Gene Expression Profiling of Glucocorticoid-Inhibited Osteoblasts

175 Gene expression proﬁling of glucocorticoid-inhibited osteoblasts

Nathalie Leclerc1, Cynthia A Luppen1, Vincent V Ho1, Shailender Nagpal1, Joseph G Hacia1, Elisheva Smith2 and Baruch Frenkel1,2 1Department of Biochemistry and Molecular Biology, Institute for Genetic Medicine, Keck School of Medicine at the University of Southern California, 2250 Alcazar Street, Los Angeles, California 90033, USA 2Department of Orthopedic Surgery, Institute for Genetic Medicine, Keck School of Medicine at the University of Southern California, 2250 Alcazar Street, Los Angeles, California 90033, USA

(Requests for offprints should be addressed to Baruch Frenkel; Email: [email protected])

Abstract

Glucocorticoid (GC) treatment for the management of autoimmune and inflammatory diseases is associated with decreased bone formation and increased risk for fracture. In MC3T3-E1 cell cultures, 0·1 – 1 µM dexamethasone (DEX) arrests development of the osteoblast phenotype when administration commences at a commitment stage around the time of confluency. To gain new insights into GC-induced osteoporosis, we performed microarray-based gene expression analysis of GC-arrested MC3T3-E1 cultures, 2·5 days after the administration of DEX. Of the .12 000 transcripts interrogated, 74 were up-regulated and 17 were down-regulated by at least 2·5-fold (P¯0·05). Some of these genes, such as Mmp13, Serum/GC-regulated kinase and Tieg, have previously been reported as GC-responsive. Others are shown here for the first time to respond to GCs. DEX strongly repressed Krox20/Egr2 at both the mRNA and the protein level. This is especially significant because mice lacking this transcription factor develop osteoporosis. The data also suggest that the bone morphogenetic protein (BMP) pathway, which is involved in regulating bone mass, and other pathways that influence BMP signaling, are abrogated by GCs: (i) DEX increased the mRNA levels of the BMP antagonists Follistatin and Dan; (ii) DEX increased the levels of p21 Rasgap3 and Ptpn16/MKP-1 mRNAs, negative regulators of the MAP kinase pathway; and (iii) DEX decreased Cox mRNA levels. DEX also increased thrombospondin mRNA levels, which negatively regulate bone mass in vivo, as well as the adipocytic marker Fkbp51. These and other observations disclose novel gene targets, whose regulation by GCs in osteoblasts may shed light on and provide new therapeutic approaches to osteoporosis. Journal of Molecular Endocrinology (2004) 33, 175–193

Introduction resorption has been suggested to contribute to GC-induced osteoporosis (Luckert & Kream 1996, Glucocorticoids (GCs) are used extensively for the Luckert 1997), it is now clear that the main treatment of autoimmune and inflammatory mechanism underlying long-term GC-induced diseases, including arthritis, asthma, multiple bone loss is the impairment of osteoblast function sclerosis, systemic lupus erythematosus, inflamma- and bone formation (Canalis 1996, Manolagas & tory bowel disease and chronic active hepatitis. In Weinstein 1999, Rubin & Bilezikian 2002). addition, GCs are used in combination with other Regarding their adverse effects on osteoblasts, drugs to reduce inflammation associated with GCs have been reported to attenuate cell hematologic and other cancers, and to suppress the proliferation and differentiation, promote apop- immune system following organ transplantation. tosis, abrogate collagen metabolism, interfere with Perhaps the most disturbing side effect of GC the autocrine/paracrine action of insulin-like treatment is rapid bone loss and increased risk of growth factor-I and bone morphogenetic protein-2 fracture (Van Staa et al. 2000). Although bone (BMP-2), and inhibit the bone-specific transcription

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 176 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

factor Runx2 (Chen et al. 1983, Delany et al. 1995a, exception of those shown in Fig. 1, where cells Linkhart et al. 1996, Lian et al. 1997, Rogatsky et al. were plated in 12-well plates (25 000 cells/well). 1997, Chang et al. 1998, Weinstein et al. 1998, Cultures were maintained in -MEM (Invitrogen Luppen et al. 2003b). While some of these effects, Corp., Carlsbad, CA, USA) containing 10% such as the induction of apoptosis, were demon- FBS (Invitrogen Corp.) and 1·5% penicillin- strated in vivo, most of the studies were performed streptomycin (Invitrogen Corp.). To support differ- in vitro, alas under conditions that do not fully entiation, 50 µg/ml ascorbic acid (Sigma) and recapitulate the inhibitory action of GCs on the 10 mM -glycerophosphate (Sigma) were added to ultimate osteoblast phenotype – deposition of confluent cultures and the medium was then mineralized extracellular matrix. In fact, in many changed every other day. in vitro studies, GCs surprisingly stimulated osteoblast proliferation and function (Tenenbaum & Calcium deposition Heersche 1985, Bellows et al. 1987, Pockwinse et al. 1995). Inhibition of mineralized extracellular Calcium deposition was demonstrated by alizarin matrix formation by GCs was recapitulated in vitro red staining or quantitated using the Sigma using the MC3T3-E1 cell line and occurred only Diagnostics Kit 587 as previously described when GC treatment commenced prior to the (Luppen et al. 2003a,b). seventh day of culture (Lian et al. 1997). In our quest for molecular mechanisms under- Apoptosis lying GC-induced osteoporosis, we continued to employ the MC3T3-E1 culture model and Apoptosis was evaluated using either acridine identified a narrow developmental window during orange staining as previously described (Mandavilli which cells are susceptible to the adverse effect of & Rao 1996) or the Apopercentage dye (Biocolor, GCs. This window encompasses a commitment http://www.bicolor.co.uk). stage, occurring around the time of confluency, during which the cells undergo a uniquely RNA preparation and cRNA array hybridization regulated post-confluent cell cycle. Unlike cell cycle progression prior to confluency, the differentiation- Total RNA was isolated from control and related cell cycle is abrogated by GCs, concomitant DEX-treated cells using Trizol reagent (Invitrogen with the inhibition of mineralization. At the Corp.) according to the manufacturer’s instruc- commitment stage, GCs activate the enzyme tions, and further cleaned by two successive glycogen synthase kinase 3, a key negative phenol/chloroform extractions, followed by selec- regulator of the Wnt and other signaling pathways tive binding to a silica-gel-based membrane using (Smith et al. 2002). RNeasy spin columns (Qiagen). Double-stranded In order to gain further insights into molecular cDNA was synthesized from 10 µg total RNA using events associated with the adverse effects of GCs, an oligo-dT primer with a 5-T7 RNA polymerase we employed oligonucleotide microarrays to com- promoter sequence and the SuperScript II cDNA pare gene expression profiles between MC3T3-E1 synthesis kit (LifeTechnologies, Gaithersburg, MD, cultures that have just undergone commitment USA). The cDNA was phenol/chloroform ex- and those arrested by DEX. Here we discuss the tracted and recovered by ethanol precipitation. potential significance of the effects of DEX on Three micrograms double-stranded cDNA were subsets of these genes which encode transcription used for the synthesis of biotin-labeled cRNA factors, secreted proteins, receptors, signaling (Enzo Eukaryotic Gene Expression Labeling Kit; molecules, and metabolic enzymes. Affymetrix Inc., Sant Clara, CA, USA), which was hybridized to Affymetrix murine MG-U74Av2 gene chips (Affymetrix Inc., Santa Clara, CA, Materials and methods USA). Unbound cRNA was washed, and hybridized cRNA was labeled with a phycoerythrin- Cell culture streptavidin conjugate. Fluorescent hybridization MC3T3-E1 cells were plated in 100-mm dishes signals were detected using a Hewlett Packard (300 000 cells/plate) for all experiments with the GeneArray Scanner.

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 177

Microarray data analysis 5 mM MgCl2, 0·5 mM EDTA, 28% glycerol) Raw gene expression scores were generated for containing protease and phosphatase inhibitors every gene in every sample using GENECHIP (5 mM NaF, 0·1 mM Na3VO4, 5 µg/ml aprotinin, Software v5·0 (Affymetrix Inc.) with the default 5 µg/ml leupeptin, 1 mM dithiothreitol, 1 mM setups. To normalize the relative hybridization phenylmethylsulfonyl fluoride, 20 µM MG132). signal for each transcript, multiplicative scaling The cells were further subjected to successive passes factors were calculated based on the median through 18·5-, 20·5-, and 23-gauge needles, followed by centrifugation at 16 000 r.p.m. for intensity of the 60th to 95th percentile of gene expression scores. All scores were set to a minimum 30 min at 4 C to remove cell debris. The protein value of 100 to minimize noise associated with rare concentration in the cell extract was determined transcripts (Karaman et al. 2003). The averages using the Micro BCA Protein Assay (Pierce, of normalized data from three control and three Rockford, IL, USA) and 30 µg were subjected to DEX-treated samples were calculated, and only electrophoresis in a 10% polyacrylamide denatur- differences of at least 2·5-fold with P^0·05 (equal ating gel. The proteins were then transferred onto a variance two-tail t-test) are reported herein. nitrocellulose membrane and Krox20 was detected using specific antibodies (1:150 dilution) from Covance (Richmond, CA, USA) and the enhanced Reverse transcription and polymerase chain chemoluminescence system (Amersham). reaction (RT-PCR) The double-stranded cDNA from above was subjected to gene-specific PCR amplification to Results confirm expression results for selected genes. The Dexamethasone specifically inhibits cDNA was PCR-amplified (MJ Research Inc., mineralization when administration Waltham, MA, USA) in a total volume of 25 µl commences at a commitment stage associated containing 5 pmoles of each primer, 1 µCi with confluency [-32P]dCTP (Perkin Elmer Life Sciences Inc., Boston, MA, USA), 0·25 nmoles unlabeled dCTP, We utilized the MC3T3-E1 cell culture model, in 1·25 nmoles each of dATP, dTTP, and dGTP, and which GCs severely inhibit development of the 0·5 units Taq polymerase (Invitrogen Corp.). For osteoblast phenotype (Smith et al. 2000). As shown each of the analyzed genes, preliminary exper- by biochemical determination of calcium depo- iments were performed with increasing amounts of sition, DEX inhibited mineralization in a manner input cDNA to achieve close-to-linear conditions of strongly dependent on both the concentration signal/input ratio, and equal cDNA input for all and the timing of DEX administration (Fig. 1A). samples was based on amplification of ribosomal First, consistent with previous reports (reviewed by protein L10A (rpL10A) cDNA, which itself varied Ishida & Heersche 1998), DEX was inhibitory by less than 25% between samples. The PCR only at the pharmacological concentrations of 100 primers are listed in Table 1. The amplified PCR and 1000 nM, whereas 10 nM was stimulatory. products were resolved by electrophoresis in a 5% Secondly, DEX at 100 and 1000 nM had a polyacrylamide gel. Following drying, the gels were maximal inhibitory effect when administered exposed to a storage phosphor screen (Molecular commencing on day 3, as cells became confluent. Dynamics, Sunnyvale, CA, USA) and the signal Consistent with our previous work (Smith et al. associated with the products was measured using 2000), little or no inhibition was observed when Storm 840 Phosphor Analyzer and Image Quant DEX was administered after the cells had Software (Molecular Dynamics). committed to mineralization, around day 4. Most remarkably, exposure of the cultures to 100 or 1000 nM DEX commencing at early stages – prior Western blot analysis to confluency – rendered them resistant to the later Cells were washed and collected in phosphate- inhibitory potential of the drug at the same doses buffered saline, centrifuged, and pellets were (Fig. 1A). Moreover, the 100 nM dose, which was resuspended in 1·5 packed cell volume of lysis inhibitory when treatment commenced on days buffer (100 mM Hepes pH 7·5, 500 mM KCl, 2–4, was stimulatory when treatment commenced www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 178 ora fMlclrEndocrinology Molecular of Journal LECLERC N n others and Table 1 Primers and conditions used for RT-PCR

