypertriglyceridemia: a review of current options. Physiol Res 2015, 64 Suppl 3:S331-340. 297. Laufs U, Scharnagl H, Marz W: Statin intolerance. Curr Opin Lipidol 2015, 26:492-501. 298. Song KH, Li T, Owsley E, Chiang JY: A putative role of micro RNA in regulation of cholesterol 7alpha-hydroxylase expression in human hepatocytes. J Lipid Res 2010, 51:2223-2233. 299. Baselga-Escudero L, Blade C, Ribas-Latre A, Casanova E, Suarez M, Torres JL, Salvado MJ, Arola L, Arola-Arnal A: Resveratrol and EGCG bind directly and distinctively to miR-33a and miR-122 and modulate divergently their levels in hepatic cells. Nucleic Acids Res 2014, 42:882-892. 300. Kir S, Zhang Y, Gerard RD, Kliewer SA, Mangelsdorf DJ: Nuclear receptors HNF4alpha and LRH-1 cooperate in regulating Cyp7a1 in vivo. J Biol Chem 2012, 287:41334-41341. 301. Vaid M, Prasad R, Singh T, Jones V, Katiyar SK: Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human

163

skin cancer cells by targeting epigenetic regulators. Toxicol Appl Pharmacol 2012, 263:122-130. 302. Nie YF, Hu J, Yan XH: Cross-talk between bile acids and intestinal microbiota in host metabolism and health. J Zhejiang Univ Sci B 2015, 16:436-446. 303. Begley M, Gahan CG, Hill C: The interaction between bacteria and bile. FEMS Microbiol Rev 2005, 29:625-651. 304. Wang H, Xue Y, Zhang H, Huang Y, Yang G, Du M, Zhu MJ: Dietary grape seed extract ameliorates symptoms of inflammatory bowel disease in IL10- deficient mice. Mol Nutr Food Res 2013, 57:2253-2257. 305. Masuda N: Deconjugation of bile salts by Bacteroids and Clostridium. Microbiol Immunol 1981, 25:1-11. 306. Li F, Jiang C, Krausz KW, Li Y, Albert I, Hao H, Fabre KM, Mitchell JB, Patterson AD, Gonzalez FJ: Microbiome remodelling leads to inhibition of intestinal farnesoid X receptor signalling and decreased obesity. Nat Commun 2013, 4:2384. 307. Jiang C, Xie C, Li F, Zhang L, Nichols RG, Krausz KW, Cai J, Qi Y, Fang ZZ, Takahashi S, et al: Intestinal farnesoid X receptor signaling promotes nonalcoholic fatty liver disease. J Clin Invest 2015, 125:386-402. 308. Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M, Fukusumi S, Habata Y, Itoh T, Shintani Y, et al: A G protein-coupled receptor responsive to bile acids. J Biol Chem 2003, 278:9435-9440. 309. Katsuma S, Hirasawa A, Tsujimoto G: Bile acids promote glucagon-like peptide-1 secretion through TGR5 in a murine enteroendocrine cell line STC-1. Biochem Biophys Res Commun 2005, 329:386-390. 310. Meloni AR, DeYoung MB, Lowe C, Parkes DG: GLP-1 receptor activated insulin secretion from pancreatic beta-cells: mechanism and glucose dependence. Diabetes Obes Metab 2013, 15:15-27. 311. Shimomura I, Bashmakov Y, Ikemoto S, Horton JD, Brown MS, Goldstein JL: Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc Natl Acad Sci U S A 1999, 96:13656- 13661.

164

312. Huang Y, Wang J, Cheng Y, Zheng Y: The hypocholesterolaemic effects of Lactobacillus acidophilus American type culture collection 4356 in rats are mediated by the down-regulation of Niemann-Pick C1-like 1. Br J Nutr 2010, 104:807-812. 313. Yoon HS, Ju JH, Kim H, Lee J, Park HJ, Ji Y, Shin HK, Do MS, Lee JM, Holzapfel W: Lactobacillus rhamnosus BFE 5264 and Lactobacillus plantarum NR74 Promote Cholesterol Excretion Through the Up-Regulation of ABCG5/8 in Caco-2 Cells. Probiotics Antimicrob Proteins 2011, 3:194-203. 314. Dalboge LS, Pedersen PJ, Hansen G, Fabricius K, Hansen HB, Jelsing J, Vrang N: A Hamster Model of Diet-Induced Obesity for Preclinical Evaluation of Anti-Obesity, Anti-Diabetic and Lipid Modulating Agents. PLoS One 2015, 10:e0135634. 315. Staels B, Fonseca VA: Bile acids and metabolic regulation: mechanisms and clinical responses to bile acid sequestration. Diabetes Care 2009, 32 Suppl 2:S237-245. 316. Uchida K, Nomura Y, Takeuchi N: Effects of cholic acid, chenodeoxycholic acid, and their related bile acids on cholesterol, phospholipid, and bile acid levels in serum, liver, bile, and feces of rats. J Biochem 1980, 87:187-194. 317. Chiang JY: Bile acids: regulation of synthesis. J Lipid Res 2009, 50:1955- 1966. 318. Hofmann AF: The continuing importance of bile acids in liver and intestinal disease. Arch Intern Med 1999, 159:2647-2658. 319. Fraga CG, Oteiza PI: Dietary flavonoids: Role of (-)-epicatechin and related procyanidins in cell signaling. Free Radic Biol Med 2011, 51:813-823.

165

Appendix 1

Supporting Tables

166

CC

CAGCTCATCAACAACCAAGACAGTGACTT

TGACCACCAGGACTGCCAGGACCA

TTCTCTCACCCTCCCACCGCACCC

TCTCTGGTTGCTCATTGTTATTCCTGT

CCTTGGGCATGATGCCTCTCCTC

CTGGACCAAACACAAACGGTTCCCA

AGTGTTCTCTTACGGTTCTGGCTT

TGTCGCTGCTCAGCACGTCCTCTTC

ATTCAACGGCACAGTCAAGGC

TGCGGTACCTCTGCATGAGCGC

CCAGCAGGACGGACAGGACTTCACC

C

TGCAAAACCTCCAATCTGTCATGAGACCTC

CACAACAACGGCAGAGCAGAG

CACACCAGCATCCAACGCAA

TTTGAGACCTTCAACACCCCAGCCA

CATCTACGAGGTCCGCA

TGCCACAGCAATTTGACACCCTAGTTGG

AAGAAGCATCCAGGCAAGCA

ACGGTGGTGTCTGTGCTGTG

ATGCTCCACACTGCTTGCCCTCGG

AAGACTGAGTGGTTGGATGGCA

CCAGAGGAGCCTGAGGACCT

AGCTTCCCGCCCTCCATCTGCACA

Probe

CCTGTCTCACCCCCAGCATA

CTTCTCAGGAGGAACATGCTTGT

CTGAGCCAGTGGTAAGAAAGG

GGTACAGTATTCCTCCAA

GCCTTTGTAGGGCACCTTGT

CAGTCTTGGCAGTGCAGATAA

GTGTGACTTTAAGGGAGTA

ATGTACAGGATGGCGATGCA

CCCATTTGATGTTAGTGG

TCAGCCCGTATATCTTGCCG

GCCCCCAGAGTAAGACTGGG

AGCCATACATCCCTTCCGTGA

CCACATAGAGGCAGAAGA

CAGGGAATCTCCATCTTC

CACAGCCTGGATGGCTACGT

CTGCTATCTCCTCTTTGATTA

CGATGGCTACCCTTTGCTTCT

GAGCAAAGTTTCTCTTAGG

GATCCAGAGCACAAAGCA

TTGGTATAGATAAGGAGGCACAGC

ATGCCTTCTTTCACTTTG

CGAAGAGAACATGTCAGA

GTCTGGTGATAGTTGGGGAAATTC

ReversePrimer

GGAGCCATGGATTGCACATT

AACTGCTGGAAGAAATGCTTTGG

GACCAATTACAGCATCTCCCC

TCCCTATGATAGCATTGG TCCCTATGATAGCATTGG

ATGACCACCTGCTCCAGCTT

GGTCCTGGCATCTTGTCCAT

GCTTGTGTCTAATCAGAATG

CCGGCAACAACAAGATCTGTG

GGTCTACATGTTCCAGTA

GATTGCCATCAAGGACGTCAG

CAGGAGACGTGATTGAAAGGG

CAGGGAGATGCTCTGTGTTCA

GAGTCCTGCAACTTTGTG

CCACAAACTCACACGTAA

GGCCAACCGTGAAAAGATGA

GACCTGACAGACAATGAG

CTGCCAAGGATGCTAATGCA

GTGGTGGTCATTATAAGC

CCTCACTAGCATCCTGAC

GACATGGACCTGAGCGTCAG

GGAGAAATTTGAAGATGAGA

ATGGCTACAATGTGTACC

AAGTTCACTGTTGGCAAGGAAAG

Forward primer Forward









-actin

Srebp1c

Ost-

Ost-

Asbt

Ntcp

Cyclo

Ibabp



Mrp-3

Bsep

OST-

OST-

ASBT

CYCLO

IBABP

Synonym

Gene Symbol

bindingprotein 1c

sterolregulatoryelement

betasubunit

Organic solute Organic transporter,

alphasubunit

Organic solute Organic transporter,

biletransporter acid

Apicalsodium dependent

cotransporting polypeptidecotransporting

sodium-taurocholate

CyclophilinA

HMGCoA-synthase

HMGCoA-reductase

protein

Ilealbile bindingacid

monooxygenase

cholesterolalpha- 7

protein3

Multidrug-resistance

Bilesaltexport pump

betasubunit

Organic solute Organic transporter,

alphasubunit

Organic solute Organic transporter,

biletransporter acid

Apicalsodium dependent

protein

Ilealbile bindingacid

GeneSynonym Name

1: qPCR Primer and probe sequences probe and Primer qPCR 1:

NM_011480.3

NM_178933.2

NM_145932.3

NM_011388.2 NM_011388.2

NM_001177561.1

NM_008907.1

NM_001291439.1

NM_008255.2

NM_001289726.1

NM_008003.2

NM_008375.2

NM_007824.2

NM_013495.2

NM_080434.3

NM_007393.4

NM_029600.3

NM_021022.3

NM_178859.3 NM_178859.3

NM_152672.5 NM_152672.5

NM_000452.2

NM_001300981.1

NM_005117.2

NM_001040442.1

Accession Number Accession

2.

Srebf1

Slc51B

Slc51A

Slc10a2

Slc10a1

Ppia

Hmgcs1

Hmgcr

Gapdh

Fgf15

Fabp6

Cyp7a1

Cpt1a

ApoA5

Actb

Abcc3

Abcb11

SLC51B

SLC51A

SLC10A2

PPIA

FGF19

FABP6

GeneSymbol

Supporting Table Table Supporting

binding1 transcriptionfactor

sterolregulatoryelement

subunit

solutebetafamily carrier 51,

subunit

solutealphafamily carrier 51,

member2

(sodium/bilecotransporter),acid

solute family carrier 10

member1

(sodium/bilecotransporter),acid

solute family carrier 10

peptidylprolylisomerase A

synthase 1 (soluble) synthase1

3-hydroxy-3-methylglutaryl-CoA

reductase

3-hydroxy-3-methylglutaryl-CoA

dehydrogenase

Glyceraldehyde-3-phosphate

(murine)

fibroblast growth factor 15 fibroblast15 factor growth

fatty acid bindingacidfatty ilealprotein 6,

subfamilyA,polypeptide 1

cytochrome P450, family 7, P450, cytochrome

(liver)

Carnitinepalmitoyltransferase 1a

ApolipoproteinA-V

actin, betaactin,

C (CFTR/MRP), member(CFTR/MRP), 3 C

ATP-bindingcassette, sub-family

B (MDR/TAP), member(MDR/TAP), 11 B

ATP-bindingcassette, sub-family

subunit

solutebetafamily carrier 51,

subunit

solutealphafamily carrier 51,

member2

(sodium/bilecotransporter),acid

solute family carrier 10

peptidylprolyl isomerase A isomerase peptidylprolyl

(human)

fibroblast growth factor 19 fibroblast19 factor growth

fatty acid bindingacidfatty ilealprotein 6,

GeneName

Chapter 2 2 Chapter

Mus musculusMus

Homo sapiens Homo Species

167

AACAGCAACAGCAGCAGCAA

CCATCCAGCAGCAGCTGCAGACG

CAGCTCATCAACAACCAAGACAGTGACTTCC

TCTCTGGTTGCTCATTGTTATTCCTGT

CTGGACCAAACACAAACGGTTCCCA

ACCGCAAGACAGCGTGGGCTACA

AGTGTTCTCTTACGGTTCTGGCTT

TGTCGCTGCTCAGCACGTCCTCTTC

ATTCAACGGCACAGTCAAGGC

TGCGGTACCTCTGCATGAGCGC

CCAGCAGGACGGACAGGACTTCACC

CGGCTACACCAAGGACAAGCAGCAAG

ACAGCCTCAGAACCTCAAGAATAGTG

TGCAAAACCTCCAATCTGTCATGAGACCTCC

TTCGACCCAGGCAAGACCGAACCC

CACACCAGCATCCAACGCAA

Probe

CAGTGGTCAGAGTTTGAG

CAGTGTGCCATTGGCTGTCT

CCTGTCTCACCCCCAGCATA

GGTACAGTATTCCTCCAA

GTCTCTGGGAAGAGCAATGTAG

TGAAGCGATACGTGGGAATG

CAGTCTTGGCAGTGCAGATAA

GCC ACA TAA GAC TGA TTA GGG AA GGG TTA TGA ACAGAC TAA GCC

TCATCATCACCATCAGGATTCCT

TTC AGC CAC CAA ATT CAC ATC CAC CAACACATT AGC TTC

GTGTGACTTTAAGGGAGTA

ATGTACAGGATGGCGATGCA

CCCATTTGATGTTAGTGG

TCAGCCCGTATATCTTGCCG

GCAGCTCCTTGTATACTTCTCC

GCCCCCAGAGTAAGACTGGG

AACAGCTCATCGGCCTCATC

GGATGATGCTGGAGTATG

AGCCATACATCCCTTCCGTGA

CATCAGTTGCATCTCCAGTTCTG

CAGGGAATCTCCATCTTC

CAC CTT CTG TTT CAC TTC CTC T CTC TTC CAC TTT CTG CTT CAC

GTC AGT TCC AGT TCC AGT CAT C CAT AGT TCC AGT TCC AGT GTC

GGGATGGCAGTAAGGTCAAA

CAG GTT TGT CAG CCA GTA GAT GTA CCA CAG TGT GTT CAG

ACT GCC TGC TTA TTC CTC ATT A ATT CTC TTC TTA TGC GCC ACT

GGG TTC TTC ATG GTC CAG TTT CAG GTC ATG TTC TTC GGG

ReversePrimer

GGAAGAGCAACAAAGACA

CTGCAGCCTCAAGTGCAAAG

GGAGCCATGGATTGCACATT

TCCCTATGATAGCATTGG TCCCTATGATAGCATTGG

GGCAGTTCTGAGGTGATTAGAG

ATGATCAATGGGACTTCCGG

GGTCCTGGCATCTTGTCCAT

CAG GCA TGA ACG CCA TTT G TTT CCA ACG TGA GCA CAG

CAAGCTCACGTACTCCACTGAAG

CTT CTC CTT GGC CAT CTA TGA CTA CAT GGC CTT CTC CTT

GCTTGTGTCTAATCAGAATG

CCGGCAACAACAAGATCTGTG

GGTCTACATGTTCCAGTA

GATTGCCATCAAGGACGTCAG

AGACCCGAACTCCAAGTTATTC

CAGGAGACGTGATTGAAAGGG

AAGGCTGGCTTCCTGAGCTT

TGACGAAATTGACAGTTTC

CAGGGAGATGCTCTGTGTTCA

ATCCTACATCCATTCGGCTCT

CCACAAACTCACACGTAA

ACT CGG GAC TTC TGG GAT AA GAT TGG TTC GAC CGG ACT

AGC AGC ATC CAC GTA CTT ATT T ATT CTT GTA CAC ATC AGC AGC

ACATTCCGAGCAAGGGATAAG

CTG TAC ACT GCT GGT CCT TAT T TAT CCT GGT GCT ACT TAC CTG

CTT ACC CAC GGT TCC TTT CA TTT TCC GGT CACACC CTT

TGT ATG GAA GGA AAC CCA ATC C AAC ATC CCA GGA GAA ATG TGT

Forward primer Forward

Srebp2

Srebp1c

Asbt

Sr-b1

Cyclo

Mtp

Ibabp

Acc1

Synonym

Gene Symbol

protein2

element-binding

Sterolregulatory

protein1c

elementbinding

sterolregulatory

dependentbile

Apicalsodium

CyclophilinA

gene-like1

disease,type C1,

Niemann-Pick

HMGCoA-synthase

reductase

HMGCoA-

bindingprotein

Ilealbile acid

hydroxylase

sterol12-alpha- hydroxylase

oxysterol7-alpha monooxygenase

cholesterolalpha- 7 hydroxylase

sterol27-

thiolase

CoenzymeA

acetoacetyl

carboxylase1

acetyl-CoA

Synonym

Gene Name

Primer and Probe Sequences Probe and Primer

NM_013684.3

NM_033218.1

NM_011480.3

NM_011388.2 NM_011388.2

NM_009127.4

NM_016741.2

NM_008907.1

NM_207242.2

NM_001163457.1

NM_010700.3

NM_001291439.1

NM_008255.2

NM_001289726.1

NM_008003.2

NM_007988.3

NM_008375.2

NM_010012.3

NM_007825.4

NM_007824.2

NM_024264.5

NM_080434.3

NM_009692.4

NM_009338.3

NM_133360.2

NM_026180.3

NM_031884.1

NM_013454.3

Accession Number Accession

Tbp

Srebf2

Srebf1

Slc10a2

Scd1

Scarb1

Ppia

Npc1l1

Mttp

Ldlr

Hmgcs1

Hmgcr

Gapdh

Fgf15

Fasn

Fabp6

Cyp8b1

Cyp7b1

Cyp7a1

Cyp27a1

ApoA5

ApoA1

Acat2

Acaca

Abcg8

Abcg5

Abca1

GeneSymbol

TATA-boxbinding protein

binding2 transcriptionfactor

sterolregulatoryelement

binding1 transcriptionfactor

sterolregulatoryelement

(sodium/bileacid

solute family carrier 10

desaturase1

stearoyl-CoenzymeA

member1

scavenger receptor class B scavengerB classreceptor

peptidylprolylisomerase A

NPC1-like1

protein

microsomaltriglyceride transfer

lowdensity lipoprotein receptor

synthase 1 (soluble) synthase1

3-hydroxy-3-methylglutaryl-CoA

reductase

3-hydroxy-3-methylglutaryl-CoA

dehydrogenase

Glyceraldehyde-3-phosphate

(murine)

fibroblast growth factor 15 fibroblast15 factor growth

fatty acid synthaseacidfatty

fatty acid bindingacidfatty ilealprotein 6,

subfamilymember 1 B

cytochrome P450 family 8 P450 cytochrome subfamilymember 1 B

cytochrome P450 family 7 P450 cytochrome subfamilyA,polypeptide 1

cytochrome P450, family 7, P450, cytochrome subfamilymemberA 1

cytochrome P450 family 27 family 27 P450 cytochrome

ApolipoproteinA-V

apolipoproteinA-I

acetyl-CoAacetyltransferase 2

acetyl-CoAcarboxylase alpha

G member 8 G

ATP bindingATP cassettesubfamily

G member 5 G

ATP bindingATP cassettesubfamily

A memberA 1

ATP bindingATP cassettesubfamily

GeneName

Supporting Table 3.1. qPCR 3.1. Table Supporting

Mus musculusMus Species

Chapter 3 3 Chapter

168

Appendix 2

Supporting Figures

169

Chapter 2 Supporting Information

Supplementary Fig. 2.1. CDCA transiently induces FGF19 expression in Caco2 cells but co-administration with GSPE causes a dose-dependent inhibition. Time-course for FGF19 expression over 8 hours for (A) CDCA or GSPE treatment alone ((Negative control: ; 100 μM CDCA: ; 20 mg/L GSPE: ; 50 mg/L GSPE: ; 100 mg/L GSPE: ); and (B) CDCA+GSPE co-administration (Negative control: ; 100 μM CDCA: ; 100 μM CDCA + 50 mg/L GSPE: ; 100 μM CDCA + 100 mg/L GSPE: ). Statistical differences are shown as: *** p< 0.001, **** p<0.0001.

170

Supplementary Fig. 2.2. GSPE does not alter hepatic bile acid transporter expression. Relative gene expression is shown 14 hours after administration for (A) bile salt export pump (Bsep) and (B) sodium-taurocholate co-transporting polypeptide (Ntcp).

171

Appendix 3

A Grape Seed Procyanidin Extract Ameliorates Fructose-Induced

Hypertriglyceridemia in Rats Via Enhanced Fecal Bile Acid and Cholesterol

Excretion and Inhibition of Hepatic Lipogenesis.

Published October, 2015 in PLoS ONE; 10.1371/journal.pone.0140267

Gianella Caiozzi, Brian Wong, and Marie-Louise Ricketts conducted the animal studies.

Gianella Caiozzi, Fernando Del Ray, and Laura Downing conducted the qPCR assays.

Rebecca Heidker analyzed histology sections. Rebecca Heidker and Laura Downing performed the serum assays. Rebecca Heidker and Kelvin Rodriguez conducted the fecal assays. Laura Downing and Rebecca Heidker performed statistical analysis.

172

A Grape Seed Procyanidin Extract Ameliorates Fructose-Induced

Hypertriglyceridemia in Rats Via Enhanced Fecal Bile Acid and Cholesterol

Excretion and Inhibition of Hepatic Lipogenesis.

Laura E. Downing¶, Rebecca M. Heidker¶, Gianella C. Caiozzi¶#a, Brian S. Wong, Kelvin

Rodriguez, Fernando Del Rey and Marie-Louise Ricketts*

Department of Agriculture, Nutrition and Veterinary Sciences, University of Nevada Reno,

Reno, Nevada, United States of America.

#aCurrent Address: Hospital de Urgencia Asistencia Pública, Santiago, Chile.

*Corresponding author

Email: [email protected] (MLR)

Short title: GSPE ameliorates fructose induced hypertriglyceridemia

¶ These authors contributed equally to this work

173

Abbreviations

BA Bile acid

GSPE Grape seed procyanidin extract

TG Triglyceride

174

Abstract

The objective of this study was to determine whether a grape seed procyanidin extract

(GSPE) exerts a triglyceride-lowering effect in a hyperlipidemic state using the fructose- fed rat model and to elucidate the underlying molecular mechanisms. Rats were fed either a starch control diet or a diet containing 65% fructose for 8 weeks to induce hypertriglyceridemia. During the 9th week of the study, rats were maintained on their respective diet and administered vehicle or GSPE via oral gavage for 7 days. Fructose increased serum triglyceride levels by 171% after 9 weeks, compared to control, while

GSPE administration attenuated this effect, resulting in a 41% decrease. GSPE inhibited hepatic lipogenesis via down-regulation of sterol regulatory element binding protein 1c and stearoyl-CoA desaturase 1 in the fructose-fed animals. GSPE increased fecal bile acid and total lipid excretion, decreased serum bile acid levels and increased the expression of genes involved in cholesterol synthesis. However, bile acid biosynthetic gene expression was not increased in the presence of GSPE and fructose. Serum cholesterol levels remained constant, while hepatic cholesterol levels decreased. GSPE did not modulate expression of genes responsible for esterification or biliary export of the newly synthesized cholesterol, but did increase fecal cholesterol excretion, suggesting that in the presence of GSPE and fructose, the liver may secrete more free cholesterol into the plasma which may then be shunted to the proximal small intestine for direct basolateral to apical secretion and subsequent fecal excretion. Our results demonstrate that GSPE effectively lowers serum triglyceride levels in fructose-fed rats after one week administration. This study provides novel insight into the mechanistic actions of GSPE in treating hypertriglyceridemia and demonstrates that it targets hepatic de novo lipogenesis, bile acid homeostasis and non-biliary cholesterol excretion as important mechanisms for reducing hypertriglyceridemia and hepatic lipid accumulation in the presence of fructose.

175

Introduction

Rates of obesity, type 2 diabetes, non-alcoholic steatohepatitis (NASH) and non-alcoholic fatty liver disease (NAFLD) have increased significantly in recent years, both in children and adults [1-4]. This surge has correlated with a significant increase in dietary fructose intake in the United States, due in large part to the rise in consumption of sugar-sweetened beverages [5]. Fructose is a highly lipogenic dietary factor [6] and increasing evidence points to an obesogenic role for fructose via the generation of substrates for de novo lipogenesis, resulting from rapid hepatic metabolism [7]. Since fructose metabolism is insulin-independent [2], there is less uptake and catabolism of triglyceride (TG)-rich lipoproteins by tissues, ultimately resulting in increased postprandial plasma TG levels [8].

Increased hepatic lipogenesis, combined with decreased uptake of TGs in peripheral tissues, is an important mechanism by which fructose induces steatosis and elevates serum TG levels [9].

In contrast to fructose-induced metabolic dysregulation, evidence indicates that diets rich in fruits and vegetables, e.g. the Mediterranean diet, exert protective effects against the development of the metabolic syndrome [10]. Such diets tend to be high in flavonoids, which exhibit cardioprotective effects in humans [11, 12]. Dietary procyanidins, a class of flavonoids commonly found in grapes, apples and red wine, have been shown to ameliorate risk factors associated with hypertriglyceridemia and steatosis [13-17]. We previously reported that a grape seed procyanidin extract (GSPE) exerts hypotriglyceridemic effects in vivo in a normolipidemic state [18-22]. We identified GSPE as a co-agonist ligand for the farnesoid x receptor (nuclear receptor subfamily 1, group H, member 4; FXR) [22], a transcription factor that regulates bile acid (BA), TG, cholesterol and glucose homeostasis [23-27]. Mechanistically, GSPE functions in conjunction with

BAs, the endogenous ligands of FXR, to upregulate the expression of small heterodimer

176

partner (nuclear receptor subfamily 0, group B, member 2; Shp), which represses sterol regulatory element binding protein 1c (Srebp-1c) expression, a key regulator of lipogenesis, resulting in the concomitant decrease in downstream lipogenic gene expression [19, 22]. Evidence also shows that GSPE administration increases fatty acid

β-oxidation [19] and reduces VLDL-TG secretion [21].

Previous studies utilized a high-fat diet to examine the effects of GSPE [20, 28], however, since sugar intake is also a critical factor that can modulate metabolic homeostasis, particularly TG levels [29, 30], evaluation of the potential therapeutic impact of GSPE on animal models subjected to other dietary regimens, such as carbohydrate-induced hypertriglyceridemia, is warranted. Consequently, the aim of the current study was to more closely mimic a real-world scenario, by assessing whether GSPE can mitigate the effects of existing fructose-induced hypertriglyceridemia in vivo, and to determine the underlying molecular mechanisms. This investigation has important implications for further investigations in human subjects using GSPE as a potential natural therapy to counteract increased incidences of hypertriglyceridemia and steatosis.

