Role of Micrornas in Hepatocarcinogenesis

Role of microRNAs in Hepatocarcinogenesis

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Bo Wang, M.S.

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2012

Dissertation Committee:

Dr. Jacob T. Samson, Advisor

Dr. Kalpana Ghoshal

Dr. SaÏd Sif

Dr. Thomas D. Schmittgen

Bo Wang

2012

Abstract

MicroRNAs are conserved, small (20-25 nucleotide) noncoding RNAs that negatively regulate expression of mRNAs at the post-transcriptional level.

MicroRNA signature is altered in different disease states including cancer and

some microRNAs act as oncogenes or tumor suppressors. To identify

microRNAs that may play a causal role in hepatocarcinogenesis we used an

animal model in which C57BL/6 mice fed choline deficient and amino acid

defined (CDAA) diet develop nonalcoholic steatohepatitis (NASH)-induced hepatocarcinogenesis after 70 weeks. Microarray analysis identified 30 hepatic microRNAs that are significantly (P≤0.01) altered in mice fed CDAA diet for 6, 18,

32 and 65 weeks compared to those fed choline sufficient and amino acid

defined diet (CSAA). Real-time RT-PCR analysis demonstrated upregulation of oncogenic miR-155, miR-181b, miR-221/222 and miR-21 and downregulation of the most abundant liver specific miR-122 at early stages of hepatocarcinogenesis.

Western blot analysis showed reduced expression of hepatic PTEN, a target of miR-21, and C/EBPβ, a target of miR-155, in these mice at early stages.

DNA binding activity of NF-κB that transactivates miR-155 gene was significantly

(P=0.002) elevated in the liver nuclear extract of mice fed CDAA diet. Further, the expression of miR-155, as measured by in situ hybridization and real-time RT-

PCR, correlated with diet-induced histopathological changes in the liver. Ectopic

expression of miR-155 promoted growth of hepatocellular carcinoma (HCC) cells

whereas its depletion inhibited cell growth. Notably, miR-155 was significantly

(P=0.0004) upregulated in primary human HCCs with concomitant decrease

(P=0.02) in C/EBPβ level compared to matching liver tissues.

The expression of tissue inhibitor of metalloprotease 3 (TIMP3), a tumor

suppressor and a validated miR-181 target, was markedly suppressed in the

livers of mice fed CDAA diet. Upregulation of hepatic transforming growth factor

β (TGFβ) and its downstream mediators Smad 2, 3 and 4 and increase in

phospho-Smad2 in the liver nuclear extract correlated with elevated miR-181b/d

in mice fed CDAA diet. The levels of the precursor and mature miR-181b were

augmented on exposure of hepatic cells to TGFβ and were significantly reduced

by small interference RNA-mediated depletion of Smad4, showing the

involvement of TGFβ signaling pathway in miR-181b expression. Ectopic

expression of miR-181b showed that miR-181b enhanced matrix

metallopeptidases 2 (MMP2) and MMP9 activity and promoted growth,

clonogenic survival, migration and invasion of HCC cells that could be reversed

by modulating TIMP3 level. Further, depletion of miR-181b inhibited tumor

growth of HCC cells in nude mice. miR-181b also enhanced resistance of HCC

cells to the anticancer drug doxorubicin.

Conclusion: Temporal changes in microRNA profile occur at early stages of CDAA diet-induced hepatocarcinogenesis. Reciprocal regulation of specific

iii oncomirs and their tumor suppressor targets implicate their role in NASH-induced hepatocarcinogenesis and suggest their use in the diagnosis and prognosis of liver cancer.

Dedicated to my parents, my wife Jian, and my son David.

Acknowledgements

First of all, I would like to extend my sincere gratitude to my advisor, Dr.

Samson T. Jacob, for his supporting and mentoring during my graduate study. Dr.

Jacob’s illuminating insight and great view in science inspire me all the way along my study. Dr. Jacob has taught me not only science but also how to become an independent scientist. I have benefited a lot from the experience working in his lab, and will carry with me throughout my career.

I am sincerely grateful to Dr. Kalpana Ghoshal, my co-advisor. It has been a privilege to work with her, a great person with genuine care and an excellent scientist with persistent motivation and enthusiasm in science. Without her instructive advice and constant guidance, I cannot achieve all the success in my research.

I owe special thanks to Dr. Sarmila Majumder for her invaluable discussion and enormous help. I also would like to thank Dr. Jharna Datta, Dr.

Huban Kutay and Dr. Tasneem Motiwala for their discussion and technical help.

My thanks go to my classmate and friend, Shuhao Hsu, for the productive collaboration and generous help with mouse techniques. I enjoy all the chatting and discussions with Dr. Yuanzhi Lu, a diligent scientist and intimate friend, who has helped me a lot in the lab as well as in life.

It is my great honor to work with all the great members in Dr. Jacob’s lab, who made this lab such a wonderful and friendly place to work. I really appreciate all their help and discussions.

This project would not be possible without all the collaborators: Dr.

Stefano Volinia and Dr. Carlo M. Croce, who helped analyze the microarray data;

Dr. Thomas D. Schmittgen, who showed me the real-time PCR analysis of microRNA expression; Dr. Gerard Nuovo, who helped with the pathological analysis and microRNA in situ hybridization; Drs. Stefan Costinean and Wendy

Frankel for help with pathological analysis.

I am deeply grateful to all my committee members, Drs. Thomas D.

Schmittgen, SaÏd Sif, and Tushar Patel for their exceptional guidance, critiques and timely help.

Finally, I would like to thank my parents, my wife, my son and my brother.

It is their constant support that makes me achieve this.

This study was supported by grants from National Institute of Health.

vii

Vita

2002 ...... Bachelor of Medicine, Shandong University

2005 ...... M.S. Peking Union Medical College Chinese Academy of Medical Science

2006 to present ...... Graduate Research Associate, Molecular, Cellular and Developmental Biology, The Ohio State University

Publications

Wang B, Hsu SH, Frankel W, Ghoshal K, Jacob ST. Stat3-mediated activation of miR-23a suppresses gluconeogenesis in hepatocellular carcinoma by downregulating G6PC and PGC-1α. Hepatology. 2012; in press

Wang B, Jacob ST. Role of cancer stem cells in hepatocarcinogenesis. Genome Medicine. 2011; 3:11.

Majumder S, Roy S, Kaffenberger T, Wang B, Costinean S, Frankel W, Bratasz A, Kuppusamy P, Hai T, Ghoshal K, Jacob ST. Loss of metallothionein predisposes mice to diethylnitrosamine-induced hepatocarcinogenesis by activating NF-kappaB target genes. Cancer Res. 2010; 70(24):10265-76.

Wang B, Hsu SH, Majumder S, Kutay H, Huang W, Jacob ST, Ghoshal K. TGFbeta-mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3. Oncogene. 2010; 29(12):1787-97.

Xiong X., Chen M, Lu Y, Zhang L, Wang B, Zhao Y, Wang X.-J., Liang, Z. Discovery of novel cell proliferation-enhancing gene by random siRNA library based combinatorial screening. Combinatorial Chemistry and High Throughput Screening, 2010; 13 (9): 798-806. viii

Cao W., McMahon M., Wang B., O'Connor R., Clarkson M. A case report of spontaneous mutation (C33 > U) in the iron-responsive element of l-ferritin causing hyperferritinemia-cataract syndrome. Blood Cells, Molecules, and Diseases, 2010; 44 (1): 22-27.

Wang B, Majumder S, Nuovo G, Kutay H, Volinia S, Patel T, Schmittgen TD, Croce C, Ghoshal K, Jacob ST. Role of microRNA-155 at early stages of hepatocarcinogenesis induced by choline-deficient and amino acid-defined diet in C57BL/6 mice. Hepatology. 2009; 50(4):1152-61.

Bai S*, Nasser MW*, Wang B*, Hsu SH, Datta J, Kutay H, Yadav A, Nuovo G, Kumar P, Ghoshal K. MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 2009; 284 (46):32015-27. * Equal contribution

Datta J, Kutay H, Nasser MW, Nuovo GJ, Wang B, Majumder S, Liu CG, Volinia S, Croce CM, Schmittgen TD, Ghoshal K, Jacob ST. Methylation mediated silencing of MicroRNA-1 gene and its role in hepatocellular carcinogenesis. Cancer Res. 2008; 68(13):5049-58.

Nasser MW, Datta J, Nuovo G, Kutay H, Motiwala T, Majumder S, Wang B, Suster S, Jacob ST, Ghoshal K. Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008; 283(48):33394-405.

Chen MH, Zhang LS, Zhang HY, Xiong XH, Wang B, Lu B, Wahlestedt C, Liang ZC. A Universal Plasmid Library Encoding All Permutations of siRNA. Proc. Natl. Acad. Sci.USA 2005; 102 (7): 2356-2361

Wang B, Chen MH. Progress in the studies of antisense technologies. China Biotechnology 2004; 24(12): 43-47

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

Table of Contents

Abstract……...... ii

Dedication...... v

Acknowledgments ...... vi

Vita………...... viii

List of Tables ...... xxivv

List of Figures ...... xv

List of Abbreviations……………………………………………………………….xvii

Chapter 1 Introduction ...... 1

1.1 Hepatocellular Carcinoma (HCC) ...... 1

1.1.1 Epidemiology of HCC……………………………………………1

1.1.2 Risk factors for HCC……………………………………………..2

1.1.3 Molecular genetics and epigenetics of HCC…………………..3

1.2 Animal Models of HCC ...... 5

1.2.1 Genetically engineered mouse models………………………..5

1.2.2 Xenograft mouse models………………………………………..6

1.2.3 Carcinogen induced mouse models……………………………7

1.3 Choline Deficient and Amino Acid Defined (CDAA) Diet

Induced Mouse HCC Model ...... 9

1.4 microRNA ...... 11

1.4.1 Biogenesis of miRNAs in animals…………………………….12

1.4.2 Mechanisms of gene silencing mediated by miRNAs………14

1.4.3 miRNA and cancer……………………………………………...16

1.4.4 miRNAs in liver cancer…………………………………………17

Chapter 2 Role of miR-155 at Early Stages of Hepatocarcinogenesis

Induced by Choline-Deficient and Amino Acid Defined Diet in

C57BL/6 Mice ...... 29

2.1 Abstract ...... 29

2.2 Introduction ...... 30

2.3 Materials and Methods ...... 32

2.4 Results ...... 39

2.4.1 Temporal changes in hepatic microRNA expression profile

occur at early stages of hepatocarcinogenesis induced by CDAA

diet………………………………………………………………………39

2.4.2 Real-time RT-PCR analysis confirmed upregulation of

several miRNAs including oncogenic miR-155, miR-221, miR-222,

miR-21 and downregulation of miR-122 in mice fed CDAA diet….41

2.4.3 Histopathological analysis revealed NASH in mice fed CDAA

diet that correlated with higher miR-155 level………………………42

2.4.4 CDAA diet induced activation of NF-κB upregulated hepatic

miR-155…………………………………………………………………43

2.4.5 The tumor suppressors C/EBPβ and PTEN, respective

targets of miR-155 and miR-21, were down regulated in the livers of

mice fed CDAA diet……………………………………………………44

2.4.6 miR-155 modulated growth of HCC cells……………………45

2.4.7 miR-155 was upregulated in primary human HCCs………..45

2.5 Discussion ...... 46

Chapter 3 TGFβ Mediated Upregulation of Hepatic miR-181b Promotes

Hepatocarcinogenesis by Targeting TIMP3 ...... 67

3.1 Abstract ...... 67

3.2 Introduction ...... 68

3.3 Materials and Methods ...... 70

3.4 Results ...... 76

3.4.1 microRNA 181b and 181d are upregulated at early stages of

hepatocarcinogenesis induced by CDAA diet……………………….76

3.4.2 Tissue Inhibitor of Metalloprotease 3 (TIMP3), a candidate

target of miR-181b, is downregulated at early stages of CDAA diet-

induced hepatocarcinogenesis………………………………………..77

3.4.3 CDAA diet-induced upregulation of TGFβ and its downstream

mediators activates miR-181b expression…………………………...80

3.4.4 miR-181b accelerates tumorigenic potential of HCC cells….81

3.4.5 TIMP3 modulates biological function of miR-181b…………..83

3.4.6 miR-181b promotes tumorigenecity in nude mice…………...83

xii

3.4.7 miR-181b enhances resistance of HCC cells to doxorubicin..84

3.4.8 miR-181 and TIMP3 expression are inversely correlated in

primary human HCCs…………………………………………………..85

3.5 Discussion ...... 86

Chapter 4 Conclusions and Future Directions ...... 111

Bibliography ...... 116

xiii

List of Tables

Table 2.1. Hepatic microRNAs dysregulated in mice fed CDAA diet for 6, 18, 32

and 65 weeks...... 60

Table 2.2. Liver pathology and miRNA expression in mice fed CSAA and CDAA

diet for 32 week...... 62

Table 2.3. Liver pathology and miRNA expression in mice fed CSAA and CDAA

diet for 65 week...... 64

Table 2.4. Expression of miR-155 in primary human HCCs and matching liver

tissues...... 66

Table 3.1. Expression of miR-181b/d in primary human HCCs and matching liver

tissues...... 109

xiv

List of Figures

Figure 1.1. Liver cancer incidence in male and female in the world ...... 19

Figure 1.2. Dysregulation of RB and p53 signaling pathways in HCC ...... 20

Figure 1.3. Signaling pathways altered in HCC ...... 21

Figure 1.4. Choline Metabolism pathways ...... 22

Figure 1.5. Pathological changes in CDAA diet induced HCC ...... 23

Figure 1.6. Potential mechanisms involved in CDAA diet induced HCC ...... 24

Figure 1.7. Biogenesis pathways of microRNAs ...... 25

Figure 1.8. Mechanisms involved in miRNA mediated gene silencing ...... 27

Figure 2.1. MicroRNA expression was dysregulated at early stages of

hepatocarcinogenesis ...... 49

Figure 2.2. Validation of miRNA microarray data ...... 50

Figure 2.3. NF-κB was activated in the liver nuclear extract of mice fed CDAA

diet ...... 54

Figure 2.4. Downregulation of C/EBPβ and PTEN, respective targets of miR-155

and miR-21, in the livers of mice fed CDAA diet ...... 55

Figure 2.5. miR-155 regulates HCC cell growth ...... 57

Figure 2.6. miR-155 and C/EBPβ levels were reciprocally regulated in primary

hepatocellular carcinomas ...... 59

Figure 3.1. MicroRNA-181b/d expression is upregulated at early stages of

hepatocarcinogenesis ...... 90

Figure 3.2. TIMP3 is a target of miR-181b ...... 91

Figure 3.3. TGFβ upregulates hepatic miR-181b ...... 95

Figure 3.4. miR-181b enhances tumorigenic properties of HCC cells ...... 99

Figure 3.5. TIMP3 is involved in miR-181b-promoted colony formation and

invasion in HCC cells ...... 102

Figure 3.6. Depletion of miR-181b suppresses tumor growth in nude mice .... 104

Figure 3.7. miR-181b enhances resistance to doxorubicin in HCC cells ...... 105

Figure 3.8. miR-181b and TIMP3 levels were reciprocally regulated in primary

hepatocellular carcinomas ...... 108

xvi

List of Abbreviations

8-OHdG 8-hydroxydeoxyguanosine

AFB1 Aflatoxin B1

Ado-Met S-adenosyl methionine

AGO Argonaute proteins

CDAA choline deficient and L-amino acid defined diet

CSCs cancer stem cells

DEN N,N-diethylnitrosamine eIF eukaryotic translation initiation factor

HBx HBV X protein

HBV Hepatitis B virus

HCC Hepatocellular Carcinoma

HCV Hepatitis C virus hnRNPs heterogeneous nuclear ribonucleoproteins

LOH loss of heterogeneity

MCD methionione and choline deficient diet miR microRNA miRNA microRNA miRISC miRNA-induced silencing complex

xvii

Mirtrons intronic miRNAs

NAFLD nonalcoholic liver disease

NASH nonalcoholic steatohepatitis

PABP1 polyadenylate-binding protein 1

PB phenobarbital

Pol II RNA polymerase II

ROS reactive oxygen species

TICs tumor initiating cells

UTR untranslated regions

xviii

Chapter 1 Introduction

1.1 Hepatocellular Carcinoma (HCC)

Primary liver cancer is the fifth most prevalent cancer and the third leading cause of cancer-related death in the world (1). The reason behind the high mortality is late stage detection of this cancer when most of the therapies available are not very effective. The 5-year survival rate for this cancer is only 10% and the death rate is expected to rise in the next 20 years (2). Hepatocellular carcinoma (HCC), the most common primary malignant tumor arising in the liver, accounts for >90% of all primary liver cancer (3).

1.1.1 Epidemiology of HCC

Although HCC is the fifth most common cancer worldwide, its incidence is not evenly distributed. More than 80% of HCC cases are from sub-Saharan

Africa or Eastern Asia due to the prevalence of hepatitis B and C virus infection

(4, 5). In contrast, the HCC incidence is relatively low in North and South

America, Northern Europe and Oceania (Figure 1.1). However, the epidemiological pattern of new HCC cases has changed in recent years (6).

Decrease in HCC incidence has been reported in high-rate areas because of effective HBV and HCV vaccination (7). Meanwhile, the HCC incidence is

increasing in Western World due to increased HCV infection and cirrhosis cases

caused by excessive alcohol intake and nonalcoholic liver disease (NAFLD) (6).

Notably, in United States HCC is the fastest growing cause of cancer related

death in men (8).

In addition to uneven distribution of HCC in different regions, HCC

incidence also differs in male and female (Figure 1.1) (1). In most regions, the

HCC incidence is higher in male than that in female, with the ratios between 2:1

to 4:1. The reasons for higher incidence in male are not known. The fact that

men are more likely to be exposed to some risk factors such as HBV infection,

alcohol consumption, and cigarette smoking etc, may contribute to higher HCC

incidence. Interestingly, some mouse HCC models also show gender disparity in

HCC incidence, suggesting that some genetic or endogenous factors may cause

the difference in HCC incidence, rather than environmental factors. For example,

it has been shown that estrogen-mediated inhibition of IL-6 production reduces

liver cancer risk in females (9).

1.1.2 Risk factors for HCC

Like the different distribution of HCC, the risk factors for HCC also vary in

different regions. The major risk factors in high-rate regions such as East Asia

are chronic HBV and HCV infection. Another high risk factor in this area is the

consumption of food contaminated with carcinogen Aflatoxin B1 (AFB1) (10).

AFB1 is shown to be metabolized in liver and the active metabolite can cause

DNA damage by alkylating nucleic acids (11), which promotes carcinogenesis of

liver. In other low–rate HCC regions, a variety of risk factors may contribute to

the development of HCC, including chronic HCV infection (12), alcohol abuse,

NAFLD, obesity, tobacco, and diabetes (13).

1.1.3 Molecular genetics and epigenetics of HCC

Hepatocarcinogenesis is a complex, multiple-step process that involves

the accumulation of both genetic and epigenetic changes. Chromosome

instability has been frequently reported in human HCC, including loss of

heterogeneity (LOH) of chromosome 1p, 4q, 6q, 8p, 9p, 10q, 13q, 16q and 17p

(14, 15), and gain of 1q, 6p, 8q, 17q and 20q (16, 17). Most of these

chromosomal aberrations are associated with dysregulation of tumor

suppressors or oncogenes in HCC. For example, LOH at loci on chromosome

13q that leads to loss of expression of RB protein was detected in about 43% of

HCCs (18). RB is known to interact with E2F and inhibit cell cycle progression

(19). Thus, inactivation of RB protein results in rapid cell division and

uncontrolled cell proliferation, leading to the initiation and progression of HCC (20)

(Figure 1.2).