Accession Primers Annealing No. of Product size number (Top-forward; bottom: reverse) temp (°C) cycles (base pairs)

Gene osteoblasts DEX-treated of analysis Microarray · C-mer proto-oncogene U21301 58CAGTACAGCACACAGCATCC 55 29 402 58CTTTCCCACACGTGAGATATC

(2004) Cox-1 M34141 58CTCGACAACTACCAGTGTG 54 30 378 58CAGAAGCTGAACATCTGG Krox20 (early growth response 2) M24377 58ATCACAGGCAGGAGAGAGTC 65 28 554

33, 58AGGCTGTGGTTGAAGCTG

175–193 Enpp2 AW122933 58AGCTATTCGGAAATTCTGACCCTCA 58 30 245 58GGAGAAAAACAGCACAGTCATTCAG FK506 binding protein 5 (51 kDa) U16959 58ACATTTGATTGCCGAGATG 55 29 460 58ACTCTCGGAGCTTCAGGTAG Follistatin Z29532 58TCCACTTGTGTGGTGGATCAGACCA 58 30 543 58CAAAGGCTATGTCAACACTGAACAT Growth arrest speciﬁc 6 X59846 58AGAGGTGTTCGAGAACGAC 55 29 442 58GCAGAGGCAAGAGTAGGAG Haptoglobin M96827 58GAGTCATGCCTATCTGCCTGCCTTC 58 33 340 58ATCCCAGCTGCGTACCAGGTGTCCT Matrix metalloproteinase 13 X66473 58GATGACCTGTCTGAGGAAG 54 29 357 58ATCAGACCAGACCTTGAAG Procollagen, type VIII, alpha 1 X66976 58CTCTACAGCTGCTGGGAATAC 55 29 561 58TTCCAGGCATTCCATGAC RhoGAP8 (expressed sequence C78947) AI843580 58AGGTCTGACTGTGGCTTG 60 40 254 58GTCACTTTATACTCCCAGTCTG Downloaded fromBioscientifica.com at09/25/202108:14:17PM Ribosomal protein L10A U12403 58CGCCGCAAGTTTCTGGAGAC 61 29 327 58CTTGCCAGCCTTGTTTAGGC TGF inducible early growth response AF064088 58CGTCTAGTGTCTCAGTGCTC 55 29 490 58CTCTTTGAAAGGAGTGGC Thrombospondin 1 M62470 58CCTCATTTGTTGTGTGACTGAGTAA 58 30 566 58TTGTTGTTCCTTGTACATAAGAAAC Thrombospondin 2 L07803 58GAAGAATATTTTGTCCCTCTGGTGG 58 30 201 www.endocrinology.org 58TCCACAAAAATCTAAAAAGTGCAGG

Primers usually anneal with two adjacent exons, to conﬁrm lack of genomic DNA contamination. However, the primer pairs for Enpp2, Follistatin, Haptoglobin, and Thrombospondins 1 and 2 targeted the 38UTR sequences present on the microarray chip. via freeaccess Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 179

plated and treated in parallel to those used for the microarray analysis, is shown in Fig. 2C-F. Interestingly, the DEX-induced arrest was not associated with increased, but rather with decreased, apoptosis (Fig. 2G-J). In vitro inhibition of osteoblast apoptosis has been demonstrated by several investigators, although promotion of apoptosis in vivo and in vitro has been reported by others (reviewed by Zalavras et al. 2003). The total RNA collected from the day-6 cultures was interrogated by MG-U74Av2 gene chips (Affymetrix Inc.). Of the over 12 000 transcripts represented on the microarray, expression of the vast majority (99%) did not change by more than 2·5-fold (P^0·05) in response to DEX. In contrast, 74 genes were up-regulated and 17 were down-regulated by d2·5-fold (P^0·05). The expression levels of the 91 DEX-responsive genes, including 82 with known functions and 9 expressed sequence tags (ESTs), as well as the unedited list of raw data, are posted on our web site (http:// hacialab.usc.edu/supplement/frenkel, Tables S1, S2). The potential significance of some of these findings is discussed below. Figure 1 DEX inhibition of calcium deposition is dependent on the dose and the time of treatment commencement. MC3T3-E1 cells were plated (day 0) in Dexamethasone-responsive genes encoding 12-well plates and treated with 10, 100, or 1000 nM transcription factors DEX commencing on the indicated days. (A) Calcium deposition was biochemically quantitated on day 32. (B) DEX treatment altered by d2·5-fold the expres- Calcium deposition is demonstrated in day-13 cultures sion of zinc finger transcription factors (Krox20, by alizarin red staining. In panel B, [DEX]=1000 nM. Kruppel-like factor 13, transforming growth factor (TGF)- inducible early growth response), basic on day 0 or day 1 (Fig. 1A). Cultures treated with leucine-zipper DNA-binding proteins (CAAT/ 1000 nM DEX commencing on day 1 were less enhancer binding protein and , nuclear factor inhibited than those treated from day 2 or day 3. I/B), and a basic helix-loop-helix transcription Figure 1B presents an independent experiment factor (Drosophila period homolog) (Table 2). with 1000 nM DEX, demonstrating similar results of calcium deposition by alizarin red staining. Krox20 (Early growth response 2, Egr2) In order to identify genes that link the GC inhibitory activity at the commitment stage to the The Egr genes (Krox for the murine homologs) are abrogation of the osteoblast phenotype, we treated mitogen-inducible, immediate early genes encoding MC3T3-E1 cultures with 1000 nM DEX com- transcription factors with three zinc fingers. Egr mencing on day 3, and performed a comprehensive proteins control cell proliferation and differentia- gene expression analysis after 2·5 days. This tion in a variety of tissues including the brain and experimental design provides a comparison peripheral nerves, the vasculature, the kidney and between steady-state mRNA levels in osteoblasts the skeleton (McMahon et al. 1990, Sukhatme undergoing normal, uninterrupted differentiation 1992, Beckmann & Wilce 1997, Khachigian & and those not allowed to undergo commitment. Collins 1998). Although Krox20/Egr2 is expressed The morphological difference between differentiat- mainly in the adult thymus and in the embryonic ing and arrested cultures is demonstrated in central and peripheral nervous systems (Wilkinson Fig. 2A–B. Alizarin red staining of day-14 cultures, et al. 1989, Topilko et al. 1994), the gene is also www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 180 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

expressed in differentiating osteoblasts (Levi et al. 5·8-fold by DEX (Table 2) and this result was 1996). Krox20/Egr2 null mice have a severe conﬁrmed by RT-PCR (Fig. 3A). Furthermore, as osteoporotic phenotype, attributable to reduced demonstrated by Western analysis, DEX strongly bone formation (Levi et al. 1996). In our microarray reduced Krox20 protein levels in MC3T3-E1 analysis, Krox20/Egr2 mRNA levels were repressed cultures (Fig. 3B). Thus, decreased Krox20/Egr2 in response to GCs may contribute to bone loss by abrogating the transcriptional control of Krox20/ Egr2 target genes. Such targets may include the Biglycan, 1(I) and 2(I) Collagen genes, encoding components of the bone extracellular matrix, which have been shown to respond to another Krox family member, c-Krox (Galera et al. 1996, Heegaard et al. 1997). In addition, the decrease in Krox20/Egr2 may be involved in the DEX- induced up-regulation of Follistatin (Table 3, Fig. 4 and see below), which is negatively regulated by Krox20/Egr2 (Seitanidou et al. 1997).

TGF- inducible early growth response (Tieg, Kruppel-like factor 10) and Kruppel-like factor 13 (Klf13) DEX-treated MC3T3-E1 cells had 5·8-fold less Tieg mRNA compared with control cultures (Table 2) and the GC-mediated repression was conﬁrmed by RT-PCR (Fig. 4). Tieg encodes a member of the Sp1/Kruppel-like transcription factor family. Tieg was originally identiﬁed in human osteoblasts as a transcript that was rapidly induced by TGF- (Subramaniam et al. 1995) and was later shown to be stimulated, albeit to a lesser extent, by other TGF- family members including activin and BMPs (Hefferan et al. 2000). Thus, the decreased Tieg mRNA levels may result from abrogated BMP signaling in the DEX-treated cultures as suggested by our previous (Luppen et al. 2003b) and current studies (see below). In contrast to Tieg, another Sp1/Klf mRNA encoding Klf13

Figure 2 The effects of DEX on cell morphology and apoptosis. MC3T3-E1 cells were plated (day 0) in 100-mm plates and treated with 1000 nM DEX commencing on day 3. (A, B) Brightfield micrographs of day-5 cultures (×200). (C, D) Micrographs of alizarin red-stained cultures on day 14 (×200). (E, F) Scans of the same stained plates. (G, H) Acridine orange staining of day-14 cultures. Bright nuclei denote cells undergoing apoptosis. (I, J) Apopercentage staining of cells undergoing apoptosis on day 7; reproduced with permission from CRC Press (Zalavras et al. 2003). Several stained cells are indicated by arrows. This method is based on the flip-flopping of plasma membrane phosphatidylserine (Biocolor).