In the present study, we show that a high-fructose diet for 8 weeks significantly increases serum TG levels in rats, while also markedly inducing hepatic lipid accumulation

(steatosis). Co-administration of GSPE with the high-fructose diet for one week only, during the 9th week of the study, effectively ameliorated the adverse consequential effects on serum TGs resulting from the high-fructose diet. This attenuation was achieved via enhanced fecal BA, total lipid, cholesterol and non-esterified fatty acid excretion, inhibition of hepatic de novo lipogenesis and increased TG catabolism. We evaluated the gene regulatory effects exerted by GSPE in the liver in the presence of fructose to gain a better insight and understanding regarding the molecular effects leading to the observed hypotriglyceridemic effect.

177

Materials and Methods

Grape Seed Procyanidin Extract (GSPE) was obtained from Les Dérives Résiniques et

Terpéniques (Dax, France). The extract was analyzed in-house using normal phase high performance liquid chromatography (HPLC), as previously described [31] to determine procyanidin composition based on the degree of polymerization. As shown in S1 Fig.,

GSPE is comprised of procyanidin monomers (68.68 ± 0.02%), dimers (26.16 ± 0.01%) and trimers (5.16 ± 0.02%).

Animal feeding studies and diets

Rats were housed under standard conditions and all experimental procedures were approved by the local Institutional Committee for Care and Use of Laboratory Animals

(IACUC) at the University of Nevada, Reno (Protocol # 00502). Male Wistar rats, 7 weeks of age, were purchased from Charles River Laboratories. After one week of acclimation, rats were randomly assigned to either a control diet (n=5) or fructose diet (n=8) for 8 weeks

(Harlan Teklad). As shown in Table 1, the starch control diet was a modification of AIN-

93G (TD.94045) replacing all sucrose with starch, and was comprised of (% by weight)

17.7% protein, 58.9% carbohydrate and 7.2% fat, providing 3.7 Kcal/g (TD.110787). The fructose diet was a modification of AIN-93G replacing all sucrose and starch with fructose, and was comprised of 17.7% protein, 64.7% carbohydrate and 7.2% fat, providing 3.9

Kcal/g (TD.110786). The animals were maintained on the AIN-93G formulated diets throughout the 9-week study, consistent with previous reports [32, 33]. Food was replenished 3 times per week and food intake was estimated by subtracting the total amount of feed and the amount remaining in the box. Rats were weighed weekly.

178

Table 1. Composition of the diets containing starch (control) and fructose as the major source of carbohydratea Ingredient Control Diet (g/kg) Fructose Diet (g/kg) Fructose 0 647 Casein 200 200 L-Cystine 3 3 Corn Starch 515 0 Maltodextrin 132 0 Soybean Oil 70 70 Cellulose 32.486 32.486 Mineral Mix 35 35 Vitamin Mix 10 10 Choline Bitartrate 2.5 2.5 Tert-butylhydroquinone (TBHQ) 0.014 0.014 aFormulated and supplied by Harlan Teklad.

Blood samples were collected at 0, 4 and 8 weeks to measure serum triglyceride levels.

After 8 weeks on the diets, the rats were randomly assigned to receive either vehicle

(water) or GSPE (250 mg/kg) via oral gavage for 7 days, while still consuming their assigned diets. The dose of GSPE used in this study is one-fifth of the no-observed- adverse-effect level (NOAEL) described for GSPE in male rats [34]. This dose is effective in reducing serum TG levels in normolipidemic C57BL/6 mice [19, 22] and rats [18], and was chosen to aid in the identification of the primary, short-term effects of grape seed procyanidins on lipid metabolism in the presence of fructose, in order to gain insight into the mechanisms that underlie their potential longer-term effects. Using a translation of animal to human doses based on metabolic body size [35] and estimating the food intake for a 60-kg human, the dose of GSPE used herein corresponds to ~1.8 g, which is less than a 2 g/day dose previously tested in human subjects [36]. On day 7, the rats were gavaged at 9am, food was then removed and they were sacrificed 5 hours later. Rats were anesthetized using isoflurane, blood was collected from the saphenous vein, after which the animals were euthanized using carbon dioxide, livers were excised and weighed, snap

179

frozen in liquid nitrogen and stored at –80oC. For collection of the feces, rats were placed in clean cages 3 days prior to the end of the experiment and feces were manually collected at the end of the study, air-dried and weighed.

Gene expression analysis

Total RNA was extracted from liver using TRIzol (Life Technologies) according to the manufacturer’s instructions. Complimentary DNA (cDNA) was reverse transcribed using superscript III reverse transcriptase (Life Technologies), and real-time quantitative polymerase chain reaction (qPCR) was used to determine gene expression changes. qPCR was performed using a CFX96 Real-Time System (BioRad). Forward and reverse primers and probes were designed using Primer3Plus software [37] and purchased from

Sigma-Aldrich or Integrated DNA Technologies. Expression of -actin and TATA box binding protein (Tbp) were used as endogenous controls. All gene names, abbreviations and accession numbers can be found in S1 Table. Primer and probe sequences can be provided upon request.

Biochemical Analysis

Serum triglyceride and total cholesterol were measured enzymatically using InfinityTM kits

(Thermo Scientific) according to the manufacturers’ instructions. Serum bile acid levels were measured using the Total Bile Acids Assay kit from Diazyme Laboratories, and serum free fatty acids were measured using a non-esterified fatty acid enzymatic colorimetric HR series NEFA-HR (2) assay from WAKO Chemicals USA Inc., performed according to the manufacturer’s instructions. Lipoprotein Lipase (LPL) activity was measured in serum using an ELISA kit (Cell Biolabs, Inc, San Diego, CA), and serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured

180

using Teco Diagnostic Kits (A526 and A561 respectively), according to the manufacturer’s instructions.

Histology

After removal from the rat, sections of excised liver were immediately immersed in 10% buffered formalin, and processed for hematoxylin and eosin (H&E) staining, which was performed by the Pathology Laboratory at University of Nevada, Reno.

Evaluation of Steatosis by Image Analysis

At least three non-consecutive microscopic fields per animal were randomly analyzed, by blindly moving the field of view, using an Olympus DP71 camera attached to a BX41 microscope, equipped with a UPlanFL 40X objective. Each image field was analyzed using a 94x70 point grid (PT). The volume density of hepatic steatosis (VV [steatosis, liver]) was then estimated as the ratio of the points marking the vesicles of fat (PP) compared to the number of test points using the following equation: VV [steatosis, liver] = PP [steatosis]/PT, as previously described [38].

Hepatic cholesterol measurement

Hepatic cholesterol was extracted using the Folch extraction method and levels were measured as previously described [39, 40]. Briefly, lipids were extracted from 100 mg of liver using a chloroform/methanol mixture. Cholesterol was then determined using a colorimetric Infinity cholesterol assay kit, performed according to the manufacturers’ instructions. Extracted cholesterol contents were normalized to wet liver weight.

Measurement of fecal bile acid, total lipid, cholesterol and free fatty acid excretion

A modified version of the method reported by Modica et al., was used to measure fecal

BA content [40]. Briefly, 0.2 g of dried feces was mixed with 2 ml of 2 mg/ml sodium borohydrate in ethanol and incubated at room temperature for 1 hour. Hydrochloric acid

181

and sodium hydroxide were added and samples were vortexed and allowed to digest for

12 hours under reflux. The samples were then filtered and dried under nitrogen. Samples were re-suspended in milli-Q water and filtered through Sep-Pak C18 cartridges (Thermo

Scientific), washed and eluted with methanol and dried under nitrogen. Samples were re- dissolved in 1 ml methanol and BA concentrations were measured enzymatically, using the Total Bile Acids Assay kit from Diazyme Laboratories. Fecal cholesterol and non- esterified fatty acids were extracted as previously described [40], and cholesterol levels were measured using a colorimetric Infinity cholesterol assay kit and non-esterified fatty acids were quantified using a Wako diagnostics HR Series NEFA-HR (2) assay. Total fecal lipids were assessed via gravimetric analysis following Folch extraction. Briefly, 0.5 ml aliquots of the chloroform layer were placed into pre-weighed glass tubes (three tubes per sample) and allowed to evaporate in a fume hood overnight. The next day, the weights were recorded and converted to percent lipids (mg lipid/mg dry fecal weight).

Statistical Analysis

Data represents the mean ± SEM for the fold change relative to control (or endogenous gene expression) (n=4 or 5 per treatment, per group, analyzed in triplicate). One-way analysis of variance (ANOVA) followed by Holm-Sidak post-hoc tests was employed to detect significant differences between groups. Treatment differences were considered statistically significant at p<0.05. All statistical analyses were performed using GraphPad

Prism version 6.05 for Windows, GraphPad Software (San Diego, CA).

Results

Effect of fructose feeding for 8 weeks and co-administration with GSPE for the 9th week of the study on body weight, liver weight and serum biochemical analysis

182

Fructose feeding for 8 weeks did not significantly increase body weight compared to the rats fed the control diet (Table 2). As shown in S2A Fig., the fructose fed rats tended to have a lower body weight compared to the control animals after the first week on the diets, a trend which continued through to week 8. Food intake was not statistically different between the groups.

GSPE administration during the 9th week of the study did not have any significant effect on the body weight of the rats in the fructose-GSPE group, compared to the fructose- vehicle group. As shown in S2B Fig., the group of animals assigned to receive GSPE in week 9 demonstrated no significant differences in body weight during the course of the study. In contrast, the fructose-fed rats had a significantly higher liver to body weight ratio compared to the control group at the end of the study, as shown in Table 2, with no significant differences observed following GSPE administration.

Control-VEH Fructose-VEH Fructose-GSPE

Body Weight (g) 509.04 ± 9.56 461.25 ± 15.23* 468.45 ± 8.38*

Liver Weight (g) 14.94 ± 0.32 15.70 ± 0.91 15.75 ± 0.75

% liver weight to body weight ratio 2.94 ± 0.08 3.40 ± 0.11** 3.36 ± 0.10*

Table 2. Body and liver weight and % liver weight to body weight ratio at the time of sacrificea. aRats were fed either the control or fructose diet for 8 weeks. Vehicle (water) or GSPE (250 mg/kg) was administered daily via oral gavage during the 9th week of the study. Significantly different from control: *p<0.05 and **p<0.01.

Consistent with the increased liver weight, fructose-fed animals had a significantly higher grade of microvesicular steatosis and increased hepatic lipid accumulation volume density, compared to the control group (Fig. 1). The fructose-fed rats also showed

183

evidence of mild inflammatory infiltration around the portal triad (Fig. 1C). GSPE administration for one week resulted in a significant decrease in hepatic lipid volume density and therefore steatosis (Figs. 1E, F and G).

184

Fig. 1. Fructose-induced hepatic lipid accumulation is ameliorated by GSPE administration. Representative liver histology sections stained with hematoxylin and eosin from (A and B) Control, (C and D) Fructose-vehicle and (E and F) Fructose-GSPE treated rats. Lipid droplet infiltration is evident in the fructose-fed rats as indicated by the black arrows (BD: Bile duct; CV: Central vein; HA: Hepatic artery; PT: Portal triad); (G) Lipid accumulation induced by fructose consumption was evaluated using image analysis of the histological sections from each animal. The volume of lipid droplets was assessed as a percentage of the total hepatic volume. *p<0.05 and **p<0.01

185

The fructose diet increased serum TG levels by 171% compared to the control group after

9 weeks (Fig. 2A), which was ameliorated by treatment with GSPE resulting in a 41% reduction. No significant changes were observed in the fructose-fed rats with respect to serum cholesterol (Fig. 2B) or NEFA levels (Fig. 2C). Serum BA levels were not altered by the fructose diet alone, however, co-administration with GSPE for one week significantly reduced serum BA levels (Fig. 2D). Neither fructose feeding nor GSPE administration caused liver damage, as evidenced by the fact that the values for both ALT and AST remained within normal limits (Figs. 2E and F). Lipoprotein lipase activity did not change upon fructose consumption, nor following GSPE administration (Fig. 2G). Hepatic cholesterol levels were significantly reduced following GSPE administration (Fig. 2H).

Fecal BA levels were significantly decreased by the fructose diet, and increased following

GSPE administration (Fig. 3A). Total fecal lipid excretion was significantly increased by

GSPE in the fructose-fed animals (Fig. 3B). Fecal cholesterol (Fig. 3C) and NEFA (Fig.

3D) were both increased by the fructose diet, while GSPE further enhanced their excretion.

186

Fig. 2. Serum biochemical analysis and hepatic cholesterol content. Serum was analyzed for (A) triglycerides (TG) (B) cholesterol (CHOL), (C) non-esterified fatty acids (NEFA), (D) bile acids (BA), (E) Alanine aminotransferase (ALT), (F) aspartate aminotransferase (AST); the dotted lines represent the normal upper and lower limits respectively. (G) lipoprotein lipase activity (LPL), and (H) hepatic cholesterol content (CHOL). *p<0.05, ***p<0.001 and ****p<0.0001.

187

Fig. 3. GSPE increases fecal bile acid, total fecal lipid, cholesterol and fatty acid excretion. Fecal (A) bile acids (BA), (B) total fecal lipid, (C) cholesterol (CHOL) or (D) non- esterified fatty acids (NEFA) were analyzed. *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001.

188

Expression of genes involved in hepatic lipogenesis, cholesterol & bile acid synthesis and transport.

To explore the molecular mechanism underlying the hypotriglyceridemic effect of GSPE observed in the fructose-fed animals, we next examined the expression of hepatic genes that regulate lipogenesis, cholesterol synthesis and transport, and BA synthesis and transport. Dietary fructose did not alter sterol regulatory element binding protein 1c

(Srebp-1c) expression in this study; however, GSPE significantly reduced expression (Fig.

4A). Peroxisome proliferator-activated receptor gamma, coactivator 1beta(Pgc-1 activates the expression of genes involved in lipogenesis and TG secretion via direct co- activation of Srebp [41]. Consequently, Pgc-1, a regulator of both carbohydrate and lipid metabolism, has been proposed to play a pivotal role in fructose-induced lipogenesis [41].

However, fructose feeding reduced Pgc-1 expression, compared to the control diet, in this study (Fig. 4B). Fructose feeding, either with or without GSPE, had no effect on fatty acid synthase (Fasn) expression, a Srebp-1c lipogenic target gene (Fig. 4C). Stearoyl-

CoA desaturase (delta-9-desaturase) 1 (Scd1) another SREBP-1c target gene, although not affected by fructose, was markedly repressed by GSPE (Fig. 4D).

189

Fig. 4. Hepatic expression of genes involved in lipogenesis. Gene expression changes were analyzed for (A) Srebp-1c, (B) Pgc-1α, (C) Fasn, (D) Scd1, (E) Pparα, (F) Fgf21 and (G) Mlxipl. *p<0.05, **p<0.01 and ****p<0.0001.

190

An alternative mechanism by which fructose can increase lipogenesis is via repression of peroxisome proliferator-activated receptor alpha (Ppar) [42]. Consequently, we also assessed the effects of fructose feeding on the expression of Ppar and fibroblast growth factor 21 (Fgf21), a down-stream target of Ppar [43-45]. As shown in Fig. 4E, fructose feeding did not alter the expression of Ppar, however, Fgf21 expression was significantly repressed (Fig. 4F). Ppar expression was significantly repressed by GSPE, compared to the control, while no difference was seen with respect to Fgf21 expression in the presence of GSPE, compared to fructose only. No significant changes in the expression of MLX interacting protein-like (Mlxipl), also referred to as carbohydrate response element binding protein, were observed following fructose ingestion or GSPE administration in this study (Fig. 4G).

Based on the combined observations of reduced serum TG and BA levels and increased fecal BA excretion, we postulated that serum TG levels were reduced due to the need to synthesize cholesterol and then BAs. Therefore, we next examined potential regulatory effects on genes involved in both cholesterol and BA synthesis. Dietary fructose had no effect on the expression of 3-hydroxy-3-methylglutaryl-CoA synthase 1 (Hmgcs1), while

GSPE significantly increased expression (Fig. 5A).

191

Fig. 5. Hepatic expression of genes involved in cholesterol synthesis following treatments. Gene expression changes were analyzed for (A) Hmgcs1, (B) Hmgcr, (C) Fdft1, (D) Sqle, (E) Lss, and (F) Dhcr7. *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001.

192

In addition, no changes in expression were seen in the fructose-fed animals with respect to 3-hydroxy-3-methylglutaryl-CoA reductase (Hmgcr) (Fig. 5B). However, GSPE increased expression of Hmgcr compared to both the control and fructose-vehicle-treated animals. In addition, several genes important in cholesterol synthesis were significantly upregulated in the presence of GSPE, including farnesyl-diphosphate farnesyltransferase

1 (Fdft1) (Fig. 5C), squalene epoxidase (Sqle) (Fig. 5D), lanosterol synthase (2,3- oxidosqualene-lanosterol cyclase) (Lss) (Fig. 5E) and 7-dehydrocholesterol reductase

(Dhcr7) (Fig. 5F), indicating that there was increased cholesterol synthesis in the presence of GSPE. Consequently, we next evaluated the effects of GSPE on BA biosynthesis. No significant effects were seen with respect to cytochrome P450, family 7, subfamily A, polypeptide 1, (cholesterol 7 alpha-monooxygenase; Cyp7a1) expression, which initiates the classical (neutral) BA biosynthetic pathway, following GSPE administration (Fig. 6A), while cytochrome P450, family 8, subfamily B, polypeptide 1,

(sterol 12-alpha-hydroxylase; Cyp8b1) levels were significantly reduced (Fig. 6B). We then assessed the effects of GSPE on genes involved in the alternative (acidic) BA biosynthesis pathway. No significant effects were observed with respect to cytochrome

P450, family 27, subfamily A, polypeptide 1 (steroid 27-hydroxylase; Cyp27a1) (Fig. 6C) or cytochrome P450, family 7, subfamily B, polypeptide 1 (oxysterol 7-alpha-hydroxylase;

Cyp7b1) (Fig. 6D). In addition, no changes were observed in the expression of ATP- binding cassette, sub-family B (MDR/TAP), member 11 (bile salt export pump; Abcb11)

(Fig. 6E).

193

Fig. 6. Hepatic expression of genes involved in bile acid biosynthesis and transport following treatments.Gene expression changes were analyzed for (A) Cyp7a1, (B) Cyp8b1, (C) Cyp27a1, (D) Cyp7b1, and (E) Abcb11. ** p<0.01.

194

Since we observed an increase in endogenous cholesterol synthesis but no changes in the expression of genes regulating BA biosynthesis, despite reduced hepatic cholesterol levels, we next analyzed expression levels of acetyl-CoA acetyltransferase 1 (Acat1) and acetyl-CoA acetyltransferase 2 (Acat2) to determine whether the newly synthesized cholesterol was being esterified and exported, for assembly into lipoproteins. No changes in Acat1 (Fig. 7A) or Acat2 expression (Fig. 7B) were observed. ATP-binding cassette, subfamily (ABC1), member 1 (Abca1) either directly or indirectly mediates the transport of cholesterol and phospholipids across cell membranes, where they are removed from cells by apolipoproteins [46]. We therefore measured Abca1 and found no changes in expression (Fig. 7C). Our previous studies showed that GSPE reduced levels of apolipoprotein B (ApoB) in HepG2 cells [19], and measurement of microsomal triglyceride transfer protein (Mttp) expression, which helps to deliver TG to ApoB was not affected by either fructose feeding or GSPE administration in this study (Fig. 7D). We next analyzed the expression of ATP-binding cassette, subfamily G (WHITE), member 5 (Abcg5) and

ATP-binding cassette, subfamily G (WHITE), member 8 (Abcg8) to determine whether the unesterified cholesterol underwent biliary export. No significant changes in expression were observed for either Abcg5 or Abcg8 (Figs. 7E and F), and fructose feeding did not alter low density lipoprotein receptor (Ldlr) expression (Fig. 7G).

195

Fig. 7. Hepatic expression of genes involved in hepatic cholesterol export. Gene expression changes were analyzed for (A) Acat1, (B) Acat2, (C) Abca1, (D) Mttp, (E) Abcg5, (F) Abcg8, and (G) Ldlr.

196

Discussion

The study presented herein provides new evidence establishing that one week administration with GSPE effectively lowers serum TG levels in a model of fructose- induced hypertriglyceridemia. Previous reports showed that GSPE decreases serum TGs in a normolipidemic state in several animal models, including rats [18, 19, 22]. We now show that, under conditions of severe hypertriglyceridemia, GSPE causes a significant

41% reduction in serum TG levels. This is comparable to that seen with fenofibrate, one of the most commonly prescribed lipid-lowering agents in the world [47], which reduces serum TGs by 36% [48]. Cholesterol synthesis gene expression was increased in the fructose-GSPE treated animals, and was accompanied by a concomitant increase in fecal excretion of cholesterol, which could occur via transintestinal cholesterol efflux (TICE) [49].

Additionally, compared to the control diet, fructose caused a marked increase in hepatic lipid droplet accumulation, indicative of steatosis (>5% lipid volume), which was significantly attenuated following co-administration with GSPE.

It is well established that high-fructose feeding causes diet-induced alterations in lipid metabolism [50]. In the present study, we observed a significant 171% increase in serum

TGs in the rats after 9 weeks on the fructose diet. Increased expression of Srebp-1c was previously shown to be one mechanism underlying fructose-induced hypertriglyceridemia, however, it is not the only mechanism involved [8]. Pparserves as an essential regulator of lipid metabolism, with gene ablation disrupting normal lipid homeostasis [51]. Hepatic suppression of Ppar was also identified as a mechanism contributing to serum hypertriglyceridemia induced by a high-fructose diet [50]. Additionally, reduced Fgf21 levels have been shown to decrease lipolysis [43].

197

In the current study, GSPE administration in the fructose-fed rats significantly decreased the expression of both Srebp1c and Scd1, indicating decreased TG synthesis, thereby contributing to reduced serum TG levels. We did not observe an increase in Srebp-1c following fructose consumption, likely due to the fact that the rats were fasted for 5 hours prior to sacrifice. It is well known that Srebp-1c is sensitively suppressed by fasting or nutritional deprivation [52, 53]. Therefore, fasting could have resulted in the lack of induction in the expression of Srebp-1c and its downstream targets, including Pgc-1 and

Fasn, in addition to Mlxipl, in the fructose-fed animals. Despite no effect on Srebp1c, Fgf21 expression was reduced in the fructose group, indicating decreased lipolysis [43].

Therefore, it is possible that repression of Fgf21 is the underlying mechanism by which fructose induced hypertriglyceridemia in these rats.

Reduced serum BA levels observed in the fructose-GSPE treated rats correlate with increased fecal BA output. Indeed, decreased intestinal BA absorption, combined with reduced hepatic lipogenesis, may be linked to the observed reduction in serum TG levels.

Reduced BA absorption necessitates increased conversion of cholesterol into BAs. Since the rats consumed a cholesterol-free diet, increased endogenous cholesterol synthesis is necessary for the production of BAs. This is consistent with the observed increase in cholesterol synthesis gene expression observed in this study. Interestingly, there was no effect on Cyp7a1, which encodes cholesterol 7-hydroxylase, the rate-limiting enzyme in

BA biosynthesis. Cyp8b1, responsible for canonical BA synthesis, was decreased, with no changes in alternative BA biosynthetic gene expression, indicating that the newly synthesized cholesterol is not then shuttled into the pathway for BA production. In addition, the most readily available source of acetyl CoA for use in cholesterol synthesis would be

198

from catabolized TGs, which provides an elegant explanation for the observed reduction in serum TGs, even in the presence of fructose.

GSPE administration profoundly increased total fecal lipid excretion, as well as BA excretion. It is known that hepatobiliary cholesterol excretion is not the only way to remove cholesterol from the body. The proximal part of the small intestine is now known to actively secrete cholesterol, via a pathway called transintestinal cholesterol efflux (TICE) [49]. The rate of TICE strongly depends on the presence of a cholesterol acceptor, and increased levels of BAs in the intestinal lumen are known to increase TICE [54]. When bile salts are combined with phospholipid, the TICE pathway is strongly stimulated [55]. Therefore, increased levels of both BA and total lipid within the intestine could stimulate TICE and therefore contribute to enhanced fecal cholesterol excretion. Consequently, serum cholesterol levels remained the same due to an equilibrium being achieved between the rate of endogenous cholesterol synthesis and the amount secreted from the liver into the blood to be subsequently excreted via TICE. Importantly, and in agreement with this notion, the amount of cholesterol excreted in the feces exceeds the levels that could have originated from dietary intake.

In addition to decreased serum TG levels, GSPE treatment significantly decreased hepatic steatosis induced by fructose, as evidenced by the reduction in hepatic lipid droplet accumulation and cholesterol content. Steatosis by itself is considered to be a relatively benign and reversible condition [56]. However, transition from steatosis into NASH represents a key step in pathogenesis, since it sets the stage for further liver damage, including development of fibrosis, cirrhosis and eventually hepatocellular carcinoma [56].

Progression from simple steatosis to NASH usually involves a “second hit”, e.g. oxidative stress and inflammation, and previous studies have shown that accumulation of

199

cholesterol, rather than fatty acids or triglycerides, is critical for this progression [57].

Reduction in hepatic cholesterol content has been proposed as a fundamental treatment strategy for NAFLD [58]. It may be speculated that one reason why the newly synthesized cholesterol is not converted to BAs, esterified or moved to the plasma membrane for export via the apolipoprotein/Abca1 pathway by GSPE in the presence of fructose, is because it is removed from the liver as a protective mechanism against further progression of steatosis.

In conclusion, this study provides valuable and innovative insight into the molecular regulatory actions of GSPE in treating hypertriglyceridemia in the fructose-fed rat model.

This is achieved at the molecular level via GSPE-induced down-regulation in the hepatic expression of Srebp1c and Scd1, to decrease lipogenesis, combined with increased endogenous hepatic cholesterol synthesis, without any corresponding increase in de novo

BA biosynthesis from the newly synthesized cholesterol in the fructose-fed rats. The novel observations resulting from this study demonstrate that, in the presence of fructose, GSPE alters the conversion of endogenously synthesized cholesterol, directing it through TICE for export via the feces. These results, combined with the decreased levels of steatosis, indicate that GSPE warrants further investigation as a treatment strategy against metabolic dysregulation and potential for amelioration of hepatic steatosis.

200

Supporting Information:

S1 Fig. HPLC analysis of the procyanidin composition in grape seed procyanidin extract (GSPE).

201

S2 Fig. Body Weight during the 8 week feeding study for (A) Control versus Fructose-fed rats, and (B) Fructose-Vehicle versus Fructose-GSPE treated rats.

202

S1 Table. Gene names, abbreviations and accession numbers and synonyms. and numbers accession and abbreviations names, Gene Table. S1

203

Acknowledgements

The authors would like to thank Dr. Mike Teglas, DVM, Ph.D., Department of ANVS, for assistance with histological analysis of rat liver sections.