Besides chromosomal alterations, mutations in some oncogenes or tumor

suppressors have also been well documented. p53, a well-known tumor suppressor that plays an important role in cell cycle, apoptosis and DNA repair, has been found to be inactivated in HCC (10-60% of cases) by deletion,

missense or nonsense mutation (21, 22) (Figure 1.2). CTNNB1 gene, which

encodes β-catenin, a key factor in Wnt signaling pathway, is another frequently

mutated gene. It has been reported that 10-44% of HCC patients carry point

mutation in exon 3 of CTNNB1 gene (23, 24), the phosphorylation site for GSK3β,

which causes the constitutive activation of Wnt/β-catenin signaling pathway and

leads to the upregulation of its downstream targets, such as c-Myc.

Apart from RB, p53 and Wnt/β-catenin signaling pathway, several other

pathways such as TGFβ (25), Ras (26, 27), PI3K/PTEN/Akt (28, 29), MAPK (30,

31), and EGFR (32, 33) pathways have also been reported to be altered in HCC

(Figure 1.3). Alterations in these pathways result in increased cell survival and proliferation of hepatocytes and eventually development of HCC.

In addition to genetic alterations, epigenetic modifications especially DNA methylation also play an important role in hepatocarcinogenesis.

Hypermethylation in the promoter regions of tumor suppressor genes is associated with silencing of these genes that are involved in cell cycle regulation, apoptosis, cell adhesion and DNA repair. Several such tumor suppressor genes including RASSF1A (34, 35), P16 (36-38), P14 (37, 39), TIMP3 (35), E-

CADHERIN (40), MGMT (41, 42), and MLH1 (42) are frequently methylated and silenced in HCC. Besides the gene specific hypermethylation, global hypomethylation has also been shown to contribute to the initiation and development of HCC (43, 44). Hypomethylation leads to genomic instability and

loss of imprinting of some imprinted genes (45), such as IGF-2, both of which may significantly enhance carcinogenesis.

1.2 Animal models of HCC

Due to the complexity of hepatocarcinogenesis, the mechanisms underlying hepatocarcinogenesis are not well understood. Numerous animal models of HCC have been developed to better understand mechanisms of HCC development. These models provide valuable tools to investigate mechanisms involved in HCC initiation and progression, as well as evaluate new treatment strategies. Because of the high similarity between the mouse and human genomes and the availability of advanced gene targeting techniques, mouse models of HCC are more widely used to study HCC compared to other species, such as rat, dog, and woodchuck. Over the past several decades, three different types of mouse HCC models have been developed, including genetically engineered, xenograft and carcinogen induced model.

1.2.1 Genetically engineered mouse models

Since HBV and HCV infection are the prevalent risk factors in East Asia and sub-Saharan Africa, it is conceivable that overexpression of HBV or HCV coding genes may promote the development of HCC. Several transgenic mouse models expressing HBV X protein (HBx) (46-48) or HCV core protein (49-51) under the control of albumin promoter or virus promoters are known to develop

HCC with an incidence of 30-100%. Consistent with the known dysregulation of

oncogenes and tumor suppressor genes, transgenic mice overexpressing

oncogenes such as c-Myc (52-54) or β-catenin/Ras (55) also develop

spontaneous HCC with age at a very high frequency. Similarly, transgenic mice overexpressing growth factors, such as EGF (56, 57), FGF19 (58), and TGFα

(59-61), that are constitutively activated in HCC, induce the development of HCC.

Besides transgenic mice model, mice lacking tumor suppressor genes can also trigger HCC development. For example, 66% of male mice and 30% of female

Pten knockout mice (62, 63) develop spontaneous HCC by week 40-44 of age.

Genetically engineered models represent valuable tools for studying the roles of oncogenes, tumor suppressors or signaling pathways alone or in combination with carcinogens in hepatocarcinogenesis. However, most of these models are expensive and it takes relatively long time to generate these models and to develop tumors.

1.2.2 Xenograft mouse models

Xenograft model refers to the transplantation of cancer cell lines or tumor tissues taken directly from patients into immuno-deficient rodents, such as nude mice. Currently, xenograft model is the most commonly used model in liver cancer study. There are mainly two types of xenograft model, subcutaneous and orthotopic transplantation.

Compared to other mouse models, xenograft model has several advantages, including human origin of tumor, short latency for tumor development and rapid tumor growth and metastasis. Therefore, xenograft model is widely used to assess the tumorigenic and metastatic capacity of specific genes when overexpressed or knocked down in these cell lines. Another important application of this model is to test the therapeutic potential of anti- tumor drugs. Recently, xenograft model has also been used to test the tumorigenic potential of cancer stem cells (CSCs) or tumor initiating cells (TICs), and their self-renewal ability by serial transplantation. CSCs are a small population of cancer cells within a tumor that exhibit the capacity to initiate and sustain tumor growth (64, 65).

One major disadvantage of xenograft model is that the cells or tumor tissues are transplanted into immune-deficient mice and there is no immune surveillance for the development of tumors and hence no interaction between the host and tumors. Because of the rapid growth of xenograft tumors, it cannot reproduce the series of pathological changes during HCC development that usually takes years and involves steatosis, inflammation, fibrosis and dysplasia

(66).

1.2.3 Carcinogen induced mouse models

Some chemicals or carcinogens, such as AFB1, are known to cause liver damage and induce HCC. Two kinds of carcinogens have been identified,

7 namely genotoxic and non-genotoxic carcinogens (67). Genotoxic compounds, such as AFB1 and N,N-diethylnitrosamine (DEN), induce DNA structural changes and DNA damage directly or through their metabolites. Non-genotoxic carcinogens, such as phenobarbital (PB), do not directly modify DNA structure but promote HCC development after initiation by other hepatotoxic compounds.

To date, the most frequently used carcinogen to induce liver cancer is

DEN, a genotoxic compound that is activated by hydroxylation to α- hydroxylnitrosamine in liver by cytochrome P450 (68). Following several steps of chemical reactions, DEN is converted to ethyldiazonium ion, which causes DNA damage by reacting with DNA bases. DEN is usually administered to 15-day-old mice by single intraperitoneal injection and more than 80% of male mice develop spontaneous tumors after 45~104 weeks depending on the dose and mouse strain (69-72). DEN injection is often accompanied with administration of PB in drinking water, which functions as a promoting agent, to induce HCC (73). PB may promote HCC development in DEN model by increasing cytochrome P450 expression, inducing oxidative stress and/or causing hypermethylation of tumor suppressors (74-76).

Several widely used non-genotoxic carcinogen induced liver cancer models include diet-fed HCC models, such as high-fat (77), methionione and choline deficient diet (MCD) (78). These diets cause the accumulation of fat in livers and induce the complicated histopathological changes including steatosis,

8 inflammation, insulin resistance and fibrosis that are the hallmarks of human

HCC.

One major advantage of carcinogen induced HCC models is that they mimic the injury, inflammation, fibrosis and malignancy process that is commonly seen in human HCC. Therefore, this model is more favorable for investigating the mechanisms underlying the process of cancer initiation and progression.

However, it usually takes a long time for the development of tumors and the incidence varies depending on mouse strain.

1.3 Choline deficient and amino acid defined (CDAA) diet induced mouse

HCC model

In the present study, I used choline deficient and amino acid defined

(CDAA) diet induced mouse HCC model to investigate the mechanisms of hepatocarcinogenesis. A detailed description of this model as well as its advantages are outlined below.

Choline is an essential vitamin that functions as a precursor of structural phospholipids, phosphatidylcholine and sphingomyelin, and signaling lipids, platelet-activating factor and sphingosylphosphorylcholine (79). It is also the precursor for intracellular messengers, diacylglycerol and ceramide, as well as a neurotransmitter, acetylcholine (80) (Figure 1.4). Furthermore, choline can be oxidized to betaine, a source of methyl group for methionine, protein synthesis, and transmethylation reactions (81, 82). Therefore, choline plays an important

physiological role in human health and its deficiency causes severe diseases

such as fatty liver, growth impairment, and cardiovascular disease.

In 1945, Copeland and Salemon first reported that dietary deficiency of

several methyl group donors including choline induced liver cancer in AES rat

(83). In 1980s, several studies showed that it is the deficiency of choline, and to a lesser extent methionine, induces HCC in rat (84, 85). In contrast, deficiency of

other methyl group donors, such as folic acid or Vitamin B12, can cause non-

neoplastic lesions and enhance liver carcinogenesis, but does not possess

carcinogenic properties per se (86). In the late 1980s, Nakae et al. formulated

choline deficient (CD) and L-amino acid defined (CDAA) diet by replacing

proteins in commercially available CD diet with pure amino acids (87). Then they

investigated the histopathological changes in the livers of Fischer 344 rat fed

CDAA diet for different time (88) (Figure 1.5). The livers initially show subcellular

injury due to reactive oxygen species (ROS)-derived oxidative stress as revealed

by the increased 8-hydroxydeoxyguanosine (8-OHdG) level from day 1. Then fat

starts to accumulate and expand by week 1. Hepatocyte apoptosis and

regenerative proliferation are observed from week 4. Collagen fibers then start to

deposit around periportal area and extend to central vein to form bridging fibrosis

by week 12. With these sequential histopathological changes, preneoplastic

nodules are formed, and eventually tumors start to develop in rat livers from

week 30 and reach an almost 100% incidence by week 52. The majority of the

tumors are HCC, with some adenomas. Therefore, CDAA diet induced HCC

represents most of the progressive pathological changes during the initiation and

progression of human HCC. Similar pathological changes occur in mice fed

CDAA diet although at different time points. Mice fed CDAA diet develop NASH

at around week 32, preneoplastic nodules at week 65 and HCC at week 80.

The mechanisms underlying CDAA diet induced HCC is not fully understood. Several mechanisms may be involved in this process (Figure 1.6).

Choline deficiency is well known to cause fatty liver by reducing very low density lipoprotein synthesis and triglyceride secretion (89). It has been shown that fat accumulation may promote liver tumor development by inducing IL-6 and TNF-α expression (77). IL-6 and TNF-α as well as several other factors such as NF-κB

(89, 90) and TGFβ (91, 92), are involved in the proliferation of hepatocytes, activation of stellate cells and thus fibrogenesis. Choline deficiency also induces oxidative stress (86, 93), which may cause DNA injury and gene mutation.

Furthermore, choline functions as a methyl group donor and is involved in the methionine and S-adenosyl methionine (Ado-Met) metabolism. Therefore, deficiency in choline may inhibit transmethylation reactions such as DNA methylation, resulting in hypomethylation (94). As discussed above, hypomethylation also promotes HCC development.

1.4 microRNA

microRNAs (miRNAs) are a class of small (~22nt), non-coding RNAs that posttranscriptionally repress target gene expression by pairing with mRNAs of

protein coding genes, mainly in the 3’ untranslated regions (UTR) (95). Since the

identification of the first miRNA lin-4 in Caenorhabditis elegans in 1993 (96, 97),

thousands of miRNAs have been found in plant, viruses, and animals (98). It has

been shown that each miRNA can target more than one hundred genes (99).

Furthermore, more than 60% of protein coding genes are predicted to have at

least one miRNA binding site in their 3’UTR (100). Therefore, miRNAs constitute

a large gene regulatory network that plays important roles in various

developmental and physiological processes.

1.4.1 Biogenesis of miRNAs in animals

About 50% of miRNA genes are located close to other miRNAs and form

miRNA clusters that are transcribed as a single transcription unit (101). Based on their genomic locations, miRNA genes can be classified into four groups: intronic miRNAs in protein coding transcripts, intronic miRNAs in non-coding transcripts, exonic miRNAs in protein coding transcripts and exonic miRNAs in non-coding transcripts (102).

Like other protein coding genes, most of miRNAs in animals are transcribed by RNA polymerase II (Pol II) as long, 5’capped and 3’ polyadenylated primary miRNA (pri-miRNA) transcripts that contain a hairpin structure (103, 104). Following transcription, pri-miRNAs are processed to precursor miRNAs (pre-miRNAs) and mature miRNAs by RNase III endonucleases (101, 105). There are mainly three miRNA biogenesis pathways:

canonical pathway, canonical intronic pathway and noncanonical intronic

pathway (102)(Figure 1.7). Most of miRNAs are processed through canonical

pathway, in which pri-miRNAs are first recognized and trimmed into ~70-nt

hairpin-structured pre-miRNAs by a large complex in the nucleus (106-108). The multi-protein complex, termed Microprocessor, contains an RNase III protein

Drosha, a double-stranded RNA (dsRNA) binding protein DGCR8 (109, 110) and other cofactors, such as the DEAD-box helicases and heterogeneous nuclear ribonucleoproteins (hnRNPs) (106). After cleavage, the hairpin-structured pre- miRNAs are recognized and transported to cytoplasm by exportin 5 and RAN-

GTP (111-114). In the cytoplasm, pre-miRNAs are further cleaved near the terminal loop into ~22-nt mature miRNAs by another dsRNA specific RNase III enzyme, Dicer (115-118), together with dsRNA binding proteins TRBP2 (119,

120) and PACT (121), whose function is not well understood yet.

Apart from canonical pathway, some miRNAs are processed through

canonical intronic pathway. Recent studies showed that Drosha cleavage of

some intronic miRNAs precedes the splicing of the host transcripts, but this

cleavage does not interfere with the ensuing splicing (122) (Figure 1.7). In

contrast, Drosha processing of some exonic miRNAs by this pathway may

destabilize the host transcripts and reduce protein expression (123). Some

intronic miRNAs (Mirtrons) are generated by non-canonical intronic pathway

(Figure 1.7), in which they are first processed by splicing complex and released

13 as the hairpin structure that resembles pre-miRNA (124-126). Therefore, their processing is independent of Drosha cropping.

1.4.2 Mechanisms of gene silencing mediated by miRNAs

Following Dicer cleavage, the ~22-nt mature miRNAs are loaded to

Argonaute (AGO) proteins and form the effector complex, miRNA-induced silencing complex (miRISC) (127-129), which is guided to target mRNAs through partial complementarity and inhibit their expression post-transcriptionally.

Although it is long believed that mammalian miRNAs repress target gene expression mainly at the level of translation (130, 131), recent studies suggest that they also function by decreasing target mRNA levels (132). In vitro and in vivo studies have suggested several mechanisms that may be involved in translation inhibition and mRNA degradation by miRNAs (133, 134) (Figure 1.8).

It has been shown that miRNAs may repress target mRNA translation at different stages, including initiation and post-initiation stages (135). As we know, translation initiation requires factors that are associated with 5’cap and 3’ poly-(A) tail of mRNAs, such as subunits of eukaryotic translation initiation factor (eIF) eIF4F, 4G and polyadenylate-binding protein 1 (PABP1) (136). Interaction between these factors brings the 5’ and 3’ end of mRNAs in proximity to form the mRNA circularization, which facilitates the translation initiation by promoting the recruitment of eIF4E and 40S ribosome. Some studies showed that translation of

5’ m7G-Capped mRNA, but not mRNA with IRES or non-functional ApppN cap is

inhibited by miRNA (137-139), suggesting miRNA may function at the initiation

stage. It has been shown that AGO proteins may compete with eIF4E for 5’cap

binding, thus interfering with the recruitment of 40S ribosome (140). AGO was

also shown to associate with eIF6 and 60S ribosome subunits and may prevent

large ribosome from joining 40S ribosome (141).

Apart from repressing translation initiation, evidence also suggested that

miRNAs may function at translation elongation stage. Studies have shown that

miRNA and their target mRNAs are associated with polysomes in sucrose

sedimentation gradient despite the fact that protein production from these

mRNAs is severely reduced. Interestingly, these polysomes are capable of active

translation as they are sensitive to various translation inhibitors (142-144). Two

models have been proposed to explain translation elongation inhibition by

miRNAs: premature dissociation of ribosomes (drop-off model) and co-

translational protein degradation model. However, further studies are needed to

decipher the exact mechanisms.

As mentioned above, miRNAs not only inhibit mRNA translation but also induce mRNA degradation. Recent studies suggested that the latter may be the predominant mechanism (132). It has been shown that GW182, a P body protein that interacts with AGO proteins, is recruited to miRNP and marks the target mRNAs for degradation (145, 146). This process is mediated by mRNA

deadenylase complex CAF-CCR4-NOT, the decapping enzyme DCP2 and some

other cofactors. Recruitment of these factors causes the deadenylation and

decapping of target mRNAs, and thus leads to mRNA degradation.

1.4.3 miRNA and cancer

Over the past several years, many studies have proved that miRNAs play

important physiological roles in almost every aspect of biological processes,

including development and differentiation, immune response, metabolism, cell

proliferation and apoptosis (147). Consequently, dysregulation of some miRNAs

has been shown to be involved in the pathogenesis of a variety of diseases, such

as vascular diseases, immunological diseases, neurological disorders, and

cancer (148-150). miRNA profiling analysis has identified hundreds of miRNAs

that are dysregulated in almost all types of human cancers (151). Like other

protein coding genes, miRNAs can also function as tumor suppressor or

oncogenes (152). It has been shown that some miRNAs, are downregulated in

various kinds of cancers and function as tumor suppressors by targeting

oncoproteins, such as let-7 family members targeting HMGA2 (153, 154), RAS

(155), c-Myc (156). In contrast, some miRNAs are upregulated and function as oncogene in cancer. For example miR-21, a well-known oncomir, is upregulated in liver (157), breast (158), lung (159), prostate (160), colon (161), pancreas cancer (162), glioma (163), and leukemia (164).

Several mechanisms have been shown to be involved in the dysregulation of miRNAs expression including amplification, deletion or mutation of miRNA

genes, dysregulation of transcription factors regulating miRNA transcription, and epigenetic regulation, such as DNA methylation (152).

1.4.4 miRNAs in liver cancer

As in other cancers, miRNA profiling analysis has identified a series of

miRNAs that are altered in liver cancer (165-168). Some of these miRNAs have

been shown to be dysregulated in a variety of HCCs. For instance, miR-96 was

reported to be specifically upregulated in HBV-related HCCs (169). Similarly,

miR-126* was found to be distinctly repressed in alcohol-related HCC (170). In

contrast, some miRNAs are commonly deregulated in HCCs regardless of the

causing agents. For example, miR-122, the most abundant miRNA in liver, is downregulated in the majority of HCCs, including HBV, HCV-related HCC (171,

172), as well as NAFLD derived HCC (173). miR-21 and miR-221/222 are

commonly upregulated in HCCs of different etiology (157, 174).

These deregulated miRNAs are shown to be involved in various aspects

of HCC development and progression, including cell proliferation, apoptosis, and

metastasis. miR-122 has been shown to suppress cell cycle progression by

targeting cyclin G1, and in turn affect p53 stability and transcriptional stability,

resulting in the decrease in G2-M phase (175). miR-122 also mediates HCC cell

migration and invasion by targeting ADAM10, SRF and IGF1R (176). Oncogenic miR-221 has been reported to promote cell proliferation by targeting p27, a cyclin-dependent kinase inhibitor (177), and DDIT4, an mTOR signaling regulator

(174). miR-221 also facilitates HCC metastasis probably by regulating PTEN and

TIMP3 (178).