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 181

Table 2 Transcription factor genes altered by DEX. Data are means±S.E.M. (n=3). Only genes altered by ≥2·5-fold are listed

Fold induction/ Accession Affymetrix repression no. identification Control DEX by DEX Gene Period homolog (Drosophila) AF022992 93619_at 236±17 1116±50 4·7 CCAAT/enhancer binding protein X61800 160894_at 1101±57 4881±239 4·4 (C/EBP), Nuclear factor I/B Y07685 160859_s_at 619±29 2199±83 3·6 Zinc finger protein 99 U62906 104010_at 116±16 389±45 3·3 Kruppel-like factor 13 (Klf13) AW125783 160617_at 912±137 2758±187 3·0 CCAAT/enhancer binding protein M61007 92925_at 2136±203 6083±237 2·8 (C/EBP), TGF- inducible early growth AF064088 99603_g_at 703±144 120±21 −5·8 response (Tieg) Early growth response 2 (Egr2/Krox20) M24377 102661_at 1028±189 177±38 −5·8 was up-regulated 3·0-fold by DEX (Table 2). Klf13 mRNA level was increased by 3·1-fold (Table 3) is a positive regulator of erythropoiesis (Asano et al. and this increase, possibly related to the suppres- 2000), and is also expressed in the skeleton during sion of Krox20/Egr2 (see above), was confirmed mouse development (Martin et al. 2001). The role by RT-PCR (Fig. 4). The mRNA for Dan (aka of Klf13 in osteoblasts, and its possible involvement neuroblastoma suppressor of tumorigenicity 1) was in the effects of GCs in these cells, remains to be increased by 3·3-fold (Table 3). Since both explored. follistatin and Dan bind to and inactivate BMPs (reviewed by Canalis et al. 2003), and since BMPs are required for osteoblast differentiation in vitro Dexamethasone-responsive genes encoding and control bone mass in vivo (Yamaguchi et al. cell surface and secreted proteins 1991, Sampath et al. 1992, Yamaguchi et al. 2000, Follistatin and Dan (Differential screening-selected gene Xiao et al. 2002, Styrkarsdottir et al. 2003, Yang aberrant in neuroblastoma) et al. 2003), the stimulation of Follistatin and Dan DEX stimulated the expression of two genes mRNAs may contribute to GC-induced osteo- encoding secreted BMP antagonists. Follistatin porosis. We have recently shown that GC- inhibition of MC3T3-E1 osteoblast differentiation was also associated with a 100-fold decrease in Bmp-2 gene expression, and that addition of recombinant BMP-2 rescued the osteoblast phenotype (Luppen et al. 2003a,b). The GC-mediated repression of Bmp-2 was not disclosed by the microarray analysis because the overall level of its mRNA was close to the background noise level of Figure 3 DEX represses the transcription factor the microarray assay. The relationship between the Krox20/Egr2 at the mRNA and protein levels. down-regulation of Bmp-2 and the up-regulation of MC3T3-E1 cells were plated (day 0) in 100-mm plates and treated with 1000 nM DEX commencing on day 3. Follistatin and Dan remains to be explored. (A) RT-PCR analysis of Krox20/Egr2 mRNA in representative cultures treated for 60 h with either DEX or vehicle. Ribosomal protein L10A (rpL10A) serves as Thrombospondins control. (B) Western blot analysis of Krox20 in DEX increased the mRNA levels for Thrombospondin representative cultures treated for 72 h. The top panel shows the 56 kDa band representing Krox20 and the 1 and 2 by 5·3-fold and 2·9-fold respectively (Table bottom panel shows two non-specific bands of 63 and 3), and these results were confirmed by RT-PCR 68 kDa demonstrating equal loading. (Fig. 4). Thrombospondins are non-collagenous www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 182 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

Table 3 Genes for cell surface and secreted proteins altered by DEX. Data are means±S.E.M. (n=3). Only genes altered by ≥2·5-fold are listed

Fold induction/ Accession Affymetrix repression no. identiﬁcation Control DEX by DEX Gene Haptoglobin M96827 96092_at 272±81 2180±327 8·0 Integrin binding sialoprotein (Bsp) L20232 100476_at 1143±838 8410±809 7·4 Ectonucleotide pyrophosphatase/ AW122933 97317_at 205±69 1408±90 6·9 phosphodiesterase 2 (Enpp2) Collagen, type VIII, alpha 1 X66976 100308_at 1161±256 6909±471 6·0 Thrombospondin 1 M62470 160469_at 915±121 4881±185 5·3 Matrix metalloproteinase 13 (collagenase 3) X66473 100484_at 2241±1152 11601±558 5·2 Cysteine-rich protein 61 (Cyr61) M32490 92777_at 942±102 3325±582 3·5 Neuroblastoma, suppression of D50263 101969_at 486±61 1584±14 3·3 tumorigenicity 1 (Dan) A disintegrin and metalloproteinase D50411 92414_at 140±31 445±48 3·2 domain 12 (Adam12) Follistatin Z29532 98817_at 938±428 2929±258 3·1 Thrombospondin 2 L07803 94930_at 1203±364 3500±85 2·9 Collagen, type XI, alpha 1 D38162 100481_at 645±106 1853±331 2·9 Chondroitin sulfate proteoglycan 2 D45889 100019_at 708±106 1758±165 2·5

secreted glycoproteins that associate with the motility, proliferation, apoptosis, differentiation, extracellular matrix, but do not appear to cytoskeletal organization and transcriptional regu- contribute directly to tissue integrity. Rather, the lation by modulating the assembly of cell surface proteins inﬂuence cell functions such as adhesion, multi-protein complexes. The two Thrombospondin genes are expressed with different developmental and spatial patterns (Iruela-Arispe et al. 1993, Tooney et al. 1998). Thrombospondin 1 is widely expressed and is involved in cytoskeletal organization during tissue repair, possibly mediating some of the effects of TGF-1 (reviewed by Chen et al. 2000). Thrombospondin 2 has a more restricted expression pattern and is synthesized primarily in connective tissues (reviewed by Bornstein et al. 2000). Both thrombospondin 1 and 2 are found in sites of new bone formation and both are produced by cultured osteoblasts (Robey et al. 1989, Carron et al. 1999). Although Thrombospondin 1 mRNA level was shown to increase during MC3T3-E1 culture progression (Sherbina & Bornstein 1992), thrombospondins seem to negatively regulate osteogenesis, based on the increase in osteoblast number, endosteal bone formation and cortical Figure 4 RT-PCR analysis. Expression level of the bone thickness observed in Thrombospondin 2 indicated genes was quantitated in day-6 MC3T3-E1 knock-out mice (Hankenson & Bornstein 2002). cultures by RT-PCR using primers listed in Table 1. Therefore, the GC-induced Thrombospondin mRNA Shown are results from a representative DEX-treated and a representative control culture. The arrow indicates levels may contribute to bone loss in vivo. the Tieg cDNA amplicon. Ribosomal protein L10A Furthermore, because both thrombospondin 1 and (rpL10A) ampliﬁcation serves as internal control. 2 inhibit angiogenesis (reviewed by Bornstein 2000

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 183 and by Chen et al. 2000), their stimulation by GCs represented on the microarray (Table S2; http:// may compromise the perfusion to bone and other hacialab.usc.edu/supplement/frenkel), DEX al- organs, and contribute to GC-induced apoptosis tered the expression of only one gene, Mmp13, in vivo. which was increased by 5·2-fold (Table 3). This increase was confirmed by RT-PCR (Fig. 4) and is consistent with previous reports (Shalhoub et al. Collagens 1992, Delany et al. 1995b). Induction of Mmp13 Ninety percent of the organic bone matrix is mRNA may contribute to GC-induced osteo- collagen, mostly type I. GCs are known to inhibit porosis by interfering with collagen type I the expression of type I collagen genes in several homeostasis and should also be considered in the cell types (reviewed by Kucharz 1988), including context of GC treatment of arthritis patients, given osteoblasts (Choe et al. 1978, Delany et al. 1995a, the high affinity of Mmp13 for type II collagen Mahonen et al. 1998, Luppen et al. 2003b). In the (Knauper et al. 1996). present study, the genes encoding the 1(I) and the 2(I) Collagen chains were inhibited by 1·9- fold and 1·7-fold respectively (Table S2; http:// A disintegrin and metalloprotease domain 12 (Adam 12) hacialab.usc.edu/supplement/frenkel), missing the Adam12 gene expression was up-regulated 3·2-fold 2·5-fold cutoff set for the initial analysis of the by DEX (Table 3). Adams are membrane- microarray data. It is noteworthy that GCs further anchored cell surface glycoproteins involved in inhibit osteoblast collagen synthesis at the protein cell fusion, cell adhesion, proteolysis and subse- level (Luppen et al. 2003b). quent signaling. In MC3T3-E1 cultures, Adam12 is In contrast to type I collagen chains, DEX highly expressed prior to confluency and is down- increased the mRNA levels for 1(VIII) and 1(XI) regulated immediately thereafter and through- Collagen chains by 5·9-fold and 2·9-fold respectively out differentiation (Inoue et al. 1998). It remains (Table 3). 1(VIII) Collagen was further tested by to be seen whether persistence of Adam12 RT-PCR analysis, which confirmed the microarray mRNA contributes to GC-inhibition of osteoblast data (Fig. 4). Type VIII collagen, a short-chain differentiation. network-forming collagen prominently expressed by endothelial cells of the vasculature and the Descemet’s membrane of the cornea, is also found Ectonucleotide pyrophosphatase/phosphodiesterase 2 in newborn mouse calvaria and skin (Muragaki (Enpp2) et al. 1992). Type XI collagen, a fibril-forming Enpps exist as both membrane and soluble collagen, is also expressed in the cornea but is proteins, and are expressed in cells from most mainly found in cartilage, where it copolymerizes tissues, including osteoblasts (Goding et al. 1998). with type II collagen and regulates chondrocyte They hydrolyze phosphodiester bonds in nucle- differentiation and spatial organization of the oside triphosphates, leading to the generation of growth plate (Li et al. 1995). The potential impact inorganic pyrophosphate, a physiologic calcifica- of increased collagens type VIII and XI on the tion inhibitor (Bollen et al. 2000, Terkeltaub 2001, physiological assembly of the bone extracellular Johnson et al. 2003). Enpp2 mRNA level was matrix remains to be explored. It would also be up-regulated several-fold in response to DEX interesting to test whether GCs induce collagens (Table 3, Fig. 4), potentially contributing to the type VIII and XI in the cornea, because this could decreased accumulation of calcium (Figs 1 and 2). provide an insight into GC-induced glaucoma Besides its role in regulating pyrophosphate levels, (Schacke et al. 2002). Enpp2 is also involved in the synthesis of lysophosphatidic acid (Tokumura et al. 2002), which can promote osteoblast proliferation and Matrix metalloproteinase 13 (Mmp13, aka survival (Grey et al. 2001, 2002). While opposite collagenase 3) actions of DEX apparently override the mitogenic Collagens are primarily degraded by collagenases, potential of Enpp2, the putative increase in specific proteinases of the matrix metallo- lysophosphatidic acid may help explain the proteinases (MMP) family. Among all the MMPs inhibition of apoptosis observed in DEX-treated www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 184 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