204

References

1. Ludwig DS, Peterson KE, Gortmaker SL: Relation between consumption of sugar-sweetened drinks and childhood obesity: a prospective, observational analysis. Lancet 2001, 357:505-508. 2. Montonen J, Jarvinen R, Knekt P, Heliovaara M, Reunanen A: Consumption of sweetened beverages and intakes of fructose and glucose predict type 2 diabetes occurrence. J Nutr 2007, 137:1447-1454. 3. Marchesini G, Brizi M, Bianchi G, Tomassetti S, Bugianesi E, Lenzi M, McCullough AJ, Natale S, Forlani G, Melchionda N: Nonalcoholic fatty liver disease: a feature of the metabolic syndrome. Diabetes 2001, 50:1844-1850. 4. Marchesini G, Bugianesi E, Forlani G, Cerrelli F, Lenzi M, Manini R, Natale S, Vanni E, Villanova N, Melchionda N, Rizzetto M: Nonalcoholic fatty liver, steatohepatitis, and the metabolic syndrome. Hepatology 2003, 37:917-923. 5. Marriott BP, Cole N, Lee E: National Estimates of Dietary Fructose Intake Increased from 1977 to 2004 in the United States. Journal of Nutrition 2009, 139:S1228-S1235. 6. Dekker MJ, Su Q, Baker C, Rutledge AC, Adeli K: Fructose: a highly lipogenic nutrient implicated in insulin resistance, hepatic steatosis, and the metabolic syndrome. Am J Physiol Endocrinol Metab 2010, 299:E685-694. 7. Stanhope KL, Schwarz JM, Havel PJ: Adverse metabolic effects of dietary fructose: results from the recent epidemiological, clinical, and mechanistic studies. Curr Opin Lipidol 2013, 24:198-206. 8. Chong MFF, Fielding BA, Frayn KN: Mechanisms for the acute effect of fructose on postprandial lipemia. American Journal of Clinical Nutrition 2007, 85:1511-1520. 9. Samuel VT: Fructose induced lipogenesis: from sugar to fat to insulin resistance. Trends Endocrinol Metab 2011, 22:60-65. 10. Kastorini CM, Milionis HJ, Esposito K, Giugliano D, Goudevenos JA, Panagiotakos DB: The effect of Mediterranean diet on metabolic syndrome and its components: a meta-analysis of 50 studies and 534,906 individuals. J Am Coll Cardiol 2011, 57:1299-1313.

205

11. Hertog MG, Feskens EJ, Hollman PC, Katan MB, Kromhout D: Dietary antioxidant flavonoids and risk of coronary heart disease: the Zutphen Elderly Study. Lancet 1993, 342:1007-1011. 12. Hertog MG, Kromhout D, Aravanis C, Blackburn H, Buzina R, Fidanza F, Giampaoli S, Jansen A, Menotti A, Nedeljkovic S, et al.: Flavonoid intake and long-term risk of coronary heart disease and cancer in the seven countries study. Arch Intern Med 1995, 155:381-386. 13. Rasmussen SE, Frederiksen H, Struntze Krogholm K, Poulsen L: Dietary proanthocyanidins: occurrence, dietary intake, bioavailability, and protection against cardiovascular disease. Mol Nutr Food Res 2005, 49:159- 174. 14. Caimari A, Del Bas JM, Crescenti A, Arola L: Low doses of grape seed procyanidins reduce adiposity and improve the plasma lipid profile in hamsters. Int J Obes (Lond) 2012. 15. Osakabe N: Flavan 3-ols improve metabolic syndrome risk factors: evidence and mechanisms. J Clin Biochem Nutr 2013, 52:186-192. 16. Auger C, Gerain P, Laurent-Bichon F, Portet K, Bornet A, Caporiccio B, Cros G, Teissedre PL, Rouanet JM: Phenolics from commercialized grape extracts prevent early atherosclerotic lesions in hamsters by mechanisms other than antioxidant effect. J Agric Food Chem 2004, 52:5297-5302. 17. Zern TL, Wood RJ, Greene C, West KL, Liu Y, Aggarwal D, Shachter NS, Fernandez ML: Grape polyphenols exert a cardioprotective effect in pre- and postmenopausal women by lowering plasma lipids and reducing oxidative stress. J Nutr 2005, 135:1911-1917. 18. Del Bas JM, Fernandez-Larrea J, Blay M, Ardevol A, Salvado MJ, Arola L, Blade C: Grape seed procyanidins improve atherosclerotic risk index and induce liver CYP7A1 and SHP expression in healthy rats. FASEB J 2005, 19:479- 481. 19. Del Bas JM, Ricketts ML, Baiges I, Quesada H, Ardevol A, Salvado MJ, Pujadas G, Blay M, Arola L, Blade C, et al: Dietary procyanidins lower triglyceride levels signaling through the nuclear receptor small heterodimer partner. Mol Nutr Food Res 2008, 52:1172-1181.

206

20. Quesada H, del Bas JM, Pajuelo D, Diaz S, Fernandez-Larrea J, Pinent M, Arola L, Salvado MJ, Blade C: Grape seed proanthocyanidins correct dyslipidemia associated with a high-fat diet in rats and repress genes controlling lipogenesis and VLDL assembling in liver. Int J Obes (Lond) 2009, 33:1007- 1012. 21. Quesada H, Diaz S, Pajuelo D, Fernandez-Iglesias A, Garcia-Vallve S, Pujadas G, Salvado MJ, Arola L, Blade C: The lipid-lowering effect of dietary proanthocyanidins in rats involves both chylomicron-rich and VLDL-rich fractions. Br J Nutr 2012, 108:208-217. 22. Del Bas JM, Ricketts ML, Vaque M, Sala E, Quesada H, Ardevol A, Salvado MJ, Blay M, Arola L, Moore DD, et al: Dietary procyanidins enhance transcriptional activity of bile acid-activated FXR in vitro and reduce triglyceridemia in vivo in a FXR-dependent manner. Mol Nutr Food Res 2009, 53:805-814. 23. Watanabe M, Houten SM, Wang L, Moschetta A, Mangelsdorf DJ, Heyman RA, Moore DD, Auwerx J: Bile acids lower triglyceride levels via a pathway involving FXR, SHP, and SREBP-1c. J Clin Invest 2004, 113:1408-1418. 24. Ma K, Saha PK, Chan L, Moore DD: Farnesoid X receptor is essential for normal glucose homeostasis. J Clin Invest 2006, 116:1102-1109. 25. Duran-Sandoval D, Mautino G, Martin G, Percevault F, Barbier O, Fruchart JC, Kuipers F, Staels B: Glucose regulates the expression of the farnesoid X receptor in liver. Diabetes 2004, 53:890-898. 26. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ: Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000, 102:731-744. 27. Houten SM, Volle DH, Cummins CL, Mangelsdorf DJ, Auwerx J: In vivo imaging of farnesoid X receptor activity reveals the ileum as the primary bile acid signaling tissue. Mol Endocrinol 2007, 21:1312-1323. 28. Terra X, Montagut G, Bustos M, Llopiz N, Ardevol A, Blade C, Fernandez-Larrea J, Pujadas G, Salvado J, Arola L, Blay M: Grape-seed procyanidins prevent low-grade inflammation by modulating cytokine expression in rats fed a high-fat diet. J Nutr Biochem 2009, 20:210-218.

207

29. Chan TF, Lin WT, Huang HL, Lee CY, Wu PW, Chiu YW, Huang CC, Tsai S, Lin CL, Lee CH: Consumption of sugar-sweetened beverages is associated with components of the metabolic syndrome in adolescents. Nutrients 2014, 6:2088-2103. 30. Reaven GM, Ho H: Sugar-induced hypertension in Sprague-Dawley rats. Am J Hypertens 1991, 4:610-614. 31. Kelm MA, Johnson JC, Robbins RJ, Hammerstone JF, Schmitz HH: High- performance liquid chromatography separation and purification of cacao (Theobroma cacao L.) procyanidins according to degree of polymerization using a diol stationary phase. J Agric Food Chem 2006, 54:1571-1576. 32. Shrestha S, Ehlers SJ, Lee JY, Fernandez ML, Koo SI: Dietary green tea extract lowers plasma and hepatic triglycerides and decreases the expression of sterol regulatory element-binding protein-1c mRNA and its responsive genes in fructose-fed, ovariectomized rats. J Nutr 2009, 139:640- 645. 33. Masterjohn C, Park Y, Lee J, Noh SK, Koo SI, Bruno RS: Dietary fructose feeding increases adipose methylglyoxal accumulation in rats in association with low expression and activity of glyoxalase-2. Nutrients 2013, 5:3311-3328. 34. Yamakoshi J, Saito M, Kataoka S, Kikuchi M: Safety evaluation of proanthocyanidin-rich extract from grape seeds. Food Chem Toxicol 2002, 40:599-607. 35. Rucker R, Storms D: Interspecies comparisons of micronutrient requirements: metabolic vs. absolute body size. J Nutr 2002, 132:2999-3000. 36. Clifton PM: Effect of Grape Seed Extract and Quercetin on Cardiovascular and Endothelial Parameters in High-Risk Subjects. J Biomed Biotechnol 2004, 2004:272-278. 37. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA: Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 2007, 35:W71-74. 38. Aguila MB, Pinheiro Ada R, Parente LB, Mandarim-de-Lacerda CA: Dietary effect of different high-fat diet on rat liver stereology. Liver Int 2003, 23:363- 370.

208

39. Folch J, Lees M, Sloane Stanley GH: A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 1957, 226:497- 509. 40. Modica S, Murzilli, S. and Moschetta, A. : Characterizing Bile Acid and Lipid Metabolism in the Liver and Gastrointestinal Tract of Mice. Current Protocols in Mouse Biology 2011, 1:289–321.

. 41. Nagai Y, Yonemitsu S, Erion DM, Iwasaki T, Stark R, Weismann D, Dong J, Zhang D, Jurczak MJ, Loffler MG, et al: The role of peroxisome proliferator- activated receptor gamma coactivator-1 beta in the pathogenesis of fructose-induced insulin resistance. Cell Metab 2009, 9:252-264. 42. Roglans N, Sanguino E, Peris C, Alegret M, Vazquez M, Adzet T, Diaz C, Hernandez G, Laguna JC, Sanchez RM: Atorvastatin treatment induced peroxisome proliferator-activated receptor alpha expression and decreased plasma nonesterified fatty acids and liver triglyceride in fructose-fed rats. J Pharmacol Exp Ther 2002, 302:232-239. 43. Inagaki T, Dutchak P, Zhao G, Ding X, Gautron L, Parameswara V, Li Y, Goetz R, Mohammadi M, Esser V, et al: Endocrine regulation of the fasting response by PPARalpha-mediated induction of fibroblast growth factor 21. Cell Metab 2007, 5:415-425. 44. Lundasen T, Hunt MC, Nilsson LM, Sanyal S, Angelin B, Alexson SE, Rudling M: PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Commun 2007, 360:437-440. 45. Badman MK, Pissios P, Kennedy AR, Koukos G, Flier JS, Maratos-Flier E: Hepatic fibroblast growth factor 21 is regulated by PPARalpha and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metab 2007, 5:426-437. 46. Oram JF: HDL apolipoproteins and ABCA1: partners in the removal of excess cellular cholesterol. Arterioscler Thromb Vasc Biol 2003, 23:720-727. 47. Moutzouri E, Kei A, Elisaf MS, Milionis HJ: Management of dyslipidemias with fibrates, alone and in combination with statins: role of delayed-release fenofibric acid. Vasc Health Risk Manag 2010, 6:525-539.

209

48. Birjmohun RS, Hutten BA, Kastelein JJ, Stroes ES: Efficacy and safety of high- density lipoprotein cholesterol-increasing compounds: a meta-analysis of randomized controlled trials. J Am Coll Cardiol 2005, 45:185-197. 49. van der Velde AE, Brufau G, Groen AK: Transintestinal cholesterol efflux. Curr Opin Lipidol 2010, 21:167-171. 50. Kelley GL, Azhar S: Reversal of High dietary fructose-induced PPARα suppression by oral administration of lipoxygenase/cyclooxygenase inhibitors. In Nutr Metab (Lond). Volume 2. London2005: 18 51. Lee SS, Pineau T, Drago J, Lee EJ, Owens JW, Kroetz DL, Fernandez-Salguero PM, Westphal H, Gonzalez FJ: Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol 1995, 15:3012-3022. 52. Horton JD, Bashmakov Y, Shimomura I, Shimano H: Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice. Proc Natl Acad Sci U S A 1998, 95:5987-5992. 53. Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, Lowell BB, Spiegelman BM: Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest 1998, 101:1-9. 54. van der Velde AE, Vrins CL, van den Oever K, Kunne C, Oude Elferink RP, Kuipers F, Groen AK: Direct intestinal cholesterol secretion contributes significantly to total fecal neutral sterol excretion in mice. Gastroenterology 2007, 133:967-975. 55. van der Velde AE, Vrins CL, van den Oever K, Seemann I, Oude Elferink RP, van Eck M, Kuipers F, Groen AK: Regulation of direct transintestinal cholesterol excretion in mice. Am J Physiol Gastrointest Liver Physiol 2008, 295:G203-G208. 56. Wouters K, van Gorp PJ, Bieghs V, Gijbels MJ, Duimel H, Lutjohann D, Kerksiek A, van Kruchten R, Maeda N, Staels B, et al: Dietary cholesterol, rather than liver steatosis, leads to hepatic inflammation in hyperlipidemic mouse models of nonalcoholic steatohepatitis. Hepatology 2008, 48:474-486.

210

57. Fernandez A, Colell A, Garcia-Ruiz C, Fernandez-Checa JC: Cholesterol and sphingolipids in alcohol-induced liver injury. J Gastroenterol Hepatol 2008, 23 Suppl 1:S9-15. 58. Enjoji M, Nakamuta M: Is the control of dietary cholesterol intake sufficiently effective to ameliorate nonalcoholic fatty liver disease? World J Gastroenterol 2010, 16:800-803.

211

Appendix 4

translin is required for metabolic regulation of sleep

Published in Current Biology, March 23, 2016; Volume 26; Issue 7: 972-980

Rebecca Heidker performed initial work on the 2-deoxyglucose, blue dye, protein,

glycogen, and triglyceride assays.

212

translin is required for metabolic regulation of sleep

Kazuma Murakami1,2#; Maria E. Yurgel1,2#; Bethany A. Stahl2, Pavel Masek3, Aradhana

Mehta1, Rebecca Heidker1, Wesley Bollinger1,2, Robert M. Gingras4, Young-Joon Kim5,

William W. Ja6, Beat Suter7, Justin R. DiAngelo4,8, and Alex C. Keene1,2*

1. Department of Biology, University of Nevada, Reno, NV 89557.

2. Department of Biological Sciences, Florida Atlantic University, John D MacArthur

Campus, Jupiter, FL, USA.

3. Department of Biology, SUNY Binghamton, Binghamton, NY 13902

4. Department of Biology, Hofstra University, Hempstead, NY, 11549

5. School of Life Sciences, Gwangju Institute of Science and Technology, Gwangju, South

Korea

6. Department of Metabolism and Aging, The Scripps Research Institute, Jupiter, FL 33458

7. University of Bern, Institute of Cell Biology, Bern, Switzerland, CH-3012.

8. Division of Science, Penn State Berks, Reading, PA 19610

# denotes equal contributions

* address correspondence to [email protected]

Running title: Metabolic regulation of sleep in Drosophila

213

Highlights

Flies deficient for translin fail to integrate sleep and metabolic state translin does not regulate stress response, metabolic function, or feeding translin functions in Leucokinin neurons to regulate sleep

Silencing of Leucokinin neurons abolishes starvation-induced sleep suppression

In Brief

Sleep and feeding are interconnected, and pathological disturbances of either process are associated with metabolism-related disorders. Murakami et al. identify the RNA/DNA binding protein Translin as a regulator of sleep-metabolism interactions in the fruit fly, providing insight into the neural basis for integrating sleep and metabolic state.

214

Summary

Dysregulation of sleep or feeding has enormous health consequences. In humans, acute sleep loss is associated with increased appetite and insulin insensitivity, while chronically sleep-deprived individuals are more likely to develop obesity, metabolic syndrome, type II diabetes, and cardiovascular disease. Conversely, metabolic state potently modulates sleep and circadian behavior; yet, the molecular basis for sleep-metabolism interactions remains poorly understood. Here, we describe the identification of translin (trsn), a highly conserved RNA/DNA binding protein, as essential for starvation-induced sleep suppression. Strikingly, trsn does not appear to regulate energy stores, free glucose levels, or feeding behavior suggesting the sleep phenotype of trsn mutant flies is not a consequence of general metabolic dysfunction or blunted response to starvation. While broadly expressed in all neurons, trsn is transcriptionally upregulated in the heads of flies in response to starvation. Spatially restricted rescue or targeted knockdown localizes trsn function to neurons that produce the tachykinin family neuropeptide Leucokinin.

Manipulation of neural activity in Leucokinin neurons revealed these neurons to be required for starvation-induced sleep suppression. Taken together, these findings establish trsn as an essential integrator of sleep and metabolic state, with implications for understanding the neural mechanism underlying sleep disruption in response to environmental perturbation.

Results and discussion

In humans, sleep and feeding are tightly interconnected, and pathological disturbances of either process are associated with metabolism-related disorders. Acute sleep loss correlates with increased appetite and insulin insensitivity, while chronically sleep- deprived individuals are more likely to develop obesity, metabolic syndrome, type II diabetes, and cardiovascular disease [1–3]. Conversely, in humans and rodents, internal

215

metabolic state potently modulates sleep and circadian behavior [4–6]. Despite the widespread evidence for interactions between sleep loss and metabolic dysfunction, little is known about how these processes integrate within the brain.

To address this question, we sought to identify integrators of sleep and metabolic state in the fruit fly, Drosophila melanogaster. Knockdown of genes from randomly selected RNAi lines was achieved by expression of UAS-RNAi under the control of the neuron-specific

GAL4 driver, n-Synaptobrevin-GAL4 (nSyb- GAL4) [7, 8]. Following 24 hr of baseline sleep measurements on food, sleep was measured during 24-hr starvation on agar, and the change in sleep was calculated as previously described [9]. Starvation-induced sleep suppression was reduced in flies with neuron-specific knockdown of the RNA/DNA binding protein translin (trsn) (Figure 1A). To confirm the effect of trsn-RNAi on sleep, we tested two additional RNAi transgenes. All three RNAi lines showed similar phenotypes; trsn knockdown flies slept similarly to control flies on food, while sleep loss resulting from starvation was reduced or absent (Figures 1B–1E). Targeted knockdown of trsn in the fat body (yolk-GAL4) or muscle (24b-GAL4), two tissues involved in energy storage, showed normal sleep suppression in response to starvation (Figure S1A), supporting the notion that trsn functions primarily in neurons to regulate sleep.

216

Figure 1. trsn Is Required for Metabolic Regulation of Sleep (A–C) Sleep profile for hourly sleep averages over a 48 hr experiment. Flies are on food for day 1, then transferred to agar for day 2. Sleep does not differ between any of the groups for day 1. The trsn knockdown groups (nSyb>trsn; orange) sleep more than nSyb-GAL4/+ (black) and trsnIR/+ controls (gray) during day

217

2 (starved). (D) Control flies (nSyb-GAL4/+ and trsnIR/+) sleep significantly more on food (black) than when starved (blue, nR36; p < 0.001), while no significant differences in sleep duration are observed in flies where nSyb-GAL4 drives expression of trsnIR#1 (n = 45; p > 0.98), trsnIR#2 (n = 45; p > 0.99), or trsnIR#3 (n = 36; p > 0.98). (E) Quantifying the percentage change in sleep between fed (day 1) and starved (day 2) states reveals significantly greater sleep loss in nSyb-GAL4/+ controls (nSyb-Gal4/+ versus trsnIR#1/+, nR38; p > 0.95; nSyb-Gal4/+ versus trsnIR#2/+, nR39; p > 0.99; nSyb-Gal4/+ versus trsnIR#3/+, nR37; p > 0.99) compared to all three lines with neuronal expression of trsnIR#1(n R 38; p < 0.01), trsnIR#2 (n R 39; p < 0.001), and trsnIR#3 (n R 36; p < 0.01). (F) Sleep profile over 48 hr reveals that sleep in trsnEP and trsnnull does not differ from w1118 control flies on food. Both trsnEP and trsnnull mutant flies sleep more than control flies on agar.

In Drosophila, starvation induces hyperactivity in addition to sleep loss [9–11]. To determine whether trsn also regulates the hyperactivity response to starvation, we analyzed waking activity in fed and starved trsn knockdown flies. Neuronal knockdown of trsn had no effect on waking activity in fed flies but reduced starvation- induced hyperactivity (Figure S1B). These findings are consistent with the notion that trsn does not modulate sleep or activity in the fed state but is required for both sleep and locomotor changes that result from starvation.

To validate that the sleep phenotype in trsn knockdown flies was not due to off-target effects of RNAi, we measured sleep in flies with a mutation in the trsn locus. Both male and female flies with a P element insertion in the trsn locus (trsnEP) or the excision allele

(trsnnull) are viable [12] and exhibit reduced sleep suppression during starvation (Figures

1F–1H, S1C, and S1D), phenocopying flies with neuron-specific RNAi knockdown. The

null waking activity of trsn flies phenocopies RNAi knockdown flies under fed conditions, while starvation-induced hyperactivity is blunted or absent in trsn mutants (Figure S1E).

A number of systems have been developed for high-resolution video tracking that may provide a more accurate measure of sleep compared to infrared-based monitoring

1118 null systems [13–16]. Tracking analysis revealed that w control, but not trsn flies, suppress sleep during starvation, confirming that the results obtained using infrared

218

tracking are not an artifact of the sleep acquisition system (Figure S1F). Taken together, these findings indicate starvation-induced sleep suppression and locomotor activity are reduced in trsn mutant flies.

Starved flies utilize glucose and fatty acids to maintain metabolic homeostasis, and the availability of these energy sources may regulate sleep. To determine the energy source required for normal sleep, we fed flies the glycolysis inhibitor 2-Deoxyglucose (2-DG) [17] or the carnitine palmitoyltransferase antagonist, etomoxir, an inhibitor of fatty acid b- oxidation [18]. Treatment with both of these drugs has been used extensively in mammals, and these inhibitors have similar effects on fly metabolism [19, 20]. Flies were fed standard food laced with 400 mM 2-DG or 25 mM etomoxir and monitored for sleep to determine whether the breakdown products of glucose or triglyceride stores (or both) contribute to reduced sleep during starvation. Flies fed 2-DG, but not etomoxir, significantly reduced sleep, suggesting that reduced glucose availability or the energy derived from its metabolism, rather than fatty acids, contribute to sleep suppression (Figure 1I and data not shown). When trsn mutant flies were subjected to the same protocol, no changes in sleep were observed with 2-DG feeding (Figure 1I). The finding that trsn mutant flies are insensitive to sleep regulation in response to both acute food deprivation and pharmacological perturbation of energy utilization suggests trsn is critical for the integration of sleep and metabolic state.

It is possible that the reduced ability of trsn mutants to suppress sleep during starvation stems from a general inability to modulate sleep in response to environmental or pharmacological disruption. To test this, sleep rebound was determined by mechanically shaking flies at 3–4 min intervals for 12 hr during the night (zeitgeber time [ZT]12–ZT24)

null and measuring sleep for 12 hr (ZT0–ZT12) the following day. Sleep-deprived trsn flies

219

showed a significant increase in daytime sleep that was not present in undisturbed

null 1118 controls (Figure S1G). The sleep rebound in trsn flies was comparable to w control flies, indicating that trsn is dispensable for the homeostatic response to mechanical sleep deprivation (Figure S1G). In addition to mechanical deprivation, numerous pharmacological agents including the stimulant caffeine and free-radical-inducing agent

1118 null paraquat disrupt sleep in flies [21, 22]. Both w control and trsn flies significantly reduced sleep when fed food laced with caffeine (Figure S1H) or paraquat (Figure S1I), supporting the notion that the loss of starvation-induced sleep suppression in trsn mutant flies does not result from a generalized inability to suppress sleep.

Flies with enhanced energy stores do not suppress sleep or increase activity in response to starvation [10, 20]. Drosophila primarily stores energy as triglycerides and glycogen, and prolonged food-deprivation results in depletion of both stores. To test the possibility that trsn mutant flies do not suppress sleep when fasted due to increased energy stores, we measured triglyceride and glycogen levels using colorimetric assays standardized to total protein level [23, 24]. No differences in glycogen, triglyceride, or free glucose levels

null 1118 were observed between fed or 24 hr starved trsn flies and w controls (Figures

S2A!S2C), indicating that the loss of starvation-induced sleep suppression in trsn mutant flies is not due to an increase in energy stores.

Many metabolism-related genes regulate both sleep and feeding [25], raising the possibility that trsn is generally required for hunger-dependent behaviors. To determine whether trsn modulates reflexive food acceptance response, we measured the proboscis extension reflex (PER) of flies starved for 24 hr prior to behavioral testing (Figure 2A) [26,

null 1118 27]. Total PER response did not differ between starved trsn and w flies to sucrose concentrations of ranging from 1 to 1,000 mM (Figure 2B), or 5% yeast extract (Figure

220

2C), indicating that trsn is dispensable for reflexive feeding. To measure food consumption, we provided flies with 100 mM sucrose or 5% yeast extract in the capillary tube feeding (CAFE) assay (Figure 2D) [28]. Flies were starved for 24 hr prior to the start of the assay, and consumption was measured over 12 hr. No differences in total consumption of 100 mM sucrose or 5% yeast extract was detected between control and

null trsn flies (Figure 2E). To quantify feeding over a shorter timeframe, the blue dye assay was used to determine the quantity of food consumed in fed and 24 hr starved flies over

null a 30 min period [29]. No differences between control and trsn flies were detected in overall consumption in the fed or starved state, indicating that trsn does not regulate acute food consumption (Figures 2F and 2G). Taken together, three independent feeding assays indicate that trsn does not regulate feeding behavior during the starved state.

221

Figure 2. Starvation-Induced Feeding Is Normal in trsn Mutant Flies (A) Diagram of the proboscis extension reflex (PER) assay. Tastant is supplied to the tarsi of a tethered female fly. (B and C) No significant differences in PER are detected between control (black) and trsnnull mutants (gray) to increasing concentrations of sucrose (n R 10; 1 mM, p > 0.84; 10 mM, p > 0.21; 100 mM and 1,000 mM, p > 0.95) (B) or 5% yeast extract (n = 18; p > 0.98) (C). (D) Diagram of the capillary feeder assay (CAFE) assay. Flies are presented with one capillary containing 100 mM sugar or 5%

222

yeast extract and a second containing water. (E) No significant differences in sucrose (left bars, n = 4; p > 0.34) or yeast (right bars, n > 4; p > 0.18) were detected between control and trsnnull flies when presented with each tastant. (F) Starved or fed flies are placed on food containing blue dye for 30 min, and consumption is measured. Representative images of flies following the assay show increased consumption in starved control and trsnnull mutants compared to fed controls. (G) Quantification of food intake reveals a significant increase in starved controls and trsnnull flies compared to fed flies from each genotype (nR26; p < 0.001). No differences were observed between genotypes in the fed (n R 29; p > 0.99) or starved (n R 26; p > 0.99) states. All bars are mean ± SEM; ***p < 0.001 by two-way ANOVA. See also Figure S2.