Recent studies suggest some miRNAs may have great clinical significance in HCC. miR-500 has been found to be increased in the sera of HCC patients and its level returned to normal after surgical treatment, suggesting it may be used as a diagnostic marker of HCC (179). Similarly, serum miR-122 and miR-223 levels were shown to be significantly higher in HCC patients than those in healthy controls by several groups and may serve as diagnostic markers (180-

182). Some other miRNAs have been shown to be associated with clinic- pathological characteristics of human HCC patients, including metastasis, prognosis and reoccurrence (183). Low expression of miR-199a/b-3p was found to correlate with poor survival of HCC patients (184). HCC patients with lower miR-26 expression were shown to have shorter overall survival than those with higher expression (185). Similarly, downregulation of miR-99a correlates with poor prognosis of HCC patients (186).

All these reports support the importance of miRNAs in the initiation and progression of HCC. Due to the heterogeneity of HCC, it will be of great interest to identify other miRNAs that are potentially involved in HCC and to elucidate their role in HCC development.

Figure 1.1 Liver cancer incidences in male and female in the world.

Reprinted, with permission, from Thun M J et al (187).

Figure 1.2 Dysregulation of RB and p53 signaling pathways in HCC. Yellow and blue denote potential oncogenic and tumor suppressive factors, respectively.

The type of their dysregulation in HCC is shown in red. Inactivation of RB caused by LOH, mutation, or hypermethylation results in the release of E2F proteins and cell cycle progression through G1 into S phase. LOH or mutation of p53 decreases the expression of p21, which prevents cell cycle progression through

S phase by inhibiting Cdk2 expression. Reprinted, with permission, from Nishida

N and Goel A (20).

Figure 1.3 Signaling pathways altered in HCC

Wnt/β-catenin, PI3K/PTEN/AKT, TGFβ/IGF2R and IL-6/IL-6R/gp130 signaling pathways are activated in HCC, which result in enhanced cancer stemness, proliferation, and survival. Activation of Wnt signaling results in accumulation and nuclear translocation of β-catenin, which forms EpICD/FHL2/ β-catenin/LEF1 and

β-catenin/TCF/LEF1 complexes that mediate Wnt target genes expression, such as c-Myc, CyclinD1, and Epcam. Activation of PI3K pathway phosphorylates and activates AKT, which promotes cell survival by suppressing BAD, Caspase9 and

FKHRL1 expression. Phosphorylated AKT also promotes cell cycle progression through activating mTOR pathway. Loss of IGF2R enhances cell proliferation by accumulation of IGF2 and activation of TGFβ signaling pathway. Reproduced, with permission, from Kumar M et al (188).

Figure 1.3

Figure 1.4 Choline Metabolism pathways.

Abbreviations: PtdEtn, phosphatidylethanolamine; AdoHcy, S-adenosylhomocyst eine; SAM, S-adenosylmethionine; PEMT, phosphatidylethanolamine methyltran sferase; MTHFR, methyltetrahydrofolate reductase. Reproduced, with permission,

from Zeisel SH (189).

Figure 1.5 Pathological changes in CDAA diet induced HCC. Choline deficient diet causes a series of pathological changes in liver including apoptosis, steatosis, fibrosis and preneoplastic foci that lead to the development of adenoma and carcinoma.

Figure 1.6 Potential mechanisms involved in CDAA diet induced HCC.

Chronic feeding of CDAA diet causes fatty liver, DNA hypomethylation and oxidative stress that result in altered signaling transduction, gene expression and mutation, which contribute to the development of HCC. Reproduced, with permission, from Nakae D (88).

Figure 1.7 Biogenesis pathways of microRNAs a. Canonical pathway. miRNA genes are transcribed into pri-miRNAs by Pol II in the nucleus and cropped by Drosha and cofactors into pre-miRNAs, which is exported into cytoplasm and further digested by RNase III enzyme Dicer into mature miRNAs. b. Canonical intronic pathways. Pri-miRNAs are processed by

Drosha and cofactors prior splicing. c. Noncanonical intronic pathway. Pre- miRNAs are produced from splicing and therefore bypass Drosha-processing step. Reprinted, with permission, from Kim NV. et al (102).

Figure 1.7

Figure 1.8 Mechanisms involved in miRNA mediated gene silencing

A. Posttranslational initiation mechanisms: miRNAs block translational elongation

or promote dissociation of ribosomes (drop-off model). B. Co-translational protein

degradation. C-E. Initiation mechanisms: Ago proteins compete with eIF4E for

binding to cap structure (C), Ago protein recruit eIF6 and prevent the large

ribosomal subunit from joining the small subunit (D), Ago proteins inhibit mRNA

circularization by deadenylation (E). F. miRNA-mediated mRNA degradation. miRNAs promote mRNA cleavage by deadenylation and decapping. Reprinted, with permission, from Eulalio A (134).

Figure 1.8

Chapter 2 Role of miR-155 at Early Stages of Hepatocarcinogenesis

Induced by Choline-Deficient and Amino Acid Defined Diet in C57BL/6 Mice

2.1 Abstract

Here, we report identification of hepatic microRNAs that are dysregulated at early stages of feeding C57BL/6 mice choline deficient and amino acid defined

(CDAA) diet that is known to promote nonalcoholic steatohepatitis (NASH)-

induced hepatocarcinogenesis after 84 weeks. Microarray analysis identified 30

hepatic microRNAs that are significantly (P≤0.01) altered in mice fed CDAA diet

for 6, 18, 32 and 65 weeks compared to those fed choline sufficient and amino

acid defined diet. Real-time RT-PCR analysis demonstrated upregulation of

oncogenic miR-155, miR-221/222 and miR-21 and downregulation of the most

abundant liver specific miR-122 at early stages of hepatocarcinogenesis.

Western blot analysis showed reduced expression of hepatic PTEN, a target of

miR-21, and C/EBPβ, a target of miR-155, in these mice at early stages. DNA

binding activity of NF-κB that transactivates miR-155 gene was significantly

(P=0.002) elevated in the liver nuclear extract of mice fed CDAA diet. Further, the

expression of miR-155, as measured by in situ hybridization and real-time RT-

PCR, correlated with diet-induced histopathological changes in the liver. Ectopic

expression of miR-155 promoted growth of HCC cells whereas its depletion

inhibited cell growth. Notably, miR-155 was significantly (P=0.0004) upregulated

in primary human HCCs with concomitant decrease (P=0.02) in C/EBPβ level

compared to matching liver tissues. In conclusion, we showed that temporal

changes in microRNA profile occur at early stages of CDAA diet-induced

hepatocarcinogenesis. Reciprocal regulation of specific oncomirs and their tumor

suppressor targets implicate their role in NASH-induced hepatocarcinogenesis

and suggest their use in the diagnosis and prognosis of liver cancer.

2.2 Introduction

Hepatocellular carcinoma (HCC) is the fifth most prevalent cancer in the

world with annual death rate exceeding 500,000 (1, 192). The low survival rate is

probably due to the late stage diagnosis of this cancer. Primary hepatocellular

carcinoma, the most common primary malignant tumor of the liver, accounts for

>90% of all primary liver cancers. The development of hepatocellular carcinoma

is a complex, multi-step process that is generally characterized by steatosis,

hepatocyte degeneration, fibrosis, inflammatory infiltrates and Mallory’s hyaline

(193). The incidence of non-alcoholic fatty liver disease (NAFLD) is increasing

dramatically, particularly in Western world, which can lead to an increase in the

prevalence of non-alcoholic steatohepatitis (NASH) and associated complications such as cirrhosis and HCC (194). NASH can also be associated with obesity, diabetes and insulin resistance all of which can contribute to an increased risk of

HCC. While our understanding of the pathogenesis of HCC in chronic viral

infections such as hepatitis B or hepatitis C is improving, there is a complete lack

of insight into the pathogenesis of NASH-associated HCC. Consequently, it is

critical to delineate the molecular mechanisms involved in NASH-mediated

hepatocarcinogenesis. An interesting and novel strategy is to determine changes

in the expression profiles of specific microRNAs (miRNAs) and their target

mRNAs at different stages of liver tumorigenesis in an animal model. Such

exploration is likely to provide important information regarding the miRNA

signature and their target mRNAs at very early stage of liver tumorigenesis and

its relationship to the miRNA signature of primary human hepatocellular

carcinoma that can be used in the diagnosis and prognosis of liver cancer.

MicroRNAs (miRNAs) are conserved small, non-coding RNAs identified in

plants, animals and viruses (134) that, in general, negatively regulate gene expression by interacting with the 3’-UTR of protein coding genes (195). Primary miRNAs predominantly transcribed by RNA polymerase II are processed to precursor miRNAs (pre-miRs) by Drosha/DGCR8 in the nucleus (196). Pre-miRs are transported to the cytoplasm by Exportin 5 to undergo further processing by

DICER1 to mature miRNAs that are recruited by miRNA-induced gene silencing complex (miRISC) to exert their biological functions.

Recent studies have identified an important role for miRNA in several human cancers including human hepatocellular cancer (197, 198). The expression profiling studies in human hepatocellular cancer have identified aberrant expression of several miRNAs (151). These signatures have the

potential of use as markers of disease progression and prognosis, and may

serve as therapeutic targets. Elucidating the role of aberrant miRNA expression

at early stages in hepatocarcinogenesis is likely to enhance understanding

pathogenesis of the disease.

While different animal models of hepatocarcingenesis are reported, a dietary model of NASH associated with progressive disease resulting in HCC (88,

190) is of particular interest. Rodents on this diet show well-defined pathological

changes that are markedly similar to the progression of liver cancer in humans.

We used a recently developed mouse model to identify temporal changes in

miRNA expression with the goal to elucidate the role of specific miRNAs in the

initiation and progression of hepatocarcinogenesis. Here, we show that some of

the key oncomirs and their tumor suppressor targets are reciprocally regulated in

murine dietary NASH model that mimic altered miR expression profile in primary

human hepatocellular carcinomas.

2.3 Materials and Methods

Mice and diet. All animal experiments were carried out under protocols

approved by the Ohio State University Institutional Laboratory Animal Care and

Use Committee. C57BL/6 mice from Jackson Lab were maintained in a sterile

room at 25oC with a 12h light-dark cycle and provided food and water ad libitum.

Male mice (6 weeks old) were fed CDAA or CSAA diet as described (190). Five

33 mice were used in each diet group for each time point. The compositions of the diets are provided in the Supplementary Materials. The weight gain of the mice was comparable in both diet groups. Lombardi’s choline-deficient (0g/Kg), low methionine (1.7g/Kg) and amino acid-defined diet (CDAA diet, #518753) from

Dyets Inc, Philadelphia was used to feed mice for different time periods. As a control diet, we used choline sufficient (14.48g/Kg), amino acid defined diet

(CSAA diet, #518754) fortified with methionine (4g/Kg). Both diets were supplemented with AIN-76A Vitamin mix (#300050), providing 0.2% Folic acid

(w/w) to the diet.

Microarray analysis. Microarray analysis was performed as described (199).

Briefly, 5 microgram of total RNA was used for hybridization of miRNA microarray chips. The chips were hybridized in 6XSSPE at 37°C. The miRNAs were labeled as biotin-containing transcripts and detected by streptavidin-Alexa647 conjugates.

The processed slides were scanned using a microarray scanner. The miRNA nomenclature was according to miRBase (http://microrna.sanger.ac.uk).

The alteration in the level of microRNAs was considered statistically significant if their P-value was lower than 0.01. We also performed a global test to determine whether the expression profiles differed between the classes by permuting the labels of each array corresponded to each class. For each permutation, the P values were re-computed and the number of genes significant at the 0.01 level was noted. The proportion of the permutations that gave at least

as many significant genes as with the actual data was the significance level of

the global test: P=0.003 for the randomized block design and P=0.025 for the

paired t test.

Microarray data analysis. Average values of the replicate spots of each miRNA

were background-subtracted and subjected to further analysis. Data normalization was performed by using quantiles. Minimal miRNAs expression was set to 75. Genes showing minimal variation across the set of arrays were excluded from the analysis. Accordingly, 175 miRNAs whose expression differed by at least 1.5 fold from the median in at least 5% of the arrays were subjected to further statistical analysis. This filtering was applied to limit the number of false positive findings.

To control the time of treatment while comparing classes, we used two

approaches. As a first choice we used the analysis of variance with a randomized

block design. Two linear models are fit to the expression data for each miRNA.

The full model includes class variable (diet/control) and the block variable (time

course), and the reduced model includes only the block variable. Likelihood ratio

test statistics were used to investigate the significance of the difference between

the two classes. As an alternative approach we used a paired t test where pairs

were assigned according to the time span of diet.

Real-time reverse-transcription polymerase chain reaction (RT-PCR) for quantification of mature miRNAs. Total RNA was isolated from liver tissues and cell lines by Trizol (Invitrogen), according to the manufacturer’s protocol.

For mature miRNA expression, reverse transcription was performed following

Applied Biosystems TaqMan MicroRNA Assay (Applied Biosystems, Foster City,

CA) protocol. PCR reaction mixtures included the TaqMan 20xmiR mix and

TaqMan Universal PCR Master Mix in a total volume of 10µl. Reaction was performed using Stratagene Mx3000 instrument. Cycling parameters were as follows: 95ºC for 10 minutes followed by 40 cycles at 95ºC (15 sec) and annealing/extension at 60ºC (1 min). All reactions were performed in triplicate.

Normalization was performed with the 18S rRNA or RNU6B. Relative expression was calculated using the comparative CT method (200, 201).

Cell lines and HCC Tumor tissue. HCC cell lines obtained from ATCC were cultured as recommended by the supplier. Primary human hepatocellular tumor and adjacent normal tissue samples were obtained from the Cooperative Human

Tissue Network at The Ohio State University James Cancer Hospital. Tissue specimens were procured in accordance with The Ohio State University Cancer

Internal Review Board guidelines.

Immunohistochemical analysis. Immunohistochemical staining of the human primary tumor samples was performed on formalin-fixed, paraffin-embedded

specimens using the Ventana Benchmark System (Ventana Medical Systems,

Tuscon AZ) according to the manufacturer’s recommendations.

Transfections. For miR precursor or anti-miR transfection, cells were plated in

60 mm dishes and transiently transfected with 50 nM pre-miR-155, negative control RNA, 60nM anti-miR-155 inhibitor, or control anti-sense RNA (Applied

Biosystems, Foster City, CA).

Western blot analysis. Whole cell or tissue extracts were prepared in SDS lysis buffer (50mM Tris-HCl, pH 7.5, 10% glycerol, 2%SDS and 1mM DTT). Total protein (50-200μg) was resolved by SDS-PAGE, transferred to the nitrocellulose membrane, and subjected to immunoblot analysis. The following antibodies were used for this study: anti-C/EBPβ (cat# sc-150), anti-p50 (cat# sc-114x), anti-p65

(cat# sc-109x) and PTEN (sc-7974) (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-GAPDH (cat# mAB 374) (Millipore, Billerica, MA). The signal was developed with ECLTM (GE Healthcare, Piscataway, NJ) or Chemiluminescent

Peroxidase Substrate (Sigma-Aldrich, St. Louis, MO) after incubation with

appropriate secondary antibodies.

Cell proliferation assay. Cell proliferation was monitored using Cell Proliferation reagent Kit I (MTT) (Roche Molecular Biochemicals). HCC cells (2500-5000

cells/well) transfected with pre-miR-155 or anti-miR-155 inhibitor were allowed to

grow in 96-well plates. Cell proliferation was documented every 24 hr following

the manufacturer’s protocol. To measure cell proliferation, 10µl of MTT labeling

reagent was added to each well and incubated at 37oC for 4 hr followed by the

addition of 100µl solubilization reagent in each well. Absorbance was measured

at 570 nm in the ELISA reader (Tristar, Berthold technology) after overnight

incubation. All experiments were performed in quadruplicate and the results are

mean of three separate experiments.

Isolation of nuclei and preparation of nuclear extract. Nuclei were isolated

from the liver as described before (202). Briefly, minced liver tissues were

homogenized in high-density sucrose buffer (2 M sucrose, 10 mM HEPES [pH

7.6], 25 mM KCl, 1 mM EDTA, 10% glycerol, 0.15 mM spermine, 0.5 mM

spermidine, and protease and phosphatase inhibitor cocktails [Sigma]) and isolated by sucrose density gradient centrifugation following Gorski et al (202).

The nuclei were resuspended in nuclear lysis buffer (10 mM HEPES [pH 7.6],

3 mM MgCl2, 100 mM KCl, 10% glycerol, 0.1 mM EDTA, 1 mM dithiothreitol [DTT]

along with protease and phosphatase inhibitor cocktails) and lysed by adding

1.2 M KCl dropwise to a final concentration of 0.4 M. After rocking at 4ºC for

30 min, the soluble proteins were collected by centrifuging at 100,000 × g for

30 min at 4°C. The extracts were snap-frozen in small aliquots in liquid N2 and

stored at 80°C.

EMSA. Liver nuclear extracts were prepared from the livers of control and diet

mice as described (202, 203) and incubated with α-32P-labeled specific

oligonucleotides (0.2ng) in the binding buffer containing 10 mM Tris HCl (pH 8.0),

150 mM KCl, 0.5 mM EDTA, 0.1% Triton-X-100, 1 mM DTT, 0.2 µg of poly(dI- dC)/µg of protein, and 12.5% glycerol. For the supershift or competition assay,

the nuclear extract was incubated in binding buffer on ice with antibodies or unlabeled oligonucleotides (20ng) before addition of the labeled oligonucleotide.

The DNA-protein complexes were separated by polyacrylamide (5% acrylamide)

gel electrophoresis with 0.5XTBE as running buffer, and analyzed by

autoradiography. The sequences of the deoxyoligonucleotides used in EMSA

were as follows: 1, NF-κB consensus oligo: 5'-AGT TGA GGG GAC TTT CCC

AGG C-3'; 2, NF-κB mutant oligo: 5'-AGT TGA GGC GAC TTT CCC AGG C-3'; 3,

miR-155/BIC NF-κB binding site: 5’-TGG GAT TTC C-3’.

LNA-ISH. In brief, the tissue was deparaffinized, proteased (30 minutes in 2

mg/ml of pepsin in RNase free water), washed in sterile water, then 100%

ethanol, and air-dried. For each miRNA studied, LNA modified

deoxyoligonucleotide probe (antisense to miR-155, miR-122 or scrambled) was

used. Hybridization was done at 37oC overnight and followed by a wash in

0.2XSSC and 2% bovine serum albumin at 15oC. The probe-target complex was

seen due to the action of alkaline phosphatase (as part of the streptavidin

complex) on the chromogen nitroblue tetrazolium and bromochloroindolyl

phosphate (NBT/BCIP) (Enzo Diagnostics). Nuclear fast red served as the

counterstain. Scrambled oligos were used as negative controls.

Statistical analysis. Statistical significance of differences between groups was analyzed by unpaired Student’s t test, and P≤0.05 was considered to be statistically significant. Paired Student’s t test was used to analyze differences in expression of microRNAs and mRNAs levels among tumors and paired nontumor tissues in real-time RT-PCR analysis. Single and double asterisks indicate

P≤0.05 and P≤0.01, respectively. The correlation between miR-155 and C/EBPβ mRNA levels was analyzed by two-tailed Pearson Correlation Test. All real-time

RT-PCR (assayed in triplicate), western blotting and transfection experiments were repeated twice and reproducible results were obtained. A representative data is presented in each experiment.