MC3T3-E1 (Fig. 2) and other osteoblastic cell Integrin binding sialoprotein (aka bone cultures (Zalavras et al. 2003). sialoprotein, Bsp) Consistent with previous reports (Ogata et al. 1995, Cysteine-rich protein 61 (Cyr61) Chen et al. 1996), DEX stimulated Bsp gene The gene encoding Cyr61 is a growth factor- expression by 7·4-fold (Table 3). Bsp is a late inducible immediate early gene. Its product is an marker for osteoblast differentiation, and the gene extracellular matrix-associated signaling protein product constitutes approximately 12% of the that promotes cell proliferation, migration and non-collagenous bone extracellular matrix proteins adhesion (Kireeva et al. 1996, Yang & Lau 1991). (reviewed by Ganss et al. 1999). It stimulates Unexpectedly, our microarray analysis indicated a osteoblastic cell adhesion and proliferation (Mintz 3·5-fold DEX-mediated increase in Cyr61 mRNA et al. 1993, Zhou et al. 1995) and has been proposed level (Table 3). Cyr61 is expressed during to function in the initiation of hydroxyapatite embryogenesis of the circulatory system and the crystal formation (Hunter & Goldberg 1993). Given cartilaginous skeleton (O’Brien & Lau 1992). Cyr61 the general inhibitory effect of DEX on the mRNA has been detected in human osteoblasts osteoblast phenotype, including the down- (Schutze et al. 1998, Lechner et al. 2000), and is regulation of other late differentiation markers up-regulated by cytokines such as tumor necrosis such as osteocalcin (Lian et al. 1997, Luppen et al. factor (TNF)- and interleukin (IL)-1, which are 2003b), the stimulation of Bsp mRNA level is important stimulators of bone resorption (Schutze somewhat surprising. While it cannot explain the et al. 1998). Interestingly, Cyr61 was the most inhibition of the osteoblast phenotype in this study, up-regulated gene in a microarray analysis of mice it may explain the positive effect that GCs have fed with cadmium, an in vivo model for cadmium- on cultured osteoblasts under different conditions induced osteoporosis (Regunathan et al. 2003). It is (Tenenbaum & Heersche 1985, Bellows et al. 1987, possible that osteoblast-derived Cyr61 contributes Leboy et al. 1991, Shalhoub et al. 1992). to the increased bone resorption observed in the initial phase of GC-induced osteoporosis. Dexamethasone-responsive genes involved in signal transduction Acute phase proteins Protein kinases and phosphatases The microarray analysis revealed the stimulation by DEX of five genes encoding proteins with Our microarray analysis revealed d2·5-fold known functions in the immune system: hapto- alteration in the mRNA levels for nine protein globin, orosomucoid 1 and 2, the Ia-associated kinases and phosphatases in response to DEX. The invariant chain of the major histocompatibility data provide evidence for increases in both protein complex class II, and sterile alpha motif domain tyrosine kinases and phosphatases, and for a and hydrolase domain-containing protein 1 (Table decrease in MAP kinase (MAPK) activity. S2; http://hacialab.usc.edu/supplement/frenkel). Of these, the first three are known as acute phase Protein tyrosine phosphatase (PTP) non-receptor type 16 proteins, and they were induced by 8·0-, 17·8-, (Ptpn16) and 5·3-fold respectively (Table 3 and Table S2; http://hacialab.usc.edu/supplement/frenkel). PTPs are either membrane receptors or non- Notably, a structural role for orosomucoid 1 in receptor proteins. DEX increased the expression of bone was suggested based on its presence in bone Ptpn16 mRNA level by 4·4-fold (Table 4). Ptpn16 is extracts (Mbuyi et al. 1982). Haptoglobin was an immediate early gene that encodes the PTP shown to affect bone cells in an organ culture non-receptor MAPK phosphatase-1 (MKP-1), system, probably through induction of prostanoids also called dual specificity phosphatase 1 for its (Lerner & Frohlander 1992). Specifically, treatment ability to dephosphorylate both phospho-tyrosines with haptoglobin resulted in higher levels of and phospho-threonines (Keyse & Emslie 1992). prostaglandin (PG) E2 and increased bone resorp- MKP-1 inactivates MAPKs (Alessi et al. 1993), tion. The GC-stimulation of osteoblastic Haptoglobin and GCs have previously been shown to mRNA level was confirmed by RT-PCR (Fig. 4). inhibit MAPKs by elevating Mkp-1 mRNA level

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 185

Table 4 Genes for signaling molecules altered by DEX. Data are means±S.E.M. (n=3). Only genes altered by ≥2·5-fold are listed

Fold induction/ Accession Affymetrix repression no. identiﬁcation Control DEX by DEX Gene C-mer proto-oncogene U21301 92698_at 208±55 1051±83 5·0 Growth arrest speciﬁc 6 (Gas6) X59846 99067_at 1639±173 7978±598 4·9 Cdc42 guanine nucleotide exchange factor AI647003 100958_at 342±102 1584±151 4·6 9-like (EST C79050) Protein tyrosine phosphatase, non-receptor X61940 1004598_at 192±16 850±126 4·4 type 16 (Ptpn16) Leukemia inhibitory factor receptor D17444 104658_at 166±16 727±42 4·4 Rho GTPase-activating protein 8 (expressed AI843580 103511_at 100±0 321±45 3·2 sequence C78947) Fibroblast growth factor receptor 2 M63503 93091_s_at 1271±194 3789±393 3·0 p21 Ras GTPase-activating protein 3 U20238 93319_at 714±94 1947±184 2·7 (p21 Rasgap3) Aplysia ras-related homolog B (RhoB) X99963 101030_at 1127±126 3002±142 2·7 Portein tyrosine phosphatase, receptor type, D13903 93896_at 151±50 387±54 2·6 D (PtpD) Rho guanine nucleotide exhange factor 5 AA726063 160977_at 274±40 100±0 −2·7 (Rhogef5)

in ﬁbroblasts and mast cells (Kassel et al. 1996). Because signals mediated by these receptors 2001). Moreover, a recent study linked MKP-1 contribute to osteoblast proliferation and differen- up-regulation to the GC-inhibition of osteoblast tiation (Canalis 1985), increased RptpD expression proliferation (Engelbrecht et al. 2003), and admin- may adversely affect osteoblast function. istration of the tyrosine phosphatase inhibitor sodium orthovanadate prevented bone loss in C-mer proto-oncogene and Growth arrest speciﬁc 6 GC-treated rats (Hulley et al. 2002). The MAPK (Gas6) pathway plays a role in osteoblast differentiation by potentiating BMP signaling (Suzawa et al. 2002), Along with the increase in PTP mRNA levels, parathyroid hormone/parathyroid hormone- DEX also stimulated the genes encoding C-mer, a related peptide (PTH/PTHrP) signaling (Carpio receptor tyrosine kinase, and its ligand, Gas6 et al. 2001, Miao et al. 2001), and by phosphorylat- (Nagata et al. 1996, Chen et al. 1997). The 5·0-fold ing and activating the osteoblast master regulator stimulation of both genes (Table 4) was supported Runx2 (Xiao et al. 2000). Thus, DEX stimulation of by RT-PCR (Fig. 4). Gas6 is a member of the Ptpn16 mRNA probably plays an important role in vitamin K-dependent family of growth factors, and GC-induced osteoporosis. has mitogenic, survival and adhesive properties in a variety of normal and cancer cell types (Goruppi et al. 1996, Li et al. 1996, Nakano et al. 1996, Receptor protein tyrosine phosphatase type D (RptpD) Yanagita et al. 2001, Funakoshi et al. 2002, Shankar DEX also increased RptpD mRNA level by 2·6-fold et al. 2003). These effects are probably mediated (Table 4). RptpD belongs to the leukocyte antigen through interactions with members of the Axl related (LAR) family of protein tyrosine phos- family of kinases, including C-mer (Varnum et al. phatases (Mizuno et al. 1993). Although RptpD ex- 1995, McCloskey et al. 1997). Because Gas6/Axl pression is largely restricted to the brain, our data signaling has been shown to inhibit osteogenic demonstrate that it is also expressed in osteoblasts. differentiation of vascular pericytes (Collett et al. Known substrates for LAR phosphatases include 2003), it is possible that the DEX-induction of Gas6 the insulin receptor and the epidermal growth and C-mer mRNA levels plays a role in GC-induced factor receptor (Hashimoto et al. 1992, Zhang et al. osteoporosis. www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 186 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

Fibroblast growth factor tyrosine kinase receptor 2 (Fgfr2) (see above) and the up-regulation of p21 Rasgap3, DEX increased the level of Fgfr2 mRNA by could severely compromise osteoblast function. 3·0-fold (Table 4). Fgfr1–4 binds fibroblast growth factor (FGF), leading to cell growth, differentiation, RhoB and Rho regulators migration and chemotaxis (reviewed by Galzie et al. DEX increased RhoB mRNA level by 2·7-fold 1997) and the Fgfr2 gene is expressed during (Table 4). Despite this increase, our results suggest osteogenesis in vivo (Eswarakumar et al. 2002). that overall Rho signaling is probably decreased in However, increased Fgfr2-mediated signaling could DEX-treated cells, because the Rhogef5 mRNA level be detrimental to bone through mechanisms similar was decreased by 2·7-fold and the Rhogap8 mRNA to those operative in patients with Crouzon, Apert level was increased by 3·2-fold. The increase in and Pfeiffer syndromes, who have constitutively Rhogap8 expression was confirmed by RT-PCR active mutant forms of Fgfr2 (Mansukhani et al. (Fig. 4). Rho belongs to the Rho/Rac/Cdc42 2000). family, which regulates the organization of the actin cytoskeleton at focal adhesions, and in Small G proteins and their regulators filipodia and lamellipodia. Therefore, the decrease Of the 91 genes that responded to DEX by in Rho signaling may be related to the morphologi- d2·5-fold, 22 are involved in intracellular signal- cal arrest of DEX-treated MC3T3-E1 cultures in ing, and of these, five are small G proteins or their the so-called cobblestone stage (Fig. 2B). regulators. Small G proteins (also called small GTP binding proteins or small GTPases) are divided into EST C79050 (Cdc42 gef9-like gene) five families: Ras, Rho/Rac/Cdc42, Rab, Sar1/ Unlike the inhibition of Rhogef5, DEX stimulated Arf, and Ran (reviewed by Takai et al. 2001). the expression of a Cdc42 gef9-like gene by 4·6-fold By transducing upstream signals to downstream (Table 4). Thus, whereas Rho and Ras signaling effectors, small G proteins serve as molecular are probably attenuated in DEX-treated cells, switches that regulate processes as diverse as Cdc42-dependent pathways might in fact be cytoskeletal reorganization, intracellular vesicle stimulated. This result is somewhat surprising trafficking, nucleocytoplasmic transport and gene because another Cdc42 gef gene, Fgd1, is specifically expression. In the absence of activating signals, expressed in calcified tissues (Gorski et al. 2000), small G proteins are found in their inactive, where it might contribute to bone cell differentia- GDP-bound form. Upon stimulation, GDP is tion through activation of c-jun N terminal kinase exchanged for GTP, a process controlled by (Zheng et al. 1996). specific guanine exchange factors (GEFs), leading to activation of the downstream effector(s). The signal transduction is terminated by the intrinsic Dexamethasone-responsive genes encoding GTPase activity of the small G proteins, which is metabolic enzymes under the control of specific GTPase activating Prostaglandin-endoperoxide synthase 1 (aka proteins (GAPs). cyclooxygenase 1, Cox1) The two Cox enzymes, Cox1 and Cox2, are p21 Rasgap3 integral membrane proteins which localize pri- DEX increased p21 Rasgap3 mRNA level by marily to the endoplasmic reticulum, and function 2·7-fold (Table 4), which can be expected to inhibit in PG biosynthesis. Cox1 is constitutively expressed Ras signaling and the downstream MAPK and and is thought to be involved in cell signaling and phosphatidylinositol 3-kinase pathways (reviewed tissue homeostasis. Cox2 is expressed in a limited by Takai et al. 2001). As mentioned above, MAPKs number of cell types and is probably responsible for contribute to osteoblast differentiation by support- prostanoid biosynthesis in response to mitogens and ing the actions of BMPs, PTH, PTHrP and Runx2 pro-inflammatory factors (reviewed by Smith et al. (Xiao et al. 2000, Carpio et al. 2001, Miao et al. 1996). The microarray analysis indicated a 2·8-fold 2001, Suzawa et al. 2002). The DEX-mediated DEX-mediated decrease in Cox1 mRNA level inhibition of the MAPK pathway, both via MKP-1 (Table 5), and this result was confirmed by

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 187

Table 5 Metabolic enzyme genes altered by DEX. Data are means±S.E.M. (n=3). Only genes altered by ≥2·5-fold are listed