In Drosophila, trsn is expressed in the brain throughout development [30]. To determine whether trsn is acutely regulated in response to sleep or feeding state, we measured trsn transcript levels by qPCR in flies that were previously starved or sleep deprived. trsn was expressed at low levels in the heads and bodies of fed flies and was specifically upregulated in the head following 24 hr of starvation (Figure 3A). No changes in trsn transcript were detected after 12 hr of mechanical sleep deprivation, suggesting the upregulation of trsn expression is not a generalized response to stress or environmental perturbation (Figure 3B). To confirm that TRSN protein is increased in response to starvation, we performed immunohistochemistry on brains immunostained with anti-

TRSN. Quantification of whole-brain fluorescence confirmed that TRSN protein is increased in response to starvation (Figures 3C and 3D). In agreement with previous

null findings, TRSN signal is below detection in trsn mutants and dramatically reduced in nSyb-GAL4>trsn-IR flies, confirming the antibody specifically labels TRSN (data not shown and [12]). Counterstaining with the neuronal marker embryonic lethal abnormal vision (ELAV) revealed that TRSN and ELAV are expressed in all neurons during the fed and starved states (Figure 3E), suggesting the observed changes in protein levels are not due to altered protein localization. Together, these data suggest that at the RNA and protein levels, trsn is increased in response to starvation.

223

The finding that trsn is upregulated in response to starvation raises the possibility that it functions acutely to modulate sleep. RNAi targeted to trsn was acutely induced in 3-day- old animals using the GeneSwitch system. Flies were fed food laced with 0.25 mM RU486, and sleep was measured on food and agar. Adult-specific pan-neuronal knockdown with all three RNAi lines under regulation of elav-Switch impaired sleep suppression compared to genotype-matched controls not fed RU486 or genetic controls lacking the trsnIRi transgene ([31, 32]; Figures 3F and S3). These findings, coupled with the upregulation of trsn in response to starvation, provide evidence that trsn is required during adulthood for the integration of sleep and metabolic state.

224

Figure 3. Spatial and Temporal Localization of trsn Function (A) Expression of trsn is upregulated in the heads (n R 14; p < 0.01), but not bodies, of w1118 control flies (n R 14; p > 0.99) following 24 hr of starvation. (B) trsn transcript does not differ in heads between flies sleep deprived for 12 hr from ZT12–ZT24 and undisturbed controls (n = 3; p > 0.17). Red arrow denotes point of tissue collection. (C and D) Immunohistochemistry for whole-brain TRSN protein (B). Neuropils are labeled by NC82 for reference (magenta), and anti-TRSN (green) is observed throughout the brain. Whole-brain TRSN protein quantification of fluorescence intensity revealed TRSN is increased in starved flies compared to fed control (n R 6; p < 0.002) by paired t test. (E) Immunostaining for anti- TRSN (magenta) and the neuronal marker anti-ELAV (green) reveals colocalization between TRSN and ELAV proteins in brains of fed (F) Percentage sleep loss in experimental flies treated with

225

RU486 (orange bars) or controls without drug treatment (black bars). Sleep suppression is significantly reduced in elav-Switch>trsnIR#1 flies (n R 36; p > 0.031), elav-Switch>trsnIR#2 (n R 68; p < 0.011), and elav-Switch>trsnIR#3 (n R 34; p < 0.041) flies fed RU486 compared to non-RU486- fed controls. There is no effect of RU486 feeding in flies harboring the elav-Switch transgene alone (n R 39; p > 0.99). All other bars are mean ± SEM; *p < 0.05; **p < 0.01; by two-way ANOVA. See also Figure S3.

We next sought to identify neurons where trsn functions to modulate sleep. Peptidergic neurons are critical regulators of many behaviors, including sleep and feeding [33–35]; therefore, we screened GAL4 lines labeling defined populations of peptidergic neurons or neurons previously shown to regulate sleep. We identified the Leucokinin (LK) neurons, where knockdown of trsn reduced sleep modulation in response to starvation. LK has been implicated in a host of fly behaviors including feeding and water homeostasis, locomotion, and olfactory behavior [36, 37]. Driving membrane tethered CD8::GFP with LK-GAL4 labeled a single large neuron in the lateral horn and three pairs of neurons in the subesophageal zone ([37]; Figure 4A).

226

Figure 4. trsn Functions in Leucokinin Neurons to Regulate Sleep (A) Whole-brain confocal reconstruction of LK-GAL4>mCD8::GFP. GFP-expressing neurons (green) labeled the subesophageal zone and dorsal protocerebrum. The brain was counterstained with the neuropil marker nc82 (gray). Scale bar denotes 100 mm. (B) Immunostaining for anti-TRSN (magenta) in the brain of LK-GAL4>UAS-GFP.nls reveals TRSN localizes to neurons labeled by LK-GAL4 (white). Depicted is a representative 2 mm section from the lateral horn region. Scale bar denotes 10 mm. The neuropil marker anti-nc82 (gray) is used as background. (C) Knockdown of trsn in LK- GAL4 neurons alone reduces starvation-induced sleep suppression in all three trsnIR lines compared to control flies harboring a UAStrsnIR transgene alone (n R 52; p < .001) or LK-GAL4 transgenes alone (n R 64; p < 0.001). (D) Expression of UAS-trsn under LK-GAL4 control in the background of a trsnnull mutation restores starvation-induced sleep suppression compared to flies harboring either UAS-trsn (n = 87; p < 0.05) or the GAL4 lines alone (n = 79; p < 0.01). No significant

227

differences were detected between LK rescue and w1118 control flies (n R 38; p > 0.10). (E) Starvation-induced sleep suppression is abolished in flies expressing TNT in LK-GAL4 neurons (LK-GAL4>UAS-TNT, fed versus starved n = 39; p = 0.96) while controls expressing inactive UAS- IMP-TNT suppress sleep (fed versus starved: LK-GAL4>UAS-IMP-TNT, n = 33, p < 0.001). Sleep duration on food does not differ significantly between LK-GAL4>UAS-TNT and UAS-IMP-TNT flies (n R 34, p > 0.06). (F) Flies were transferred to agar at ZT9, then sleep was measured at 31"C on food (black) or agar (blue) over the 12 hr night (ZT12–ZT24). Genetic silencing of LKGAL4 abolished starvation-induced sleep suppression (LK-GAL4>UAS-ShiTS, fed versus starved, nR40, p > 0.98), while control flies robustly suppressed sleep (fed versus starved: control, n R 79, p < TS1 0.001; UAS- Shi /+, n R 42, p < 0.0001; LK-GAL4/+, n R 51, p < 0.002). No differences were observed between genotypes in the fed state (fed versus fed: control versus LK-GAL4>UAS-ShiTS, p > 0.72; UAS-ShiTS/+ versus LK-GAL4>UAS-ShiTS, p > 0.98, LK-GAL4/+ versus LK-GAL4>UAS- ShiTS, p = 0.07). All columns are mean ± SEM; **p < 0.01; ***p < 0.001; by two-way ANOVA. See also Figure S4.

Immunostaining brains of LK-GAL4 flies driving nuclear GFP (UAS-GFP.nls) revealed that the LK-GAL4 neurons that are co-labeled by TRSN antibody (Figure 4B). In addition, all three trsn-IR lines impaired starvation-induced sleep suppression when expressed under the control of LK-GAL4 (Figure 4C), whereas restoration of trsn specifically in LK-GAL4 neurons, or in all neurons with nSyb-GAL4, rescued starvation-induced sleep suppression to control levels (Figures 4D and S4A). Therefore, trsn function in LK neurons is essential for starvation-induced sleep loss.

To further examine the role of LK neurons in sleep regulation, we blocked synaptic release from LK neurons and measured sleep in fed and starved flies [37, 38]. Chronic blockade of synaptic release in LK neurons with tetanus toxin (TNT) impaired starvation-induced sleep suppression compared to control flies expressing an inactive form of TNT (UAS-

IMP-TNT) or genetic controls harboring only a single transgene ([39]; Figures 4E and

S4B). In fed conditions, silencing of LK neurons increased sleep compared to controls that approached significance, raising the possibility that these neurons are wake promoting

(Figure S4B). To examine the effects of acutely silencing LKGAL4 neurons, the dominant- negative form of the GTPase Shibire (ShiTS1) was expressed in LK neurons, and sleep was measured in both fed and starved flies during the night period [40]. Flies expressing

228

TS1 Shi in LK-labeled neurons failed to suppress sleep at the non-permissive temperature of 31"C (Figures 4F and S4C–S4E). Control and experimental groups did not suppress sleep at 22"C due to the lower temperature and shortened duration of the assay (Figures

S4C and S4D). Therefore, LK neurons are acutely required for modulation of sleep in response to starvation, supporting the notion that trsn function in LK neurons is essential for the integration of sleep and metabolic state.

Taken together, we have identified trsn as an essential regulator of sleep-metabolism interactions. While many genes have been identified as genetic regulators of sleep or metabolic state, multiple lines of evidence indicate that trsn functions as a unique integrator of these processes. trsn is not required for the homeostatic increase in sleep following mechanical deprivation or response to stimulants, suggesting trsn is not generally required for acute modulation of sleep. Further, trsn-deficient flies display normal feeding behavior, indicating that it is not required for modulation of behavior in response to food deprivation. Finally, energy stores in trsn mutant flies are normal, indicating that the starvation-induced sleep suppression phenotype is not due to increased nutrient storage. These results provide evidence that trsn is not required for the perception of starvation or the general induction of hunger-related behaviors but is required for the induction of wakefulness in the absence of food.

While trsn is broadly expressed in the Drosophila nervous system, we localize the function of trsn in metabolic regulation of sleep to LK-expressing neurons. Targeted knockdown of trsn in LK neurons disrupts metabolic control of sleep, while restoring trsn to LK neurons rescues sleep regulation in trsn mutants. In addition to regulating sleep, ablation of LK neurons reduces meal number, while increasing consumption during individual feeding bouts, suggesting a role in feeding behavior [37]. LK is expressed in the subesophageal

229

zone, the insect taste center, and in modulatory neurons within the lateral horn, raising the possibility that the sleep and feeding phenotypes associated with LK mutations or manipulation of LK neurons may localize to distinct brain regions [37]. It is possible that the same populations of LK neurons regulate meal frequency and sleep or distinct neurons modulate each process. Combinatorial genetic approaches to manipulate subsets of

GAL4-labeled neurons in combination with recent advances in behavioral analysis of meal frequency may allow for the localization of LK neurons involved in each behavioral process

[41–43].

In addition to its known role in the synthesis of non-coding RNA, TRSN physically associates with Translin- Associated Protein X (TRAX) [44, 45]. TRSN and TRAX are essential components for the RNA-induced silencing complex (RISC), suggesting a role in post-transcriptional gene silencing through the generation of small RNAs. trsn knockout mice have diminished forebrain monoamine levels, indicating that trsn may serve to regulate neurotransmitter synthesis [46]. Further investigation of the mechanistic relationship between trsn and neural regulation of sleep will provide a framework to study the molecular properties and neural networks that are associated with interactions between sleep and metabolic state.

Experimental procedures

Drosophila Maintenance and Fly Stocks

Flies were grown and maintained on standard food (New Horizon Jazz Mix, Fisher

Scientific). Flies were maintained in incubators (Powers Scientific; Dros52) at 25"C on a

12:12 LD cycle, with humidity set at 55%–65%. The back- ground control line used in this

1118 EP study is the w fly strain, and all experimental fly strains including trsn and nSyb-GAL4 were outcrossed for 5–6 generations into this background. The nSyb-GAL4 line was a

230

generous gift from Dr. Julie Simpson (UCSB). For further genotype information, see

Supplemental Experimental Procedures.

Sleep and Feeding Analysis

Unless otherwise noted, fly activity was monitored using Drosophila Activity Monitors

(DAM2; Trikinetics) as previously described [47] (Hendricks et al., 2000; Shaw, Cirelli,

Greenspan, & Tononi, 2000). Female flies were briefly anesthetized using CO2 within 1 hr of lights on at zeitgeber time on at (ZT0) and placed into plastic tubes containing standard fly food. All flies were given at least 22 hr to recover from anesthesia prior to behavior experiments. For detailed description of all behavioral paradigms, see Supplemental

Experimental Procedures.

Pharmacological Manipulation

For pharmacological manipulation of glucose and fatty acid utilization, flies were loaded into tubes containing standard fly food. Following a 24 hr acclimation period, flies were transferred at ZT0 into tubes containing standard fly food (control), food laced with 400 mM 2-DG, 25 mM etomoxir, or 400 mM 2-DG and 25 mM etomoxir, and sleep was measured for an additional 24 hr. For GeneSwitch experiments, a 100 mM stock solution of RU486 (Sigma) was added to fly food or 1% agar solution to a final concentration of

0.25 mM RU486. For further details, see Supplemental Experimental Procedures.

Paraquat dichloride (Sigma) was dissolved directly into1% agar with5% sucrose and poured into plates to obtain a 1 mM concentration of paraquat. To test the effect of caffeine on sleep, we dissolved caffeine (Sigma) in melted fly food and poured it into plates to a concentration of 4 mg/mL. Further details are provided in Supplemental Experimental

Procedures.

231

Protein, Glycogen, and Triglyceride Measurements

Assays for quantifying triglyceride, glycogen, and protein content of flies were performed as previously described [23, 24]. Further details are provided in Supplemental

Experimental Procedures. qPCR and Immunohistochemistry

Flies were collected 5–7 days after eclosion. Ten or more flies were separated into fed and starved groups and were flash frozen. Total RNA was extracted from fly heads using the QIAGEN RNeasy Tissue Mini kit according to the manufacturer’s protocol. RNA samples were reverse transcribed using iScript (Biorad), and the generated cDNA was used for real-time PCR (Biorad CFX96, SsoAdvanced Universal SYBR Green Supermix qPCR Mastermix Plus for SYBRGreen I) using 1.7 ng of cDNA template per well and a primer concentration of approximately 300 nM. Specific primer details are provided in

Supplemental Experimental Procedures.

Statistical Analysis

Statistical analyses were performed using InStat software (GraphPad Software 5.0) or

IBM SPSS 22.0 software (IBM). For analysis of sleep, we employed a one- or two-way

ANOVA followed by a Tukey’s post hoc test. For PER experiments, each fly was sampled three times with the same stimulus. The response was binary (PER yes/no), and these three responses were pooled for values ranging from 0 to 3. The Kruskal-Wallis test (non- parametric ANOVA) was performed on the raw data from single flies, and Dunn’s multiple comparisons test was used to compare different groups. For the capillary feeding assay,

30–60 flies were used per tube, and 4–20 tubes per group were tested. The Wilcoxon

232

signed rank test (non-parametric) with two-tailed p value was used to test significance on single groups.

233

Supplemental information

Figure S1 related to Figure 1: Characterization of sleep in trsn deficient flies.

234

A. Percentage sleep loss in flies expressing trsnIR in the fat body (yolk-GAL4) or muscle (24b- GAL4). No significant differences are observed between trsn knockdown and control flies harboring GAL4 alone (N≥11; P>0.34 for both groups). B. Average waking activity (beam breaks/waking minute) in fed (black) and starved (blue) flies over 24 hours. Waking activity in fed flies does not differ between any genotypes (N≥36; P>0.98). Under starved conditions, waking activity is increased in nSyb-GAL4/+ and trsnIR/+ control flies (N≥36; P<0.001), while no change in waking activity is detected in each of the three nSyb-GAL4>trsnIR knockdown lines (N≥36; P>0.91). C. In male flies, sleep is significantly reduced in starved w1118 controls (N=39; P<0.01), while sleep duration of trsnEP (N=45; P<0.76) and trsnnull flies (N=48; P>0.82) does not significantly differ on food and agar. D. Percentage change in sleep from fed to starved conditions in male flies show sleep loss is significantly greater in control flies compared to trsnEP and trsnnull flies (N≥39, P<0.001). E. Average waking activity in fed (black) and starved (blue) flies over 24 hours. Waking activity in fed flies does not differ between any genotypes (N≥54; P<0.66). Waking activity during starvation is increased in control (N=54; P<0.001) and trsnEP flies (N=69; P>0.66), while there is no effect of starvation on waking activity in trsnnull flies (N=68; P>0.98). Waking activity of starved trsnEP flies is reduced compared to controls suggesting a blunted locomotor response to starvation. F. Video tracking analysis of sleep in fed and starved flies. In control flies, sleep is significantly reduced in fed control (black) compared to starved control (blue, N≥37; P<0.001), while no significant differences are observed in fed trsnEP or trsnnull mutant flies (N≥39; P>0.99). G. Daytime sleep from ZT0-ZT12 is significantly greater following mechanical sleep deprivation for 12 hours from ZT12-ZT24 (pink) compared to undisturbed flies (black) for w1118 control (N=32; P<0.001) and trsnnull genotypes (N=32; P<0.001). Total sleep does not differ between sleep-deprived control and trsnnull (N=32; P>0.43) flies or undisrupted control and trsnnull (N=32, P>0.23) flies from ZT0- ZT12. H. Sleep is reduced in control (N=32; P<0.05), trsnEP (N=32; P<0.01) and trsnnull (N=32; P<0.001) flies fed food containing caffeine (orange) compared to flies fed standard fly food (black). HI Sleep is reduced in control (N=32; P<0.01), trsnEP (N=32; P<0.01), and trsnnull (N=32; P<0.01) fed paraquat (orange) compared to flies fed standard fly food (black). All error bars are mean ± SEM. * denotes P<0.05*, ** denotes P<0.01, *** denotes P<0.001,*** by two- way ANOVA.

235

Figure S2 related to Figure 2: Energy stores and free glucose are normal in trsn mutant flies. A. Triglyceride levels did not differ between control (black) and trsnnull (grey) in the fed (N=20; P>0.92) or starved state (N=20; P>0.99). B. Glycogen levels did not differ between control (black) and trsnnull (grey) in the fed (N=16; P>0.67) or starved state (N=16; P<0.96). C. Free glucose did not differ between control (black) and trsnnull (grey) in the fed (N≥16; P>0.75) nor starved state (N≥13; P>0.81). All bars are mean ± SEM by two-way ANOVA.

236

Figure S3 related to Figure 3: Adult-specific knockdown of trsn disrupts sleep suppression. A. Sleep profiles depicting hourly sleep averages over a 48 hour experiment. Flies are placed on food for day 1, then transferred to agar for day 2. Flies harboring elav-Switch alone with RU486 treatment (orange) or elav-Switch alone without treatment (black). BD. Sleep on agar is greater in exprimental flies (elav-Switch>trsnIR; orange) fed RU486 compared to genotype- matched controls without drug treatment (black).

237

Figure S4, related to Figure 4. LK neurons are acutely required for starvationinduced sleep suppression. A. Expression of UAS-trsn under control nSyb-GAL4 null in the background of a trsn mutation restores starvation-induced sleep suppression compared to flies harboring either UAS-trsn (N≥37; P<0.05) or the GAL4 line alone (N≥82;P<0.01). No significant difference was detected between nSyb rescue and control flies (N≥37; P>0.66) . B. Sleep profile over 48 hours reveals that sleep in LK-GAL4>UAS-TNT (red) flies is moderately increased 1118 compared to w control flies (black) or flies expressing inactive IMP-TNT (grey) for day one on food. Sleep in LK-GAL4>UAS-TNT is significantly greater for day two on agar compared to control and IMP-TNT-expressing flies. C. No significant differences for sleep duration on food (black) or agar (blue) were detected for any of the genotypes tested when flies were housed at 22°C (Fed vs

238

Starved: control, N≥38, P=0.99; UAS- ShiTS/+; N≥87, P=0.83, LK-GAL4/+, N=26, P=0.97, LK- GAL4>UAS- ShiTS; N≥23, P=0.99). D. Sleep profile over 12 hours on food at 31°C reveals that 1118 sleep in LKGAL4> UAS-ShiTS (green) flies does not differ from w controls (black) or respective heterozygote controls (brown/grey). E. Sleep profile over 12 hours on agar at 31°C reveals that 1118 sleep suppression in LK-GAL4>UAS-ShiTS (green) sleep significantly more than w controls (black) and heterozygote controls (brown/grey). All columns are mean ± SEM; P<0.01,**; P<0.001,*** by 2-way ANOVA.

239

Supplemental Experimental Procedures

Drosophila maintenance and Fly Stocks

The trsn-RNAi lines are from the Vienna Drosophila Resource Center [S1]. The RNAi lines have been renamed from original transformant identifiers as follows: trsn-IR#1 (GD9963),

EP trsn-IR#2 (GD9964) and trsn-IR#3 (108456). The trsn line is the EPgy2 insertion trsnEY06981

null and has previously been characterized [S2–S4]. The trsn allele is an excision of the

1118 trsnEY06981 locus derived from mobilizing the EPgy2 insertion in the w background that has been previously described [S3]. This allele removes the entire coding region of the gene and likely represents a null mutation. It has previously been described as Δtrsn [S3].

The LK-GAL4 line is a promoter fusion of 3.6 kb upstream of LK, cloned in the laboratory of YJK with a similar expression pattern to a previously described line [5].. The lines UAS-

TS1 TNT and UAS-Shi have previously been described [7, 8]. The UAS-mCD8::GFP (32184;

[S6]) and UAS-GFP.nls (32184; [S9]) transgenes have previously been described and were obtained from Bloomington. The UAS-trsn transgene was generated by amplifying from GM27569 clone into a PhiC31 vector at the attP86Fb docking site on the 3rd chromosome by Zoltan Astolos (Aktogen, Cambridge, UK). Three to five day old mated female flies were used for all experiments in this study, except when noted.

Behavioral Analysis

The DAM system detects activity by monitoring infrared beam crossings for each animal.

These data were used to calculate sleep information by extracting immobility bouts of 5 minutes using the Drosophila Sleep Counting Macro [S10]. For experiments examining the effects of starvation on sleep, activity was recorded for one day on food, prior to transferring flies into tubes containing 1% agar (Fisher Scientific) at ZT0 and activity was monitored for an additional 24 hours. Change in sleep during starvation or dietary

240

manipulation was calculated as ((sleep duration (mins) experimental-sleep duration (mins) baseline)/(sleep duration (mins) baseline))*100 as previously described [S11]. For experiments employing thermogenetic manipulation of LK neurons, only nighttime sleep was analyzed because flies were unable to survive 24 hours of starvation at elevated temperatures. Following 24 hours of acclimation, baseline sleep was measured on food at 22°C from ZT12-ZT24. On the following day at ZT8 flies were transferred to new tubes containing either standard fly food (control) or 1% agar. The temperature was increased to 31°C at ZT12 and activity was recorded through ZT24. For tracking analysis, fly activity was recorded using a custom video acquisition system [S12]. Flies were anesthetized using cold-shock and loaded into standard 24-well tissue culture plates (BD Biosciences

351147), with each well containing either 5% sucrose dissolved in 1% agar (fed group) or

1% agar alone (starved group). The sucrose diet was required as standard fly food is opaque and prevents efficient tracking. The plates were placed in a chamber illuminated with white (6500K) LED lights (Environmental Lights Inc. product no. dlrf3528-120-8-kit) on a 12:12 LD cycle, and with constant illumination from 850-880nm infra-red (IR) lights

(Environmental Lights Inc., product no. irrf850-390). Video was recorded using an ICD-49 camera (Ikegami Tsushinki Co., Japan) fitted with an IRtransmitting lens (Computar Inc.,

Vari Focal H3Z4512 CS-IR 4.5-12.5 mm F 1.2 TV lens). An IR high-pass filter (Edmund

Optics Worldwide, filter optcast IR 5x7 in. part no. 46,620) was placed between the camera and the lens to block visible light. Video was recorded at a resolution of 525 lines at 59.94

Hz, 2:1 interlace. Fly activity was analyzed using Ethovision XT 9.0 video tracking software

(Noldus Inc.). Sleep was calculated by measuring bouts of inactivity >5 minutes using a previously described Microsoft Excel macro [S12]. For sleep deprivation experiments, flies were shaken in DAM2 monitors every 3-4 minutes for 12 hours from ZT12 (onset of darkness) through ZT0 (onset of light) as previously described [S13]. Stimulus was applied

241

using a vortexer (Fisher Scientific, MultiTube Vortexer) with a custom milled plate to hold

DAM2 monitors and a repeat cycle relay switch (Macromatic, TR63122). Sleep rebound was measured the following day from ZT0-ZT12.

Proboscis Extension Reflex (PER)

Three to five day old flies were collected and placed on fresh food for 24 hours, then starved for the designated period of time in vials containing wet Kimwipe paper (Kimberly-

Clark Corporation). Flies were then anaesthetized under CO2, and their thorax and wings were glued with nail polish (Electron Microscopy Science) to a microscopy slide, leaving heads and legs unconstrained. Following 3-6 hours recovery in a humidified chamber, the slide was mounted vertically under the dissecting microscope (Leica, S6E) and PER was observed. PER induction was performed as described previously [S14]. Briefly, flies were satiated with water before and during experiments. Flies that did not water satiate within

5 minutes were excluded from the experiment. A 1 ml syringe (Tuberculin, BD&C) with an attached pipette tip (TipOne) was used for tastant presentation. Tastant was manually applied to tarsi for 2-3 seconds 3 times with 10 second inter-trial intervals, and the number of full proboscis extensions was recorded. Tarsi were then washed with distilled water between applications of different tastants and flies were allowed to drink water during the experiment ad libitum. Each fly was assayed for response to multiple tastants. PER response was calculated as a percentage of proboscis extensions to total number of tastant stimulations to tarsi.

Blue dye assay

Short-term food intake was measured as previously described [S15]. Briefly, flies were starved for 24 or 48 hours on wet Kimwipes or maintained on standard fly food. At ZT0 flies were then transferred to food vials containing 1% agar, 5% sucrose, and 2.5% blue

242

dye (FD&C Blue Dye No. 1). Following 30 minutes of feeding flies were flash frozen on dry ice and individually homogenized in 400 μL PBS (pH 7.4, Ambion). Color spectrophotometry was then used to measure absorbance at 655 nm in a 96-well plate reader (Millipore, iMark). Baseline absorbance was determined by subtracting the absorbance measured in non-dye fed flies from each experimental sample.

Capillary Feeder assay (CAFE)

A modified volumetric drinking assay was used to test food consumption [S16] as previously described [S13]. Female flies were allowed to feed on a tube containing 100mM sucrose or 5% yeast extract in water, while a second capillary tube provided access to water alone (WPI, #1B150F-4 ID 1mm, OD 1.5mm, with filament). The capillary tubes were inserted into an empty food vial at a 90angle and vials were placed at a 45angle.

The openings of the capillaries were aligned with the ceiling of the vial. Following 24 hours of fasting, 30-60 female flies were placed into a vial and food consumption was measured.

The volume consumed was calculated as the length of liquid missing from the capillary multiplied by the cross-section of the inner diameter of the capillary. All measurements were adjusted for missing liquid due to evaporation using control capillary tubes without flies. Consumption was measured every hour following the introduction of flies into the assay. Taste compounds were mixed with Allura red food dye (FD&C red #40) to a concentration of 3μl per 1ml dilution for bettervisibility in the capillary tube. Following the conclusion of the assay flies were anaesthetized and the number of flies in each vial was counted. Total consumption per fly was measured as volume consumed in each capillary divided by number of live flies in the vial.