2.4 Results

2.4.1 Temporal changes in hepatic microRNA expression profile occur at early stages of hepatocarcinogenesis induced by CDAA diet

Choline-deficient, low methionine and amino acid-defined diet (CDAA diet) is known to induce liver tumors in C57BL/6 mice (88, 190) that are normally resistant to hepatocarcinogenesis. Mice on CDAA diet develop NASH at early

stages leading to the formation of preneoplastic nodules after 65 weeks, and

hepatocellular adenomas and carcinomas after 84 weeks (88, 190) (Figure 1.5).

To identify miRs that may play a causal role in hepatocarcinogenesis we

performed microarray analysis of hepatic RNA in mice fed CDAA diet for different

time periods. The result showed deregulation of 30 miRNAs (P≤0.01) in mice fed

CDAA diet for 6, 18, 32 and 65 weeks compared to those fed CSAA (control) diet

(Figure 2.1). Among these miRNAs, 17 were upregulated and 10 were

downregulated in at least one time point (Table 2.1). The upregulated miRs in

mice fed CDAA diet can be broadly classified into four groups based on their

expression: a) microRNAs such as miR-155, miR-221, miR-222, miR-34a, miR-

223, miR-342 and miR-16 consistently upregulated and remained high from 18 to

65 weeks; b) miR-181, miR-150, miR-99b, miR-214, miR-142 and miR-195 increased at 32 and 65 weeks; c) miR-17, miR-346 and miR-20b upregulated transiently at 32 weeks; and d) miR-200 and miR-487a elevated only at 65 weeks.

Based on this temporal pattern of expression of several miRs, it is conceivable that the targets of each miR are likely to be involved in precise control of diet- induced pathological changes in the liver. It is notable that some of these miRs, such as miR-221/222, miR-181b, miR-34a, miR-214, miR-16, and miR-99b, are also upregulated in the livers of human NASH patients (173).

2.4.2 Real-time RT-PCR analysis confirmed upregulation of several miRNAs

including oncogenic miR-155, miR-221, miR-222, miR-21 and downregulation of miR-122 in mice fed CDAA diet

Next we confirmed dysregulation of a few critical miRs by real-time RT-

PCR analysis of mature miRs. The result showed that hepatic miR-155 known to be induced by inflammatory mediators (204) was upregulated (~2.3 fold)

(P=0.003) in animals fed CDAA diet for 18 weeks and remained elevated after 32 weeks (P=0.005) and 65 weeks (P=0.005) compared to that in the control mice

(Figure 2.2A). We also observed significant upregulation of miR-221 (~1.5 fold)

(P=0.0005) at early stage (18 and 32 weeks) (Figure 2.2A) suggesting that it may play a key role in the NASH. Interestingly, miR-222 processed from the same primary transcript of miR-221 was also elevated (~1.5 fold) (P=0.02) after feeding CDAA diet for 18 and 32 weeks (Figure 2.2A). Unlike miR-221, miR-222 level remained elevated even after 65 weeks that may be due to differential processing of these two miRs. Notably, maximal increase in most of these miRs expression was observed after 32 weeks.

While microarray analysis did not reveal significant alteration in the expression of miR-21, an oncomir upregulated in many solid tumors including

HCC (157), RT-PCR analysis showed small but significant increase in miR-21 after 18 weeks (P=0.0006) which persisted after 32 (P=0.006) and 65 weeks

(P=0.03) of feeding CDAA diet (Figure 2A). In contrast, the level of miR-122, the most abundant (70%) hepatic miR and frequently downregulated in NASH (173)

and HCC (205), decreased by 40% (P=0.006) at 65 weeks (Figure 2.2A).

Northern blot analysis confirmed the real-time RT-PCR data of these two miRs

(Figure 2.2B and C). In situ hybridization with LNA-modified anti-miR-122 probe also showed decrease in miR-122 positive hepatocytes in mice fed CDAA diet for

65 weeks (Figure 2.2D). No signal was detected with scrambled oligo demonstrating specificity of the probes (data not shown). Taken together, these results demonstrate dysregulation of both oncogenic and tumor suppressor miRs at early stages of CDAA diet-induced hepatocarcinogenesis, which is consistent with their differential expressions in primary human HCC (157, 205).

2.4.3 Histopathological analysis revealed NASH in mice fed CDAA diet that correlated with higher miR-155 level

Mice fed CDAA diet had higher level of steatosis (90% as opposed to 30-60% in the control livers) (Table 2.2). A representative histopathology profile is presented in Figure 2.2E. Moderate inflammation occurred in the livers of mice fed CDAA diet for 32 weeks. Mice fed control diet had negligible NASH (score 1-

2 points) whereas mice fed CDAA diet exhibited higher NASH (5 points) (Table

2.2). Although animals on both diet groups developed marked steatosis after 65 weeks (Figure 2.2E), inflammation was more prominent in CDAA diet group

(Table 2.3). Dysplastic nodules were apparent in one liver (CDAA #2). Notably,

3 out of 4 mice developed NASH after 65 weeks on CDAA diet whereas none from the CSAA fed group exhibited NASH (Table 2.3).

Next we investigated whether diet-induced histopathological changes in the liver correlated with dysregulation of miR-155, known to be induced by inflammatory mediators (204), by LNA-ISH. The results showed high level of

miR-155 in the cytoplasm of hepatocytes and inflammatory cells in mice fed

CDAA diet for 32 weeks (Figure 2.2F). Although miR-155 was detectable only in

a few steatotic hepatocytes in the livers of age-matched mice fed control diet, the

number of miR-155 positive cells correlated with the extent of inflammation in

each mouse (Table 2.2 and 2.3). No signal was detected with scrambled oligo

demonstrating specificity of the probes (Figure 2.2F). Further, real-time RT-PCR analysis of miR-155 expression level in individual mouse positively correlated with the number of miR-155 positive cells as well as the extent of inflammation in these mice, suggesting that miR-155 could play a causal role in the CDAA diet-

induced pathogenesis.

2.4.4 CDAA diet induced activation of NF-κB upregulated hepatic miR-155

Next, we sought to identify the transcription factor that plays a key role in

upregulation of hepatic miR-155 in mice fed CDAA diet. Since miR-155 level correlated with diet-induced inflammation (Table 2.2 and 2.3) and NF-κB is known to activate miR-155 expression (206), we performed EMSA with liver nuclear extracts from mice on CSAA or CDAA diet for 32 weeks. A specific complex was detected with 32P-labeled NF-κB probe in the liver nuclear extracts

from mice fed CSAA diet that was 2 fold increased (P=0.002) in the mice fed

CDAA diet (Figure 2.3A, compare lanes 12-15 to 2-5 and Figure 2.3B). The

competition of the complex by an excess of unlabeled wild type but not the

mutant oligo (Figure 2.3A, lanes 6, 7 and 16, 17), and supershift of this complex

with antibodies specific for p65 and p50 subunits of NF-κB (Figure 2.3A, lane 8,

9 and 18, 19) confirmed its identity with NF-κB. Further, an excess of a duplex oligo encompassing NF-κB cognate site in miR-155 promoter was also able to

compete out the complex formation (Figure 2.3A, lanes 10 and 20), indicating

that NF-κB could bind to this site on miR-155 promoter.

2.4.5 The tumor suppressors C/EBPβ and PTEN, respective targets of miR-

155 and miR-21, were down regulated in the livers of mice fed CDAA diet

Next, we identified the possible target of miR-155 that may potentially be

involved in diet-induced hepatocarcinogenesis. C/EBPβ, a tumor suppressor

frequently suppressed in HCC (207), is a validated target of miR-155 (208).

C/EBPβ harbors a conserved miR-155 site in its 3’UTR (Figure 2.4A). Western blot analysis showed reduced expression of C/EBPβ in Hep3B and HepG2 cells transfected with pre-miR-155 (Figure 2.4B), indicating miR-155 can target

C/EBPβ in HCC cells. Next we checked C/EBPβ expression in the livers of mice fed CDAA diet. Its mRNA level decreased by ~50% after 32 (P=0.03) and 65

(P=0.024) weeks in mice fed CDAA diet compared to the control mice (Figure

2.4C). C/EBPβ protein level decreased by ~40% (P=0.02) after 32 weeks of

feeding CDAA diet (Figure 2.4D) that was further reduced by ~80% (P=0.003)

after 65 weeks (Figure 2.4D).

PTEN, another tumor suppressor and known target of the upregulated

miR-21 (Figure 2.2A) was also decreased by ~50% in protein level after 32

weeks (P=0.02) and 65 weeks (P=0.03) in mice fed CDAA diet (Figure 2.4E). No

significant change in PTEN mRNA level was observed (data not shown).

2.4.6 miR-155 modulated growth of HCC cells

miR-155, upregulated in many primary cancers, demonstrated oncognic properties when overexpressed in lymphocytes (209). We, therefore, investigated

its growth regulatory property in HCC cells. Overexpression of miR-155 by

precursor transfection accelerated growth in both Hep3B (P=0.003) (Figure 2.5A)

and HepG2 cells (P=0.006) (Figure 2.5B). In contrast, depletion of endogenous miR-155 by transfecting anti-miR-155 resulted in reduced growth of SNU-182

cells (P=0.0068 after 6 days) (Figure 2.5C). These results demonstrate growth stimulatory property of miR-155.

2.4.7 miR-155 was upregulated in primary human HCCs

Next, we measured miR-155 level in primary human HCCs and pair-

matched normal liver tissues. Among the 20 HCC samples analyzed (listed in

Table 2.4), miR-155 level increased in 16 HCC samples (P=0.0004) (Figure

2.6A). Comparison of miR-155 and its target showed inverse correlation between

the two (N=20, r= -0.51, P=0.02) (Figure 2.6B). Immunoblot analysis of the

extracts from 5 HCC samples demonstrated significant decrease in C/EBPβ

protein levels in 4 HCCs compared to matching livers (Figure 2.6C).

Immunohistochemical analysis of 3 HCC samples showed C/EBPβ beta

expression was undetectable or very low (only in 5% cells) whereas in adjacent

benign liver tissues 15 to 55% hepatocytes were positive for C/EBPβ (a

representative photograph is shown in Figure 2.6D). These data showed

reciprocal regulation of oncogenic miR-155 and its tumor suppressor target

C/EBPβ in primary human HCCs, suggesting that miR-155 may play a causal role in transformation of hepatocytes.

2.5 Discussion

It is now well established that the expression of microRNAs and their key targets is either elevated or reduced in almost all types of cancer. Although a few altered microRNAs exhibit oncogenic or tumor suppressor properties, the biological functions of most microRNAs remain to be elucidated. To our knowledge, the present study is the first comprehensive analysis of differential expression of microRNAs and their important targets during preneoplastic transformation of hepatocytes in a mouse model. A major advantage of this model is that the liver tumor is developed in the absence of potent chemicals or viruses. While similar dietary deficiency also induces HCCs in rats, the

47 development of the mouse model facilitates studies on the role of different genetic factors in the induction of hepatocarcinogenesis.

A significant observation of the present study is the dysregulation of specific microRNAs and their targets at early stages of hepatocarcinogenesis long before preneoplastic transformation implicating their role in the initiation of tumorigenesis. These altered miRNAs were almost identical to those observed in primary human HCCs. miR-21 and miR-221/222 have been reported to be upregulated in various types of cancers, including HCC (157, 177). Notably, the expression of PTEN, a tumor suppressor target of miR-21, was significantly reduced in the livers of CDAA-fed mice at early stages of tumorigenesis.

miR-155, a common target of proinflammatory cytokines (204) is overexpressed in solid tumors and functions as an oncogene when overexpressed in B cells (209). The correlation of miR-155 level with CDAA diet- induced pathological changes in the liver suggests that miR-155 plays a causal role in this dietary model of hepatocarcinogenesis. Our study also revealed that diet-induced activation of NF-κB plays a key role in miR-155 expression.

Suppression of miR-155 in Huh-7 cells by Bay 11, a potent inhibitor of NF-κB, confirmed the role of NF-κB in miR-155 expression in hepatocyte derived cells

(data not shown). It is conceivable that upregulation of miR-155 with concomitant downregulation of its tumor suppressor target C/EBPβ plays a causal role in diet- induced liver pathogenesis.

Although the present study focused on upregulated miRNAs, a few

miRNAs including the most abundant liver miR-122, are suppressed in rodent and human primary HCC (205). Interestingly, a recent study displayed a dramatic reduction of miR-122 level in human NASH patients (173). Microarray analysis has shown that downregulation of miR-122 leads to re-expression of genes that are normally suppressed in the liver (210). Thus, the loss of miR-122 is likely to promote dedifferentiation of hepatocytes. It would be of considerable interest to generate miR-122 conditional knock out mice for exploring its role in hepatocarcinogenesis in vivo.

In conclusion, using a mouse model of NASH we have shown that upregulation of oncogenic miRs with concomitant suppression of their tumor suppressor targets is a very early molecular event that could play a causal role in hepatocarcinogenesis. Interestingly, very similar changes in miR profile in livers of NASH patients (173) underscore the usefulness of the mouse model to test the therapeutic efficacy of microRNA mimetics (miR-122, let-7a) or anti- miR-155 in preclinical trials.

Figure 2.1 MicroRNA expression was dysregulated at early stages of hepatocarcinogenesis. Clustering of the miRNA expression profiles at 4 time points (6, 18, 32 and 65 weeks) was performed by average linkage using correlation metrics. MicroRNAs were selected by class comparison using analysis of variance with randomized block design. The cluster tree with the fold change of 30 miRs (P≤0.01) that varied with the time course was constructed.

Figure 2.2 Validation of miRNA microarray data

A. Real-time RT-PCR analysis of selected microRNA expression from DNase I

treated total RNA. RNAs from 5 mice were used for RT-PCR and each sample

was analyzed in triplicate. Single and double asterisks denote P≤0.05 and ≤0.01

respectively. B and C. Northern blot analysis of miR-21 and miR-122 in the liver.

Total RNA (30 µg) was separated in 15% acrylamide gel denaturing (8M urea) gel, transferred to nylon membrane followed by hybridization to 32P-labeled antisense miR-21/122 probes. The signal was developed by autoradiography and quantified using Kodak Imaging software. D. Localization of miR-122 in livers by

LNA-ISH. Tissue sections were hybridized to biotin-labeled oligo (anti-miR-122),

which was captured with alkaline phosphatase conjugated-streptavidin and the

signal (blue color) was developed with NBT/BCIP. Cell body was stained with

Nuclear fast red. Red arrows indicated mature miR-122. E. Representative

photographs of H&E stained liver sections from mice. F. Localization of miR-155

in livers by LNA-ISH. Scrambled oligo probe was used as negative control.

Green arrows indicated mature miR-155.

Figure 2.2

Continued

Figure 2.2 continued

Continued

Figure 2.2 continued

Figure 2.3 NF-κB was activated in the liver nuclear extract of mice fed

CDAA diet. A. Identical amount (3 µg) of the extract was incubated with 32P- labed NF-κB oligo under optimal binding conditions. The protein DNA complex was resolved in a 5% polyacrylamide gel, dried and subjected to phosphorimager analysis. For competition and supershift assays, the extracts were preincublated with 100 fold molar excess of unlabeled oligos and antibodies, respectively for 30 minutes before adding labeled probe. B. Quantitative analysis of the data in A.

Figure 2.4 Downregulation of C/EBPβ and PTEN, respective targets of miR-

155 and miR-21, in the livers of mice fed CDAA diet

A. Schematic representation of conserved miR-155 site in C/EBPβ 3’UTR. B.

Western blot analysis of C/EBPβ in HCC cells. Hep3B and HepG2 cells were

transfected with pre-miR-155 (50nM) followed by Western blot analysis. C. Real-

time RT-PCR analysis of C/EBPβ in the liver of mice fed diet for 32 and 65 weeks.

D and E. Western blot analysis of C/EBPβ, PTEN and GAPDH in the liver

extracts. Equal amount of proteins were subjected to immunoblot analysis first

with specific primary and secondary antibodies and the signal was developed

with ECL reagent. The signal was quantified using Kodak Imaging software and

the data was normalized to GAPDH.

Figure 2.4

Continued

Figure 2.4 continued

Continued

Figure 2.5 miR-155 regulates HCC cell growth. A and B. Ectopic expression of miR-155 promoted growth of Hep3B and HepG2 cells in culture. Cells were transfected with miR-155 precursor or control RNA (50 nM) followed by MTT assay. For details of the assay, see Materials and Methods section. C.

Knockdown of endogenous miR-155 reduced SNU-182 cell growth. Cells were transfected with anti-miR-155 or control RNA (60 nM) followed by MTT assay.

NC: negative control.

Figure 2.5 Continued

Figure 2.6 miR-155 and CE/BPβ levels were reciprocally regulated in

primary hepatocellular carcinomas

A. Total RNA from 20 HCCs and pair-matched normal liver tissues was subjected to real-time RT-PCR analysis for miR-155 level. Expression of miR-

155 in each sample presented in Supplementary Table 5 is depicted as dot plots.

Horizontal bars indicate median expression value. B. Inverse correlation between

C/EBPβ mRNA level and miR-155 expression in HCCs (r=-0.51, P=0.02),

determined by real-time RT-PCR analysis in 20 HCC samples. C. Western blot

analysis of C/EBPβ in whole tissue extracts (500 µg) from HCCs (T) and

matching livers (N). Asterisks denote HCC samples in which C/EBPβ is reduced.

D. Immunohistochemical analysis of C/EBPβ in a HCC and benign liver tissues.

Formalin-fixed HCC sections were subjected to immunohistochemistry analysis

with anti-C/EBPβ antibody using Ventana Ultraview Universal Red system.

C/EBPβ signal is red (green arrow) and the cell body is light blue.

Figure 2.6

Fold Change FDR Gene Parametric False

Symbol 6 week 18 week 32 week 65 week P-value Discovery Rate miR-200c 1.00 0.84 1.00 2.67 0.000 0.004 miR-200b 1.00 1.00 1.00 2.53 0.001 0.010 miR-181d 0.77 0.45 4.21 2.40 0.000 0.005 miR-155 0.87 1.43 2.81 1.90 0.000 0.000 miR-487a 3.04 0.92 0.46 1.78 0.006 0.040 miR-181b 0.70 0.92 3.20 1.73 < 1e-07 < 1e-07 miR-223 0.47 1.84 2.82 1.62 < 1e-07 < 1e-07 miR-342- 0.51 1.54 1.73 1.40 0.000 0.000 3p miR-150 0.99 0.92 2.79 1.39 0.000 0.005 miR-99b 0.76 1.00 1.68 1.33 0.000 0.001 miR-214 0.80 0.98 1.73 1.32 0.002 0.017

Continued

Table 2.1 Hepatic microRNAs dysregulated in mice fed CDAA diet for 6, 18,

32 and 65 weeks. Analysis of variance with randomized block design identified

30 hepatic miRNAs that are altered P<0.01) upon feeding mice CDAA diet

compared to CSAA diet. RNA from 4 mice on CSAA diet and 5 mice on CDAA

diet at each time point was used for microarray analysis.