Fold induction/ Accession Affymetrix repression no. identiﬁcation Control DEX by DEX Gene Aldehyde dehydrogenase family 1, M74570 100068_at 100±0 578±97 5·8 subfamily A1 Glutamine synthetase U09114 94852_at 158±29 753±164 4·8 Glutamate-cysteine ligase, catalytic subunit U85414 99649_at 269±28 959±62 3·6 Pyruvate dehydrogenase kinase 4 AJ001418 102049_at 718±66 2541±132 3·5 Hydroxysteroid 17- dehydrogenase 11 AA822174 102370_at 930±40 3181±88 3·4 Xanthine dehydrogenase X75129 97950_at 558±95 1898±80 3·4 Galactokinase AV217354 161363_r_at 210±55 595±42 2·8 Ferredoxin reductase D49920 92754_at 376±50 1061±76 2·8 Cytochorome P450, 1b1, benz[a]anthracene X78445 99979_at 1128±346 2871±315 2·5 inducible Carnitine palmitoyltransferase 1, liver AF017175 93320_at 1018±116 395±66 −2·6 Prostaglandin-endoperoxide synthase 1 M34141 95597_at 338±31 123±19 −2·8 (Cox-1) RIKEN cDNA 2610002H19 gene AV069997 162469_at 4556±310 1508±436 −3·0 (cytochrome c-1) Platelet-activating factor acethylhydrolase, U57746 100576_at 828±130 250±36 −3·3 isobform 1b, 1

RT-PCR (Fig. 4). Cox2 mRNA level was decreased and activity in GC-treated cultures of normal by 2·1-fold, less than our 2·5-fold cutoff (Table S2; human osteoblast-like and osteosarcoma cells http://hacialab.usc.edu/supplement/frenkel). Both (Nawata et al. 1995). Ferredoxin reductase, a Cox1 and Cox2 genes are known to be expressed in component of the mitochondrial electron transport osteoblastic cells, in association with osteogenesis chain, is involved in the ﬁrst step of steroid (Sato et al. 1997), and PGs are known to contribute synthesis. Hydroxysteroid 17- dehydrogenase is to BMP signaling (Chikazu et al. 2002) and bone also expressed in bone cells (Sasano et al. 1997, formation (as well as resorption) (reviewed by Raisz Eyre et al. 1998), where it converts estrone 1999 and by Pilbeam et al. 2002). Thus, produced by Cyp1B1 to estradiol. Given the down-regulation of Cox genes in osteoblasts could well-established anti-apoptotic properties of estro- contribute to the GC-mediated inhibition of gens in osteoblasts (Gohel et al. 1999, Manolagas osteoblast function and bone formation. et al. 2002), the putative stimulation of estradiol synthesis may help explain the unexpected Steroidogenic enzymes inhibition of apoptosis in GC-treated osteoblast cultures (Fig. 2G–J and Zalavras et al. 2003). In DEX induced the expression of three genes addition, GC-induced estradiol synthesis may involved in the synthesis of steroid hormones: contribute to the attenuation of bone resorption cytochrome P450 1b1 (2·6-fold), Ferredoxin reductase and the low bone turnover seen after long-term GC (2·8-fold), and Hydroxysteroid 17- dehydrogenase 11 treatment. (3·4-fold), (Table 5). Cytochrome P450 1b1 (Cyp1B1) is involved in the metabolism of diverse substrates including steroids, fatty acids and Additional genes altered by DEX xenobiotics. The gene is broadly expressed in bone (Sasano et al. 1997, Eyre et al. 1998), where it is FK506 binding protein 5 (aka Fkbp51) responsible for the local production of estrogens The transcript encoding Fkbp51 was induced (Nawata et al. 1995). The up-regulation of Cyp1B1 is 7·0-fold after DEX treatment, and this result was consistent with the reported increase in its mRNA conﬁrmed by RT-PCR (Fig. 4). Fkbp51 is a www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 188 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

member of the immunophilin protein family and is and Dan. DEX could also have inhibited BMP involved in protein folding and trafficking, includ- action through parallel pathways known to interact ing the nuclear transport of the GC receptor with BMP signaling. For example, DEX increased following ligand binding (Davies et al. 2002). Fkbp51 the expression of the genes encoding p21 Rasgap3 mRNA is abundant in T cells and thymus, and and the PTPs Ptpn16 and RptpD. These effects increases during GC-induced apoptosis of murine probably result in the inhibition of the MAPK thymoma cells (Baughman et al. 1995). The gene pathway, which is known to synergize with product also selectively accumulates during adipo- Smad-mediated BMP signaling and to transmit genesis (Yeh et al. 1995). Noteworthy, the decrease Smad-independent signals (Lou et al. 2000, Gallea in bone volume in GC-induced osteoporosis is et al. 2001, Lai & Cheng 2002, Suzawa et al. 2002, accompanied by increased marrow fat (Meunier Hassel et al. 2003). In addition, the DEX-induced et al. 1971, Burkhardt et al. 1987, Nuttall & Gimble decrease in Cox mRNA levels can be expected to 2000). Thus, the increase in Fkbp51 mRNA level inhibit BMP signaling because PGs, the products of may reflect a GC-induced switch from an osteo- Cox activity, support BMP action (Chikazu et al. blastic to an adipocytic phenotype (Wang et al. 2002). Evidence for abrogated BMP signaling in 1977, Nuttall et al. 1998). the GC-treated cultures is provided by the 5·8-fold decreased expression of Tieg, a BMP-responsive gene (Hefferan et al. 2000). Discussion Along with the alterations that may contribute to osteoblast dysfunction, the expression of several This study provides an extensive profile of the genes was inconsistent with the overall adverse effect alterations in gene expression that occur when GCs of GCs. For example, DEX stimulated the expres- block the progression of MC3T3-E1 osteoblast sion of genes involved in the synthesis of estrogens, cultures through a commitment stage around the known to promote osteoblast differentiation and time of confluency. While some of the disclosed preserve bone mass (Qu et al. 1998, Gohel et al. 1999, genes have previously been described as GC- Manolagas et al. 2002). Cyr61, an extracellular responsive (e.g. Mmp13, Serum/GC-regulated kinase, matrix-associated protein that promotes cell pro- Tieg, Fkbp51), the response of many others, such as liferation (Kireeva et al. 1996), was also induced by Krox20/Egr2, Thrombospondin 1 and 2, and Follistatin, DEX, as was Bsp, a late marker for osteoblast is described here for the first time. Based on these differentiation (Mintz et al. 1993, Zhou et al. 1995). data, several potential mechanisms by which GCs Indeed, GCs can either stimulate or suppress impair osteoblast function and induce osteoporosis osteoblast function in vitro, depending on their con- can be proposed. centration, the specific culture system and the The strong repression of Krox20/Egr2 in GC- administration protocol. We performed our micro- treated cells, shown here at both the mRNA and array analysis under conditions where the adverse protein levels, most likely contributes to GC- effects apparently override the stimulatory ones. induced osteoporosis, because Krox20 gene ablation This study employed a cell line, MC3T3-E1, a in the mouse leads to osteoblast insufficiency and novel culture system in which GCs inhibit bone loss (Levi et al. 1996). Decreased Krox20 commitment to the ultimate osteoblast phenotype, mRNA levels could result in decreased collagen i.e. elaboration of mineralized extracellular matrix. synthesis (Galera et al. 1996) and may also This inhibitory effect is associated with alterations contribute to the observed increase in the mRNA in pathways, which critically contribute to bone for Follistatin, a BMP antagonist negatively health in vivo, including the Wnt (Smith et al. 2002) regulated by Krox20 (Seitanidou et al. 1997). and the BMP signaling pathways (Luppen et al. BMP signaling plays a key role in regulating 2003b). Furthermore, some GC-responsive genes bone mass and skeletal integrity (Styrkarsdottir et al. identified in the present study (e.g. Krox 20/Egr2 2003). Taken together, a number of changes and thrombospondin 2) have been directly linked to observed following DEX treatment can be bone health in vivo. However, extrapolation of expected to ultimately inhibit BMP signaling. Most observations made in the MC3T3-E1 cell line to directly, DEX increased the expression of genes GC-induced osteoporosis will require careful encoding the secreted BMP antagonists, Follistatin studies with other osteoblast culture systems,

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 189 animal models and/or human bone biopsies, which Two of the most attractive potential mechanisms will have to demonstrate, for example, similar emerging from this study are the suppression alterations in gene expression in vivo and a role for of Krox20/Egr2 and the abrogation of BMP these alterations in mediating the adverse effects of signaling. GCs on bone mass and quality. Analysis of gene expression using microarrays suffers a number of inherent limitations. First, by Supplemental material setting our cutoff to a 2·5-fold change, we filtered out some smaller, yet possibly important effects. Supplemental material, including the complete set Such appears to be the case for the mRNAs of raw microarray data and the list of the 91 genes encoding the type I collagen chains, which were most responsive to DEX, is available online at down-regulated by only 1·7- to 1·9-fold in the http://hacialab.usc.edu/supplement/frenkel. DEX-treated cultures. A second obvious limitation is that the microarray analysis is confined to the RNA level. This limitation too is well demonstrated Acknowledgements by the inhibition of type I collagen gene expression, which reaches a factor of 4- to 10-fold when The authors thank Dr Jack Turman (University of measured in the same cultures at the protein level Southern California) for generously providing the (Luppen et al. 2003b). Thirdly, we only reported Krox20 antibodies. The authors are also grateful robust effects (d2·5-fold, P^0·05) for genes whose to Vijaya Rao, Sara Martinez and Jack Chen for expression levels were above a predetermined their contribution to the calcium assays and the threshold (see Materials and methods). Along with RT-PCR analyses. This study was supported by many potentially misleading differences within the grants from the National Institutes of Health noise range, this approach could have filtered out (AR47052), the Arthritis Foundation (Atlanta, GA, important effects of DEX on rare transcripts. USA) and the Robert E and May R Wright Our RT-PCR analyses generally confirmed the Foundation (Los Angeles, CA, USA). N L is the microarray results. Most of the primers used for recipient of an Arthritis Foundation postdoctoral RT-PCR amplified protein-coding sequences training grant. spanning adjacent exons, in order to disclose possible contamination of the cDNA-derived signal by amplification of genomic DNA. In contrast, the References sequences represented on the microarrays usually interrogate the 3-UTRs of mRNAs. The general Alessi DR, SmytheC&Keyse SM 1993 The human CL100 gene encodes a Tyr/Thr-protein phosphatase which potently and agreement between the microarray and the RT- specifically inactivates MAP kinase and suppresses its activation by PCR results, despite the difference in sequences oncogenic ras in Xenopus oocyte extracts. Oncogene 8 2015–2020. targeted by the two methods, increases our confi- Asano H, Li XS & Stamatoyannopoulos G 2000 FKLF-2: a novel Kruppel-like transcriptional factor that activates globin and other dence in the disclosed effects of DEX. However, the erythroid lineage genes. Blood 95 3578–3584. difference between the sequences targeted by the Baughman G, Wiederrecht GJ, Campbell NF, Martin MM & microarray versus the RT-PCR analysis can lead to Bourgeois S 1995 FKBP51, a novel T-cell-specific immunophilin capable of calcineurin inhibition. Molecular Cell Biology 15 disagreement between the two methods in cases 4395–4402. where DEX affects, for example, alternative poly- Beckmann AM & Wilce PA 1997 Egr transcription factors in the adenylation or alternative splicing. This could have nervous system. Neurochemistry International 31 477–510. Bellows CG, Aubin JE & Heersche JN 1987 Physiological been the case for four of the twenty genes tested, concentrations of glucocorticoids stimulate formation of bone where the RT-PCR results were different from nodules from isolated rat calvaria cells in vitro. Endocrinology 121 those of the microarray analysis. These four genes 1985–1992. Bollen M, Gijsbers R, Ceulemans H, Stalmans W & Stefan C 2000 are denoted by asterisks in Table S1 (http:// Nucleotide pyrophosphatases/phosphodiesterases on the move. hacialab.usc.edu/supplement/frenkel). Critical Reviews in Biochemistry and Molecular Biology 35 393–432. In summary, we used oligonucleotide microarray Bornstein P 2000 Matricellular proteins: an overview. Matrix Biology analysis to identify DEX-responsive genes in 19 555–556. Bornstein P, Armstrong LC, Hankenson KD, Kyriakides TR & MC3T3-E1 osteoblast cultures and highlight Yang Z 2000 Thrombospondin 2, a matricellular protein with potential mechanisms of GC-induced osteoporosis. diverse functions. Matrix Biology 19 557–568. www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 190 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