Pharmacological manipulation

243

Crosses for RU486 experiments were raised at room temperature in normal fly food vials then transferred to individual DAM tubes containing 0.25mM RU486; the flies were acclimated in the DAM monitor for 24 hours. On experimental day 1, sleep was recorded.

On day 2, flies were flipped to DAM tubes containing 1% agar and 0.25mM RU486; % sleep was then recorded. RU486 effects during the experiment were calculated by comparing the amount of sleep during the baseline night (without drug) with that during

1118 the treatment night. For parquat experiments, DAM tubes were made similarly. Both w controls and trsn mutant flies were raised at room temperature in normal fly food vials then transferred to individual DAM tubes containing 1mM paraquat dichloride. The flies were acclimated in the DAM monitor for 24 hours before treatment. Sleep was measured for 5 days under standard light/dark cycles and percent sleep was monitored. For caffeine

1118 experiments, both w and trsn mutant flies were raised at room temperature in normal fly food vials and then transferred to individual DAM tubes containing standard food. The flies were acclimated in the DAM monitor for 24 hours. On experimental day 1, sleep was recorded. On day 2, flies were flipped to DAM tubes containing 4mg/mL caffeine and percent sleep was recorded. Caffeine effects during each experiment were calculated by comparing the amount of sleep during the baseline day (without drug) with that during the treatment day.

Protein, glycogen, and triglyceride measurements

Protein glucose and triglyceride measurements were performed as previously described

[S17, S18].Two female flies aged 3-5 days were homogenized in 50 mM Tris-HCl, pH 7.4,

140 mM NaCl, 0.1% Triton-X, and 1X protease inhibitor cocktail (Sigma Aldrich, P8340).

Triglyceride concentration was measured using the Stanbio Liquicolor Kit (Boerne, TX), and protein concentrations were measuring using a BCA Protein Assay Kit (Pierce

244

Scientific). Total glucose levels were determined using the Glucose Oxidase Reagent

(Pointe Scientific) in samples previously treated with 8mg/mL amyloglucosidase in 0.2M

Sodium Citrate buffer, pH 5.0 (Boston BioProducts). Free glucose was measured in samples not treated with amyloglucosidase and then glycogen concentrations were determined by subtracting the free glucose from total glucose concentration. Both glycogen and triglyceride concentrations were standardized to the total protein content of each sample containing two flies.

Quantitative RT-PCR

For qPCR experiments 3-5 day old female flies were sacrificed at ZT0 and flash-frozen on dry ice. Heads and bodies were separated by vortexing and manually isolated. The primers used were: trsn (F-5’GCTCCGCCTTCTCCAGATACT3’ and R-

5’CCGCCTCCAGGTAAATAACCA3’), actin 5C (F-

5’AGCGCGGTTACTCTTTCACCAC3’) and R-5’GTGGCCATCTCCTGCTCAAAGT3’), and β-tubulin (F-5’GCAGTTCACCGCTATGTTCA3’ and R-

5’CGGACACCAGATCGTTCAT3’). Triplicate measurements were conducted for each sample. Primers were purchased from IDT technologies.

Immunohistochemistry

Fly brains were dissected in ice-cold PBS and fixed in 4% formaldehyde, PBS, 0.2%

Triton-X 100 for 30 minutes. Brains were rinsed 3X with PBS, Triton-X for 10 minutesand incubated overnight at 4°C in 1:4 anti-ELAV, 1:20 NC82 ([S19] Iowa Hybridoma Bank) and

1:1000 anti-TRSN [3]. The brains were rinsed again in PBS-Triton X, 3X for 10 minutes and placed in secondary antibodies (Goat anti-Mouse 555, and Goat antirabbit 488; Life

Technologies) for 90 minutes at room temperature. The brains were mounted in

Vectashield (VectorLabs) and imaged on a Leica SP8 confocal microscope. Brains were

245

imaged in 2μm sections and are presented as the Z-stack projection through the entire brain. For quantification of whole-brain TRSN levels, the entire brain was imaged in 2μm sections, merged into a single Z-stack as maximum fluorescence, and the total brain fluorescence was determined. For experiments examining colocalization, each channel was imaged separately, and the absence of bleed through was validated.

246

References

1. Knutson, K. L., and Van Cauter, E. (2008). Associations between sleep loss and

increased risk of obesity and diabetes. Ann. N. Y. Acad. Sci. 1129, 287–304.

2. Peppard, P. E., Young, T., Palta, M., Dempsey, J., and Skatrud, J. (2000).

Longitudinal study of moderate weight change and sleep-disordered breathing.

JAMA 284, 3015–3021.

3. Taheri, S., Lin, L., Austin, D., Young, T., and Mignot, E. (2004). Short sleep duration

is associated with reduced leptin, elevated ghrelin, and increased body mass index.

PLoS Med. 1, 210–217.

4. Danguir, J., and Nicolaidis, S. (1979). Dependence of sleep on nutrient’s

availability. Physiol. Behav. 22, 735–740.

5. Macfadyen, U., Oswald, I., and Lewis, S. (1973). Starvation and human slow-wave

sleep. J Appl Physiol 35, 391–4.

6. Green, C. B., Takahashi, J. S., and Bass, J. (2008). The Meter of Metabolism. Cell

134, 728–742.

7. Dietzl, G., Chen, D., Schnorrer, F., Su, K.-C., Barinova, Y., Fellner, M., Gasser, B.,

Kinsey, K., Oppel, S., Scheiblauer, S., et al. (2007). A genome-wide transgenic

RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151–156.

8. Bushey, D., Tononi, G., and Cirelli, C. (2009). The Drosophila fragile X mental

retardation gene regulates sleep need. J. Neurosci. 29, 1948–1961.

9. Keene, A. C., Duboué, E. R., McDonald, D. M., Dus, M., Suh, G. S. B., Waddell, S.,

and Blau, J. (2010). Clock and cycle limit starvation-induced sleep loss in

Drosophila. Curr. Biol. 20, 1209–1215.

247

10. Keene, A. C., Duboué, E. R., McDonald, D. M., Dus, M., Suh, G. S. B., Waddell, S.,

and Blau, J. (2010). Clock and cycle limit starvation-induced sleep loss in

Drosophila. Curr. Biol. 20, 1209–1215.

11. Lee, G., and Park, J. H. (2004). Hemolymph sugar homeostasis and starvation-

induced hyperactivity affected by genetic manipulations of the adipokinetic

hormone-encoding gene in Drosophila melanogaster. Genetics 167, 311–323.

12. Mattaliano, M. D., Montana, E. S., Parisky, K. M., Littleton, J. T., and Griffith, L. C.

(2007). The Drosophila ARC homolog regulates behavioral responses to starvation.

Mol. Cell. Neurosci. 36, 211–221.

13. Claußen, M., Koch, R., Jin, Z. Y., and Suter, B. (2006). Functional characterization

of Drosophila Translin and Trax. Genetics 174, 1337–1347.

14. Zimmerman, J. E., Raizen, D. M., Maycock, M. H., Maislin, G., and Pack, A. I.

(2008). A video method to study Drosophila sleep. Sleep 31, 1587–1598.

15. Donelson, N., Kim, E. Z., Slawson, J. B., Vecsey, C. G., Huber, R., and Griffith, L.

C. (2012). High-resolution positional tracking for long-term analysis of Drosophila

sleep and locomotion using the “tracker” program. PLoS One 7.

16. Gilestro, G. F. (2012). Video tracking and analysis of sleep in Drosophila

melanogaster. Nat. Protoc. 7, 995–1007. Available at:

http://www.ncbi.nlm.nih.gov/pubmed/22538850.

17. Garbe, D., Bollinger, W., Vigderman, A., Masek, P., Gertowski, J., Sehgal, A., and

Keene, A. (2015). Context-specific comparison of sleep acquisition systems in

Drosophila. Biol Open 4, 1558–68.

18. Puschner, B., and Schacht, J. (1997). Energy metabolism in cochlear outer hair

248

cells in vitro. Hear. Res. 114, 102–106.

19. Lopaschuk, G. D., Wall, S. R., Olley, P. M., and Davies, N. J. (1988). Etomoxir, a

carnitine palmitoyltransferase I inhibitor, protects hearts from fatty acid-induced

ischemic injury independent of changes in long chain acylcarnitine. Circ. Res. 63,

1036–1043.

20. Dus, M., Min, S., Keene, A. C., Lee, G. Y., and Suh, G. S. B. (2011). Taste-

independent detection of the caloric content of sugar in Drosophila. Proc. Natl.

Acad. Sci. U. S. A. 108, 11644–11649.

21. Thimgan, M. S., Suzuki, Y., Seugnet, L., Gottschalk, L., and Shaw, P. J. (2010).

The perilipin homologue, lipid storage droplet 2, regulates sleep homeostasis and

prevents learning impairments following sleep loss. PLoS Biol. 8.

22. Wu, M. N., Ho, K., Crocker, A., Yue, Z., Koh, K., and Sehgal, A. (2009). The effects

of caffeine on sleep in Drosophila require PKA activity, but not the adenosine

receptor. J. Neurosci. 29, 11029–11037.

23. Koh, K., Evans, J. M., Hendricks, J. C., and Sehgal, A. (2006). A Drosophila model

for age-associated changes in sleep:wake cycles. Proc. Natl. Acad. Sci. U. S. A.

103, 13843–13847.

24. Sassu, E. D., McDermott, J. E., Keys, B. J., Esmaeili, M., Keene, A. C., Birnbaum,

M. J., and DiAngelo, J. R. (2012). Mio/dChREBP coordinately increases fat mass

by regulating lipid synthesis and feeding behavior in Drosophila. Biochem. Biophys.

Res. Commun. 426, 43–48.

25. Gingras, R. M., Warren, M. E., Nagengast, A. A., and Diangelo, J. R. (2014). The

control of lipid metabolism by mRNA splicing in Drosophila. Biochem. Biophys. Res.

Commun. 443, 672–676.

249

26. Yurgel, M., Masek, P., DiAngelo, J., and Keene, A. (2014). Genetic dissection of

sleep-metabolism interactions in the fruit fly. J Comp Physiol A Neuroethol Sens

Neural Behav Physiol.

27. Dethier, V. G. (1976). The Hungry Fly: A Physiological Study of the Behavior

Associated with Feeding (Harvard University Press).

28. Masek, P., and Scott, K. (2010). Limited taste discrimination in Drosophila. Proc.

Natl. Acad. Sci. U. S. A. 107, 14833–14838.

29. Ja, W. W., Carvalho, G. B., Mak, E. M., de la Rosa, N. N., Fang, A. Y., Liong, J. C.,

Brummel, T., and Benzer, S. (2007). Prandiology of Drosophila and the CAFE

assay. Proc. Natl. Acad. Sci. U. S. A. 104, 8253–8256.

30. Wong, R., Piper, M. D. W., Wertheim, B., and Partridge, L. (2009). Quantification of

food intake in Drosophila. PLoS One 4, e6063.

31. Suseendranathan, K., Sengupta, K., Rikhy, R., D'Souza, J. S., Kokkanti, M.,

Kulkarni, M. G., Kamdar, R., Changede, R., Sinha, R., Subramanian, L., et al.

(2007). Expression pattern of Drosophila translin and behavioral analyses of the

mutant. Eur. J. Cell Biol. 86, 173–186.

32. Roman, G., Endo, K., Zong, L., and Davis, R. L. (2001). P[Switch], a system for

spatial and temporal control of gene expression in Drosophila melanogaster. Proc.

Natl. Acad. Sci. U. S. A. 98, 12602–12607.

33. Osterwalder, T., Yoon, K. S., White, B. H., and Keshishian, H. (2001). A conditional

tissue-specific transgene expression system using inducible GAL4. Proc. Natl.

Acad. Sci. U. S. A. 98, 12596–12601.

34. Griffith, L. C. (2013). Neuromodulatory control of sleep in Drosophila melanogaster:

250

Integration of competing and complementary behaviors. Curr. Opin. Neurobiol. 23,

819–823.

35. Taghert, P. H., and Nitabach, M. N. (2012). Peptide Neuromodulation in

Invertebrate Model Systems. Neuron 76, 82–97.

36. Nässel, D. R., and Winther, Å. M. E. (2010). Drosophila neuropeptides in regulation

of physiology and behavior. Prog. Neurobiol. 92, 42–104.

37. De Haro, M., Al-Ramahi, I., Benito-Sipos, J., López-Arias, B., Dorado, B., Veenstra,

J. A., and Herrero, P. (2010). Detailed analysis of leucokinin-expressing neurons

and their candidate functions in the Drosophila nervous system. Cell Tissue Res.

339, 321–336.

38. Al-Anzi, B., Armand, E., Nagamei, P., Olszewski, M., Sapin, V., Waters, C., Zinn,

K., Wyman, R. J., and Benzer, S. (2010). The leucokinin pathway and its neurons

regulate meal size in Drosophila. Curr. Biol. 20, 969–978.

39. Donlea, J. M., Thimgan, M. S., Suzuki, Y., Gottschalk, L., and Shaw, P. J. (2011).

Inducing sleep by remote control facilitates memory consolidation in Drosophila.

Science 332, 1571–1576.

40. Sweeney, S. T., Broadie, K., Keane, J., Niemann, H., and O’Kane, C. J. (1995).

Targeted expression of tetanus toxin light chain in Drosophila specifically eliminates

synaptic transmission and causes behavioral defects. Neuron 14, 341–351.

41. Kitamoto, T. (2001). Conditional modification of behavior in Drosophila by targeted

expression of a temperature-sensitive shibire allele in defined neurons. J.

Neurobiol. 47, 81–92.

42. Itskov, P. M., Moreira, J.-M., Vinnik, E., Lopes, G., Safarik, S., Dickinson, M. H.,

251

and Ribeiro, C. (2014). Automated monitoring and quantitative analysis of feeding

behaviour in Drosophila. Nat. Commun. 5, 4560. Available at:

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=4143931&tool=pmcentr

ez&rendertype=abstract.

43. Ro, J., Harvanek, Z. M., and Pletcher, S. D. (2014). FLIC: high-throughput,

continuous analysis of feeding behaviors in Drosophila. PLoS One 9, e101107.

Available at:

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=4076220&tool=pmcentr

ez&rendertype=abstract.

44. Luan, H., Peabody, N. C., Vinson, C. R., and White, B. H. (2006). Refined spatial

manipulation of neuronal function by combinatorial restriction of transgene

expression. Neuron 52, 425–36. Available at:

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1713190&tool=pmcentr

ez&rendertype=abstract.

45. Aoki, K., Suzuki, K., Ishida, R., and Kasai, M. (1999). The DNA binding activity of

Translin is mediated by a basic region in the ring-shaped structure conserved in

evolution. FEBS Lett. 443, 363–6.

46. Wu, R., Osatomi, K., Terada, L., and Uyeda, K. (2003). Identification of

Translin/Trax complex as a glucose response element binding protein in liver.

Biochim. Biophys. Acta 1624, 29–35.

47. Stein, J. M., Bergman, W., Fang, Y., Davison, L., Brensinger, C., Robinson, M. B.,

Hecht, N. B., and Abel, T. (2006). Behavioral and neurochemical alterations in mice

lacking the RNA-binding protein translin. J. Neurosci. 26, 2184–2196.

48. Pfeiffenberger, C., Lear, B. C., Keegan, K. P., and Allada, R. (2010). Locomotor

252

activity level monitoring using the Drosophila activity monitoring (DAM) system.

Cold Spring Harb. Protoc. 5.

253

Supplemental References

S1. Dietzl, G., Chen, D., Schnorrer, F., Su, K.6C., Barinova, Y., Fellner, M., Gasser, B., Kinsey, K., Oppel, S., Scheiblauer, S., et al. (2007). A genome6wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151– 156.

S2. Bellen, H. J., Levis, R. W., Liao, G., He, Y., Carlson, J. W., Tsang, G., Evans6Holm, M., Hiesinger, P. R., Schulze, K. L., Rubin, G. M., et al. (2004). The BDGP gene disruption project: Single transposon insertions associated with 40% of Drosophila genes. Genetics 167, 761–781.

S3. Claußen, M., Koch, R., Jin, Z. Y., and Suter, B. (2006). Functional characterization of Drosophila Translin and Trax. Genetics 174, 1337–1347.

S4. Suseendranathan, K., Sengupta, K., Rikhy, R., D'Souza, J. S., Kokkanti, M., Kulkarni, M. G., Kamdar, R., Changede, R., Sinha, R., Subramanian, L., et al. (2007). Expression pattern of Drosophila translin and behavioral analyses of the mutant. Eur. J. Cell Biol. 86, 173–186.

S5. Al6Anzi, B., Armand, E., Nagamei, P., Olszewski, M., Sapin, V., Waters, C., Zinn, K., Wyman, R. J., and Benzer, S. (2010). The leucokinin pathway and its neurons regulate meal size in Drosophila. Curr. Biol. 20, 969–978.

S6. Pfeiffer, B. D., Jenett, A., Hammonds, A. S., Ngo, T.6T. B., Misra, S., Murphy, C., Scully, A., Carlson, J. W., Wan, K. H., Laverty, T. R., et al. (2008). Tools for neuroanatomy and neurogenetics in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 105, 9715–9720.

S7. Sweeney, S. T., Broadie, K., Keane, J., Niemann, H., and O’Kane, C. J. (1995). Targeted expression of tetanus toxin light chain in Drosophila specifically eliminates synaptic transmission and causes behavioral defects. Neuron 14, 341–351.

254

S8. Kitamoto, T. (2001). Conditional modification of behavior in Drosophila by targeted expression of a temperature6sensitive shibire allele in defined neurons. J. Neurobiol. 47, 81–92.

S9. Yasunaga, K., Saigo, K., and Kojima, T. (2006). Fate map of the distal portion of Drosophila proboscis as inferred from the expression and mutations of basic patterning genes. Mech. Dev. 123, 893–906. Available at: http://www.ncbi.nlm.nih.gov/pubmed/17027238.

S10. Pfeiffenberger, C., Lear, B. C., Keegan, K. P., and Allada, R. (2010). Processing sleep data created with the Drosophila Activity Monitoring (DAM) System. Cold Spring Harb. Protoc. 2010, pdb.prot5520.

S11. Keene, A. C., Duboué, E. R., McDonald, D. M., Dus, M., Suh, G. S. B., Waddell, S., and Blau, J. (2010). Clock and cycle limit starvation6induced sleep loss in Drosophila. Curr. Biol. 20, 1209–1215.

S12. Garbe, D., Bollinger, W., Vigderman, A., Masek, P., Gertowski, J., Sehgal, A., and Keene, A. (2015). Context6specific comparison of sleep acquisition systems in Drosophila. Biol Open 4, 1558–68.

S13. Masek, P., Reynolds, L. a, Bollinger, W. L., Moody, C., Mehta, A., Murakami, K., Yoshizawa, M., Gibbs, A. G., and Keene, A. C. (2014). Altered regulation of sleep and feeding contribute to starvation resistance in Drosophila. J. Exp. Biol. Available at: http://www.ncbi.nlm.nih.gov/pubmed/24948636.

S14. Masek, P., and Scott, K. (2010). Limited taste discrimination in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 107, 14833–14838.

S15. Wong, R., Piper, M. D. W., Wertheim, B., and Partridge, L. (2009). Quantification of food intake in Drosophila. PLoS One 4, e6063.

S16. Ja, W. W., Carvalho, G. B., Mak, E. M., de la Rosa, N. N., Fang, A. Y., Liong, J. C., Brummel, T., and Benzer, S. (2007). Prandiology of Drosophila and the CAFE assay. Proc. Natl. Acad. Sci. U. S. A. 104, 8253–8256.

255

S17. Sassu, E. D., McDermott, J. E., Keys, B. J., Esmaeili, M., Keene, A. C., Birnbaum, M. J., and DiAngelo, J. R. (2012). Mio/dChREBP coordinately increases fat mass by regulating lipid synthesis and feeding behavior in Drosophila. Biochem. Biophys. Res. Commun. 426, 43–48.

S18. Gingras, R. M., Warren, M. E., Nagengast, A. A., and Diangelo, J. R. (2014). The control of lipid metabolism by mRNA splicing in Drosophila. Biochem. Biophys. Res. Commun. 443, 672–676.

S19. Wagh, D. A., Rasse, T. M., Asan, E., Hofbauer, A., Schwenkert, I., Dürrbeck, H., Buchner, S., Dabauvalle, M. C., Schmidt, M., Qin, G., et al. (2006). Bruchpilot, a protein with homology to ELKS/CAST, is required for structural integrity and function of synaptic active zones in Drosophila. Neuron 49, 833– 844.

256

Appendix 5

Feeding State, Insulin and NPR-1 Modulate Chemoreceptor Gene Expression via

Integration of Sensory and Circuit Inputs

Published in PLoS Genetics; October 2014; 10.1371/journal.pgen.1004707

Rebecca Heidker created several mutant/srh-234 constructs and assessed srh-234 expression in fed and starved conditions, as well as assessing srh-234 expression of N2

worms in different feeding conditions and in sephadex beads.

257

Feeding State, Insulin and NPR-1 Modulate Chemoreceptor Gene Expression via

Integration of Sensory and Circuit Inputs

Matthew Gruner1, Dru Nelson1, Ari Winbush1, Rebecca Hintz2, Leesun Ryu3, Samuel H. Chung4,5, Kyuhyung Kim3, Chrisopher V. Gabel4,5, Alexander M. van der Linden1*

1 Department of Biology, University of Nevada, Reno, Nevada, United States of America,

2 Department of Agriculture, Nutrition and Veterinary Sciences, University of Nevada,

Reno, Nevada, United States of America,

3 Department of Brain Science, Daegu Gyeongbuk Institute of Science and Technology

(DGIST), Daegu, Korea,

4 Department of Physiology and Biophysics, Boston University School of Medicine, Boston,

Massachusetts, United States of America,

5 Boston University Photonics Center, Boston, Massachusetts, United States of America

258

Abstract

Feeding state and food availability can dramatically alter an animals’ sensory response to chemicals in its environment. Dynamic changes in the expression of chemoreceptor genes may underlie some of these food and state-dependent changes in chemosensory behavior, but the mechanisms underlying these expression changes are unknown. Here, we identified a KIN-29 (SIK)-dependent chemoreceptor, srh-234, in C.elegans whose expression in the ADL sensory neuron type is regulated by integration of sensory and internal feeding state signals. We show that in addition to KIN-29, signaling is mediated by the DAF-2 insulin-like receptor, OCR-2 TRPV channel, and NPR-1 neuropeptide receptor. Cell-specific rescue experiments suggest that DAF-2 and OCR-2 act in ADL, while NPR-1 acts in the RMG interneurons. NPR-1-mediated regulation of srh-234 is dependent on gap-junctions, implying that circuit inputs regulate the expression of chemoreceptor genes in sensory neurons. Using physical and genetic manipulation of

ADL neurons, we show that sensory inputs from food presence and ADL neural output regulate srh-234 expression. While KIN-29 and DAF-2 act primarily via the MEF-2 (MEF2) and DAF-16 (FOXO) transcription factors to regulate srh-234 expression in ADL neurons,

OCR-2 and NPR-1 likely act via a calcium-dependent but MEF-2- and DAF-16- independent pathway. Together, our results suggest that sensory- and circuit-mediated regulation of chemoreceptor genes via multiple pathways may allow animals to precisely regulate and fine-tune their chemosensory responses as a function of internal and external conditions.

259

Introduction

An animals’ feeding state (i.e. fed versus starved) and food availability dramatically alters the responsiveness of chemosensory neurons and behavioral output to suit the needs of the animal to, for instance, locate food, find mates and avoid predators under different environmental conditions. Although these state-dependent changes in chemosensory behaviors have long been thought to arise from plasticity in central processes, there is now growing evidence that feeding state gates responses in peripheral chemosensory neurons themselves, thereby directly modulating changes in chemosensory behaviors [1].

One particular mechanism by which feeding state could alter the response properties of chemosensory neurons, is by dynamically changing the transcript levels of chemoreceptor genes. For example, in mosquitoes, olfactory neuron responsiveness to host-specific odors after a blood-feeding is highly correlated with small changes in transcript levels of the corresponding olfactory receptor [2–5], which may allow them to alter their sensitivity to these odors, thereby altering its host-seeking behavior. Thus, dynamic changes in the expression levels of chemoreceptor genes may provide a simple mechanism by which chemosensory neurons may alter their responses to specific chemical stimuli under different feeding state conditions. The Caenorhabditis elegans sensory system provides an ideal system to explore the mechanisms by which chemosensory gene expression and behavior is altered by changes in its environment. As in other animals, C.elegans is able to rapidly and reversibly modify its chemosensory behavior to specific chemicals according to its feeding state. For example, starved animals increase their adaptation towards particular attractive odors and they discriminate more classes of food-related odors than fed animals [6]. Starved animals also change their response to certain volatile repulsive odors, and this modulation occurs through serotonergic and dopaminergic signaling [7,8].

The neuropeptide receptor, NPR-1, and insulin-like receptor, DAF-2, in C.elegans are also

260

involved in a multitude of food-dependent behaviors. For example, pre-exposure of

C.elegans to salt in the absence of food switches the normally attractive salt response to avoidance, and this modulation is dependent on insulin signaling from the AIA interneurons via DAF-2 acting in ASE sensory neurons [9,10]. Recent elegant work has shown that the neuropeptide receptor

NPR-1 plays a key role in the RMG interneuron to regulate avoidance responses of sensory neurons to pheromones, a response that appears to be mediated by food [11,12].

Thus, insulin and neuropeptide signaling from interneurons play an important role in translating multiple aspects of food and feeding state information to peripheral chemosensory neurons to fine-tune their responses.

As described above, dynamic changes in the expression levels of chemoreceptor genes could, at least in part, contribute to modifications in chemosensory behaviors, but it is unknown whether or how neuromodulators, such as neuropeptides, insulin and monoamines, alter expression levels of chemoreceptor genes as a function of feeding state. In C.elegans, individual and distinct subsets of chemoreceptor genes are regulated by several mechanisms, including developmental changes, sensory activity, and levels of pheromones [13,14]. In addition, our previous work showed that KIN-29 regulates a subset of chemoreceptors in chemosensory neurons [15] by phosphorylating the HDA-4 class II histone deacetylase (HDAC), and inhibiting the gene repressive functions of the MEF-2 transcription factor [16]. KIN-29 is a member of the salt-inducible kinase (SIK) family, which plays a major role in the regulation of lipolysis and gluconeogenic gene expression in response to feeding and fasting [17–20]. For example, during feeding, Drosophila SIK3 is activated by insulin to regulate fat stores through phosphorylation of HDAC4 [21], a function that appears to be conserved in C.elegans [16]. Upon starvation, Drosophila SIK3 is inactivated resulting in HDAC4 dephosphorylation and subsequent activation of FOXO-

261

mediated gene expression [21]. Thus, SIKs are critical regulators of feeding and fasting states, suggesting that a role for KIN-29 in feedingstate dependent regulation of gene expression may be conserved.