Table 2.1 continued

FDR Fold Change Gene Parametric False Symbol P-value Discovery 6 week 18 week 32 week 65 week Rate miR-221 0.80 1.19 1.51 1.32 0.009 0.057 miR-195 0.90 1.02 1.67 1.29 0.000 0.000 miR-142- 0.54 1.03 2.19 1.28 0.005 0.035 5p miR-222 0.84 1.17 1.37 1.28 0.002 0.017 miR-34a 0.57 1.22 1.62 1.26 0.004 0.032 miR-16 0.88 1.12 1.72 1.16 0.000 0.000 miR-107 1.01 0.69 0.67 0.92 0.001 0.006 miR-30a 1.02 0.92 0.81 0.88 0.005 0.038 let-7a 1.10 0.66 0.62 0.85 0.005 0.038 miR-103 1.00 0.71 1.08 0.81 0.009 0.054 miR-30b 0.99 0.73 0.96 0.74 0.004 0.032 miR-30e 0.96 0.83 0.70 0.70 0.010 0.059 miR-323- 1.34 0.75 0.52 0.60 0.001 0.008 5p miR-27a 1.06 1.01 0.97 0.40 0.007 0.048 miR-802 1.00 0.74 0.71 0.28 0.000 0.000 miR-32 0.98 0.87 0.79 0.21 0.000 0.001 miR-17 0.83 0.99 1.45 0.90 0.000 0.003 miR-346 1.50 1.19 1.34 0.41 0.000 0.001 miR-20b 0.77 0.92 1.20 0.76 0.002 0.016

miR-155/18S CASE HISTOLOGY miR-155-LNA-ISH rRNA -∆C 4 (2 T) X10 CSAA Steatosis – 60% Inflammation – 0 1+ 4.28 Not NASH 7% HEPATOCYTES + CSAA Steatosis – 50% Inflammation – 0 2+ 6.2 Not NASH 22% HEPATOCYTES + CSAA Steatosis – 30% Inflammation – 0 1+ 2.57 Not NASH 2% HEPATOCYTES + CSAA Steatosis – 30% Inflammation – 0 1+ 2.68 Not NASH 5% HEPATOCYTES + Continued

Table 2.2 Liver pathology and miR expression in mice fed diet for 32 weeks.

Formalin-fixed paraffin-embedded (FFP) liver sections were (i) stained with H&E.

Steatosis, inflammation and fibrosis were scored blind folded by a liver pathologist. FFP tissue sections were also subjected to in situ hybridization with

LNA-modified anti-miR-155 (LNA-ISH) and miR-155 positive cells were counted. miR-155 was scored as follows: 1+ was between 1% and 20%+, 2+ was 21% to

50%+, 3+ was >50%+ (the majority of cells). The numbers were derived from counting at least 250 hepatocytes. miR-155 level was also determined in the liver by real-time RT-PCR.

Table 2.2 Continued

miR-155/18S CASE HISTOLOGY miR-155-LNA-ISH rRNA -∆C 4 (2 T) X10 CDAA Steatosis – 90% Inflammation – 3+ 17.56 moderate NASH 69% HEPATOCYTES + CDAA Steatosis – 90% Inflammation – 3+ 16.3 moderate NASH 57% HEPATOCYTES + CDAA Steatosis – 90% Not determined 11.38 Inflammation –

moderate NASH CDAA Steatosis – 90% Not determined 22.13 Inflammation –

moderate NASH

miR-155/18S Diet HISTOLOGY miR-155-LNA-ISH rRNA -∆C 4 (2 T) X10 CSAA Steatosis – 75% Inflammation – mild 2+ 4.14 Not NASH 21% HEPATOCYTES + CSAA Steatosis – 90% inflammation– mild 2+ 5.25 Not NASH 24% HEPATOCYTES + CSAA Steatosis – 90% Inflammation– mild Not determined 1.46 Not NASH CSAA Steatosis – 90% Inflammation– mild 1+ 3.37 Not NASH 6% HEPATOCYTES + Continued

Table 2.3 Liver pathology and miR expression in mice fed diet for 65 weeks.

Formalin-fixed paraffin-embedded (FFP) liver sections were (i) stained with H&E.

Steatosis, inflammation and fibrosis were scored blind folded by a liver pathologist. FFP tissue sections were also subjected to in situ hybridization with

LNA-modified anti-miR-155 (LNA-ISH) and miR-155 positive cells were counted. miR-155 was scored as follows: 1+ was between 1% and 20%+, 2+ was 21% to

50%+, 3+ was >50%+ (the majority of cells). The numbers were derived from counting at least 250 hepatocytes. miR-155 level was also determined in the liver by real-time RT-PCR.

Table 2.3 Continued

miR-155/18S Diet HISTOLOGY miR-155-LNA-ISH rRNA 4 (2-∆CT) X10 CDAA Steatosis – 90% Inflammation – moderate 3+ 7.25 to severe NASH 52% HEPATOCYTES + CDAA Steatosis – 90% Portal tract inflammation 3+ 6.83 – moderate NASH 55% HEPATOCYTES + CDAA Steatosis – 75% Inflammation – moderate 1+ 3.33 Not NASH 19% HEPATOCYTES + CDAA Steatosis – 90% Inflammation– moderate 3+ 8.38 NASH 59% HEPATOCYTES +

Fold Change Sample Cancer Type Age/Gender (Tumor/Matching liver) 1 HCC 80/M 9.19 2 HCC 65/M 6.17 3 HCC 31/M 3.22 4 HCC 57/M 3.73 5 HCC 52/F 3.86 6 HCC 69/M 9.12 7 HCC 56/M 1.97 8 HCC 57/M 1.47 9 HCC 65/F 10.51 10 HCC 63/F 1.86 11 HCC 69/M 4.40 12 HCC 76/M 1.74 13 HCC 66/F 1.37 14 HCC 76/M 1.02 15 HCC 64/F 1.85 16 HCC 72/F 2.13 17 HCC HCV+ 56/M 1.10 18 HCC 70/F 0.76 19 HCC 72/M 1.86 20 HCC 56/F 0.72

Table 2.4 Expression of miR-155 in primary human HCCs and matching liver tissues. miR-155 level was measured using Taqman probes and primers for mature miR-155 and 18S rRNA respectively. The data was normalized to 18S rRNA and the fold change (Tumor/matching liver) was calculated. M and F stand for male and female respectively.

Chapter 3 TGFβ Mediated Upregulation of Hepatic miR-181b Promotes

Hepatocarcinogenesis by Targeting TIMP3

3.1 Abstract

To identify microRNAs that may play a causal role in

hepatocarcinogenesis, we used an animal model in which C57/BL6 mice fed

choline deficient and amino acid defined (CDAA) diet develop preneoplastic

lesions at 65 weeks and hepatocellular carcinomas after 84 weeks. miRNA

expression profiling showed significant upregulation of miR-181b and miR-181d

in the livers of mice as early as 32 weeks that persisted at preneoplastic stage.

The expression of TIMP3, a tumor suppressor and a validated miR-181 target,

was markedly suppressed in the livers of mice fed CDAA diet. Upregulation of

hepatic TGFβ and its downstream mediators Smad 2, 3 and 4 and increase in

phospho-Smad2 in the liver nuclear extract correlated with elevated miR-181b/d

in mice fed CDAA diet. The levels of the precursor and mature miR-181b were

augmented upon exposure of hepatic cells to TGFβ and were markedly reduced

by siRNA-mediated depletion of Smad4, demonstrating the involvement of TGFβ

signaling pathway in miR-181b expression. Ectopic expression and depletion of

miR-181b showed that miR-181b enhanced MMP2 and MMP9 activity and

promoted growth, clonogenic survival, migration and invasion of HCC cells that

70 could be reversed by modulating TIMP3 level. Further, depletion of miR-181b inhibited tumor growth of HCC cells in nude mice. miR-181b also enhanced resistance of HCC cells to the anti-cancer drug doxorubicin. Based on these results, we conclude that upregulation of miR-181b at early stages of feeding

CDAA diet promotes hepatocarcinogenesis.

3.2 Introduction

Different strategies have been used to treat hepatocellular carcinoma

(HCC) which is the fifth most prevalent cancer and the third leading cause of cancer death in the world (1). Despite these efforts, the survival rate has been dismal probably due the late stage diagnosis of this cancer. Like other cancers,

HCC is the result of a complex, multi-step process associated with various genetic and epigenetic changes. Many factors are involved in the development of

HCC, which include virus infection, chronic alcohol abuse, obesity, diabetes, and nonalcoholic fatty liver diseases (NAFLD), which is increasing in Western world leading to nonalcoholic steatohepatosis (NASH) and HCC (211). While the underlying molecular mechanisms involved in the pathogenesis of HBV or HCV infection have been explored in great detail, the pathophysiology and the detailed mechanisms of the initiation and progression of NASH-associated HCC have not been completely understood.

Most of the chemotherapeutic strategies to treat liver cancer using different drugs have met with limited success. Recently, there has been

considerable interest in the application of microRNA (miRNA) mimetics and antisense microRNAs as potential therapeutics for hepatocellular carcinoma due to their stability and predominant uptake by the liver. MicroRNAs are endogenous, short (20~22-nucleotide), non-coding RNAs that regulate gene expression posttranscriptionally by blocking translation at initiation or post-initiation steps,

inducing mRNA deadenylation and decay (100, 134). The genes encoding miRNAs are transcribed in the nucleus predominantly by RNA polymerase II into primary miRNAs (pri-miRNAs), that are processed into ~70-nucleotide precursor

miRNAs (pre-miRNAs) by Drosha-DGCR8 microprocessor complex (102). Pre- miRNAs are then transported into the cytoplasm by Exportin 5 and further processed into mature miRNAs by Dicer and cofactors (212). Mature miRNAs are incorporated into miRNA-induced gene silencing complex (miRISC) and guide miRISC to specific target mRNAs to exert biological functions (213).

MicroRNAs are involved in various biological processes, such as development and differentiation, immune response, metabolism, cell proliferation and apoptosis (147). The expression profile of miRNAs is altered in disease states and may be involved in the initiation and progression of many types of cancers by targeting classic oncogenes or tumor suppressors (214). miRNA expression profiling is emerging as a potentially powerful tool in the diagnosis and prognosis of diseases.

The role of miRNAs in the development and progression of hepatocellular carcinoma (HCC) is emerging only recently. To elucidate the role of specific

miRNAs in the initiation and progression of hepatocarcinogenesis, we used a

mouse model to identify temporal changes in miRNA expression at early stage of

hepatocarcinogenesis. In this model, mice fed choline deficient and amino acid

defined (CDAA) diet develop nonalcoholic steatohepatitis (NASH) at early stages

leading to preneoplastic nodules after 65 weeks, and hepatocellular adenomas

and carcinomas after 84 weeks (190). Using this diet model, we have identified

several miRs that are dysregulated during hepatocarcinogenesis (215). Here, we

focused on the role of one of these miRNAs, miR-181b, in hepatocarcinogenesis,

and elucidated the role of TGFβ signaling pathway in its induction.

3.3 Materials and Methods

Mice and diet. All animal experiments are described in Chapter 2.

Real-time reverse-transcription polymerase chain reaction (RT-PCR). The

TaqMan miRNA Assay (Applied Biosystems, Foster City, CA) was used to

measure mature miRNAs expression according to manufacturer's instructions.

Normalization was performed with the 18S rRNA or RNU6B. Relative expression

was calculated using the comparative CT method (200).

Cell Lines, treatment conditions and HCC Tumor tissue. HCC cell lines obtained from ATCC were cultured as recommended by the supplier. Primary

human hepatocellular tumor and adjacent normal tissue samples were obtained

from the Cooperative Human Tissue Network at The Ohio State University

James Cancer Hospital. Tissue specimens were procured in accordance with

The Ohio State University Internal Review Board guidelines. Hepatocytes and

HCC cell lines were treated with TGFβ (20ng/ml for HepG2, 5ng/ml for Hep3B,

and 10ng/ml for hepatocytes and Huh7) for 24h.

Primary culture of mouse hepatocyte: Adult C57BL/6J mice (20-30gms) were anesthetized with ketamine and xylazine given i.p. Livers were perfused with 30 ml of warm (37°C) liver perfusion medium (Invitrogen, Carlsbad, CA, USA) and then with 30 ml of warm (37°C) liver digestion medium (Invitrogen) at a rate of 2 ml/min via the vena cava with the perfusate exiting severed portal vein. The thoracic segment of vena cava was tied to keep perfusate circulating in liver vascular system. The livers were aseptically removed to a sterile Petri dish containing hepatocyte wash medium (Invitrogen) at 4°C to stop digestion. The hepatocyte was released by peeling off hepatic capsule and dispersed by shaking the digested liver in wash medium at 4°C, followed by filtration through gauze. The cells were washed twice and resuspended in serum-containing culture medium (1/3 Waymouth’s medium, 2/3 Minimum Essential Medium, 10% fetal bovine serum, 1% Hepes (pH 7.4), 100 units/ml penicillin G sodium, and

100 μg/ml streptomycin sulfate). Cell count and viability were determined by trypan blue dye exclusion. The cells were plated on 60- or 35-mm dishes coated

with rat tail type I collagen (BD Biosciences, San Jose, CA, USA) in the above

medium at a density of 1.2x106 cells or 0.4x106 cells per dish, respectively. After

incubation for 2h (period of attachment), the cells were used for experiments.

Plasmid construction: TIMP3 cDNA was PCR amplified from cDNAs reversely t

ranscribed from total normal mouse liver RNA using specific primers. TIMP3 cDN

A was subsequently cloned into the EcoR I / EcoR V site of p3xFlag-CMV vector

(Sigma Chemical Co, St. Louis, MO, USA). Correct clones were verified by sequ

encing. The 3’-UTR of TIMP3 were amplified from human genomic DNA using Ac

cuprime Taq polymerase (Invitrogen) and cloned into pDrive vector (Qiagen, Vale

ncia, CA, USA). Inserts were retrieved with Nhe I/Mlu I and cloned into the same

sites of a luciferase reporter vector, pIS0, obtained from Addgene, resulting in pI

S0-TIMP3-3’UTR. To delete miR-181b sites in TIMP3-3’UTR, pIS0-TIMP3-3’UTR

construct was digested with XbaI, resulting in pIS0-TIMP3-3’UTRΔ construct.

The following primers were used: TIMP3-cDNA-EcoRI-F: GGAATTCCATGACCC

CTTGGCTCGGG, TIMP3-cDNA-EcoRV-R: GGATATCAAGGGGTCTGTGGCAT

TGATG, TIMP3-3’UTR-F: GCTTCCCTTGGACACTAACTC, TIMP3-3’UTR-R: TG

TGATAGAAATAAAACCAC, TIMP3-RT-F: ACGCTGGTCTACACCATCAAGC, TI

MP3-RT-R: CCGAAATTGGAGAGCATGTCG, GAPDH-RT-F: TCCTGCACCACC

AACTGCTTAG, GAPDH-RT-R: TGCTTCACCACCTTCTTGATGTC.

Transfections. Hep3B cells were transiently transfected with 8µg of MSCV-PIG

or MSCV-PIG-miR-181b using Lipofectamine 2000 reagent (Invitrogen) following

the manufacturer’s protocol. RNA and protein were isolated after 48h. For miR

precursor or anti-miR transfection, cells were plated in 60 mm dishes and

transiently transfected with 25 nM pre-miR-181b, negative control RNA, 60nM

anti-miR-181b, or control anti-sense RNA (Applied Biosystems, Foster City, CA).

Western blot analysis. Whole cell or tissue extracts were prepared in SDS lysis

buffer, followed by immunoblotting with specific antibodies as described in

Chapter 2: anti-TIMP3 (cat# 6836) (Santa Cruz Biotechnology, Santa Cruz, CA,

USA), and anti-GAPDH (cat# mAB 374) (Millipore, Billerica, MA, USA). Nuclear

extracts from liver tissues were immunoblotted with anti-phospho-Smad2 (mAb #

3108), Smad2 (mAb # 3122), Smad4 (# 9515) (cell signaling technology,

Danvers, MA, USA) and Ku-70 (sc-17789) (Santa Cruz Biotechnology)

antibodies.

Luciferase assay: Cells (1X105 cells/well) were plated in 24-well plates. Cells

were transfected with 100ng pIS0-TIMP3-3’UTR or pIS0-TIMP3-3’UTRΔ, 10ng

Renilla luciferase expression vector (pRL-TK) and 600ng MSCV-PIG or MSCV-

PIG-miR-181b using lipofectamine 2000. Hep3B cells were transfected with

100ng pIS0-TIMP3-3’UTR or pIS0-TIMP3-3’UTRΔ, 10ng pRL-TK and anti-miR-

181b or control RNA (60nM) (Applied Biosystems, Foster City, CA, USA).

Luciferase assay was performed after 48h using dual-luciferase reporter assay system (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity.

Depletion of Smad4 using siRNA. HCC cells were transfected with Smad4 specific siRNA (CAUCCUAGUAAAUGUGUUAdTdT) or control siRNA

(UUCUCCGAACGUGUCACGUdTdT) (60nM) using lipofectamine 2000 following manufacturer’s instruction.

Cell proliferation assay. Cell proliferation was assessed using cell proliferation reagent kit I (MTT) (Roche Applied Science, Indianopolis, IN) as described (216).

Colony formation assay. HCC cells transfected with pre-miR-181b or control miR, anti-miR-181b or control antisense RNA were plated in 60 mm dishes (500 cells/dish) and cultured for 2 weeks to allow colony formation. The colonies were fixed in methanol, stained with 0.1% crystal violet and counted.

Matrix metalloproteinase (MMP) activity measurement. MMP activity was measured by zymogram gel. SK-Hep1 cells were transfected with 50nM control pre-miRNA (NC) or miR-181b, 60nM anti-miR-181b or control anti-miR. Twenty four hours later, serum free medium was added to the cells and cultured for another 24h. After incubation, the medium was mixed with 2x Zymogram sample

buffer (Bio-Rad Laboratories, Hercules, CA, USA), and loaded on Ready Gel

Zymogram Gel (Bio-Rad Laboratories). After electrophoresis, the gel was

renatured and developed.

Isolation of nuclei and preparation of nuclear extract. This procedure was

described in Chapter 2.

Cell migration and invasion assay. The migration and invasion assays were

measured using 24-well Transwell chambers (8-µm pore size polycarbonate membrane, Corning Costar Corp. Lowell, MA, USA) and BD BioCoat Matrigel

Invasion Chambers (BD Biosciences, San Jose, CA, USA), respectively. For the migration assay, 1x105 Hep3B or HepG2 cells transfected with pre-miR-181b or

control RNA were suspended in 0.1ml of serum-free MEM medium and seeded

into the upper chamber, while 0.6ml of MEM containing 10% FBS was added to

the bottom well. After 24 h of incubation, the non-migrated cells were removed by

a cotton tip from the upper side of the chamber and migrated cells were fixed and

stained with Hema-3 (Fisher scientific, Pittsburgh, PA, USA). For invasion assay,

SK-Hep1 cells (5x104) transfected with anti-miR-181b inhibitor or anti-miR control

RNA were suspended in 0.5ml of serum-free MEM and added into the upper chamber, and 0.75ml of MEM containing 10% FBS was added to the bottom well.

Cells were incubated for 48 h and the invading cells were fixed and stained.

Migrating or invading cells were counted.

Analysis of oncogenic potential of miR-181b in nude mice. SK-Hep1 cells

(5x106) transfected with anti-miR-181b or control anti-miR were subcutaneously injected into nude mice. Tumor growth was monitored weekly and tumors were harvested after 6 weeks.