Burkhardt R, Kettner G, Bohm W, Schmidmeier M, Schlag R, dephosphorylation of extracellular signal-regulated kinase and Frisch B, Mallmann B, Eisenmenger W & Gilg T 1987 Changes impair proliferation in human and mouse osteoblast cell lines. in trabecular bone, hematopoiesis and bone marrow vessels in Endocrinology 144 412–422. aplastic anemia, primary osteoporosis, and old age: a comparative Eswarakumar VP, Monsonego-Ornan E, Pines M, Antonopoulou I, histomorphometric study. Bone 8 157–164. Morriss-Kay GM & Lonai P 2002 The IIIc alternative of Fgfr2 is a Canalis E 1985 Effect of growth factors on bone cell replication and positive regulator of bone formation. Development 129 3783–3793. differentiation. Clinical Orthopaedics 193 246–263. Eyre LJ, Bland R, Bujalska IJ, Sheppard MC, Stewart PM & Canalis E 1996 Clinical review 83: Mechanisms of glucocorticoid Hewison M 1998 Characterization of aromatase and 17 action in bone: implications to glucocorticoid-induced beta-hydroxysteroid dehydrogenase expression in rat osteoblastic osteoporosis. Journal of Clinical Endocrinology and Metabolism 81 cells. Journal of Bone and Mineral Research 13 996–1004. 3441–3447. Funakoshi H, Yonemasu T, Nakano T, MatumotoK&Nakamura Canalis E, Economides AN & Gazzerro E 2003 Bone morphogenetic T 2002 Identification of Gas6, a putative ligand for Sky and Axl proteins, their antagonists, and the skeleton. Endocrinology Reviews receptor tyrosine kinases, as a novel neurotrophic factor for 24 218–235. hippocampal neurons. Journal of Neuroscience Research 68 150–160. Carpio L, Gladu J, GoltzmanD&RabbaniSA2001Induction of Galera P, Park RW, Ducy P, Mattei MG & Karsenty G 1996 osteoblast differentiation indexes by PTHrP in MG-63 cells c-Krox binds to several sites in the promoter of both mouse type I involves multiple signaling pathways. American Journal of Physiology, collagen genes. Structure/function study and developmental Endocrinology and Metabolism 281 E489–E499. expression analysis. Journal of Biological Chemistry 271 21331–21339. Carron JA, Bowler WB, Wagstaff SC & Gallagher JA 1999 Gallea S, Lallemand F, Atfi A, Rawadi G, Ramez V, Spinella-Jaegle Expression of members of the thrombospondin family by human S, Kawai S, Faucheu C, Huet L, BaronR&Roman-RomanS skeletal tissues and cultured cells. Biochemical and Biophysical Research 2001 Activation of mitogen-activated protein kinase cascades is Communications 263 389–391. involved in regulation of bone morphogenetic protein-2-induced Chang DJ, Ji C, Kim KK, Casinghino S, McCarthy TL & Centrella osteoblast differentiation in pluripotent C2C12 cells. Bone 28 M 1998 Reduction in transforming growth factor beta receptor I 491–498. expression and transcription factor CBFa1 on bone cells by Galzie Z, Kinsella AR & Smith JA 1997 Fibroblast growth factors glucocorticoid. Journal of Biological Chemistry 273 4892–4896. and their receptors. Biochemistry and Cell Biology 75 669–685. Chen H, Herndon ME & Lawler J 2000 The cell biology of Ganss B, Kim RH & Sodek J 1999 Bone sialoprotein. Critical Reviews thrombospondin-1. Matrix Biology 19 597–614. in Oral Biology and Medicine 10 79–98. Chen J, Sodek J, Thomas HF & Ranly DM 1996 Dexamethasone Goding JW, Terkeltaub R, Maurice M, Deterre P, SaliA&Belli SI stimulates luciferase gene expression through the rat bone 1998 Ecto-phosphodiesterase/pyrophosphatase of lymphocytes sialoprotein gene promoter in transgenic mice. Connective Tissue and non-lymphoid cells: structure and function of the PC-1 Research 35 33–39. family. Immunological Reviews 161 11–26. Chen J, Carey K & Godowski PJ 1997 Identification of Gas6 as a Gohel A, McCarthy MB & Gronowicz G 1999 Estrogen prevents ligand for Mer, a neural cell adhesion molecule related receptor glucocorticoid-induced apoptosis in osteoblasts in vivo and in vitro. tyrosine kinase implicated in cellular transformation. Oncogene 14 Endocrinology 140 5339–5347. 2033–2039. Gorski JL, Estrada L, HuC&LiuZ2000Skeletal-specific Chen TL, Cone CM & Feldman D 1983 Glucocorticoid modulation expression of Fgd1 during bone formation and skeletal defects in of cell proliferation in cultured osteoblast-like bone cells: faciogenital dysplasia (FGDY; Aarskog syndrome). Developmental differences between rat and mouse. Endocrinology 112 1739–1745. Dynamics 218 573–586. Chikazu D, Li X, Kawaguchi H, Sakuma Y, Voznesensky OS, GoruppiS,RuaroE&Schneider C 1996 Gas6, the ligand of Axl Adams DJ, Xu M, Hoshio K, Katavic V, Herschman HR, Raisz tyrosine kinase receptor, has mitogenic and survival activities for LG & Pilbeam CC 2002 Bone morphogenetic protein 2 induces serum starved NIH3T3 fibroblasts. Oncogene 12 471–480. cyclo-oxygenase 2 in osteoblasts via a Cbfal binding site: role in Grey A, Banovic T, Naot D, Hill B, Callon K, ReidI&Cornish J effects of bone morphogenetic protein 2 in vitro and in vivo. Journal 2001 Lysophosphatidic acid is an osteoblast mitogen whose of Bone and Mineral Research 17 1430–1440. proliferative actions involve G(i) proteins and protein kinase C, Choe J, SternP&FeldmanD1978 Receptor mediated but not P42/44 mitogen-activated protein kinases. Endocrinology glucocorticoid inhibition of protein synthesis in isolated bone cells. 142 1098–1106. Journal of Steroid Biochemistry 9 265–271. Grey A, Chen Q, Callon K, Xu X, Reid IR & Cornish J 2002 The Collett G, Wood A, Alexander MY, Varnum BC, Boot-Handford phospholipids sphingosine-1-phosphate and lysophosphatidic acid RP, Ohanian V, Ohanian J, Fridell YW & Canfield AE 2003 prevent apoptosis in osteoblastic cells via a signaling pathway Receptor tyrosine kinase Axl modulates the osteogenic involving G(i) proteins and phosphatidylinositol-3 kinase. differentiation of pericytes. Circulation Research 92 1123–1129. Endocrinology 143 4755–4763. Davies TH, Ning YM & Sanchez ER 2002 A new first step in Hankenson KD & Bornstein P 2002 The secreted protein activation of steroid receptors: hormone-induced switching of thrombospondin 2 is an autocrine inhibitor of marrow stromal cell FKBP51 and FKBP52 immunophilins. Journal of Biological Chemistry proliferation. Journal of Bone and Mineral Research 17 415–425. 277 4597–4600. Hashimoto N, Zhang WR & Goldstein BJ 1992 Insulin receptor and Delany AM, Gabbitas BY & Canalis E 1995a Cortisol downregulates epidermal growth factor receptor dephosphorylation by three osteoblast alpha 1 (I) procollagen mRNA by transcriptional and major rat liver protein-tyrosine phosphatases expressed in a posttranscriptional mechanisms. Journal of Cellular Biochemistry 57 recombinant bacterial system. Biochemical Journal 284 569–576. 488–494. Hassel S, Schmitt S, Hartung A, Roth M, Nohe A, Petersen N, Delany AM, Jeffrey JJ, RydzielS&Canalis E 1995b Cortisol Ehrlich M, Henis YI, Sebald W & Knaus P 2003 Initiation of increases interstitial collagenase expression in osteoblasts by Smad-dependent and Smad-independent signaling via distinct post-transcriptional mechanisms. Journal of Biological Chemistry 270 BMP-receptor complexes. Journal of Bone and Joint Surgery of America 26607–26612. 85 44–51. Engelbrecht Y, de Wet H, Horsch K, Langeveldt CR, Hough FS & Heegaard AM, Gehron Robey P, Vogel W, Just W, Widom RL, Hulley PA 2003 Glucocorticoids induce rapid up-regulation of Scholler J, Fisher LW & Young MF 1997 Functional mitogen-activated protein kinase phosphatase-1 and characterization of the human biglycan 5-flanking DNA and