Here, we identified a KIN-29-dependent chemoreceptor, srh- 234, whose expression levels in the ADL sensory neuron type of C.elegans is downregulated upon starvation. We find that this starvation-modulation is likely a consequence of both sensory inputs associated with a decrease in food presence and an internal state of starvation due to a decrease in food ingestion. We show that in addition to KIN-29, expression levels of srh-

234 are regulated by multiple pathways, including signaling mediated by the DAF-2 insulin-like receptor, OCR-2 TRPV channel, and NPR-1 neuropeptide receptor. We show that intact cilia and dendrites of ADL, as well as neural output from ADL are required for srh-234 expression. Cell- and tissue-specific rescue experiments show that DAF-2 and

OCR-2 act in ADL neurons, whereas NPR- 1 acts in RMG interneurons to regulate srh-

234 expression and this regulation is dependent on unc-7/9 gap-junctions. While MEF-2 and DAF-16 FOXO transcription factors act downstream of KIN-29 and DAF-2, respectively, in regulating srh-234 expression, OCR-2 and NPR-1 pathways act independently from MEF-2 and DAF-16. Taken together, our results suggest that integration of sensory and circuit inputs via multiple signaling pathways allows animals to precisely modulate chemoreceptors genes according to their feeding status, providing insights into the gene expression mechanisms that contribute to chemosensory plasticity in C.elegans.

262

Results

Expression of srh-234 in ADL neurons is downregulated in starved animals

Since SIKs regulate feeding state-dependent gene expression, we investigated whether feeding and starvation regulates the expression of kin-29-dependent chemoreceptor genes. Expression of gfp driven under the regulatory sequences of candidate chemoreceptor genes, str-1, sra-6 and srh-234 is strongly downregulated in AWB, ASH and ADL neurons, respectively [15,16]. We found that gfp expression driven under only

165 bp of the regulatory sequence of srh-234 (srh-234p::gfp) is strongly expressed in ADL in fed animals (Figure 1A, upper panel), but when animals were starved for long-periods of time (.6 hours), srh-234p::gfp was significantly downregulated (Figure 1A, lower panel).

Similar results were found for another independent integrated transgenic array of srh-

234p::gfp (oyIs57) (Table S2). The expression of str-1::gfp and sra-6::gfp was unaffected in starved animals. We further confirmed the starvation-induced change in expression by examining the endogenous levels of srh-234 with help of qRT-PCRs, and found that the transcript levels of srh-234 were similarly downregulated but not abolished in starved animals (Figure 1B).

263

Figure 1. Starvation downregulates the expression of srh-234 in ADL neurons. A) Expression of srh-234p::gfp in an ADL neuron of wild-type animals when well-fed in the presence of E.coli OP50 food (upper panel) and starved (lower panel) in the absence of food for 12 hours. The head of the animal is indicated with a white line. Arrow points to the ADL cell body. Images were acquired at the same exposure time. Lateral view: anterior is on the left. Scale, 100 µm. B) Levels of endogenous srh-234 messages are downregulated in starved animals compared to fed animals. Shown is the ratio of endogenous srh-234 message to endogenous odr-10 [65] message as quantified by qRT–PCR in fed and starved animals. In hermaphrodite animals, expression of odr-10 is unaffected by starvation. The mean of the ratios from two independent experiments is shown. * indicates values that are different from fed wild-type animals at P<0.01 using a two- sample t-test. Error bars denote the SEM.

The effect of starvation on srh-234 expression is reversible as L1 larvae or adult animals starved for 12 hours and then re-fed with E.coli food restore expression to near wild-type levels within 6 hours (Figure S1A). Moreover, when starved L1 larvae were grown on a nutrient-rich minimal media for 24 hours that is axenic, i.e. in the absence of any bacterial food, allowing developmental growth albeit delayed {Szewczyk, 2003 #4559], no increase in srh-234 expression was observed (Figure S1B). As bacterial food can alter the production of pheromones in C.elegans [22], which in turn can regulate chemoreceptor gene expression [13], we examined srh-234 expression in the absence and presence of pheromones. However, no effect on srh-234 expression was found in daf-22(m130)

264

mutants, which is required for pheromone biosynthesis [23], and in the presence of crude pheromone extracts (Table S2), suggesting that pheromones do not alter srh-234 expression. Thus, starvation reduces the expression of the kin-29-dependent chemoreceptor, srh-234, in ADL, and this modulation is reversible upon re-feeding with food.

We next sought to identify additional chemoreceptor genes in ADL regulated by fed and starved conditions. Of the 11 chemoreceptor genes tested, only gfp driven by the cis- regulatory region of the chemoreceptor srh-34 in ADL was altered in fed and starved animals with an opposite phenotype than observed for srh- 234; srh-34 is expressed in starved animals but not in fed animals (Table S1). Thus, the feeding status (fed versus starved) of C.elegans alters the expression levels of at least two chemoreceptor genes in

ADL. We focused our subsequent studies on using the srh-234p::gfp reporter assay to further explore the mechanisms underlying starvation modulation of chemoreceptor gene expression in ADL.

External food presence and an internal state of starvation modulate srh-234 expression

The reduced srh-234 expression levels we observed in starved wild-type animals could arise as a consequence of an internal state of starvation triggered by a decrease in the ingestion of food, or alternatively, by an external sensory response as a result of a decrease in the perception of food. To distinguish between these possibilities, we exposed fed and starved wild-type adult animals carrying the srh-234p::gfp reporter to E.coli food treated with the antibiotic aztreonam, which results in bacteria that grow in long chains that C.elegans cannot eat due its large size, but still can smell and touch comparable to regular non-treated bacteria [24]. We found that fed animals placed on aztreonam-treated

E.coli OP50 (inedible food) for 24 and 48 hours significantly reduces srh-234 expression mimicking the effects of starvation when compared to fed animals placed on non-treated

265

E.coli OP50 (edible food) (Figure 2A). Consistent with these findings, loss-of-function (lf) mutations in eat-2 that result in animals with a pharyngeal pumping defect compromising their food ingestion, also reduce srh-234 expression on edible food (Figure 2B). Thus, the reduced srh-234 expression is likely due to an internal state response triggered by a decreased food ingestion. However, when we placed starved adult animals (in the absence of food for 6–12 hours) on aztreonam-treated E.coli OP50 (inedible food), we found that the srh-234 expression phenotype was not significantly different from their nontreated E.coli OP50 (edible food) counterpart as if they sense food presence correctly even when they cannot eat this food (Figure 2A). It is possible that starved animals in our experiments can ingest some of the inedible food but at a reduced amount. However, we found that animals placed on aztreonam-treated E.coli food have a starved appearance similar to starved animals placed on plates without any food. Moreover, we verified that aztreonam-treated E.coli cannot be eaten properly as we find that L1 larvae exposed to treated food used in our experiments do not sustain growth (98% of L1 animals placed on aztreonam-treated bacteria for 24 hours were arrested, as compared to 0% of L1 larvae placed on edible food). Thus, the perception of inedible food can override the effects of starvation on reducing srh-234 expression levels. In summary, our results suggest that the starvation-induced downregulation of srh- 234 expression is likely a consequence of both sensory inputs associated with a decreased food presence, and an internal state of starvation triggered by a decrease in food ingestion.

266

Figure 2. External food presence and internal state signals alter srh-234 expression levels. A) Percentage of animals expressing srh-234p::gfp at wild-type levels when fed with E.coli OP50 food (OP50), aztreonam-treated E.coli OP50 food (inedible OP50), or no food (no OP50) for 24 and 48 hours. Young adult animals grown on edible E.coli OP50 food were divided into two groups: a fed group maintained in the presence of food, and a starved group maintained in the absence of food for 6–12 hours. We confirmed that srh-234 expression levels upon starvation were reduced. Subsequently, adults were picked onto new NGM plates seeded with either edible E.coli OP50, no E.coli OP50, or inedible E.coli OP50 food (see Material and Methods). B) Percentage of eat-2(lf) mutants defective in food intake expressing srh-234p::gfp at wild-type levels. In all experiments, wildtype expression of srh-234p::gfp was defined as expression levels that allowed visualization of both the cell bodies and processes of at least one ADL neuron (see Material and Methods). Animals (n>150) were examined at 150X magnification for each condition or genotype. * indicates values that is different from that of wild-type animals at P<0.001, and n.s. indicates the values that are not significantly different between the different food conditions compared by brackets using a χ2 test of independence. Error bars denote the SEP.

267

DAF-2/DAF-16 acts cell-autonomously in ADL to regulate srh-234 expression

As internal state signals in C.elegans are conveyed through an insulin signaling pathway with DAF-2 being the main insulin-like receptor [25], we explored whether insulin signaling plays a role in the regulation of srh-234. Consistent with low daf-2 insulin signaling being associated with a starved state, we found that daf- 2(e1307) mutants reduce srh-234 expression in ADL in fed conditions, similar to starved wild-type animals (Figure 3A). Since daf-2 activates insulin signaling by repressing the daf-16 FOXO transcription factor, and loss of daf-16 function results in active insulin signaling [26], we next examined whether daf-16(mu86) suppressed the daf-2- and starvation-induced downregulation of srh-234 expression. Indeed, we found that both daf-16(mu86) mutants and daf-2(e1307); daf-

16(mu86) double mutants showed a significant increase in srh-234 expression during starvation compared to starved wild-type animals (Figure 3A), suggesting that starved animals reduce srh-234 expression by lowering DAF-2 signaling and activating DAF-16.

To further refine the site of action of the DAF-2/DAF-16 insulin signaling pathway in regulating srh-234 expression, we introduced cDNAs of daf-2 and daf-16 under different cell- and tissue-specific promoters in daf-2 and daf-16 mutants, respectively, and measured their effects on srh-234 expression in either fed or starved conditions. We found that expression of daf-2 in ADL neurons fully restored the reduced srh-234 expression phenotype of daf-2(e1307) mutants during feeding to near wild-type levels, whereas daf-

2 expression in the nervous system had a partial effect (Figure 3B). Expression of daf-2 in the intestine did not result in a restoration of the reduced srh-234 expression phenotype of daf-2(e1307) mutants (Figure 3B). These results suggest that DAF-2 signaling acts in

ADL to regulate srh-234 expression. There are three functionally characterized DAF- 16 isoforms, DAF-16a, DAF-16b and DAF-16df, and all of these isoforms show neuronal expression in developing larvae [27–29]. We found that expression of daf-16a cDNA

268

specifically in ADL restored the increased srh-234 expression of daf-16(mu86) mutants during starvation back to wild-type levels, but similar to daf-2, expression of daf-16a cDNA in the intestine had no effect (Figure 3C). Together, these results suggest that both DAF-

2 and DAF-16 act cellautonomously in ADL to regulate srh-234 expression levels.

There are over 40 insulin-like peptides (ILPs) expressed in C.elegans. The daf-28 ILP, is a known agonist for DAF-2 and is expressed at high levels only when food is present

[30,31]. Interestingly, a semi-dominant mutation, sa191, in daf-28, thought to block other agonistic ILPs through stereo-hindrance [32], partially reduces srh-234 expression in ADL during feeding (Figure 3A). These results suggest that DAF-28 or other ILPs regulate srh-

234 expression in ADL, likely through the DAF-2/DAF-16 insulin pathway.

269

Figure 3. daf-2 and daf-16a are required in ADL, but not in the intestine, to regulate srh-234 expression. A) Percentage of mutant animals with defects in insulin signaling expressing srh-234p::gfp at wild-type levels. daf-2(e1307) is a temperature sensitive allele. In all experiments, animals were raised at 15°C (permissive temperature) and shifted to the 25°C (restrictive temperature) as L4 larvae. Animals (n>150) were examined at 150X magnification for each genotype. B, C) Relative expression of srh-234p::gfp in daf-2 or daf-16 mutants carrying compared to wild-type when fed or starved. For strains carrying ADL::daf-2 cDNA, pan-neural::daf- 2 cDNA, intestine::daf-2 cDNA, ADL::daf-16a cDNA and intestine::daf-16a cDNA extrachromosomal arrays (see Material and Methods), data shown is for at least two independent transgenic lines. Animals (n = 18–25) were examined at 400X magnification for each genotype. * indicates values that are different from that of wild-type animals at P<0.001, # and ## indicates the values that are different between the genotypes compared by brackets at P<0.001, and P<0.05, respectively, using either a two-sample t-test or a χ2 test of independence. Error bars denote the SEM or SEP.

270

NPR-1 acts in RMG to regulate srh-234 expression

The neuropeptide receptor, NPR-1, in C.elegans regulates a range of food-related behaviors. For example, mutants lacking npr-1 move rapidly, avoid high oxygen concentrations and aggregate in groups in a food-dependent manner [33–35]. We therefore examined whether loss of NPR-1 activity alters the expression levels of srh-234 in ADL. Indeed, we found a strong reduction in srh-234 expression in ADL in lf mutants of npr-1 (alleles ad609, ky13 and ok1447), and in a reduction-of-function npr-1 allele, g320, in fed conditions, with the g320 allele having the weakest effect (Figure 4A; Table S2). lf mutations in flp-18 and flp-21 encoding NPR-1 ligands as well as double mutants inactivating both ligands did not alter srh-234 expression (Table S2), suggesting that neuropeptides other than FLP-18/FLP-21 may act on NPR-1 to regulate srh-234 expression. Expression of npr-1 under control of its own promoter fully restored the reduced srh-234 expression phenotype of npr-1(ad609) mutants back to wild-type levels

(Figure 4A). However, ADL-specific expression of npr-1 using the sre-1 promoter did not restore the reduced srh-234 expression phenotype of npr-1(ad609) mutants (Figure 4A), suggesting that npr-1 activity is required in neurons other than ADL to regulate srh-234 expression.

271

Figure 4. Reducing npr-1 activity in RMG promotes srh-234 expression levels. A) Percentage of npr-1 mutant animals expressing srh-234p::gfp at wild-type levels. For strains carrying the npr-1::npr-1 genomic and ADL::npr-1 extrachromosomal arrays (see Material and Methods), data shown is the average of at least two independent transgenic lines. Animals (n>150) were examined at 150X magnification for each genotype. B) Relative expression of srh-234p::gfp in npr-1 mutants compared to wild-type. For strains carrying RMG:: npr-1 extrachromosomal arrays (see Material and Methods), data shown is for at least two independent transgenic lines. Animals (n = 20–23) were examined at 400X magnification for each genotype. C) Percentage of animals of the indicated genotypes expressing srh-234p::gfp at wild-type levels. Animals (n>150) were examined at 150X magnification for each genotype. D) Relative expression of srh-234p::gfp in unc- 7 npr-1 double mutants compared to wild-type. For strains carrying ADL::unc-7L cDNA, flp-21::unc- 7L cDNA and pan-neural::unc-7L cDNA extrachromosomal arrays (see Material and Methods),

272

data shown is for at least two independent transgenic lines. Animals (n = 15–22) were examined at 400Xmagnification for each genotype. In all experiments, * indicates values that is different from that of wild-type animals at P,0.001, and # indicates the values that are different between the genotypes compared by brackets at P,0.001 using either a x2 test of independence or using a two- sample t-test. n.s. indicates the values between brackets that are not significantly different. Error bars denote the SEM or SEP.

273

Figure 5. Expression levels of srh-234 are modulated by sensory inputs into ADL, neural outputs from ADL and OCR-2 activity. A) Pictures show examples of fed animals

274

expressing srh-234p::gfp before (left panel) and after surgery (right panel; 24 hr) of the right ADL

(ADLR) dendrite using a femtosecond laser (see Material and Methods). The ablation site is indicated as a circle. B) Difference in fed animals expressing srh-234p::gfp between severed and non-severed (‘cut-to-uncut’) ADL sensory dendrites. Animals (n = 8–17) were examined at

4006magnification for each genotype. C) Percentage of mutant animals with defects in cilia formation expressing srh-234p::gfp at wild-type levels. For strains carrying the ADL::osm-6 extrachromosomal array (see Material and Methods), data shown is the average of two independent transgenic lines. Animals (n>150) were examined at 150X magnification. D) Relative expression of srh-234p::gfp in the indicated genotypes compared to wild-type animals. For strains carrying ADL::pkc-1(gf) or ADL::TeTx extrachromosomal arrays, data shown is for two independent transgenic lines. Animals (n = 10–17) were examined at 400X magnification for each genotype. E,

F) Percentage of animals of the indicated genotypes expressing srh-234p::gfp at wild-type levels.

For strains carrying the ADL::ocr-2 extrachromosomal array (see Material and Methods), data shown is the average of two independent transgenic lines. Animals (n>150) were examined at 150X magnification. * indicates values that are different from that of wild-type animals at P<0.001, and # between the genotypes compared by brackets at P<0.001 using either a two-sample t-test, or the using a χ2 test of independence. Error bars denote the SEP or SEM.

275

We next sought to identify the cells where npr-1 activity is required for regulation of srh-

234 expression in ADL. npr-1 is expressed in at least 20 cells [36]; 4 of these form chemical synapses with ADL, and 3 form gap-junctions with ADL, including RMG interneurons [37]. Previous studies have shown that RMG is the major site for NPR-1 in regulating aggregative behavior and pheromone responses [11,12]. Based on these findings, we asked whether similarly RMG is the site of action for NPR-1 to modulate srh-

234 expression in ADL. Cell-specific expression of npr-1 in RMG using a previously described Cre-Lox system (referred further as RMG::npr-1) [11] in npr-1(ad609) mutants completely restored the reduced srh-234 expression phenotype of npr-1 mutants to wild- type levels during feeding, and increased srh-234 expression when starved (Figure 4B).

This increase is likely due to overexpression effects of the RMG::npr-1 transgene, which could overwhelm inhibitory regulation of srh- 234 by starvation. Thus, npr-1 is necessary and sufficient in RMG to promote srh-234 expression.

We next asked how NPR-1 in RMG interneurons affects srh- 234 expression in ADL?

Reasoning by analogy to the recently proposed RMG hub-and-spoke circuit [11] we examined whether loss of gap-junction function alters srh-234 expression in ADL. The innexins, unc-7 and unc-9, are widely expressed in neurons and muscles and form electrical synapses in the locomotory system [38], and unc-9 is involved in the modulation of ADL-mediated pheromone responses [12]. We found that unc-7(e139) and unc- 9(e101) fully suppressed the reduced srh-234 expression phenotype of npr-1(ad609) mutants in fed conditions (Figure 4C), but no suppression was observed in a daf-2(e1307) or kin-

29(oy38) mutant background (Table S2). These results suggest that unc-7/9 gap junctions are necessary for npr-1-mediated regulation of srh- 234 expression; however, other signaling pathways such as ocr-2 and daf-2 may act in parallel on the srh-234 promoter.

We also observed that srh-234 expression in starved conditions is significantly

276

upregulated in unc-7(e139) and unc-9(e101) mutants, as well as in unc-7 npr-1 and unc-

9 npr-1 double mutants when compared to starved wild-type animals (Figure 4C; Table

S2), suggesting that loss of unc-7/9 gap-junctions can suppress the effects of starvation on reducing srh-234 expression.

We next investigated whether UNC-7/9 are directly involved in the RMG gap-junction circuit to regulate srh-234 expression. We therefore expressed the cDNA of the unc-7 specifically in ADL neurons (ADL::unc-7), in flp-21-expressing cells that include RMG interneurons (flp-21::unc-7), and in all neurons (pan-neural::unc-7) in unc-7(e139) npr-

1(ad609) double mutants, and examined their effect on srh-234 expression. Surprisingly, however, we did not observe a restoration of the reduced srh-234 expression phenotype of unc-7 npr-1 double mutants back to npr-1 levels for either transgene in fed conditions

(Figure 4D). Moreover, ADL-specific knock down of unc-7 or unc-9 by RNAi did not suppress the reduced srh-234 expression phenotype of npr-1(ad609) mutants in fed conditions (Figure S3). Only pan-neural expression of unc-7 cDNA showed a partial suppression of the reduced srh-234 expression phenotype of unc-7 npr-1 double mutants

(Figure 4D). Thus, UNC-7/9 may have indirect effects on the regulation of srh- 234 expression mediated by NPR-1, although they could have subtle roles within the RMG gap-junction circuit.

Sensory inputs into ADL and neural outputs from ADL regulate srh-234 expression levels

In addition to inputs from RMG facilitated by NPR-1, our experiments with aztreonam- treated E.coli food that can be sensed but not eaten suggest that srh-234 expression is also modulated by sensory inputs from food. The presence of food could be perceived directly by ADL, or through other sensory neurons that connect to ADL. To examine these possibilities, we first performed physical and genetic manipulations of ADL sensory

277

dendrites, thereby eliminating the ability of ADL neurons to perceive any sensory inputs from the environment. We analyzed srh-234 expression in wild-type animals in which dendrites of the bilateral ADL pair are physically cut with a femtosecond laser (Figure 5A).

This subcellular laser surgery exhibits precision with sub-micrometer resolution and has been successfully used in C.elegans to analyze the role of AFD sensory dendrites in temperature sensation [39]. We found that cutting either the ADLL or ADLR sensory dendrite showed a significant reduction in srh-234 expression over time (Figure 5B). This is in contrast to AWB neurons where expression of str-1p::gfp is maintained after severing sensory dendrites [40]. Thus, ADL dendrites are necessary to promote srh-234 expression in fed conditions.

Although these dendritic cuts indicate a direct role for ADL sensory neurons in regulating srh-234 expression, it is possible that these subcellular cuts could damage ADL and thus compromise their physiology. To further confirm whether sensory inputs into ADL regulate srh-234 expression, we examined osm-5(p813) and osm-6(p811) mutants that lack functional sensory cilia [41,42], and found that these cilia defective mutants strongly reduce srh- 234 expression in ADL in fed conditions (Figure 5C). Functional reconstitution of ADL cilia in osm-6(p811) mutants by expressing osm-6 fused to mCherry under control of the sre-1 promoter was sufficient to restore wild-type srh-234 expression in fed conditions (Figure 5C). We confirmed that ADL formed proper cilia by visually inspecting their morphology with help of mCherry expression, and found a significant correlation between upregulation of srh-234 expression and wild-type cilia morphology of ADL (97% of ADL neurons with wild-type cilia expressed srh-234p::gfp expression at wild-type levels, n= 36). These results suggest that sensory inputs from food presence specifically through

ADL cilia and dendrites are essential to promote srh-234 expression.

278

We next asked whether altering the neural output of ADL neurons also effects the expression levels of srh-234. We therefore generated transgenic animals that express the pkc-1(gf) and the tetanus toxin (TeTx) cDNA under control of the ADL-specific sre-1 promoter (ADL::pkc-1(gf) and ADL::TeTx). The pkc-1(gf) is a constitutively active protein kinase C that enhances synaptic output by promoting secretion of dense-core vesicles containing neuropeptides [11,43–45], while TeTx prevents secretion of small neurotransmitter molecules by blocking synaptobrevin-mediated fusion of small, synaptic vesicles [46]. We found that expression of ADL::pkc-1(gf) strongly increased srh-234 expression in fed wildtype animals compared to non-transgenic siblings (Figure 5D), while blocking ADL synaptic output by expressing TeTx specifically in ADL (ADL::TeTx) did not significantly change levels of srh-234 expression (Figure 5D). Interestingly, the increased srh-234 expression phenotype of ADL::pkc-1(gf) is completely suppressed by npr-

1(ad609) (Figure 5D), suggesting that npr-1 may act downstream of pkc-1(gf)-enhanced neuropeptide secretion from ADL to regulate srh-234 expression. Consistent with these findings, lf mutations in genes that disrupt the release and processing of neuropeptides globally (e.g. egl-3, unc-31 [47–49]), as well as an inhibitor of vesicle release (e.g. tom-1

[50]), also modulate srh-234 expression levels (Table S2). No changes in srh-234 expression are observed in mutants with defects in monoamine synthesis including serotonin, octopamine and dopamine, or upon exogenous exposure to these amines

(Table S2). Together, these results suggest that perhaps release of neuropeptides from

ADL may in turn modulate NPR-1 in RMG to regulate srh-234 expression.

OCR-2 acts in ADL to regulate srh-234 expression

We showed that intact ADL cilia are required to properly express srh-234 in fed conditions, suggesting that a cilia-localized mechanism for sensing food presence may be important

279

for the regulation of srh-234. The TRPV channels, OCR-2 and OSM-9, localize to the cilia of a subset of sensory neurons, including ADL [51,52], and OCR-2 may function in coupling the perception of food presence to starvation survival [53]. Based on these findings, we wondered whether OCR-2 and OSM-9 may transduce sensory inputs from food into ADL to modulate srh-234 expression. Indeed, we found that lf mutations in ocr-

2 (alleles ak47 and yz5) strongly reduce srh-234 expression in ADL in fed animals, whereas osm-9(ok1667) did so more weakly (Figure 5E; Table S2). Thus, ocr-2 and to a lesser extent osm-9 promote srh-234 expression in fed conditions. It is possible that ocr-

2(ak47) and osm-9(ok1667) mutants reduce srh-234 expression when fed as a result of a decrease in food ingestion instead of a decrease in food perception; however, consistent with previous findings [54], both ocr-2 and osm-9 mutants ingest food similar to wild-type animals as measured by pumping rates (231.064 and 22565 pumps/min for ocr-2 and osm-9 mutants, respectively, as compared to 23565 pumps/min for wild-type animals, n =

25). ADL-specific expression of ocr-2 under control of the sre-1 promoter (ADL::ocr-2) fully restored srh-234 expression in ocr-2(ak47) mutants during feeding, and is slightly upregulated when starved (Figure 5E); an increase likely caused by overexpression effects of the transgene. Thus, OCR-2 activity in ADL is necessary during feeding and sufficient when starved to regulate srh-234.

We further investigated the relationship between the OCR-2 and NPR-1 pathways in regulating srh-234 expression. As expected, double mutants for ocr-2(ak47); npr-1(ad609) showed a reduced srh-234 expression phenotype similar to that of npr- 1(ad609) or ocr-

2(ak47) mutants alone in both fed and starved conditions (Table S2). Interestingly, ocr-

2(ak47) and osm-6(p811) fully suppressed the unc-7(e139) phenotype of upregulated srh-

234 expression in starved conditions (Figure 5F), suggesting that sensory inputs and

OCR-2 activity are essential for the gap junction-mediated reduction of srh-234 expression

280

in response to starvation. Consistent with these findings, sensory inputs from inedible food that can be sensed but not eaten (Figure 2A), and ADL-specific overexpression of OCR-

2 (Figure 5D), can override the effects of starvation on reducing srh-234 expression. Thus, starvation-modulation of srh-234 expression mediated by gap-junctions is likely dependent on sensory inputs.

Increased calcium signaling can bypass the requirement for OCR-2, NPR-1, DAF-2 and

KIN-29 in regulating the expression of srh-234

As calcium signaling plays an important role in the regulation of the KIN-29-dependent str-

1 chemoreceptor in AWB neurons [16], we explored the possibility that calcium signaling is also important for regulating srh-234. gf mutations in the voltage-gated calcium channel, egl-19, are predicted to prolong depolarization and result in sustained calcium influx [55].