Statistical analysis: Statistical significance of differences between groups was analyzed by unpaired Student’s t test, and P≤.05 was considered to be statistically significant. Paired Student’s t test was used to analyze differences in expression of microRNAs and mRNAs levels among tumors and paired nontumor tissues in real-time RT-PCR analysis. The correlation between miR-181b and

TIMP3 mRNA levels was analyzed by two-tailed Pearson Correlation Test.

3.4 Results

3.4.1 microRNA 181b and 181d are upregulated at early stages of hepatocarcinogenesis induced by CDAA diet

Previously, we demonstrated differential expression of hepatic miRNAs at early stages of hepatocarcinogenesis in mice fed diet deficient in choline, low in methionine and amino acid-defined (CDAA) that is known to induce hepatocarcinogenesis (190, 191). Using this mouse model, we identified 30 miRs that were dysregulated at early stages of hepatocarcinogenesis (215). Among the dysregulated miRNAs, the expression of miR-181b/d was elevated in mice

fed CDAA diet for 32 and 65 weeks compared to those fed CSAA (control) diet (P

<0.01) (Figure 3.1A). Real-time RT-PCR analysis confirmed that the levels of

hepatic miR-181b and miR-181d, coded by different genes, were elevated (~1.5

fold, n=5) (P=0.0004) after 32 weeks of feeding CDAA diet, which persisted at 65 weeks (Figure 3.1B) when preneoplastic changes occur. We also measured hepatic miR-181a level in these mice, since miR-181a and miR-181b are encoded by the same gene. Significant increase in miR-181a was observed at 32

(~1.7 fold, P=0.01) and 65 weeks (~1.9 fold, P=0.01), suggesting co-ordinate induction of these miRNAs by CDAA diet (Figure 3.1B).

3.4.2 Tissue Inhibitor of Metalloprotease 3 (TIMP3), a candidate target of miR-181b, is downregulated at early stages of CDAA diet-induced hepatocarcinogenesis

Since miRNAs generally function by regulating their target gene expression, we sought to identify tumor suppressor targets of miR-181b that are likely to be involved in CDAA diet-induced hepatocarcinogenesis. We focused our attention on a well-established tumor suppressor, TIMP3, the conserved target of miR-181 predicted by multiple databases, for further studies. The proteins encoded by TIMP family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in the degradation of extracellular matrix (ECM)

(217). The 3’-UTR of TIMP3 harbors two highly conserved cognate sites for miR-

181 (sites 1 and 2) (Figure 3.2A). Indeed, hepatic TIMP3 protein level was

80 markedly reduced (~80%) in mice fed CDAA diet for 32 weeks (P=0.003) and 65 weeks (P=0.004) compared to those fed the control diet (Figure 3.2B.i). Real time RT-PCR analysis also showed significant decrease in TIMP3 mRNA level at both 32 and 65 weeks (Figure 3.2B.ii). The dramatic decrease in TIMP3 expression is likely due to the co-ordinate induction of multiple miRNAs, e.g. miR-21, miR-221/222 (215) and miR-181 in the diet model, all of which potentially target TIMP3. Recently, miR-21 has been shown to target TIMP3 in cholangiocarcinoma (218) and glioma (219).

To confirm that miR-181b can indeed suppress TIMP3 expression, two

HCC cell lines were transfected with pre-miR-181b or control RNA that resulted in increased miR-181b level in Hep3B (P=0.008) and SK-Hep1 (P=2x10-6) cells

(Figure 3.2C.i and 2C.ii, upper panel). As expected, a pronounced decrease in

TIMP3 protein level (~56%) was observed in both Hep3B and SK-Hep1 cells expressing miR-181b (Figure 3.2C.i and 3.2C.ii, middle panel). TIMP3 RNA level was also dramatically reduced (~70%) in both cell lines by miR-181b

(Figure 3.2C.i and 3.2C.ii, lower panel).

We also performed the reverse experiment by transfecting anti-miR-181b in SK-Hep1 cells that resulted in ~65% decrease (P=0.0008) in endogenous miR-

181b level compared to cells transfected with control anti-miR (Figure 3.2C.iii, upper panel). TIMP3 protein and RNA levels were elevated by 50% and 60% respectively in cells depleted of miR-181b (Figure 3.2C.iii, middle and lower

panel). These results suggest that miR-181b interferes with TIMP3 expression at mRNA and/or protein levels.

Since TIMP3 is a potent inhibitor of matrix metallopeptidases (MMPs), we investigated whether miR-181b affects MMP activity. For this purpose, miR-181b

was overexpressed in SK-Hep1 cells or depleted from these cells by transfecting

with pre-miR-181b or anti-miR-181b, and MMP activity was analyzed in the

culture supernatant by gelatin zymography that detected two bands

corresponding to the size of pro-MMP 9 (92kD) and active MMP 2 (72kD),

respectively. The amount of gelatin degraded by MMP that reflects the MMP

proteolytic activity increased ~2-fold upon miR-181b overexpression, and reduced by ~50% upon depletion of miR-181b (Figure 3.2D).

To address whether negative regulation of TIMP3 by miR-181b is mediated through its 3’UTR, we cloned the wild type TIMP3-3’UTR and mutated

TIMP3-3’UTR lacking miR-181b putative binding sites (TIMP3-3’UTRΔ) into the firefly luciferase expression vector pIS0 (14). Next, Hep3B cells were cotransfected with pIS0-TIMP3-3’UTR or pIS0-TIMP3-3’UTRΔ, pRL-TK (internal control) along with control anti-miR or anti-miR-181b, which resulted in depletion of endogenous miR-181b (Figure 3.2E.i). The normalized luciferase activity increased by 60% (P=0.0017) in pIS0-TIMP3-3’UTR transfected cells but not in pIS0-TIMP3-3’UTRΔ expressing cells (Figure 3.2E.ii.), indicating that miR-181b negatively regulates TIMP3 expression by interacting with its 3’-UTR. We consistently observed increase in TIMP3 3’-UTR driven luciferase activity by

expressing anti-miR-181b whereas its inhibition by miR-181b mimetic was minimal (data not shown).

3.4.3 CDAA diet-induced upregulation of TGFβ and its downstream mediators activates miR-181b expression

Next, we addressed the mechanism of upregulation of miR-181b during CDAA diet induced liver damage and carcinogenesis. TGFβ signaling pathway plays an important role in the pathology of NASH (220). Recent studies have shown that

TGFβ regulates the expression of several miRNAs (221, 222). We, therefore, tested the possibility if TGFβ regulates hepatic miR-181b upon exposure to

CDAA diet. For this purpose, we first measured the level of TGFβ and its downstream mediators in the livers of mice fed diet for 32 and 65 weeks. Real- time RT-PCR analysis showed that TGFβ, its receptor-regulated Smads (Smad2 and Smad3) and Co-Smad (Smad4) mRNAs were upregulated in mice fed CDAA diet compared to CSAA diet (Figure 3.3A). In contrast, there was no significant change in the mRNA level of inhibitory Smad (Smad7). Western blot analysis showed significant increase in phospho-Smad2 and Smad4 protein level in the liver nuclear extracts of mice on CDAA diet for 32 weeks (Figure 3.3B).

To determine whether TGFβ can indeed regulate miR-181b expression,

we treated mouse hepatocytes and human HCC cell lines with TGFβ for 24h that

resulted in 8, 7, 2 and 12 fold increase in miR-181b expression in hepatocytes

(P=7x10-5), HepG2 (P=0.0003), Huh7 (P=0.002) and Hep3B (P=2x10-5) cells,

respectively (Figure 3.3C.i). Northern blot analysis showed increase in both

precursor and mature forms of miR-181b upon TGFβ treatment (Figure 3.3D).

A recent study has shown that the expression of miRs can be regulated at the level of transcription or processing by TGFβ depending upon the cell type

(221, 223). To investigate whether TGFβ regulates miR-181b at the transcriptional and/or post-transcriptional level in HCC cells, we followed time course of miR-181b induction in response to TGFβ in HepG2 cells. While miR-

181b level increased marginally at 4-12 hour, it was maximally induced (4 fold) after 24 hours of TGFβ treatment (Figure 3.3C.ii). Interestingly, miR-181a coded by the same gene as miR-181b, and miR-181d transcribed by a distinct gene, showed similar expression pattern upon TGFβ treatment (Figure 3.3C.iii and iv), suggesting the involvement of TGFβ signaling pathway in their regulation as well.

To demonstrate that TGFβ pathway indeed modulates transcription of

miR-181b gene in HCC cells, Smad4 was depleted by transfecting with siRNA.

Depletion of Smad4 in HepG2 cells reduced both basal and TGFβ mediated

expression of miR-181b by 60% (Figure 3.3E). Similar results were obtained in

Huh7 cells depleted of Smad4 (Figure 3.3E). As expected, Smad4 mRNA level

was significantly depleted in these cells by siRNA compared to control siRNA

(Figure 3.3E).

3.4.4 miR-181b accelerates tumorigenic potential of HCC cells

Upregulation of miR-181b during diet-induced hepatocarcinogenesis with

concurrent decrease in TIMP3 suggested to us its potential oncogenic functions.

To test this function of miR-181b, we first measured growth of HCC cells

transfected with miR-181b precursor or anti-miR-181b based on its endogenous

levels in HCC cells (Figure 3.4A). Ectopic expression of miR-181b in Hep3B

cells increased cell growth by 25% (P=0.001) after 4 days (Figure 3.4B). In

contrast, depletion of endogenous miR-181b resulted in reduced growth of SNU-

182 cells by 20% (P=0.0036 after 6 days) (Figure 3.4B). We also measured

clonogenic survival of HCC cells transfected with pre-miR-181b which increased by ~50% in Hep3B cells (P=0.01) compared to cells transfected with control RNA

(Figure 3.4C). Depletion of miR-181b expression in SK-Hep1 cells showed 30% decrease in the number of colonies formed (Figure 3.4C).

We next assessed the effect of miR-181b on HCC cell migration and

invasion, the hallmarks of cancer cells, using a transwell assay. The motility of

Hep3B and HepG2 cells was significantly augmented (~120%, P=0.006 for

Hep3B and ~35%, P=0.02 for HepG2) upon expression of miR-181b compared

to those expressing the control RNA (Figure 3.4D). Conversely, migration of SK-

Hep1 cells depleted of miR-181b was reduced by ~30% (P=0.03) (Figure 3.4D).

Depletion of endogenous miR-181b also dramatically reduced invasiveness of

SK-Hep1 cells (Figure 3.4E). These results established the role of miR-181b in

tumorigenesis in vitro.

3.4.5 TIMP3 modulates the biological function of miR-181b

To explore the functional relationship between miR-181b and TIMP3, we

investigated whether TIMP3 can counteract the biological effect of miR-181b in

HCC cells. For this purpose, Hep3B cells were transfected with miR-181b,

followed by transfection with p3xFlag-TIMP3 lacking its 3’UTR. Overexpression

of TIMP3, confirmed by western blot analysis (Figure 3.5A), resulted in complete

reversal of miR-181b-mediated increase in clonogenic survival of Hep3B cells

(Figure 3.5A). In contrast, knocking down TIMP3 expression by siRNA significantly restored colony formation ability in miR-181b-depleted SK-Hep1

cells (Figure 3.5B). Similarly, TIMP3 depletion antagonized the effect of anti-

miR-181b on invasiveness of SK-Hep1 cells (Figure 3.5C). Taken together,

these data suggest that TIMP3 is a functional target of miR-181b in HCC cells.

3.4.6 miR-181b promotes tumorigenecity in nude mice

Next we investigated whether miR-181b can promote tumor formation ex vivo.

SK-Hep1 cells transfected with anti-miR-181b or control anti-miR were injected subcutaneously into posterior flanks of nude mice and tumors were harvested after 6 weeks. Notably, tumors formed by cells transfected with anti-miR-181b were much smaller than those from control anti-miR transfected cells

(~0.25±0.15g compared to ~0.03±0.016g) (Figure 3.6A and 3.6B), indicating the role of miR-181b in promoting tumor growth in vivo. We also checked miR-181b expression in SK-Hep1 cells before injection and in tumors after harvest. The

result showed that miR-181b expression was reduced by 60% in SK-Hep1 cells

and 20% in tumors from the nude mice compared to the control group (Figure

3.6C). Notably, TIMP3 level was 20% higher in the tumors generated from miR-

181b transfected cells than those produced by control RNA-transfected cells

(Figure 3.6D).

3.4.7 miR-181b enhances resistance of HCC cells to doxorubicin

HCC is highly refractory to cytotoxic chemotherapy because of overexpression of the multidrug resistance genes (224). Recently, there has been considerable interest in the potential use of anti-sense miRs as anticancer agents especially for HCCs due to their predominant uptake by the liver and enhanced stability

(210). Therefore, it was logical to investigate whether miR-181b can modulate sensitivity of HCC cells to doxorubicin, a potent anticancer drug. The results showed that the survival of miR-181b expressing Hep3B cells significantly increased when treated with doxorubicin at concentrations ranging from 0.1μM to

1.0μM (Figure 3.7A) as measured by MTT assay. Conversely, depletion of miR-

181b from SK-Hep1 cells enhanced sensitivity to the drug (Figure 3.7A). Since clonogenic survival at pharmacological concentrations of the drug is a better indicator of drug sensitivity, we also examined the effect of miR-181b on the clonogenic survival of HCC cells by its ectopic expression in Hep3B cells and depletion in Sk-Hep1 cells in the presence and absence of the drug (1ng/ml). The results showed 40% increase (P=0.006) in the number of colonies in miR-181b

expressing cells compared to those transfected with control RNA treated with

doxorubicin (Figure 3.7B). In contrast, clonogenic survival was reduced by 20%

(P=0.002) in SK-Hep1 depleted of miR-181b (Figure 3.7C). These data suggest that anti-miR-181b can sensitize HCC cells to anticancer agents.

3.4.8 miR-181 and TIMP3 expression are inversely correlated in primary human HCCs

Next, we measured miR-181b/d level in primary human HCCs and pair-matched normal liver tissues (pathological information is provided in Table 3.1). Among the 20 HCC samples analyzed, miR-181b and miR-181d levels were significantly elevated in 13 HCC samples (P=0.009) (Figure 3.8A and Table 3.1). Notably,

both miRs were upregulated in the same HCC samples (Table 3.1) that

correlated inversely with TIMP3 mRNA level (r= -0.48, P<0.05) (Figure 3.8B).

These data confirm upregulation of miR-181b/d in primary human HCCs as well,

suggesting its potential role in maintaining tumor-specific characteristics of

human liver cancer.

Detection of TIMP3 protein and miR-181b by co-labeling showed distinct

localization of the microRNA and its target (one representative photograph is

shown in Figure 3.8C). Strikingly, some malignant hepatocytes in the same

tissue section were TIMP3 positive (red) and miR-181b negative whereas the

miR-181b positive cells (blue) were TIMP3 negative. Analysis of 32 samples

revealed inverse correlation between TIMP3 and miR-181b in ~65% (20 of 32) of

HCCs (Figure 3.8D). These results correlated with miR-181b and TIMP3 RNA

levels (Figure 3.8B). Taken together these results demonstrate mutually

exclusive expression of miR-181b and its target TIMP3 in the hepatocellular

cancer.

3.5 Discussion

Recently, there has been considerable interest in understanding the roles

of miR-181 family of miRNAs in cancer. These studies have suggested that miR-

181s function both as oncogenes and tumor suppressors depending upon the cellular context. Accordingly, these miRNAs are elevated in breast (225), colon tumors (226) and pancreatic cancer (162), but are reduced in gliomas (227) and aggressive CLL (228). Upregulation of miR-181b/d at an early stage of NASH- associated hetpatocarcinogenesis implicates their role in diet-induced liver pathogenesis leading to neoplastic transformation of hepatocytes. Interestingly, two recent studies showed significant increase in the level of miR-181b in NASH patients (173) as well as HCCs (229), further confirming that this microRNA plays important role in hepatocarcinogenesis.

Since there is usually an inverse relationship between the expressions of miRNA and their targets, the identification of TIMP3 as a target of miR-181b is of considerable interest. TIMP3, an inhibitor of metalloprotease, induces apoptosis, inhibits angiogenesis, cell migration and invasion (217). Further, TIMP3 knockout mice exhibit severe inflammation in the liver by inhibiting TACE that often leads

to transformation of hepatocyte (230). TIMP3 deficiency also causes steatosis

(217), a characteristic of NASH, in mouse liver. The present study offers a molecular mechanism for the potential role of miR-181 in the early stages of non-

alcoholic steatohepatitis in the mouse model via decreased expression of its

target TIMP3. Further, based on our finding that this microRNA can promote

HCC cell proliferation, migration, invasion and tumor growth in nude mice, it is

logical to conceive that miR-181b functions as an oncogene in HCC.

The potential role of TGFβ signaling pathway in the pathogenesis of liver

diseases in the context of the present data merits comment. The present study

indicates a direct role of TGFβ in the regulation of miR-181 expression during

NASH-associated hepatocarcinogenesis. A recent report has demonstrated

modulation of miR-21 expression by TGFβ at the pre-miR-21 processing rather

than transcriptional level (223). An important difference between TGFβ mediated

regulation of miR-21 and miR-181b expression is the requirement of Smad4 in

miR-181 expression upon TGFβ treatment, suggesting transcriptional regulation

of this miRNA. TGFβ plays paradoxical roles in tumorigenesis by functioning both

as tumor suppressor and as oncogene based upon the stage of tumor

progression (231). TGFβ-induced expression of genes can be divided into two

distinct groups, early responsive genes and late responsive genes (232). The

late TGFβ-signature showed an aggressive and invasive tumor phenotype

relative to early TGFβ-responsive genes, suggesting that the differential expression of these two classes of genes could help predict prognosis of HCC

90 patients. The increase in miR-181 level upon TGFβ treatment at 4h, reaching maximal level at 24h observed in the present study points to a late response.

This observation as well as the promotion of HCC cell invasion by miR-181b and upregulation of miR-181b in highly invasive HCCs (229) suggests that miR-181b could serve as a prognostic marker for HCC.

The miR-181b-mediated resistance of HCC cells to a widely used drug for liver cancer therapy is noteworthy. In this context, we have previously observed that upregulation of another miRNA, miR221/222, can confer resistance of breast cancer cells and primary breast cancer to Tamoxifen, an important drug used in estrogen-receptor positive breast cancer, by targeting the cell cycle inhibitor p27

(233). miR-1 sensitizes lung cancer cells to doxorubicin by targeting the well- known oncogene, c-Met, a receptor tyrosine kinase (216). It would be of interest to examine therapeutic efficacy of anti-miR-181b in preclinical trials since it sensitizes HCC cells to Doxorubicin.

Since miRNAs play a key role in the development of cancer, it is conceivable that miR-mimetics (for downregulated miRNAs) or anti-miRs (for upregulated miRNAs) could emerge as new class of molecular targets for therapeutic intervention (234). Indeed, intravenous administration of chemically engineered oligonucleotides, designated antagomirs, for miR-16, miR-122, miR-

194 and miR-192 caused dramatic reduction of corresponding miRNA levels in most tissues and bone marrow in mice (210). A significant finding was the specificity, efficiency and long lasting effects of the suppression of endogenous

91 miRNAs by this procedure. The biological significance of this approach was further assessed for miR-122, an abundant liver-specific miRNA in two laboratories (210, 235) that showed predicted decrease in the expression of several lipogenic genes and reduced plasma cholesterol levels. Similar observation has been made recently in non-human primates (236), further confirming the effectiveness of these small molecules as a novel class of therapeutics for disease-specific miRNAs. Based on the TGFβ-mediated upregulation of miR-181b/d and suppression of TIMP3, a key tumor suppressor, in the mouse model for NASH-associated hepatocarcinogenesis, it is logical to predict that anti-miR-181b alone or in conjunction with other anticancer agents could function as an effective, alternate therapeutic regimen against HCC.