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 191

binding of the transcription factor c-Krox. Journal of Bone and Levi G, Topilko P, Schneider-Maunoury S, Lasagna M, Mantero S, Mineral Research 12 2050–2060. Cancedda R & Charnay P 1996 Defective bone formation in Hefferan TE, Subramaniam M, Khosla S, Riggs BL & Spelsberg TC Krox-20 mutant mice. Development 122 113–120. 2000 Cytokine-specific induction of the TGF-beta inducible early Li R, Chen J, Hammonds G, Phillips H, Armanini M, Wood P, gene (TIEG): regulation by specific members of the TGF-beta Bunge R, Godowski PJ, Sliwkowski MX & Mather JP 1996 family. Journal of Cellular Biochemistry 78 380–390. Identification of Gas6 as a growth factor for human Schwann Hulley PA, Conradie MM, Langeveldt CR & Hough FS 2002 cells. Journal of Neuroscience 16 2012–2019. Glucocorticoid-induced osteoporosis in the rat is prevented by the Li Y, Lacerda DA, Warman ML, Beier DR, Yoshioka H, Ninomiya tyrosine phosphatase inhibitor, sodium orthovanadate. Bone 31 Y, Oxford JT, Morris NP, Andrikopoulos K, Ramirez F, Wardell 220–229. BB, Lifferth GD, Teuscher C, Woodward SR, Taylor BA, Hunter GK & Goldberg HA 1993 Nucleation of hydroxyapatite by Seegmiller RE & Olsen BR 1995 A fibrillar collagen gene, bone sialoprotein. PNAS 90 8562–8565. Col11a1, is essential for skeletal morphogenesis. Cell 80 Inoue D, Reid M, Lum L, Kratzschmar J, Weskamp G, Myung 423–430. YM,BaronR&BlobelCP1998 Cloning and initial Lian JB, Shalhoub V, Aslam F, Frenkel B, Green J, Hamrah M, characterization of mouse meltrin beta and analysis of the Stein GS & Stein JL 1997 Species-specific glucocorticoid and expression of four metalloprotease-disintegrins in bone cells. 1,25-dihydroxyvitamin D responsiveness in mouse MC3T3-E1 Journal of Biological Chemistry 273 4180–4187. osteoblasts: dexamethasone inhibits osteoblast differentiation and Iruela-Arispe ML, Liska DJ, Sage EH & Bornstein P 1993 vitamin D down-regulates osteocalcin gene expression. Differential expression of thrombospondin 1, 2, and 3 during Endocrinology 138 2117–2127. murine development. Developmental Dynamics 197 40–56. Linkhart TA, MohanS&Baylink DJ 1996 Growth factors for bone IshidaY&Heersche JN 1998 Glucocorticoid-induced osteoporosis: growth and repair: IGF, TGF beta and BMP. Bone 19 1S–12S. both in vivo and in vitro concentrations of glucocorticoids higher LouJ,TuY,LiS&ManskePR2000 Involvement of ERK in than physiological levels attenuate osteoblast differentiation. Journal BMP-2 induced osteoblastic differentiation of mesenchymal of Bone and Mineral Research 13 1822–1828. progenitor cell line C3H10T1/2. Biochemical and Biophysical Research Communications Johnson K, Goding J, Van Etten D, Sali A, Hu SI, Farley D, Krug 268 757–762. H, Hessle L, Millan JL & Terkeltaub R 2003 Linked deficiencies Luckert B 1997 Glucocorticoid-induced osteoporosis. In Osteoporosis, in extracellular PP(i) and osteopontin mediate pathologic pp 801–820. Eds R Markus, D Feldman&JKelsey. San Diego: calcification associated with defective PC-1 and ANK expression. Academic Press. Journal of Bone and Mineral Research 18 994–1004. Luckert B Kream B 1996 Clinical and basic aspects of glucocorticoid Principles of Bone Biology Karaman MW, Houck ML, Chemnick LG, Nagpal S, Chawannakul action in bones. In , pp 533–548. Eds JP D, Sudano D, Pike BL, Ho VV, Ryder OA & Hacia JG 2003 Bilezikian, LG Raisz & GA Rodan. San Diego: Academic Press. Comparative analysis of gene-expression patterns in human and Luppen CA, Leclerc N, Noh T, Barski A, Khokhar A, Boskey AL, African great ape cultured fibroblasts. Genome Research 13 SmithE&Frenkel B 2003a Brief bone morphogenetic protein 2 1619–1630. treatment of glucocorticoid-inhibited MC3T3-E1 osteoblasts rescues commitment-associated cell cycle and mineralization Kassel O, Sancono A, Kratzschmar J, Kreft B, Stassen M & Cato without alteration of Runx2. Journal of Biological Chemistry 278 AC 2001 Glucocorticoids inhibit MAP kinase via increased 44995–45003. expression and decreased degradation of MKP-1. EMBO Journal Luppen CA, Smith E, Spevak L, Boskey AL & Frenkel B 2003b 20 7108–7116. Bone morphogenetic protein-2 restores mineralization in Keyse SM & Emslie EA 1992 Oxidative stress and heat shock glucocorticoid-inhibited MC3T3-E1 osteoblast cultures. Journal of induce a human gene encoding a protein-tyrosine phosphatase. Bone and Mineral Research 18 1186–1197. Nature 359 644–647. McCloskey P, Fridell YW, Attar E, Villa J, Jin Y, VarnumB&Liu Khachigian LM & Collins T 1998 Early growth response factor 1: a ET 1997 GAS6 mediates adhesion of cells expressing the receptor pleiotropic mediator of inducible gene expression. Journal of tyrosine kinase Axl. Journal of Biological Chemistry 272 23285–23291. Molecular Medicine 613–616. 76 McMahon AP, Champion JE, McMahon JA & Sukhatme VP 1990 Kireeva ML, Mo FE, Yang GP & Lau LF 1996 Cyr61, a product of Developmental expression of the putative transcription factor a growth factor-inducible immediate-early gene, promotes cell Egr-1 suggests that Egr-1 and c-fos are coregulated in some proliferation, migration, and adhesion. Molecular and Cellular Biology tissues. Development 108 281–287. 16 1326–1334. Mahonen A, Jukkola A, Risteli L, RisteliJ&MaenpaaPH1998 Knauper V, Lopez-Otin C, Smith B, Knight G & Murphy G 1996 Type I procollagen synthesis is regulated by steroids and related Biochemical characterization of human collagenase-3. Journal of hormones in human osteosarcoma cells. Journal of Cellular Biological Chemistry 271 1544–1550. Biochemistry 68 151–163. Kucharz EJ 1988 Hormonal control of collagen metabolism. Part II. Mandavilli BS & Rao KS 1996 Accumulation of DNA damage in Endocrinologie 26 229–237. aging neurons occurs through a mechanism other than apoptosis. Lai CF & Cheng SL 2002 Signal transductions induced by bone Journal of Neurochemistry 67 1559–1565. morphogenetic protein-2 and transforming growth factor-beta in Manolagas SC & Weinstein RS 1999 New developments in the normal human osteoblastic cells. Journal of Biological Chemistry 277 pathogenesis and treatment of steroid-induced osteoporosis. Journal 15514–15522. of Bone and Mineral Research 14 1061–1066. Leboy PS, Beresford JN, DevlinC&OwenME1991 Manolagas SC, Kousteni S & Jilka RL 2002 Sex steroids and bone. Dexamethasone induction of osteoblast mRNAs in rat marrow Recent Progress in Hormone Research 57 385–409. stromal cell cultures. Journal of Cellular Physiology 146 370–378. Mansukhani A, Bellosta P, Sahni M & Basilico C 2000 Signaling by Lechner A, Schutze N, Siggelkow H, Seufert J & Jakob F 2000 The fibroblast growth factors (FGF) and fibroblast growth factor immediate early gene product hCYR61 localizes to the secretory receptor 2 (FGFR2)-activating mutations blocks mineralization pathway in human osteoblasts. Bone 27 53–60. and induces apoptosis in osteoblasts. Journal of Cell Biology 149 Lerner UH & Frohlander N 1992 Haptoglobin-stimulated bone 1297–1308. resorption in neonatal mouse calvarial bones in vitro. Arthritis and Martin KM, Metcalfe JC & Kemp PR 2001 Expression of Klf9 and Rheumatism 35 587–591. Klf13 in mouse development. Mechanisms of Development 103 149–151. www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access 192 N LECLERC and others · Microarray analysis of DEX-treated osteoblasts

Mbuyi JM, Dequeker J, BloemmenF&Stevens E 1982 Plasma Raisz LG 1999 Prostaglandins and bone: physiology and proteins in human cortical bone: enrichment of alpha 2 pathophysiology. Osteoarthritis Cartilage 7 419–421. HS-glycoprotein, alpha 1 acid-glycoprotein, and IgE. Calcified Regunathan A, Glesne DA, Wilson AK, Song J, Nicolae D, Flores T Tissue International 34 229–231. & Bhattacharyya MH 2003 Microarray analysis of changes in Meunier P, Aaron J, EdouardC&VignonG1971Osteoporosis bone cell gene expression early after cadmium gavage in mice. and the replacement of cell populations of the marrow by adipose Toxicology and Applied Pharmacology 191 272–293. tissue. A quantitative study of 84 iliac bone biopsies. Clinical Robey PG, Young MF, Fisher LW & McClain TD 1989 Orthopaedics 80 147–154. Thrombospondin is an osteoblast-derived component of Miao D, Tong XK, Chan GK, Panda D, McPherson PS & mineralized extracellular matrix. Journal of Cell Biology 108 Goltzman D 2001 Parathyroid hormone-related peptide stimulates 719–727. osteogenic cell proliferation through protein kinase C activation of Rogatsky I, Trowbridge JM & Garabedian MJ 1997 Glucocorticoid the Ras/mitogen-activated protein kinase signaling pathway. receptor-mediated cell cycle arrest is achieved through distinct Journal of Biological Chemistry 276 32204–32213. cell-specific transcriptional regulatory mechanisms. Molecular and Mintz KP, Grzesik MJ, Midura RJ, Robey PG, Termine JD & Cellular Biology 17 3181–3193. Fisher LW 1993 Purification and fragmentation of nondenatured Rubin MR & Bilezikian JP 2002 Clinical review 151: The role of bone sialoprotein: evidence for a cryptic, RGD-resistant cell parathyroid hormone in the pathogenesis of attachment domain. Journal of Bone and Mineral Research 8 glucocorticoid-induced osteoporosis: a re-examination of the 985–995. evidence. Journal of Clinical Endocrinology and Metabolism 87 Mizuno K, Hasegawa K, Katagiri T, Ogimoto M,T&YakuraH 4033–4041. 1993 MPTP delta, a putative murine homolog of HPTP delta, is Sampath TK, Maliakal JC, Hauschka PV, Jones WK, Sasak H, expressed in specialized regions of the brain and in the B-cell Tucker RF, KH, Coughlin JE, Tucker MM, Pang RH, Corbett lineage. Molecular and Cellular Biology 13 5513–5523. C, Özkaynak E, Oppermann H & Rueger DC 1992 Recombinant Muragaki Y, Shiota C, Inoue M, Ooshima A, Olsen BR & human osteogenic protein-1 (hOP-1) induces new bone formation Ninomiya Y 1992 Alpha 1(VIII)-collagen gene transcripts encode in vivo with a specific activity comparable with natural bovine a short-chain collagen polypeptide and are expressed by various osteogenic protein and stimulates osteoblast proliferation and epithelial, endothelial and mesenchymal cells in newborn mouse differentiation in vitro. Journal of Biological Chemistry 267 tissues. European Journal of Biochemistry 207 895–902. 20352–20362. Nagata K, Ohashi K, Nakano T, Arita H, Zong C, Hanafusa H & Sasano H, Uzuki M, Sawai T, Nagura H, Matsunaga G, Kashimoto Mizuno K 1996 Identification of the product of growth O & Harada N 1997 Aromatase in human bone tissue. Journal of arrest-specific gene 6 as a common ligand for Axl, Sky, and Mer Bone and Mineral Research 12 1416–1423. receptor tyrosine kinases. Journal of Biological Chemistry 271 Sato Y, Arai N, NegishiA&OhyaK1997Expression of 30022–30027. cyclooxygenase genes and involvement of endogenous Nakano T, Kawamoto K, HigashinoK&Arita H 1996 Prevention prostaglandin during osteogenesis in the rat tibial bone marrow of growth arrest-induced cell death of vascular smooth muscle cavity. Journal of Medical Dental Science 44 81–92. cells by a product of growth arrest-specific gene, gas6. FEBS Letters Schacke H, Docke WD & Asadullah K 2002 Mechanisms involved 387 78–80. in the side effects of glucocorticoids. Pharmacology and Therapeutics Nawata H, Tanaka S, Takayanagi R, Sakai Y, Yanase T, Ikuyama S 96 23–43. & Haji M 1995 Aromatase in bone cell: association with Schutze N, Lechner A, Groll C, Siggelkow H, Hufner M, Kohrle J osteoporosis in postmenopausal women. Journal of Steroid & Jakob K 1998 The human analog of murine cystein rich Biochemistry and Molecular Biology 53 165–174. protein 61 [correction of 16] is a 1 alpha,25-dihydroxyvitamin D3 Nuttall ME & Gimble JM 2000 Is there a therapeutic opportunity to responsive immediate early gene in human fetal osteoblasts: either prevent or treat osteopenic disorders by inhibiting marrow regulation by cytokines, growth factors, and serum. Endocrinology adipogenesis? Bone 27 177–184. 139 1761–1770. Nuttall ME, Patton AJ, Olivera DL, Nadeau DP & Gowen M 1998 Seitanidou T, Schneider-Maunoury S, Desmarquet C, Wilkinson Human trabecular bone cells are able to express both osteoblastic DG & Charnay P 1997 Krox-20 is a key regulator of and adipocytic phenotype: implications for osteopenic disorders. rhombomere-specific gene expression in the developing hindbrain. Journal of Bone and Mineral Research 13 371–382. Mechanisms of Development 65 31–42. O’Brien TP & Lau LF 1992 Expression of the growth Shalhoub V, Conlon D, Tassinari M, Quinn C, Partridge N, Stein factor-inducible immediate early gene cyr61 correlates with GS & Lian JB 1992 Glucocorticoids promote development of the chondrogenesis during mouse embryonic development. Cell Growth osteoblast phenotype by selectively modulating expression of cell and Differentiation 3 645–654. growth and differentiation associated genes. Journal of Cellular Ogata Y, Yamauchi M, Kim RH, Li JJ, Freedman LP & Sodek J Biochemistry 50 425–440. 1995 Glucocorticoid regulation of bone sialoprotein (BSP) gene Shankar SL, O’Guin K, Cammer M, McMorris FA, Stitt TN, Basch expression. Identification of a glucocorticoid response element in RS,VarnumB&Shafit-Zagardo B 2003 The growth the bone sialoprotein gene promoter. European Journal of Biochemistry arrest-specific gene product Gas6 promotes the survival of human 230 183–192. oligodendrocytes via a phosphatidylinositol 3-kinase-dependent Pockwinse SM, Stein JL, Lian JB & Stein GS 1995 Developmental pathway. Journal of Neuroscience 23 4208–4218. stage-specific cellular responses to vitamin D and glucocorticoids Sherbina NV & Bornstein P 1992 Modulation of thrombospondin during differentiation of the osteoblast phenotype: interrelationship gene expression during osteoblast differentiation in MC3T3-E1 of morphology and gene expression by in situ hybridization. cells. Bone 13 197–201. Experimental Cell Research 216 244–260. Smith E, Redman RA, Logg CR, Coetzee GA, Kasahara N & Pilbeam CC, Harrison JR & Raisz LG 2002 Prostaglandins and Frenkel B 2000 Glucocorticoids inhibit developmental bone metabolism. In Principles of Bone Biology, pp 715–728. Eds JP stage-specific osteoblast cell cycle. Dissociation of cyclin Bilezikian, LG Raisz & GA Rodan. San Diego: Academic Press. A-cyclin-dependent kinase 2 from E2F4-p130 complexes. Journal of Qu Q, Perala-Heape M, Kapanen A, Dahllund J, Salo J, Vaananen Biological Chemistry 275 19992–20001. HK & Harkonen P 1998 Estrogen enhances differentiation of Smith E, Coetzee GA & Frenkel B 2002 Glucocorticoids inhibit cell osteoblasts in mouse bone marrow culture. Bone 22 201–209. cycle progression in differentiating osteoblasts via glycogen