We found that egl-19(gf) suppressed the starvation-induced downregulation in a wild-type background (Figure 6A), whereas lf mutations in egl-19 and unc-36, but not unc-2, encoding other voltage-gated calcium channels, partially reduce srh-234 expression during feeding (Figure S2). Thus, increased calcium signaling can override the effects of starvation on reducing srh-234 expression. We further show that egl-19(gf) can suppress the reduced srh-234 expression phenotype of npr-1(ad609), daf-2(e1307) and osm-

9(ok1667) mutants (Figure 6A) as well as kin-29(oy38) mutants (Table S2). Expression of egl-19(gf) specifically in ADL neurons (ADL::egl-19(gf)) also suppressed the reduced srh-

234 expression phenotype of ocr-2(ak47) and npr-1(ad609) mutants in fed conditions

(Figure 6B). These results suggest that increased calcium signaling is sufficient in ADL to bypass the requirement of OCR-2, DAF-2 and KIN-29, and NPR-1 pathways in regulating srh-234 expression.

281

Figure 6. mef-2 mutations and increased calcium signaling suppress the starvation- induced downregulation of srh-234 expression. A, C) Percentage of animals of the indicated genotypes expressing srh-234p::gfp at wild-type levels. Animals (n>150) were examined at 1506 magnification for each genotype. B) Relative expression of srh-234p::gfp in ocr-2 and npr- 1 mutants compared to wild-type. For strains carrying ADL::egl-19(gf) extrachromosomal arrays (see Material and Methods), data shown is for two independent transgenic lines. Animals (n = 15– 20) were examined at 400X magnification for each genotype. * and ** indicates values that are different from that of wild-type animals at P<0.001, and P<0.05, respectively, and # indicates the values that are different between the genotypes compared by brackets at P<0.05 using either a two-sample t-test or a χ2 test of independence. Error bars denote the SEP or SEM.

282

To further test the hypothesis whether calcium levels in ADL may be modulated by feeding and starvation responses, we measured intracellular calcium dynamics specifically in ADL neurons in fed and starved wild-type animals in the presence of the C9-pheromone (asc-

DC9; ascr#3) using the genetically encoded Ca2 + sensor GCaMP3. ADL is known to sense C9 as determined by calcium imaging and behavioral assays [12]. However, we found that C9-induced calcium transients were not significantly different in wild-type animals starved for 6 hours when compared to fed animals (Figure S3). Moreover, when we quantified the fluorescence intensity of the ADL::GCaMP3 reporter in the absence of any stimuli in wild-type animals starved for 6, 12 or 24 hours, we also observed no significant differences in ADL:: GCaMP3 expression when compared to control fed animals (Figure S4). Thus, although we were unable to detect changes in calcium in fed and starved animals, our experiments with egl-19(gf) suggest that increased calcium signaling is correlated with increased srh-234 expression.

Mutations in mef-2 suppress the starvation-induced downregulation of srh-234 expression

We previously showed that lf mutations in mef-2 encoding the MEF2 transcription factor can suppress the reduced srh-234 expression phenotype of kin-29 mutants [16], suggesting that KIN-29 antagonizes the function of MEF-2 in regulating str-1. We show that mef-2(gv1) failed to suppress the reduced srh-234 expression phenotype of ocr-

2(ak47), npr-1(ad609) and daf- 2(e1307) mutants in fed and starved conditions (Figure

6C), suggesting that MEF-2 does not act genetically downstream of OCR-2, DAF-2 and

NPR-1. In addition, we show that kin- 29(oy38) mutants can suppress the increased srh-

234 expression phenotype when overexpressing OCR-2 and NPR-1 (Figure 4B; Table

S2), suggesting that these pathways likely act interdependently to regulate srh-234.

Interestingly, mef-2(gv1) suppressed the starvation-induced downregulation of srh-234

283

expression, but had no major effect on srh-234 expression during feeding (Figure 6C), suggesting that the inhibitory regulation of srh-234 expression by starvation signals is dependent on MEF-2 function.

Since insulin signaling appears to be compromised in kin-29 mutants in the regulation of dauer formation and life-span [15], we next asked whether DAF-16 acts as a downstream effector of KIN-29 to regulate srh-234 expression. However, daf-16(mu86) did not suppress the srh-234 expression phenotype of kin- 29(oy38) mutants as well as of ocr-

2(ak47) and npr-1(ok1447) mutants (Table S2). Together, these results suggest that MEF-

2 and DAF-16 may act as state-dependent transcriptional regulators of srh-234 expression downstream of KIN-29 and DAF-2, respectively, while OCR-2 and NPR-1 act via MEF-2 and DAF-16-independent pathways.

Discussion

In this study, we identified a chemoreceptor gene, srh-234, in the ADL sensory neuron type of C.elegans, whose expression levels is altered by feeding state conditions.

Expression levels of srh-234 are regulated by sensory signals associated with food presence and internal starvation signals via integration of signals by multiple pathways. In

ADL neurons, signaling mediated by the kin-29 salt-inducible kinase, the daf-2 insulin-like receptor, and the ocr-2 TRPV channel converge their regulation on srh-234 expression, while the npr-1 neuropeptide receptor acts in RMG interneurons to regulate srh-234 expression in ADL sensory neurons (Figure 7). This sensory- and circuit-mediated regulation of chemoreceptor genes may allow animals to precisely regulate and fine-tune their chemosensory responses as a function of feeding state.

284

Figure 7. Model for sensory and circuit-mediated regulation of srh-234 expression. Expression levels of srh-234 are modulated by integration of sensory and internal feeding state signals via multiple pathways. During feeding, srh-234 expression is promoted by kin-29 salt- inducible kinase, daf-2 insulin-like receptor, and ocr-2 TRPV channel in ADL, and the npr-1 neuropeptide receptor in RMG interneurons. Negative transcriptional regulators of srh-234 expression, mef-2 and daf-16, act genetically downstream of kin-29 and daf-2, respectively, and likely act in parallel to ocr-2 and npr-1 pathways. The epistatic relationship between the different signaling pathways in ADL neurons remains to be fully defined. Unknown insulin-like peptides secreted by ADL or other neurons lead to activation of daf-2. Signaling mediated by kin-29, ocr-2, and npr-1, but less daf-2, converge on Ca2+ signaling, which likely affects activity-dependent transcription of chemoreceptor genes. After prolonged starvation, mef-2 and daf-16 may repress srh-234 expression, while yet unknown transcription factors may drive srh-234 expression during feeding.

285

Sensory inputs from food into ADL, and an internal state of starvation modulates chemoreceptor gene expression

Expression of srh-234 is increased in fed animals and dramatically reduced in starved animals. When wild-type fed animals were presented with inedible E.coli food (bacterial food that can be sensed but not eaten after treatment with the aztreonam antibiotic), or when eat-2(lf) mutants were exposed to edible food, the expression of srh-234 decreased in ADL, suggesting that the signal needed to reduce srh-234 expression is probably an internal metabolic signal arising after food ingestion. However, when starved animals were presented with either edible or inedible E.coli food, expression of srh-234 is increased in

ADL, suggesting that animals perceive the availability of food, even when they are unable to eat the inedible food. Thus, inedible food likely blocks signals associated with starvation to regulate srh-234 expression. Interestingly, this finding is similar to a previous study, showing that the repressive effects of starvation on C.elegans mating can be partially blocked by placing males on inedible food [24].

Sensory inputs are known to alter chemoreceptor gene expression in a subset of sensory neurons. We show that loss of all sensory inputs into ADL, as demonstrated by physically cutting the ADL dendrites, causes fed animals to reduce srh-234 expression. Moreover, restoring only ADL cilia in osm-6(lf) mutants that have severe truncations of all ciliated sensory neurons [41,42], rescues the reduced srh-234 expression phenotype of osm- 6(lf) mutants. These results suggest that sensory inputs through ADL sensory endings are essential to regulate srh-234 expression. Thus, we propose that depending on food availability and feeding state, srh-234 expression in ADL is regulated by two inputs, through external signals from food presence mediated directly by ADL and internal state signals resulting from food ingestion.

286

Circuit inputs modulate chemoreceptor gene expression

Modulation of chemoreceptor gene expression is thought to be defined primarily by external environmental inputs perceived by sensory neurons and not by circuit inputs from other neurons. Our results described here reveal a novel role for circuit-mediated regulation of chemoreceptor genes in sensory neurons. First, we show that npr-1 in RMG interneurons, which forms gap-junctions with ADL [56], was both necessary and sufficient for srh-234 expression in ADL. Second, this npr-1-mediated regulation of srh- 234 is dependent on the function of unc-7/9 gap-junctions. Third, we show that enhancing the secretion of dense-core vesicles that contain neuropeptides by expressing pkc-1(gf) in

ADL neurons promotes expression of srh-234, and this regulation is dependent on npr-1.

Fourth, we show that mutants with defects in neuropeptide processing and secretion alter the expression of srh-234. Lastly, insulin signals from other neurons may act on DAF-2 in

ADL to regulate srh-234 as suggested by the srh-234 expression phenotype of daf-28(gf) mutants, and daf-2/daf-16 signaling acting cell-autonomously in ADL.

The specific mechanisms by which npr-1 in RMG interneurons alters the expression of srh-234 in ADL remains to be determined. Current understanding suggests that NPR-1- mediated regulation of aggregative behavior and pheromone responses requires RMG

[11,12], which forms the hub of a circuit that is connected to spoke sensory neurons including ADL via gap junctions [56]. We show that unc-7 and unc-9 gap-junctions are essential for npr-1- mediated regulation of srh-234. Surprisingly, however, cell-specific rescue and RNAi knock down experiments of unc-7/9 in either ADL or RMG neurons suggest that they may not be directly involved in forming gap-junctions between RMG and

ADL neurons. One possibility is that unc-7/9 are required in other neurons besides RMG and ADL for regulating srh-234 expression, which is consistent with the partial rescue of the srh-234 expression phenotype of unc-7 npr-1 double mutants by driving unc-7 cDNA

287

in the nervous system (Figure 4D). Alternatively, any of the other innexins in C.elegans may act as gap-junction components within the RMG circuit.

A role for insulin signaling in regulating chemoreceptor gene expression

Insulin signals reflect the feeding state of an animal, which has been suggested to directly affect chemosensory sensitivity to chemical cues. Our results suggest a new role for insulin-mediated regulation of chemoreceptor genes. Consistent with low daf-2 signaling being associated with a starved state of C.elegans, we show that srh-234 expression is strongly reduced in daf-2(lf) mutants in a daf-16-dependent fashion. Rescue experiments with various promoters suggest that both DAF-2 and DAF-16 act cell-autonomously in

ADL to regulate srh-234 expression. A gf mutation in the daf-28 insulin-like peptide (ILP), which has been proposed to block other agonistic ILPs from binding to DAF-2 [32], reduces srh-234 expression in fed conditions. These results indicate that ILPs from other yet unknown neurons may target DAF-2 in ADL, which in turn regulates srh-234 expression. C.elegans contains 40 ILPs, and for some specific functions in particular sensory neurons have been reported. For example, in salt-chemotaxis learning, DAF-2 acts in ASE sensory neurons, and is targeted by the INS-1 ILP released from AIA interneurons [9]. Similarly, release of INS-1 from AIA regulates food-dependent AWC responses [57]. However, we show that ins-1 mutants did not change srh-234 expression in fed or starved conditions, suggesting there may be other ILPs involved in the regulation of srh-234 expression.

A role for OCR-2 and calcium in regulatingchemoreceptor gene expression

The OCR-2 and OSM-9 TRPV channels in C.elegans have been implicated in regulating the expression of sensory neuronal genes. For example, loss of these TRPV channels reduces expression of the odr-10 chemoreceptor gene in AWA neurons [51,52], while they

288

reduce the expression of the key enzyme in serotonin synthesis, tph-1, in AFD neurons

[54]. We reveal here the first description of a chemoreceptor regulated by ocr-2 in ADL neurons. TRPV channels in mammals are permeable to calcium [58], and in C.elegans, the reduced tph-1 expression phenotype of ocr-2(lf) mutants can be suppressed by activating downstream calcium-dependent pathways [54]. Similarly, we show that increased calcium signaling using egl-19(gf) can bypass the requirement of OCR-2 in regulating the expression of srh-234. Such activity-dependent transcriptional regulation of chemoreceptors may allow TRPV channels to regulate the sensitivity of sensory neurons to particular chemical stimuli as a function of feeding state. MEF2 plays a critical role in activity-dependent transcription in the nervous system [59], but we show that mef-2 does not suppress the srh-234 reduced expression phenotype of ocr-2 mutants. Thus, TRPV- mediated transcriptional regulation of srh-234 is independent of MEF-2 function, suggesting other possible downstream effectors of OCR-2 in regulating srh-234 expression. A possible target is the CREB-regulated transcriptional coactivator CRTC1, which recently was shown to regulate TRPVmediated longevity [60], and is a known target for SIK phosphorylation [20].

A role for MEF-2 and DAF-16 as state-dependent regulators of chemoreceptor gene expression

The specific transcriptional mechanisms by which feeding and starvation regulate chemoreceptor gene expression remain to be deciphered; however, our genetic experiments implicate a key role for the MEF-2 and DAF-16 transcription factors acting downstream of the KIN-29 and DAF-2 pathways, respectively. We show that mef-2(lf) and daf-16(lf) suppress the starvation-induced downregulation of srh-234 expression, but the expression of srh- 234 is not altered during feeding. On the basis of these genetic experiments, we suggest that under starved conditions, MEF-2 and DAF-16 are required

289

to repress but not activate srh-234 expression, suggesting that other yet unknown transcription factors may be required to drive srh-234 expression in ADL. Our previous work showed that MEF-2 is able to directly bind a MEF- 2 sequence motif upstream of the str-1 chemoreceptor [16]. Searching the upstream sequence of srh-234 revealed a similar

MEF2 binding motif as well as an E-box sequence motif (Figure S5). E-box motifs are found in the cis-regulatory region of genes expressed in ADL neurons [61], which are known to bind transcription factors of the basic helix-loop-helix (bHLH). Interestingly,

MEF2 has been shown to interact with bHLH factors at E-boxes to regulate myogenic gene expression [62]. Thus, a similar mechanism may operate in C.elegans, in which

MEF-2 function is essential for the starvation-induced reduction in srh- 234 expression levels by repressing a bHLH transcription factor that drives expression of srh-234 in ADL via the E-box. The molecular mechanism by which DAF-16 regulates srh-234 remains unclear as no canonical DAF-16 binding element (DBE) appears to be present in the 165 bp promoter sequence necessary for feeding-state regulation of srh-234 (pers. comm.

M.G and A.M.V). In Drosophila, SIK3 activity can be activated by insulin, which antagonizes FOXO-activated gene expression [21]. However, we show that KIN-29 antagonizes the function of MEF-2 but not DAF-16 in regulating the expression of srh-234, suggesting that DAF-16 mainly acts downstream of insulin signaling.

Functional consequences of regulating chemoreceptor genes in ADL

C.elegans expresses multiple chemoreceptors in each chemosensory neuron. We and others have proposed that to selectively modify a response to a single chemical may rely on changing the expression of individual or subsets of chemoreceptor genes, rather than altering the response of the entire neuron, which would inadvertently result in changing the response to all stimuli sensed by that neuron. Selectively modulating distinct

290

populations of chemoreceptors in this manner may allow C.elegans to modulate ‘long- term’ changes in chemosensory responses in changing environmental conditions. This expression strategy may be particularly important in ADL, which mediates avoidance responses to a wide variety of chemical signals in its environment, such as odors [63], pheromones [12], and heavy metals [64].

Our results show that the expression of least two candidate chemoreceptor genes in ADL, srh-234 and srh-34, are regulated by fed and starved conditions, but it is unknown what chemical or subset of chemicals are detected by these chemoreceptors. Only a few chemoreceptors with known chemical ligands have been found in C.elegans, such as the chemoreceptor gene, odr-10, expressed in the AWA olfactory neuron type for the attractive chemical diacetyl [65]. When the odr-10 gene was introduced into the repulsive

AWB neuron, C.elegans changes its normally attractive response to diacetyl to trigger avoidance of diacetyl [66], suggesting that chemoreceptors expressed in a specific neuron type are linked to a common odor response that is determined by the identity of the neuron.

Similarly, all chemoreceptors expressed in the ADL neuron type may be linked to a common avoidance response to chemicals detected by ADL, although in some cases a sensory neuron has the capacity to switch its behavioral preference towards odors [45].

The presence and absence of food is known to rapidly and reversibly alter responses of animals to repulsive chemical cues, and part of this response appears to be mediated by

ADL [7]. It is therefore tempting to speculate that increased srh- 234 expression in ADL, allows fed animals to be less tolerant of aversive stimuli detected by srh-234, whereas decreased srh-234 expression in ADL following starvation may allow starved animals to be more tolerant to these aversive stimuli. This dynamic modulation in chemoreceptor gene expression could allow starved C.elegans animals to sample different environments, perhaps increasing their chances of finding food under stress-full conditions.

291

Plasticity in chemoreceptor gene expression in other systems

Other invertebrates and vertebrates alter chemoreceptor gene expression in response to environmental and developmental signals. For example, expression of olfactory receptor genes in the zebrafish Danio rerio is induced in temporal waves, which may reflect a mechanism for odorant sensitivity during development [67]. Changes in chemoreceptor gene expression is also dependent on the sex of an animal. After mating, female flies of

Drosophila rapidly modify their chemosensory behaviors to lower their attraction to males such that they can focus on reproduction, and these behavioral changes are accompanied by modulation of different chemoreceptor genes [68]. Interestingly, in mosquitoes, the regulated expression of a subset of olfactory receptor genes before and after a blood feeding has been correlated with transitions between host-seeking and leaving behavior

[2–5]. Parasitic nematodes also actively seek out their host using chemical cues (reviewed in [69]); however, little is known about host-seeking behaviors in parasitic nematodes, and even less is known about whether expression of chemoreceptor genes are modulated by its feeding state. The function of certain chemosensory neuron types in parasitic nematodes have been examined in only a few cases. For example, similar to C.elegans, ablation of ASE and ASH neurons of the parasitic nematode S. stercoralis showed that these sensory neuron types mediate attraction and repulsion to soluble chemicals, respectively [70]. Given that C.elegans has high anatomical and functional similarity to certain parasitic nematodes, it would be important to determine whether similar mechanisms of feeding state-regulated chemoreceptor gene expression presented here operate in parasitic nematodes. Moreover, identification of additional regulators and mechanisms underlying chemoreceptor gene expression will lead to a better understanding of how animals modify their chemosensory behavior in response to changes in external and internal conditions.

292

Materials and Methods

Strains

Nematodes were grown at 20uC under standard conditions [71] on nematode growth medium (NGM) with E.coli OP50 as the primary food source unless indicated otherwise.

The wild-type strain used was C.elegans variety Bristol, strain N2. Mutant strains used in this study were obtained from the Caenorhabditis Genetics Center (CGC) unless indicated otherwise: PR811 osm-6(p811), PR813 osm-5(p813), DA609 npr-1(ad609), RB1330 npr-

1(ok1447), CX4148 npr-1(ky13); CX4057 npr-1(g320); VC2106 flp-18(gk3063), RB982 flp-21(ok889), VC461 egl- 3(gk328), CB169 unc-31(e169), CB55 unc-2(e55), CB251 unc-

36(e251), CB1370 daf-2(e1370), JT191 daf-28(sa191), CF1038 daf-16(mu86), LC33 bas-

1(tm351), CB1112 cat-2(e1112), RB1161 tbh-1(ok1196), RB993 tdc-1(ok914), GR1321 tph-1(mg280), VC1262 osm-9(ok1677), CX4544 ocr-2(ak47), JY243 ocr-2(yz5), DA465 eat-2(ad465), DA1116 eat-2(ad1116), KM134 mef-2(gv1), PY1476 kin-29(oy38), CB139 unc-7(e139), CB101 unc-9(e101), MT6129 egl-19(n2368)gf, MT1212 egl-19(n582),

VC223 tom-1(ok285), and DR476 daf-22(m130). Transgenic strains used in this study were: VDL3 oyIs56[srh-234p::gfp, unc-122p::rfp], VDL143 oyIs57[srh-234p::gfp, unc-

122p::rfp], and BOL171 npr-1(ad609); lin-15[ncs-1p::Cre flp-21p::loxPstoploxP::npr-1 SL2 gfp, lin-15(+)] (RMG::npr-1) [11], and sre-1::GCaMP3 [12]. Double mutant strains were constructed using standard genetic methods, and the presence of each mutation was confirmed via PCR or sequencing.

Real-time qRT PCR

Total RNA was isolated from a growth-synchronized population of adult animals and reverse transcribed using oligo(dT) primers. Real-time quantitative reverse transcription–

PCR (qRT–PCR) was performed with a Corbett Research Rotor-Gene 3000 real-time

293

cycler, Platinum Taq polymerase (Invitrogen), and primers specific for srh-234 and odr-10 coding sequences. Primer sequences for srh-234 are 5’-GGACAATTGAAATGCAACACA-

3’ and 5’-GACGGGGACAATAAAGAGCA-3’. Primer sequences for odr-10 are 5’-

GAGAATTGTGGATTACCCTAG-3’ and 5’-CTCAATATGCATTATAGGTCGTAATATG-3’.

Measurement and quantification of srh-234p::gfp

Animals carrying srh-234p::gfp reporters were cultured and grown at 20°C on standard nematode growth media (NGM) plates seeded with E.coli OP50 as the bacterial food source unless indicated otherwise. Young adult animals were washed with M9 buffer (to remove any bacteria in the gut) and transferred onto plates with E.coli OP50 food (Fed) or without E.coli OP50 food for 12–24 hours (Starved) unless indicated otherwise. Levels of srh-234p::gfp expression in animals were measured under a dissection microscope equipped with epifluorescence as described [16]. For quantification, gfp was scored as

‘‘bright’’ if levels of gfp fluorescence allowed visualization of one of the ADL cell bodies and dendritic process, and ‘‘dim’’ if gfp expression could not be detected or could be detected weakly at the same magnification. For more precise measurements, we mounted animals on a DM5500 compound microscope, and used Volocity analytical software to quantify gfp expression levels emanating from the srh- 234p::gfp reporter. Statistical analyses of srh-234 expression were performed using either the two-sample t-test, or the x2 test of independence to test for statistically significant differences between proportions in the categories ‘‘bright’’ and ‘‘dim’’ for different genotypes (d.f. 1). A proportion of 0% was set to a default of 1.

Analysis of srh-234p::gfp expression

Different food conditions: We exposed fed and starved animals carrying srh-234p::gfp reporters to aztreonam-treated E.coli OP50 (inedible food). For generating inedible food,

294

E.coli OP50 was treated with the aztreonam antibiotic as previously described [24]. In brief, E.coli OP50 was grown in LB to log phase at 37uC with shaking. Cultures were mixed with the aztreonam antibiotic (Sigma) to a final concentration of 10 mg/ml and incubated for an additional 3 hours at 37uC with minimal shaking to prevent bacterial shearing.

Bacteria was spread onto NGM plates containing 10 mg/ml aztreonam and immediately dried and used the same day, since the septum-inhibitory effects of aztreonam are short lived. Expression levels of srh-234p::gfp were measured and quantified following exposure to the different food conditions as described above.

Sephadex-beads: We exposed starved wild-type animals carrying srh-234p::gfp reporters to 1 ml of 30 mg/ml Illustra Sephadex G- 50 DNA Grade Fine (GE Healthcare UK Limited) suspended in water spread on NGM agar plates without bacterial food as described previously [72]. After at least 6 hours of exposure to Sephadex beads, animals were rapidly transferred into 35% sucrose solution to separate animals from the Sephadex beads. Animals floating on the surface of the sucrose solution were collected in 16 M9 buffer and immediately transferred to NGM agar plates without food for measurement and quantification of srh-234p::gfp expression levels. We confirmed that the sucrose floating procedure alone does not alter srh-234p::gfp expression levels.

Monogenic amines: We exposed fed or starved wild-type animals carrying srh-234p::gfp reporters to NGM plates with or without 3 mg/ml octopamine-hydrochloride (Sigma) in the presence of food, and 1 mg/ml serotonin creatinine sulphate (Sigma) in the absence of food. For octopamine treatment, an overnight culture of E.coli OP50 in LB was spun down and resuspended in 1/20 volume of water. About 50 ml of the concentrated OP50 was spread on the assay plates and was left until the surface of the plates became dry. After

6 hours of exposure to serotonin and octopamine, srh-234p::gfp expression levels were measured and quantified.

295

Pheromones: We exposed fed wild-type animals carrying srh-234p::gfp reporters to low levels of crude dauer pheromone in the presence of UV-killed E.coli food as described previously [13]. Dauer pheromone was prepared according to Golden and Riddle [22].

Expression constructs and generation of transgenic animals

Expression vectors were generated by amplifying either the wild-type genomic sequences of osm-6, npr-1, ocr-2, egl-19(gf), or cDNAs of daf-2 ([73], a kind gift from Shreekanth

Chalasani), daf- 16a (this study), unc-7, unc-9 (this study), pkc-1(gf) and tetanus toxin

(TeTx) (kind gift from Cori Bargmann, [12]). This resulted in the generation of the constructs pMG1 sre-1p::osm-6 genomic::m-Cherry (ADL::osm-6), pMG2 sre-1p::npr-1 genomic::mCherry (ADL::npr-1), pMG3 sre-1p::ocr-2 genomic::mCherry (ADL::ocr- 2), pMG4 sre-1::pkc-1(gf) cDNA (ADL::pkc-1(gf)), pMG5 sre-1p::tetanus toxin cDNA

(ADL::TeTx), pVDL14 sre-1p::daf-2 cDNA SL2::mCherry (ADL::daf-2), pMG14 sre-

1p::daf-16a cDNA SL2::mCherry (ADL::daf-16a), pMG24 sre-1p::unc-7 cDNA

SL2::mCherry (ADL::unc-7), and pMG39 flp-21::unc-7 cDNA SL2::mCherry (flp-21::unc-

7), pMG40 unc-31p::unc-7 cDNA SL2::mCherry (pan-neural::unc-7), and pMG37 sre-

1p::egl-19(gf) genomic SL2::mCherry (ADL::egl-19(gf)). Expression constructs rgef-

1p::daf-2 (pJH664) (pan-neural::daf-2), ges-1p::daf-2 (pJH668) (intestine:daf-2), and ges-

1p::gfp::daf-16a (pJH2973) (intestine::daf-16a) are kind gifts from Mei Zhen [32]. For generating the npr-1p::npr-1 expression construct, we fused 2.5 Kb of the npr-1 regulatory sequence and the complete npr-1 wild-type genomic sequence to gfp as previously described [74]. Transgenic animals were generated using the unc-122p::dsRed (50–100 ng/ml) or the pRF4 rol-6(su1006) co-injection markers injected at 150 ng/ml. Expression constructs were injected at 20 ng/ml. For generating the cell-specific knock down constructs, we fused the sre-1 promoter to a 1 kb exon-rich genomic fragment of either

296

unc-7 or unc-9 in the sense and antisense (sas) orientation as described [75]. Equal amounts of PCR products of either ADL::unc-7(sas) or ADL::unc-9(sas) were mixed and microinjected together with the pRF4 rol-6(su1006) co-injection markers injected at 90 ng/ml. All amplified products in the generated constructs were sequenced to confirm the absence of errors generated via the amplification procedure.