Figure 3.1 MicroRNA-181b/d expression is upregulated at early stages of

hepatocarcinogenesis. A. Relative expression of miR-181b/d in the livers of

mice on control or CDAA diet for 6, 18, 32 and 65 weeks as determined by

microarray analysis. Total RNA from 5 mice of each group was used for

microarray analysis, which was described previously (11). B. Real-time RT-PCR analysis of miR-181a/b/d expression in mouse livers using Taqman primers and probe. Single and double asterisks denote P≤0.05 and ≤0.01, respectively.

Figure 3.2 TIMP3 is a target of miR-181b

A. Schematic representation of conserved miR-181 sites in TIMP3 3’-UTRs. B.

TIMP3, a candidate target of miR-181b, was downregulated in the livers of mice fed CDAA diet. i. Western blot analysis of TIMP3 expression in moue liver.

Mouse liver tissue extracts were immunoblotted with anti-TIMP3, and GAPDH antibodies. ii. Realtime RT-PCR analysis of TIMP3 mRNA level in 32 and 65 weeks mouse liver. C. Overexpression of miR-181b in Hep3B (i) and Sk-Hep1 (ii)

cells reduced TIMP3 levels. Cells were transfected with pre-miR-181b (25nM) or

negative control RNA (NC) followed by assay of miR-181b, protein and mRNA

levels of TIMP3, respectively. iii. Depletion of endogenous miR-181b from SK-

Hep1 cells with anti-miR-181b increased TIMP3 mRNA and protein levels. Cells were transfected with 60nM anti-miR-181b followed by measurements of miR-

181b and protein/RNA levels of TIMP3. D. MMP activity assay. Twenty and forty

microliters of serum free medium from SK-Hep1 cells transfected with negative

control (NC) or pre-miR-181b, and anti-miR-181b or control anti-miR (anti-NC)

respectively was resolved on Zymogram gel, followed by renaturation,

development and Coomassie staining. The amount of gelatin digested reflects

the activity of MMPs. E. Luciferase assay. i. Expression of miR-181b in Hep3B cells transfected with anti-miR-181b or anti-NC. Ii. Hep3B cells were cotransfected with the reporters and anti-miR-181b (60nM) or negative control RNA

(NC). After 48h RLU1/RLU2 activity was measured.

Figure 3.2

Continued

Figure 3.2 continued

Figure 3.3 TGFβ upregulates hepatic miR-181b

A. Real-time RT-PCR analysis of the expression of TGFβ and its downstream

mediators in mice fed CDAA diet for 32 and 65 weeks. B. Western blot analysis

of phospho-Smad2, Smad2 and Smad4 expression in the nuclear extracts from

32 weeks mice liver. Quantification of the expression was normalized to Ku-70. C.

i. Real-time RT-PCR analysis of miR-181b expression in cells treated with TGFβ

(20ng/ml for HepG2, 5ng/ml for Hep3B, and 10ng/ml for hepatocytes and Huh7) for 24h. ii-iv. The kinetics of miR-181a/b/d response to TGFβ. HepG2 cells were treated with TGFβ for different time points (0-24h) and subjected to real-time RT-

PCR analysis of miR-181a/b/d. D. Northern blot analysis of miR-181b expression in HepG2 and Hep3B cells treated with TGFβ. 5S rRNA was used as a control for

RNA loading. E. Knockdown of Smad4 by siRNA interferes with miR-181b expression. HepG2 and Huh7 cells were transfected with Smad4 specific siRNA followed by real-time RT-PCR analysis of Smad4 and miR-181b after 48h in the absence or presence of TGFβ.

Figure 3.3

Continued 98

Figure 3.3 continued

Continued

Figure 3.3 Continued

100

Figure 3.4 miR-181b enhances tumorigenic properties of HCC cells

A. miR-181b expression levels in HCC cell lines. B. miR-181b promotes HCC

cell growth in culture. Hep3B and SNU-182 cells were transfected with pre-miR-

181b or control miR (25nM), and anti-miR or control RNA (60 nM), respectively

followed by MTT assay. The left panels present real-time RT-PCR analysis of

miR-181b in HCC cells. C. Clonogenic survival of HCC cells increased upon ectopic expression of miR-181b. Hep3B (500 cells) transfected with miR-181b or

control miR, SK-Hep1 (500 cells) transfected with anti-miR or control RNA, were plated in 60mm dishes and colonies formed after 2 weeks were stained with crystal violet and counted. D. miR-181b promotes HCC cell migration. HCC cells were loaded onto the top well of a trans-well inserts for cell migration assay. After

24h, cells that migrated to the bottom chamber containing serum-supplemented medium were stained with Hema-3, and counted. E. Depletion of miR-181b in

SK-Hep1 cells reduces cell invasion. SK-Hep1 cells were transfected with anti- miR or control RNA followed by invasion assay using trans-well chamber.

Invaded cells were stained after 48h and photographed under microscope.

101

Figure 3.4

Continued

102

Figure 3.4 continued

103

Continued

Figure 3.5 TIMP3 is involved in miR-181b-promoted colony formation and invasion in HCC cells. A. Overexpression of TIMP3 abrogated miR-181b- enhanced colony formation in Hep3B cells. Hep3B cells transfected with miR-

181b or NC were further transfected with TIMP3 expressing vector p3xFlag-

TIMP3 or empty vector. Then, cells were subjected to colony formation assay, and proteins were extracted from the cells following Flag western blot. B. and C.

Knocking down TIMP3 rescued colony formation and invasive ability in SK-Hep1 cells transfected with anti-miR-181b. SK-Hep1 cells were first transfected with anti-miR-181b or anti-NC, and then with siTIMP3 or siNC, followed by western blot analysis, colony formation and invasion assays. 104

Figure 3.5 Continued

105

Figure 3.6 Depletion of miR-181b suppresses tumor growth in nude mice. A.

Tumors formed in nude mice. SK-Hep1 cells (5x106) transfected with anti-miR-

181b or anti-NC were subcutaneously injected into nude mice. Tumors were

harvested after 6 weeks. B. Statistic analysis of tumor weight. C. Real-time RT-

PCR analysis of miR-181b expression in SK-Hep1 cells and tumors. D. Western blot analysis of TIMP3 expression in tumors. Proteins were extracted from tumors and subjected to Western blot analysis.

106

Figure 3.7 miR-181b enhances resistance to doxorubicin in HCC cells

A. MTT assay of HCC cells in the presence of doxorubicin. Cells were seeded in

96-well plates with a density of 5x103 cells/well for Hep3B and 3x103 cells/well for

SK-Hep1. After 24h, Doxorubicin was added at different concentration (0-1.0 μM)

and cells were allowed to grow for another 72h followed by MTT assay. The absorbance at 595 nm of treated cells was divided by that of the untreated cells

(which was taken as 100%) to assess the percentage of growth that was then plotted as a function of the Doxorubicin concentration. B and C. Clonogenic survival of HCC cells in the absence or presence of doxorubicin. Hep3B (500

cells) and SK-Hep1 (500 cells) were subjected to clonogenic survival assay in the

absence or presence of doxorubicin (1ng/ml).

107

Figure 3.7

Continued

108

Figure 3.7 continued

109

Figure 3.8. miR-181b and TIMP3 levels were reciprocally regulated in

primary hepatocellular carcinomas. A. Total RNA from 20 HCCs and pair-

matched normal liver tissues was subjected to real-time RT-PCR analysis for miR-181b/d. Expression of these miRs in each sample is presented as dot plots.

Line through the middle is the median. B. Inverse relationship between TIMP3 mRNA level and miR-181b expression in HCCs. C. Co-labeling of miR-181b and

TIMP3 in the primary HCC tissue section. A formalin-fixed HCC section was subjected to LNA-ISH to detect miR-181b (blue) followed by immunohistochemistry with anti-TIMP3 antibody using fast red as the chromogen.

D. Quantification of miR-181b and TIMP3 positive primary HCCs among 32 samples analyzed.

110

Fold Change Sample Cancer Type Age/Gender (Tumor/matching liver) miR-181b miR-181d 1 HCC 80/M 18.83 16.1 2 HCC 65/M 1.08 1.13 3 HCC 31/M 1.97 2.59 4 HCC 57/M 3.51 4.55 5 HCC 52/F 2.10 2.53 6 HCC 69/M 2.32 2.44 7 HCC 56/M 0.47 0.7 8 HCC 57/M 2.27 2.93 9 HCC 65/F 1.49 1.17 10 HCC 63/F 3.57 9.09 11 HCC 75/M 2.43 2.36 12 HCC 69/M 0.44 0.54 13 HCC 76/M 1.74 1.62 14 HCC 66/F 1.22 1.22 15 HCC 76/M 1.24 1.14 16 HCC 64/F 0.94 0.92 17 HCC 72/F 2.70 1.9 18 HCC HCV+ 56/M 3.94 4.5 19 HCC 70/F 1.97 1.7 20 HCC 72/M 36.33 48.54

Table 3.1 Expression of miR-181b/d in primary human HCCs and matching liver tissues. miR-181b/d level was measured using Taqman probes and primers for mature miR-181b/d and 18S rRNA respectively. The data was normalized to 18S rRNA and the fold change (Tumor/matching liver) was calculated. M and F stand for male and female respectively.

111

Chapter 4 Conclusions and Future Directions

Over the past decade, substantial evidence has proven that aberrant

expression of miRNAs plays important role in a variety of human diseases,

including cancer. Recently, Medina et al. showed that miR-21 conditional transgenic mice develop spontaneous pre-B-lymphoma and the tumors regress when miR-21 is inactivated, providing direct evidence that miR-21 is a genuine oncogene and it plays causal role in lymphoma initiation and maintenance (237).

Similarly, B cell specific overexpression of miR-155 induces the development of acute lymphoblastic leukemia/high-grade lymphoma in mice (238). Two third of mice deficient in Dicer1 in liver, an enzyme necessary for miRNA maturation, spontaneously develop HCC, suggesting that miRNAs have critical role in hepatocyte survival, metabolism and tumor suppression in liver (239).

In this study, using a CDAA diet induced mouse HCC model, we identified a series of miRNAs, including miR-155, miR-181b/d, miR-122, miR-21, and miR-

221/222 etc, that are dysregulated at early stages of hepatocarcinogenesis, indicating that cooperation of these miRNAs may be involved in the initiation of

HCC. Interestingly, most of these miRNAs have also been reported to be deregulated in human primary HCCs, suggesting they may also play important role in the progression and maintenance of HCC properties. In vitro studies further showed that miR-155 and miR-181b regulate HCC cell proliferation,

112

migration and invasion, suggesting that they participate in the regulation of HCC

properties.

Studies have suggested that some miRNAs may be used as diagnostic

markers for cancer. For example, serum miR-122, the most abundant miRNA in the liver, has been found to be elevated in HCC patients (180, 181). Similarly, the level of miR-21 in serum was shown to be higher in HCC patients than healthy normals (180). However, there is no report regarding miR-155 or miR-181b serum levels in patients with HCC or chronic liver diseases. In this study, we showed that miR-155 level in liver correlated with the severity of non-alcoholic steatohepatitis in CDAA diet fed mouse livers. Furthermore, miR-155 and miR-

181b levels are significantly increased in preneoplastic stages of HCC development as well as human primary HCCs. It would be of interest to examine the serum level of these miRNAs at early stages of HCC development in this mouse model and human HCC patients, and to determine if they can be used as serum markers for early diagnosis of HCC. Another important clinical significance of miRNAs is that they may be employed as prognostic markers for cancer. miRNA profiling analysis revealed the expression of a series of miRNAs may predict the recurrence of HCC after surgical resection. It has been shown that miR-199a/b-3p level in liver is inversely correlated with prognosis of HCC patients (184). A recent study indicated that higher level of miR-155 promotes

HCC cell invasion and predicts poor survival of HCC patients following liver transplantation (240). In this study, Han et al. compared miR-155 levels in tumor

113

tissues obtained from patients undergoing orthotopic liver transplantation (OLT)

and found that miR-155 expression is relatively higher in patients with post-OLT

recurrence compared to patients without recurrence. They further showed that

miR-155 expression is correlated with micro-vascular invasion and patients with

higher miR-155 levels have poorer recurrence-free survival and overall survival,

suggesting important prognostic value of miR-155 in HCC. However, whether

miR-181b holds prognostic value in HCCs still requires further investigation.

It is well known that HCC is often diagnosed at advanced stage when

most of therapeutic options including surgical resection and transplantation are of

limited efficacy. What makes it even worse is that HCC is resistant to most

chemotherapeutic drugs and is not susceptible to radiotherapy. As a result, HCC

is one of the most mortal types of cancer with less than 10% of the 5-year

survival rate (2). Therefore, the development of more effective therapeutic

strategies for HCC is of urgent need. Numerous studies have supported the

notion that miRNAs may function as oncogenes or tumor suppressors in cancer

and dysregulation of these miRNAs play a causal role in cancer. It is conceivable

that modulating the levels of these miRNAs in tumor tissues by administering

mimetic of tumor suppressor miRNAs or antagomir of oncogenic miRNAs may

prove to be effective therapeutic approaches for some cancers. Intranasal

delivery of viral particles expressing let-7, a tumor suppressor miRNA that is downregulated in various tumors, significantly suppresses the initiation of lung tumors or reduces the lung tumor burden after tumors are formed (241).

114

Systemic delivery of adeno-associated virus (AAV) expressing miR-26a has been

shown to inhibit cancer cell proliferation and induce tumor specific apoptosis in a

mouse model of HCC (242). Similarly, systemic administration of antagomir-miR-

10b to mice bearing highly metastatic cells dramatically inhibits tumor metastasis

(243). These in vivo studies suggest that miRNA-based therapeutics have great potentials for cancer treatment. In this study, we found that miR-155 and miR-

181b function as oncogenes and play important role in the initiation and development of HCCs. Knockdown miR-181b expression by transfecting anti- miR into SK-Hep1 cells reduces its tumorigenic potential and growth in nude mice. In addition, we observed that miR-181b enhances Doxorubicin resistance of HCC cell lines. Another study showed that miR-181 is upregulated in

EpCAM+AFP+ HCCs with cancer stem/progenitor cell features (229). It is known

that cancer stem cells or tumor initiating cells are prone to drug resistance and

may be responsible for cancer recurrence (244). Therefore, in vivo silencing miR-

181b expression alone or together with other chemotherapeutic drugs such as

Doxorubicin may be an effective approach for HCC treatment.

As described in chapter 1, CDAA diet fed mice develop HCC at late stage

(around 80w). The current study focused on changes at early stages of

hepatocarcinogenesis and the miRNAs identified from this study may be involved

in the initiation of HCC development. miRNA profiling after tumors are formed

may identify some other miRNAs that play roles in the maintenance of HCC

properties. This mouse model may be a valuable tool for studying mechanisms

115 by which these miRNAs regulate HCC proliferation, apoptosis and/or metastasis.

It is known that CDAA diet may induce the methylation changes in the genome.

Therefore, this model is also useful for studying epigenetic mechanisms, especially DNA methylation, involved in hepatocarcinogenesis.

116

Bibliography

1. El-Serag HB, Rudolph KL. Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology 2007;132:2557-2576. 2. Altekruse SF, McGlynn KA, Reichman ME. Hepatocellular carcinoma incidence, mortality, and survival trends in the United States from 1975 to 2005. J Clin Oncol 2009;27:1485-1491. 3. Lau WY, Lai EC. Hepatocellular carcinoma: current management and recent advances. Hepatobiliary Pancreat Dis Int 2008;7:237-257. 4. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin 2005;55:74-108. 5. Srivatanakul P, Sriplung H, Deerasamee S. Epidemiology of liver cancer: an overview. Asian Pac J Cancer Prev 2004;5:118-125. 6. McGlynn KA, Tsao L, Hsing AW, Devesa SS, Fraumeni JF, Jr. International trends and patterns of primary liver cancer. Int J Cancer 2001;94:290-296. 7. Chang MH, Chen CJ, Lai MS, Hsu HM, Wu TC, Kong MS, Liang DC, et al. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children. Taiwan Childhood Hepatoma Study Group. N Engl J Med 1997;336:1855-1859. 8. El-Serag HB. Hepatocellular carcinoma: recent trends in the United States. Gastroenterology 2004;127:S27-34. 9. Naugler WE, Sakurai T, Kim S, Maeda S, Kim K, Elsharkawy AM, Karin M. Gender disparity in liver cancer due to sex differences in MyD88- dependent IL-6 production. Science 2007;317:121-124. 10. Shen HM, Ong CN. Mutations of the p53 tumor suppressor gene and ras oncogenes in aflatoxin hepatocarcinogenesis. Mutat Res 1996;366:23-44. 11. Bedard LL, Massey TE. Aflatoxin B1-induced DNA damage and its repair. Cancer Lett 2006;241:174-183. 12. Davila JA, Morgan RO, Shaib Y, McGlynn KA, El-Serag HB. Hepatitis C infection and the increasing incidence of hepatocellular carcinoma: a population-based study. Gastroenterology 2004;127:1372-1380. 13. El-Serag HB, Mason AC. Risk factors for the rising rates of primary liver cancer in the United States. Arch Intern Med 2000;160:3227-3230. 14. Nagai H, Pineau P, Tiollais P, Buendia MA, Dejean A. Comprehensive allelotyping of human hepatocellular carcinoma. Oncogene 1997;14:2927- 2933. 15. Boige V, Laurent-Puig P, Fouchet P, Flejou JF, Monges G, Bedossa P, Bioulac-Sage P, et al. Concerted nonsyntenic allelic losses in hyperploid 117

hepatocellular carcinoma as determined by a high-resolution allelotype. Cancer Res 1997;57:1986-1990. 16. Nishimura T, Nishida N, Itoh T, Kuno M, Minata M, Komeda T, Fukuda Y, et al. Comprehensive allelotyping of well-differentiated human hepatocellular carcinoma with semiquantitative determination of chromosomal gain or loss. Genes Chromosomes Cancer 2002;35:329- 339. 17. Homayounfar K, Gunawan B, Cameron S, Haller F, Baumhoer D, Uecker S, Sander B, et al. Pattern of chromosomal aberrations in primary liver cancers identified by comparative genomic hybridization. Hum Pathol 2009;40:834-842. 18. Zhang X, Xu HJ, Murakami Y, Sachse R, Yashima K, Hirohashi S, Hu SX, et al. Deletions of chromosome 13q, mutations in Retinoblastoma 1, and retinoblastoma protein state in human hepatocellular carcinoma. Cancer Res 1994;54:4177-4182. 19. Azechi H, Nishida N, Fukuda Y, Nishimura T, Minata M, Katsuma H, Kuno M, et al. Disruption of the p16/cyclin D1/retinoblastoma protein pathway in the majority of human hepatocellular carcinomas. Oncology 2001;60:346- 354. 20. Nishida N, Goel A. Genetic and epigenetic signatures in human hepatocellular carcinoma: a systematic review. Curr Genomics 2011;12:130-137. 21. Murakami Y, Hayashi K, Hirohashi S, Sekiya T. Aberrations of the tumor suppressor p53 and retinoblastoma genes in human hepatocellular carcinomas. Cancer Res 1991;51:5520-5525. 22. Hussain SP, Schwank J, Staib F, Wang XW, Harris CC. TP53 mutations and hepatocellular carcinoma: insights into the etiology and pathogenesis of liver cancer. Oncogene 2007;26:2166-2176. 23. de La Coste A, Romagnolo B, Billuart P, Renard CA, Buendia MA, Soubrane O, Fabre M, et al. Somatic mutations of the beta-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc Natl Acad Sci U S A 1998;95:8847-8851. 24. Edamoto Y, Hara A, Biernat W, Terracciano L, Cathomas G, Riehle HM, Matsuda M, et al. Alterations of RB1, p53 and Wnt pathways in hepatocellular carcinomas associated with hepatitis C, hepatitis B and alcoholic liver cirrhosis. Int J Cancer 2003;106:334-341. 25. Yamazaki K, Masugi Y, Sakamoto M. Molecular pathogenesis of hepatocellular carcinoma: altering transforming growth factor-beta signaling in hepatocarcinogenesis. Dig Dis 2011;29:284-288. 26. Jagirdar J, Nonomura A, Patil J, Thor A, Paronetto F. ras oncogene p21 expression in hepatocellular carcinoma. J Exp Pathol 1989;4:37-46. 27. Nonomura A, Ohta G, Hayashi M, Izumi R, Watanabe K, Takayanagi N, Mizukami Y, et al. Immunohistochemical detection of ras oncogene p21