Journal of Molecular Endocrinology (2004) 33, 175–193 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access Microarray analysis of DEX-treated osteoblasts · N LECLERC and others 193

synthase kinase-3 beta. Journal of Biological Chemistry 277 osteoblasts and osteocytes by glucocorticoids. Potential 18191–18197. mechanisms of their deleterious effects on bone. Journal of Clinical Smith WL, Garavito RM & DeWitt DL 1996 Prostaglandin Investigation 102 274–282. endoperoxide H synthases (cyclooxygenases)-1 and -2. Journal of Wilkinson DG, Bhatt S, Chavrier P, BravoR&Charnay P 1989 Biological Chemistry 271 33157–33160. Segment-specific expression of a zinc-finger gene in the developing Styrkarsdottir U, Cazier JB, Kong A, Rolfsson O, Larsen H, nervous system of the mouse. Nature 337 461–464. Bjarnadottir E, Johannsdottir VD, Sigurdardottir MS, Bagger Y, Xiao G, Jiang D, Thomas P, Benson MD, Guan K, Karsenty G & Christiansen C, Reynisdottir I, Grant SFA, Jonasson K, Frigge Franceschi RT 2000 MAPK pathways activate and phosphorylate ML,GulcherJR,SigurdssonG&Stefansson K 2003 Linkage of the osteoblast-specific transcription factor, Cbfa1. Journal of osteoporosis to chromosome 20p12 and association to BMP2. Biological Chemistry 275 4453–4459. PLoS Biology 1 351–360. Xiao G, Gopalakrishnan R, Jiang D, Reith E, Benson MD & Subramaniam M, Harris SA, Oursler MJ, Rasmussen K, Riggs BL Franceschi RT 2002 Bone morphogenetic proteins, extracellular & Spelsberg TC 1995 Identification of a novel matrix, and mitogen-activated protein kinase signaling pathways TGF-beta-regulated gene encoding a putative zinc finger protein are required for osteoblast-specific gene expression and in human osteoblasts. Nucleic Acids Research 23 4907–4912. differentiation in MC3T3-E1 cells. Journal of Bone and Mineral Sukhatme VP 1992 The Egr transcription factor family: from signal Research 17 101–110. transduction to kidney differentiation. Kidney International 41 Yamaguchi A, Katagiri T, Ikeda T, Wozney JM, Rosen V, Wang 550–553. EA,KahnAJ,SudaT&YoshikiS1991Recombinant human Suzawa M, Tamura Y, Fukumoto S, Miyazono K, Fujita T, Kato S bone morphogenetic protein-2 stimulates osteoblastic maturation & Takeuchi Y 2002 Stimulation of Smad1 transcriptional activity and inhibits myogenic differentiation in vitro. Journal of Cell Biology by Ras-extracellular signal-regulated kinase pathway: a possible 113 681–687. mechanism for collagen-dependent osteoblastic differentiation. Yamaguchi A, Komori T & Suda T 2000 Regulation of osteoblast Journal of Bone and Mineral Research 17 240–248. Takai Y, SasakiT&Matozaki T 2001 Small GTP-binding proteins. differentiation mediated by bone morphogenetic proteins, hedgehogs, and Cbfa1. Endocrine Reviews 393–411. Physiological Reviews 81 153–208. 21 Tenenbaum HC & Heersche JN 1985 Dexamethasone stimulates Yanagita M, Arai H, Nakano T, Ohashi K, Mizuno K, Fukatsu A, osteogenesis in chick periosteum in vitro. Endocrinology 117 DoiT&KitaT2001 Gas6 induces mesangial cell proliferation 2211–2217. via latent transcription factor STAT3. Journal of Biological Chemistry Terkeltaub RA 2001 Inorganic pyrophosphate generation and 276 42364–42369. disposition in pathophysiology. American Journal of Physiology - Cell Yang GP & Lau LF 1991 Cyr61, product of a growth factor-inducible Physiology 281 C1–C11. immediate early gene, is associated with the extracellular matrix Tokumura A, Majima E, Kariya Y, Tominaga K, Kogure K, and the cell surface. Cell Growth and Differentiation 2 351–357. Yasuda K & Fukuzawa K 2002 Identification of human plasma Yang S, Wei D, Wang D, Phimphilai M, Krebsbach PH & lysophospholipase D, a lysophosphatidic acid-producing enzyme, Franceschi RT 2003 In vitro and in vivo synergistic interactions as autotaxin, a multifunctional phosphodiesterase. Journal of between the Runx2/Cbfa1 transcription factor and bone Biological Chemistry 277 39436–39442. morphogenetic protein-2 in stimulating osteoblast differentiation. Tooney PA, Sakai T, Sakai K, AeschlimannD&MosherDF1998 Journal of Bone and Mineral Research 18 705–715. Restricted localization of thrombospondin-2 protein during mouse Yeh WC, Li TK, Bierer BE & McKnight SL 1995 Identification and embryogenesis: a comparison to thrombospondin-1. Matrix Biology characterization of an immunophilin expressed during the clonal 17 131–143. expansion phase of adipocyte differentiation. PNAS 92 Topilko P, Schneider-Maunoury S, Levi G, Baron-Van Evercooren 11081–11085. A, Chennoufi AB, Seitanidou T, Babinet C & Charnay P 1994 Zalavras C, Shah S, Birnbaum MJ & Frenkel B 2003 Role of Krox-20 controls myelination in the peripheral nervous system. apoptosis in glucocorticoid-induced osteoporosis and osteonecrosis. Nature 371 796–799. Critical Reviews in Eukaryotic Gene Expression 13 221–235. Van Staa TP, Leufkens HG, Abenhaim L, ZhangB&CooperC Zhang WR, Li PM, Oswald MA & Goldstein BJ 1996 Modulation 2000 Use of oral corticosteroids and risk of fractures. Journal of of insulin signal transduction by eutopic overexpression of the Bone and Mineral Research 15 993–1000. receptor-type protein-tyrosine phosphatase LAR. Molecular Varnum BC, Young C, Elliott G, Garcia A, Bartley TD, Fridell Endocrinology 10 575–584. YW, Hunt RW, Trail G, Clogston C, Toso RJ, Yanagihara D, Zheng Y, Fischer DJ, Santos MF, Tigyi G, Pasteris NG, Gorski JL & Bennett L, Sylber M, Merewether LA, Tseng A, Escobar E, Liu Xu Y 1996 The faciogenital dysplasia gene product FGD1 ET & Yamane HK 1995 Axl receptor tyrosine kinase stimulated functions as a Cdc42Hs-specific guanine-nucleotide exchange by the vitamin K-dependent protein encoded by factor. Journal of Biological Chemistry 271 33169–33172. Nature growth-arrest-specific gene 6. 373 623–626. Zhou HY, Takita H, Fujisawa R, Mizuno M & Kuboki Y 1995 Wang GJ, Sweet DE, Reger SI & Thompson RC 1977 Fat-cell Stimulation by bone sialoprotein of calcification in osteoblast-like changes as a mechanism of avascular necrosis of the femoral head MC3T3-E1 cells. Calcified Tissue International 56 403–407. in cortisone-treated rabbits. Journal of Bone and Joint Surgery of America 59 729–735. Weinstein RS, Jilka RL, Parfitt AM & Manolagas SC 1998 Received in final form 24 March 2004 Inhibition of osteoblastogenesis and promotion of apoptosis of Accepted 30 March 2004

www.endocrinology.org Journal of Molecular Endocrinology (2004) 33, 175–193

Downloaded from Bioscientifica.com at 09/25/2021 08:14:17PM via free access