Subcellular laser ablation

Laser microsurgery was carried out as previously described [39]. A titanium::sapphire laser system (Mantis PulseSwitch Laser, Coherent Inc., Santa Clara, CA) generated a 1 kHz train of near infrared (λ=800 nm) pulses that were ~100 fs in duration and had a pulse energy of 5–15 nJ. The laser beam was focused to a diffraction-limited spot (using a 60X microscope objective) and used to disrupt sensory dendrites of ADL neurons expressing srh-234p::gfp. Following brief laser exposure, the targeted dendrite was inspected for a visual break to confirm that is was severed. Prior to laser surgery of either the ADLL or

ADLR sensory dendrite, fed animals were aestheticized on 2% agar pads with 3 mM

Sodium Azide, removed post-surgery for recovery and returned to NGM agar plates containing E.coli OP50 for measuring and quantifying srh-234p::gfp expression levels 2,

4, 6 and 24 hours following surgery in fed animals. Expression of srh-234 in severed

(‘‘cut’’) neurons was compared to controls (‘‘uncut’’) neurons in the same animals that were aestheticized for imaging but received no laser surgery.

Quantification of sre-1p::GCaMP3 in fed and starved animals

To measure fluorescence intensity of GCaMP3 expressed specifically in ADL neurons under either fed or starved conditions, three L4 staged sre-1p::GCaMP3 integrated transgenic animals [12] were grown on a E.coli OP50 seeded plate for 1.5 days to obtain about 100 eggs. The eggs were grown until they became young adults at 20°C. The young

297

adult animals were washed in 1X M9 buffer and divided and placed on two NGM plates

(one plate in the presence of E.coli OP50 food: ‘‘fed’’, and one plate in the absence of

E.coli OP50 food, ‘‘starved’’). Images of GCaMP3 expression in the ADL neurons were captured under fixed exposure time (500 ms) with a Zeiss Axioplan microscopy using a

40X objective and Zeiss AxioCam HR camera at 0 hr, 6 hr, 12 hr or 24 hr in either fed or starved conditions (n= 40–60 for each). The fluorescence intensity of GCaMP3 in ADL was quantified using the Image J software (NIH).

Imaging of C9 ascaroside-induced Ca2+ responses in fed and starved animals

Ca2+ imaging experiments in the presence of C9 (asc-ΔC9; ascr#3) pheromone were carried out as previously described [12] with custom-made microfluidics chips [76].

Imaging was performed on a Zeiss Axioplan microscopy using a 40X objective and a Zeiss

AxioCam HR camera. The images were analyzed using Image J software (NIH), and a custom-written MATLAB (The Mathworks) script.

298

Acknowledgments

We would like to thank Piali Sengupta and members of the van der Linden Lab for valuable discussions and comments on the manuscript. Initial experiments of this work were performed in the laboratory of Piali Sengupta, and we like to thank Melanie Hong and Piali

Sengupta for discovering that sensory inputs alter srh-234 expression during feeding conditions. We thank Douglas Portman for sharing unpublished observations. We are grateful to the Caenorhabditis Genetics Center (CGC) for the strains used in this study,

Piali Sengupta for reagents and strains, Mei Zhen and Shreekanth Chalasani for daf-2 and daf-16 plasmids, Cori Bargmann for pkc-1(gf) and tetanus toxin plasmids, which were unpublished at the time of receipt, and Mario De Bono for npr-1 transgenic strains.

Author Contributions

Conceived and designed the experiments: MG AMvdL. Performed the experiments: MG

DN AW RH LR SHC. Analyzed the data: MG DN AW RH LR SHC. Contributed reagents/materials/analysis tools: KK LR SHC CVG. Wrote the paper: MG AMvdL.

299

Supporting Information

Figure S1 Re-feeding restores srh-234 expression in starved animals. A) Percentage of starved wild-type L1 larvae (red line), and adults (black line) expressing srh-234p::gfp at wild- type levels at different time-points (hr) after they were placed on-food (E.coli OP50) plates. B) Percentage of starved animals expressing srh-234p::gfp at wild-type levels at different time-points (hr) after they were placed on-food (E.coli OP50) plates (black line), off-food plates (red line), or axenic-media without food (blue line). Error bars denote the SEP.

300

Figure S2 ADL-specific RNAi of unc-7 and unc-9 does not suppress the npr-1- mediated reduction of srh-234 expression. Relative expression of srh-234p::gfp in the indicated genotypes compared to wild-type animals. For strains carrying ADL::unc-7(sas) and ADL::unc-9(sas) extrachromosomal arrays, data shown is for at least two independent transgenic lines. Animals (n =10– 25) were examined at 400X magnification for each genotype. * indicates values that are different from that of wild-type animals at P<0.001 using a two-sample t-test. n.s. indicates values that are not significantly different. (sas) indicates sense-antisense. Error bars denote the SEM.

301

Figure S3. C9 pheromone-induced Ca2 + transients in the ADL neurons of well-fed or starved wild-type animals. (Left) Intracellular Ca2 + dynamics in GCaMP3-expressing ADL neurons upon addition of 500 nM C9 (asc-ΔC9; ascr#3) (red horizontal bars) were observed in animals at 0 hr (A) or 6 hr (B) after they were placed on-food or off-food plates, respectively. (Middle) Scatter plot shows the peak percentage changes after C9 addition. Dotted lines indicate the median. (Right) The averages of the peak percentage change after C9 addition are shown. ≥10 neurons each. n.s. indicates the values between brackets that are not significantly different. Error bars denote the SEM.

302

Figure S4. Fluorescence intensity of the genetically encoded Ca2 + sensor GCaMP3 specifically expressed in ADL of fed or starved wild-type animals. Fluorescence intensity (A.U.) was measure at 0, 6, 12 and 24 hr after they were placed on-food or off-food plates. # indicates the values that are different between the brackets at P<0.05 using a two-sample t-test. ≥40 animals for each. Error bars denote the SEM.

303

Figure S5. The promoter sequence of srh-234 contains a putative MEF-2 and E-box sequence motif. Expression of gfp driven by 165 bp srh-234 regulatory sequence. Shown is a predicted E-box motif (stippled box) that drives expression of ADL-expressed genes [61], and a predicted MEF2 site (black box).

304

Table S1. Summary of ADL-expressed chemoreceptor genes examined as a function of feeding state. Genea Feeding state

regulatedb

srb-6 _

sre-1 _

srh-34 +

srh-37 _

srh-60 _

srh-132 _

srh-186 _

srh-220 _

srh-234 +

sri-51 _

sro-1 _

srz-24 _

srz-78 _ n = 150-250 a Expression of gfp gene fusions carried on extrachromosomal arrays, and arrays stably integrated into the genome, gmIs12[srb-6p::gfp] and oyIs56[srh-234p::gfp] were examined in adult animals in fed and starved conditions. b “+”, regulated, or “-“ not regulated by fed and starved conditions.

305

Table S2. Analysis of srh-234p::gfp expression levels as a function of feeding state in different conditions and mutants. Feeding % expressing Straina P- srh-234p::gfp in at least d State values one ADL neuronb oyIs56[srh-234p::gfp] Fed 87 oyIs56[srh-234p::gfp] Starved 5 <0.001e oyIs57[srh-234p::gfp]c Fed 89 oyIs57[srh-234p::gfp]c Starved 6 <0.001f

Bacterial food HB101 Fed 88 HB101 Starved 6

Pheromone daf-22(m130) Fed 98 daf-22(m130) Starved 10 Crude pheromone + OP50 Fed 88 food

Monoamine synthesis tdc-1(ok914) Fed 80 tdc-1(ok914) Starved 0 tbh-1(ok1196) Fed 87 tbh-1(ok1196) Starved 2 tph-1(mg280) Fed 91 tph-1(mg280) Starved 5 cat-2(e1112) Fed 82 cat-2(e1112) Starved 4 bas-1(tm315)c Fed 98 bas-1(tm315)c Starved 1

Exogenous Amines and

Sephadex Serotonin + OP50 food Starved 8 Octopamine + OP50 food Fed 98 Sephadex beads + no food Starved 2

Double mutants with kin-29 kin-29(oy38) Fed 0 kin-29(oy38); mef-2(gv1) Fed 91 <0.001h kin-29(oy38); egl-19(gf) Fed 67 <0.001h kin-29(oy38); daf-16(mu86) Fed 0

306

kin-29(oy38) npr-1(ad609) Fed 0 kin-29(oy38) unc-7(e139) Fed 0 kin-29(oy38); Ex[ADL::ocr-2] Fed 0 kin-29(oy38); Ex[npr-1::npr-1] Fed 0

Cilia defective osm-5(p813) Fed 0 <0.001e

Insulin signaling ins-1(tm1888) Fed 93 ins-1(tm1888) Starved 2

TRPV signaling ocr-2(yz5) Fed 0 <0.001e ocr-2(yz5) Starved 0

Double mutants with ocr-2 ocr-2(ak47) Fed 2 <0.001e ocr-2(ak47) Starved 1 ocr-2(ak47); npr-1(ad609) Fed 1 ocr-2(ak47); npr-1(ad609) Starved 1 ocr-2(ak47); daf-16(mu86) Fed 1 ocr-2(ak47); daf-16(mu86) Starved 1

NPR-1 signaling npr-1(g320) Fed 52 <0.001e npr-1(g320) Starved 2 npr-1(ok1447) Fed 6 <0.001e npr-1(ok1447) Starved 2 npr-1(ky13) Fed 17 <0.001e npr-1(ky13) Starved 1 flp-18(gk3063) Fed 92 flp-18(gk3063) Starved 18 <0.05g flp-21(ok889) Fed 80 flp-21(ok889) Starved 4 flp-18(gk3063); flp-21(ok889) Fed 94 flp-18(gk3063); flp-21(ok889 Starved 2 npr-1(ok1447); daf-16(mu86) Fed 0 npr-1(ok1447); daf-16(mu86) Starved 0

Double mutants with unc-9 unc-9(e101) Fed 96

307

unc-9(e101) Starved 95 <0.001g unc-9(e101) npr-1(ad609) Fed 95 unc-9(e101) npr-1(ad609) Starved 93 <0.001g unc-9(e101); osm-6(p811) Fed 0 <0.001i unc-9(e101); osm-6(p811) Starved 0 unc-9(e101); ocr-2(ak47) Fed 0 <0.001i unc-9(e101); ocr-2(ak47) Starved 0

Double mutants with unc-7 unc-7(e139) Fed 97 unc-7(e139) Starved 96 <0.001g unc-7(e139); npr-1(ky13) Fed 84 unc-7(e139); npr-1(ky13) Starved 16 <0.05g unc-7(e139); daf-2(e1307) Fed 2 <0.001j unc-7(e139); daf-2(e1307) Starved 0

Neuropeptide release and

processing unc-31(e169) Fed 100 unc-31(e169) Starved 22 <0.05g tom-1(ok285) Fed 35 <0.001e tom-1(ok285) Starved 1 egl-3(gk328) Fed 96 egl-3(gk328) Starved 47 <0.001g

Voltage-gated calcium

channels unc-2(e55) Fed 96 unc-2(e55) Starved 5 egl-19(n582) Fed 60 <0.001e egl-19(n582) Starved 0 unc-36(e251)c Fed 38 <0.001f unc-36(e251)c Starved 0

n = 150-350. a Adult animals grown at 20C in the presence of OP50 food were examined in all cases unless indicated otherwise. All strains contain stably integrated copies of oyIs56[srh-234p::gfp] fusion genes with the exception of bas-1 and unc-36 which contain integrated copies of oyIs57[srh- 234p::gfp]. b Expression of oyIs56[srh-234p::gfp] was examined at 150X magnification as defined in Material and Methods.

308

c Expression of oyIs57[srh-234p::gfp] was examined at 400X magnification as defined in Material and Methods. d Indicates values that are different from that of wild-type animals either in fed or starved conditions using a χ2 test of independence. e Compared to wild-type oyIs56[srh-234p::gfp when fed. f Compared to wild-type oyIs57[srh-234p::gfp] when fed. g Compared to wild-type oyIs56[srh-234p::gfp when starved. h Compared to kin-29(oy38) under same conditions. i Compared to unc-9(e101) under same conditions. j Compared to unc-7(e139) under same conditions.

309

References

1. Sengupta P (2012) The belly rules the nose: feeding state-dependent modulation of peripheral chemosensory responses. Curr Opin Neurobiol 23: 68–75.

2. Fox AN, Pitts RJ, Robertson HM, Carlson JR, Zwiebel LJ (2001) Candidate odorant receptors from the malaria vector mosquito Anopheles gambiae and evidence of down- regulation in response to blood feeding. Proc Natl Acad Sci U S A 98: 14693–14697.

3. Hallem EA, Nicole Fox A, Zwiebel LJ, Carlson JR (2004) Olfaction: mosquito receptor for human-sweat odorant. Nature 427: 212–213.

4. Rinker DC, Pitts RJ, Zhou X, Suh E, Rokas A, et al. (2013) Blood meal-induced changes to antennal transcriptome profiles reveal shifts in odor sensitivities in Anopheles gambiae.

Proc Natl Acad Sci U S A 110: 8260–8265.

5. Qiu YT, van Loon JJ, Takken W, Meijerink J, Smid HM (2006) Olfactory Coding in

Antennal Neurons of the Malaria Mosquito, Anopheles gambiae. Chem Senses 31: 845–

863.

6. Colbert HA, Bargmann CI (1997) Environmental signals modulate olfactory acuity, discrimination, and memory in Caenorhabditis elegans. Learn Mem 4: 179–191.

7. Chao MY, Komatsu H, Fukuto HS, Dionne HM, Hart AC (2004) Feeding status and serotonin rapidly and reversibly modulate a Caenorhabditis elegans chemosensory circuit.

Proc Natl Acad Sci U S A 101: 15512–15517.

8. Ezcurra M, Tanizawa Y, Swoboda P, Schafer WR (2011) Food sensitizes C.elegans avoidance behaviours through acute dopamine signalling. EMBO J 30: 1110–1122.

9. Tomioka M, Adachi T, Suzuki H, Kunitomo H, Schafer WR, et al. (2006) The insulin/PI

3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans. Neuron

51: 613–625.

310

10. Oda S, Tomioka M, Iino Y (2011) Neuronal plasticity regulated by the insulinlike signaling pathway underlies salt chemotaxis learning in Caenorhabditis elegans. J

Neurophysiol 106: 301–308.

11. Macosko EZ, Pokala N, Feinberg EH, Chalasani SH, Butcher RA, et al. (2009) A hub- and-spoke circuit drives pheromone attraction and social behaviour in C.elegans. Nature

458: 1171–1175.

12. Jang H, Kim K, Neal SJ, Macosko E, Kim D, et al. (2012) Neuromodulatory state and sex specify alternative behaviors through antagonistic synaptic pathways in C.elegans.

Neuron 75: 585–592.

13. Peckol EL, Troemel ER, Bargmann CI (2001) Sensory experience and sensory activity regulate chemosensory receptor gene expression in C.elegans. Proc Natl Acad Sci USA.

14. Nolan KM, Sarafi-Reinach TR, Horne JG, Saffer AM, Sengupta P (2002) The DAF-7

TGF-beta signaling pathway regulates chemosensory receptor gene expression in

C.elegans. Genes Dev 16: 3061–3073.

15. Lanjuin A, Sengupta P (2002) Regulation of chemosensory receptor expression and sensory signaling by the KIN-29 Ser/Thr kinase. Neuron 33: 369–381.

16. van der Linden AM, Nolan KM, Sengupta P (2007) KIN-29 SIK regulates chemoreceptor gene expression via an MEF2 transcription factor and a class II HDAC.

EMBO J 26: 358–370.

17. Dentin R, Liu Y, Koo SH, Hedrick S, Vargas T, et al. (2007) Insulin modulates gluconeogenesis by inhibition of the coactivator TORC2. Nature 449: 366–369.

18. Koo SH, Flechner L, Qi L, Zhang X, Screaton RA, et al. (2005) The CREB coactivator

TORC2 is a key regulator of fasting glucose metabolism. Nature 437: 1109–1111.

311

19. Wang B, Goode J, Best J, Meltzer J, Schilman PE, et al. (2008) The insulin-regulated

CREB coactivator TORC promotes stress resistance in Drosophila. Cell Metab 7: 434–

444.

20. Choi S, Kim W, Chung J (2011) Drosophila salt-inducible kinase (SIK) regulates starvation resistance through cAMP-response element-binding protein (CREB)- regulated transcription coactivator (CRTC). J Biol Chem 286: 2658–2664.

21. Wang B, Moya N, Niessen S, Hoover H, Mihaylova MM, et al. (2011) A hormone- dependent module regulating energy balance. Cell 145: 596–606.

22. Golden JW, Riddle DL (1984) The Caenorhabditis elegans dauer larva: developmental effects of pheromone, food, and temperature. Dev Biol 102: 368–378.

23. Butcher RA, Ragains JR, Li W, Ruvkun G, Clardy J, et al. (2009) Biosynthesis of the

Caenorhabditis elegans dauer pheromone. Proc Natl Acad Sci U S A 106: 1875–1879.

24. Gruninger TR, Gualberto DG, Garcia LR (2008) Sensory perception of food and insulin-like signals influence seizure susceptibility. PLoS Genet 4: e1000117.

25. Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G (1997) daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science 277: 942–

946.

26. Lin K, Dorman JB, Rodan A, Kenyon C (1997) daf-16: An HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans. Science 278:

1319–1322.

27. Ogg S, Paradis S, Gottlieb S, Patterson GI, Lee L, et al. (1997) The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in

C.elegans. Nature 389: 994–999.

28. Libina N, Berman JR, Kenyon C (2003) Tissue-specific activities of C.elegans DAF-16 in the regulation of lifespan. Cell 115: 489–502.

312

29. Kwon ES, Narasimhan SD, Yen K, Tissenbaum HA (2010) A new DAF-16 isoform regulates longevity. Nature 466: 498–502.

30. Li W, Kennedy SG, Ruvkun G (2003) daf-28 encodes a C.elegans insulin superfamily member that is regulated by environmental cues and acts in the DAF-2 signaling pathway.

Genes Dev 17: 844–858.

31. Ritter AD, Shen Y, Fuxman Bass J, Jeyaraj S, Deplancke B, et al. (2013) Complex expression dynamics and robustness in C.elegans insulin networks. Genome Res 23:

954–965.

32. Hung WL, Wang Y, Chitturi J, Zhen M (2014) A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.

Development 141: 1767–1779.

33. de Bono M, Bargmann CI (1998) Natural variation in a neuropeptide Y receptor homolog modifies social behavior and food response in C.elegans. Cell 94: 679– 689.

34. Rogers C, Persson A, Cheung B, de Bono M (2006) Behavioral motifs and neural pathways coordinating O2 responses and aggregation in C.elegans. Curr Biol 16: 649–

659.

35. Cheung BH, Cohen M, Rogers C, Albayram O, de Bono M (2005)

Experiencedependent modulation of C.elegans behavior by ambient oxygen. Curr Biol 15:

905–917.

36. Coates JC, de Bono M (2002) Antagonistic pathways in neurons exposed to body fluid regulate social feeding in Caenorhabditis elegans. Nature 419: 925–929.

37. White JG, Southgate E, Thomson JN, Brenner S (1986) The structure of the nervous system of the nematode Caenorhabditis elegans. Phil Transact R Soc Lond B 314: 1–340.

313

38. Starich TA, Xu J, Skerrett IM, Nicholson BJ, Shaw JE (2009) Interactions between innexins UNC-7 and UNC-9 mediate electrical synapse specificity in the Caenorhabditis elegans locomotory nervous system. Neural Dev 4: 16.

39. Chung SH, Clark DA, Gabel CV, Mazur E, Samuel AD (2006) The role of the AFD neuron in C.elegans thermotaxis analyzed using femtosecond laser ablation. BMC

Neurosci 7: 30.

40. Wu Z, Ghosh-Roy A, Yanik MF, Zhang JZ, Jin Y, et al. (2007) Caenorhabditis elegans neuronal regeneration is influenced by life stage, ephrin signaling, and synaptic branching.

Proc Natl Acad Sci U S A 104: 15132–15137.

41. Collet J, Spike CA, Lundquist EA, Shaw JE, Herman RK (1998) Analysis of osm-6, a gene that affects sensory cilium structure and sensory neuron function in Caenorhabditis elegans. Genetics 148: 187–200.

42. Perkins LA, Hedgecock EM, Thomson JN, Culotti JG (1986) Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev Biol 117: 456–487.

43. Sieburth D, Madison JM, Kaplan JM (2007) PKC-1 regulates secretion of neuropeptides. Nat Neurosci 10: 49–57.

44. Okochi Y, Kimura KD, Ohta A, Mori I (2005) Diverse regulation of sensory signaling by C.elegans nPKC-epsilon/eta TTX-4. EMBO J 24: 2127–2137.

45. Tsunozaki M, Chalasani SH, Bargmann CI (2008) A behavioral switch: cGMP and

PKC signaling in olfactory neurons reverses odor preference in C.elegans. Neuron 59:

959–971.

46. Schiavo G, Benfenati F, Poulain B, Rossetto O, Polverino de Laureto P, et al. (1992)

Tetanus and botulinum-B neurotoxins block neurotransmitter release by proteolytic cleavage of synaptobrevin. Nature 359: 832–835.

314

47. Kass J, Jacob TC, Kim P, Kaplan JM (2001) The EGL-3 proprotein convertase regulates mechanosensory responses of Caenorhabditis elegans. J Neurosci 21: 9265–

9272.

48. Husson SJ, Clynen E, Baggerman G, Janssen T, Schoofs L (2006) Defective processing of neuropeptide precursors in Caenorhabditis elegans lacking proprotein convertase 2 (KPC-2/EGL-3): mutant analysis by mass spectrometry. J Neurochem 98:

1999–2012.

49. Speese S, Petrie M, Schuske K, Ailion M, Ann K, et al. (2007) UNC-31 (CAPS) is required for dense-core vesicle but not synaptic vesicle exocytosis in Caenorhabditis elegans. J Neurosci 27: 6150–6162.

50. Gracheva EO, Burdina AO, Touroutine D, Berthelot-Grosjean M, Parekh H, et al.

(2007) Tomosyn negatively regulates CAPS-dependent peptide release at Caenorhabditis elegans synapses. J Neurosci 27: 10176–10184.

51. Colbert HA, Smith TL, Bargmann CI (1997) OSM-9, a novel protein with structural similarity to channels, is required for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J Neurosci 17: 8259–8269.

52. Tobin D, Madsen D, Kahn-Kirby A, Peckol E, Moulder G, et al. (2002) Combinatorial expression of TRPV channel proteins defines their sensory functions and subcellular localization in C.elegans neurons. Neuron 35(2): 307– 318.

53. Lee BH, Ashrafi K (2008) A TRPV channel modulates C.elegans neurosecretion, larval starvation survival, and adult lifespan. PLoS Genet 4: e1000213.

54. Zhang S, Sokolchik I, Blanco G, Sze JY (2004) Caenorhabditis elegans TRPV ion channel regulates 5HT biosynthesis in chemosensory neurons. Development 131: 1629–

1638.

315

55. Lee RY, Lobel L, Hengartner M, Horvitz HR, Avery L (1997) Mutations in the alpha1 subunit of an L-type voltage-activated Ca2+ channel cause myotonia in Caenorhabditis elegans. Embo J 16: 6066–6076.

56. White JG, Southgate E, Thomson JN, Brenner S (1976) The structure of the ventral nerve cord of Caenorhabditis elegans. Phil Transact R Soc Lond B 275: 327–348.

57. Chalasani SH, Kato S, Albrecht DR, Nakagawa T, Abbott LF, et al. (2010)

Neuropeptide feedback modifies odor-evoked dynamics in Caenorhabditis elegans olfactory neurons. Nat Neurosci 13: 615–621.

58. Pedersen SF, Owsianik G, Nilius B (2005) TRP channels: an overview. Cell Calcium

38: 233–252.

59. Flavell SW, Cowan CW, Kim TK, Greer PL, Lin Y, et al. (2006) Activity-dependent regulation of MEF2 transcription factors suppresses excitatory synapse number. Science

311: 1008–1012.

60. Riera CE, Huising MO, Follett P, Leblanc M, Halloran J, et al. (2014) TRPV1 pain receptors regulate longevity and metabolism by neuropeptide signaling. Cell 157: 1023–

1036.

61. McCarroll SA, Li H, Bargmann CI (2005) Identification of transcriptional regulatory elements in chemosensory receptor genes by probabilistic segmentation. Curr Biol 15:

347–352.

62. Molkentin JD, Black BL, Martin JF, Olson EN (1995) Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 83: 1125– 1136.

63. Troemel ER, Chou JH, Dwyer ND, Colbert HA, Bargmann CI (1995) Divergent seven transmembrane receptors are candidate chemosensory receptors in C.elegans. Cell 83:

207–218.

316

64. Sambongi Y, Nagae T, Liu Y, Yoshimizu T, Takeda K, et al. (1999) Sensing of cadmium and copper ions by externally exposed ADL, ASE, and ASH neurons elicits avoidance response in Caenorhabditis elegans. Neuroreport 10: 753–757.

65. Sengupta P, Chou JH, Bargmann CI (1996) odr-10 encodes a seven transmembrane domain olfactory receptor required for responses to the odorant diacetyl. Cell 84: 899–

909.

66. Troemel ER, Kimmel BE, Bargmann CI (1997) Reprogramming chemotaxis responses: sensory neurons define olfactory preferences in C.elegans. Cell 91: 161–169.

67. Barth AL, Justice NJ, Ngai J (1996) Asynchronous onset of odorant receptor expression in the developing zebrafish olfactory system. Neuron 16: 23–34.

68. Zhou S, Stone EA, Mackay TF, Anholt RR (2009) Plasticity of the chemoreceptor repertoire in Drosophila melanogaster. PLoS Genet 5: e1000681.

69. Chaisson KE, Hallem EA (2012) Chemosensory behaviors of parasites. Trends

Parasitol 28: 427–436.

70. Forbes WM, Ashton FT, Boston R, Zhu X, Schad GA (2004) Chemoattraction and chemorepulsion of Strongyloides stercoralis infective larvae on a sodium chloride gradient is mediated by amphidial neuron pairs ASE and ASH, respectively. Vet Parasitol 120:

189–198.

71. Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77: 71–94. 72.

Suo S, Culotti JG, Van Tol HH (2009) Dopamine counteracts octopamine signalling in a neural circuit mediating food response in C.elegans. EMBO J 28: 2437–2448.

73. Leinwand SG, Chalasani SH (2013) Neuropeptide signaling remodels chemosensory circuit composition in Caenorhabditis elegans. Nat Neurosci 16: 1461–1467.

74. Hobert O (2002) PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C.elegans. Biotechniques 32: 728–730.

317

75. Esposito G, Di Schiavi E, Bergamasco C, Bazzicalupo P (2007) Efficient and cell specific knock-down of gene function in targeted C.elegans neurons. Gene 395: 170–176.

76. Chalasani SH, Chronis N, Tsunozaki M, Gray JM, Ramot D, et al. (2007) Dissecting a circuit for olfactory behaviour in Caenorhabditis elegans. Nature 450: 63–70.