118

product in liver cirrhosis and hepatocellular carcinoma. Am J Gastroenterol 1987;82:512-518. 28. Hu TH, Huang CC, Lin PR, Chang HW, Ger LP, Lin YW, Changchien CS, et al. Expression and prognostic role of tumor suppressor gene PTEN/MMAC1/TEP1 in hepatocellular carcinoma. Cancer 2003;97:1929- 1940. 29. Nakanishi K, Sakamoto M, Yamasaki S, Todo S, Hirohashi S. Akt phosphorylation is a risk factor for early disease recurrence and poor prognosis in hepatocellular carcinoma. Cancer 2005;103:307-312. 30. Min L, He B, Hui L. Mitogen-activated protein kinases in hepatocellular carcinoma development. Semin Cancer Biol 2011;21:10-20. 31. Iyoda K, Sasaki Y, Horimoto M, Toyama T, Yakushijin T, Sakakibara M, Takehara T, et al. Involvement of the p38 mitogen-activated protein kinase cascade in hepatocellular carcinoma. Cancer 2003;97:3017-3026. 32. Hamazaki K, Yunoki Y, Tagashira H, Mimura T, Mori M, Orita K. Epidermal growth factor receptor in human hepatocellular carcinoma. Cancer Detect Prev 1997;21:355-360. 33. Kira S, Nakanishi T, Suemori S, Kitamoto M, Watanabe Y, Kajiyama G. Expression of transforming growth factor alpha and epidermal growth factor receptor in human hepatocellular carcinoma. Liver 1997;17:177-182. 34. Zhang YJ, Ahsan H, Chen Y, Lunn RM, Wang LY, Chen SY, Lee PH, et al. High frequency of promoter hypermethylation of RASSF1A and p16 and its relationship to aflatoxin B1-DNA adduct levels in human hepatocellular carcinoma. Mol Carcinog 2002;35:85-92. 35. Yu J, Ni M, Xu J, Zhang H, Gao B, Gu J, Chen J, et al. Methylation profiling of twenty promoter-CpG islands of genes which may contribute to hepatocellular carcinogenesis. BMC Cancer 2002;2:29. 36. Wong IH, Lo YM, Zhang J, Liew CT, Ng MH, Wong N, Lai PB, et al. Detection of aberrant p16 methylation in the plasma and serum of liver cancer patients. Cancer Res 1999;59:71-73. 37. Fukai K, Yokosuka O, Imazeki F, Tada M, Mikata R, Miyazaki M, Ochiai T, et al. Methylation status of p14ARF, p15INK4b, and p16INK4a genes in human hepatocellular carcinoma. Liver Int 2005;25:1209-1216. 38. Lee S, Lee HJ, Kim JH, Lee HS, Jang JJ, Kang GH. Aberrant CpG island hypermethylation along multistep hepatocarcinogenesis. Am J Pathol 2003;163:1371-1378. 39. Roncalli M, Bianchi P, Bruni B, Laghi L, Destro A, Di Gioia S, Gennari L, et al. Methylation framework of cell cycle gene inhibitors in cirrhosis and associated hepatocellular carcinoma. Hepatology 2002;36:427-432. 40. Tsujiuchi T, Shimizu K, Itsuzaki Y, Onishi M, Sugata E, Fujii H, Honoki K. CpG site hypermethylation of E-cadherin and Connexin26 genes in hepatocellular carcinomas induced by a choline-deficient L-Amino Acid- defined diet in rats. Mol Carcinog 2007;46:269-274.

119

41. Zhang YJ, Chen Y, Ahsan H, Lunn RM, Lee PH, Chen CJ, Santella RM. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation and its relationship to aflatoxin B1-DNA adducts and p53 mutation in hepatocellular carcinoma. Int J Cancer 2003;103:440-444. 42. Matsukura S, Soejima H, Nakagawachi T, Yakushiji H, Ogawa A, Fukuhara M, Miyazaki K, et al. CpG methylation of MGMT and hMLH1 promoter in hepatocellular carcinoma associated with hepatitis viral infection. Br J Cancer 2003;88:521-529. 43. Shen L, Fang J, Qiu D, Zhang T, Yang J, Chen S, Xiao S. Correlation between DNA methylation and pathological changes in human hepatocellular carcinoma. Hepatogastroenterology 1998;45:1753-1759. 44. Park IY, Sohn BH, Yu E, Suh DJ, Chung YH, Lee JH, Surzycki SJ, et al. Aberrant epigenetic modifications in hepatocarcinogenesis induced by hepatitis B virus X protein. Gastroenterology 2007;132:1476-1494. 45. Poirier K, Chalas C, Tissier F, Couvert P, Mallet V, Carrie A, Marchio A, et al. Loss of parental-specific methylation at the IGF2 locus in human hepatocellular carcinoma. J Pathol 2003;201:473-479. 46. Araki K, Miyazaki J, Hino O, Tomita N, Chisaka O, Matsubara K, Yamamura K. Expression and replication of hepatitis B virus genome in transgenic mice. Proc Natl Acad Sci U S A 1989;86:207-211. 47. Zheng Y, Chen WL, Louie SG, Yen TS, Ou JH. Hepatitis B virus promotes hepatocarcinogenesis in transgenic mice. Hepatology 2007;45:16-21. 48. Xiong J, Yao YC, Zi XY, Li JX, Wang XM, Ye XT, Zhao SM, et al. Expression of hepatitis B virus X protein in transgenic mice. World J Gastroenterol 2003;9:112-116. 49. Moriya K, Fujie H, Shintani Y, Yotsuyanagi H, Tsutsumi T, Ishibashi K, Matsuura Y, et al. The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice. Nat Med 1998;4:1065-1067. 50. Lerat H, Honda M, Beard MR, Loesch K, Sun J, Yang Y, Okuda M, et al. Steatosis and liver cancer in transgenic mice expressing the structural and nonstructural proteins of hepatitis C virus. Gastroenterology 2002;122:352-365. 51. Tanaka N, Moriya K, Kiyosawa K, Koike K, Aoyama T. Hepatitis C virus core protein induces spontaneous and persistent activation of peroxisome proliferator-activated receptor alpha in transgenic mice: implications for HCV-associated hepatocarcinogenesis. Int J Cancer 2008;122:124-131. 52. Thorgeirsson SS, Santoni-Rugiu E. Transgenic mouse models in carcinogenesis: interaction of c-myc with transforming growth factor alpha and hepatocyte growth factor in hepatocarcinogenesis. Br J Clin Pharmacol 1996;42:43-52. 53. Beer S, Zetterberg A, Ihrie RA, McTaggart RA, Yang Q, Bradon N, Arvanitis C, et al. Developmental context determines latency of MYC- induced tumorigenesis. PLoS Biol 2004;2:e332.

120

54. Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, et al. MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature 2004;431:1112- 1117. 55. Harada N, Oshima H, Katoh M, Tamai Y, Oshima M, Taketo MM. Hepatocarcinogenesis in mice with beta-catenin and Ha-ras gene mutations. Cancer Res 2004;64:48-54. 56. Tonjes RR, Lohler J, O'Sullivan JF, Kay GF, Schmidt GH, Dalemans W, Pavirani A, et al. Autocrine mitogen IgEGF cooperates with c-myc or with the Hcs locus during hepatocarcinogenesis in transgenic mice. Oncogene 1995;10:765-768. 57. Borlak J, Meier T, Halter R, Spanel R, Spanel-Borowski K. Epidermal growth factor-induced hepatocellular carcinoma: gene expression profiles in precursor lesions, early stage and solitary tumours. Oncogene 2005;24:1809-1819. 58. Nicholes K, Guillet S, Tomlinson E, Hillan K, Wright B, Frantz GD, Pham TA, et al. A mouse model of hepatocellular carcinoma: ectopic expression of fibroblast growth factor 19 in skeletal muscle of transgenic mice. Am J Pathol 2002;160:2295-2307. 59. Jhappan C, Stahle C, Harkins RN, Fausto N, Smith GH, Merlino GT. TGF alpha overexpression in transgenic mice induces liver neoplasia and abnormal development of the mammary gland and pancreas. Cell 1990;61:1137-1146. 60. Murakami H, Sanderson ND, Nagy P, Marino PA, Merlino G, Thorgeirsson SS. Transgenic mouse model for synergistic effects of nuclear oncogenes and growth factors in tumorigenesis: interaction of c-myc and transforming growth factor alpha in hepatic oncogenesis. Cancer Res 1993;53:1719- 1723. 61. Ohgaki H, Sanderson ND, Ton P, Thorgeirsson SS. Molecular analyses of liver tumors in c-myc transgenic mice and c-myc and TGF-alpha double transgenic mice. Cancer Lett 1996;106:43-49. 62. Horie Y, Suzuki A, Kataoka E, Sasaki T, Hamada K, Sasaki J, Mizuno K, et al. Hepatocyte-specific Pten deficiency results in steatohepatitis and hepatocellular carcinomas. J Clin Invest 2004;113:1774-1783. 63. Watanabe S, Horie Y, Kataoka E, Sato W, Dohmen T, Ohshima S, Goto T, et al. Non-alcoholic steatohepatitis and hepatocellular carcinoma: lessons from hepatocyte-specific phosphatase and tensin homolog (PTEN)- deficient mice. J Gastroenterol Hepatol 2007;22 Suppl 1:S96-S100. 64. Bjerkvig R, Tysnes BB, Aboody KS, Najbauer J, Terzis AJ. Opinion: the origin of the cancer stem cell: current controversies and new insights. Nat Rev Cancer 2005;5:899-904. 65. Yamashita T, Ji J, Budhu A, Forgues M, Yang W, Wang HY, Jia H, et al. EpCAM-positive hepatocellular carcinoma cells are tumor-initiating cells with stem/progenitor cell features. Gastroenterology 2009;136:1012-1024.

121

66. Kelland LR. Of mice and men: values and liabilities of the athymic nude mouse model in anticancer drug development. Eur J Cancer 2004;40:827- 836. 67. Heindryckx F, Colle I, Van Vlierberghe H. Experimental mouse models for hepatocellular carcinoma research. Int J Exp Pathol 2009;90:367-386. 68. Verna L, Whysner J, Williams GM. N-nitrosodiethylamine mechanistic data and risk assessment: bioactivation, DNA-adduct formation, mutagenicity, and tumor initiation. Pharmacol Ther 1996;71:57-81. 69. Vesselinovitch SD, Mihailovich N. Kinetics of diethylnitrosamine hepatocarcinogenesis in the infant mouse. Cancer Res 1983;43:4253- 4259. 70. Chen B, Liu L, Castonguay A, Maronpot RR, Anderson MW, You M. Dose- dependent ras mutation spectra in N-nitrosodiethylamine induced mouse liver tumors and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone induced mouse lung tumors. Carcinogenesis 1993;14:1603-1608. 71. Tamano S, Merlino GT, Ward JM. Rapid development of hepatic tumors in transforming growth factor alpha transgenic mice associated with increased cell proliferation in precancerous hepatocellular lesions initiated by N-nitrosodiethylamine and promoted by phenobarbital. Carcinogenesis 1994;15:1791-1798. 72. Maeda S, Kamata H, Luo JL, Leffert H, Karin M. IKKbeta couples hepatocyte death to cytokine-driven compensatory proliferation that promotes chemical hepatocarcinogenesis. Cell 2005;121:977-990. 73. Majumder S, Roy S, Kaffenberger T, Wang B, Costinean S, Frankel W, Bratasz A, et al. Loss of metallothionein predisposes mice to diethylnitrosamine-induced hepatocarcinogenesis by activating NF- kappaB target genes. Cancer Res 2010;70:10265-10276. 74. Imaoka S, Osada M, Minamiyama Y, Yukimura T, Toyokuni S, Takemura S, Hiroi T, et al. Role of phenobarbital-inducible cytochrome P450s as a source of active oxygen species in DNA-oxidation. Cancer Lett 2004;203:117-125. 75. Lee GH. Paradoxical effects of phenobarbital on mouse hepatocarcinogenesis. Toxicol Pathol 2000;28:215-225. 76. Watson RE, Goodman JI. Effects of phenobarbital on DNA methylation in GC-rich regions of hepatic DNA from mice that exhibit different levels of susceptibility to liver tumorigenesis. Toxicol Sci 2002;68:51-58. 77. Park EJ, Lee JH, Yu GY, He G, Ali SR, Holzer RG, Osterreicher CH, et al. Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression. Cell 2010;140:197-208. 78. Hoover KL, Lynch PH, Poirier LA. Profound postinitiation enhancement by short-term severe methionine, choline, vitamin B12, and folate deficiency of hepatocarcinogenesis in F344 rats given a single low-dose diethylnitrosamine injection. J Natl Cancer Inst 1984;73:1327-1336. 79. Blusztajn JK. Choline, a vital amine. Science 1998;281:794-795.

122

80. Zeisel SH. Choline phospholipids: signal transduction and carcinogenesis. FASEB J 1993;7:551-557. 81. Lu SC, Alvarez L, Huang ZZ, Chen L, An W, Corrales FJ, Avila MA, et al. Methionine adenosyltransferase 1A knockout mice are predisposed to liver injury and exhibit increased expression of genes involved in proliferation. Proc Natl Acad Sci U S A 2001;98:5560-5565. 82. Selhub J, Seyoum E, Pomfret EA, Zeisel SH. Effects of choline deficiency and methotrexate treatment upon liver folate content and distribution. Cancer Res 1991;51:16-21. 83. Copeland DH, Salmon WD. The occurrence of neoplasms in the liver, lungs, and other tissues of rats as a result of prolonged choline deficiency. Am J Pathol 1946;22:1059-1079. 84. Mikol YB, Hoover KL, Creasia D, Poirier LA. Hepatocarcinogenesis in rats fed methyl-deficient, amino acid-defined diets. Carcinogenesis 1983;4:1619-1629. 85. Ghoshal AK, Farber E. The induction of liver cancer by dietary deficiency of choline and methionine without added carcinogens. Carcinogenesis 1984;5:1367-1370. 86. Ghoshal AK, Farber E. Choline deficiency, lipotrope deficiency and the development of liver disease including liver cancer: a new perspective. Lab Invest 1993;68:255-260. 87. Nakae D, Yoshiji H, Maruyama H, Kinugasa T, Denda A, Konishi Y. Production of both 8-hydroxydeoxyguanosine in liver DNA and gamma- glutamyltransferase-positive hepatocellular lesions in rats given a choline- deficient, L-amino acid-defined diet. Jpn J Cancer Res 1990;81:1081-1084. 88. Nakae D. Endogenous liver carcinogenesis in the rat. Pathol Int 1999;49:1028-1042. 89. Lombardi B, Pani P, Schlunk FF. Choline-deficiency fatty liver: impaired release of hepatic triglycerides. J Lipid Res 1968;9:437-446. 90. Dela Pena A, Leclercq I, Field J, George J, Jones B, Farrell G. NF-kappaB activation, rather than TNF, mediates hepatic inflammation in a murine dietary model of steatohepatitis. Gastroenterology 2005;129:1663-1674. 91. Masuhara M, Katyal SL, Nakamura T, Shinozuka H. Differential expression of hepatocyte growth factor, transforming growth factor-alpha and transforming growth factor-beta 1 messenger RNAs in two experimental models of liver cell proliferation. Hepatology 1992;16:1241- 1249. 92. Albright CD, Zeisel SH. Choline deficiency causes increased localization of transforming growth factor-beta1 signaling proteins and apoptosis in the rat liver. Pathobiology 1997;65:264-270. 93. Rushmore TH, Ghazarian DM, Subrahmanyan V, Farber E, Ghoshal AK. Probable free radical effects on rat liver nuclei during early hepatocarcinogenesis with a choline-devoid low methionine diet. Cancer Res 1987;47:6731-6740.

123

94. Locker J, Reddy TV, Lombardi B. DNA methylation and hepatocarcinogenesis in rats fed a choline-devoid diet. Carcinogenesis 1986;7:1309-1312. 95. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281-297. 96. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin- 4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993;75:843-854. 97. Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 1993;75:855-862. 98. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Res 2008;36:D154-158. 99. Hendrickson DG, Hogan DJ, McCullough HL, Myers JW, Herschlag D, Ferrell JE, Brown PO. Concordant regulation of translation and mRNA abundance for hundreds of targets of a human microRNA. PLoS Biol 2009;7:e1000238. 100. Carthew RW, Sontheimer EJ. Origins and Mechanisms of miRNAs and siRNAs. Cell 2009;136:642-655. 101. Lee Y, Jeon K, Lee JT, Kim S, Kim VN. MicroRNA maturation: stepwise processing and subcellular localization. Embo J 2002;21:4663-4670. 102. Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol 2009;10:126-139. 103. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. MicroRNA genes are transcribed by RNA polymerase II. EMBO J 2004;23:4051-4060. 104. Cai X, Hagedorn CH, Cullen BR. Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. RNA 2004;10:1957-1966. 105. Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 2003;425:415- 419. 106. Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B, Cooch N, Shiekhattar R. The Microprocessor complex mediates the genesis of microRNAs. Nature 2004;432:235-240. 107. Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ. Processing of primary microRNAs by the Microprocessor complex. Nature 2004;432:231-235. 108. Han J, Lee Y, Yeom KH, Kim YK, Jin H, Kim VN. The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev 2004;18:3016-3027. 109. Landthaler M, Yalcin A, Tuschl T. The human DiGeorge syndrome critical region gene 8 and Its D. melanogaster homolog are required for miRNA biogenesis. Curr Biol 2004;14:2162-2167.

124

110. Wang Y, Medvid R, Melton C, Jaenisch R, Blelloch R. DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self- renewal. Nat Genet 2007;39:380-385. 111. Kim VN. MicroRNA precursors in motion: exportin-5 mediates their nuclear export. Trends Cell Biol 2004;14:156-159. 112. Lund E, Guttinger S, Calado A, Dahlberg JE, Kutay U. Nuclear export of microRNA precursors. Science 2004;303:95-98. 113. Okada C, Yamashita E, Lee SJ, Shibata S, Katahira J, Nakagawa A, Yoneda Y, et al. A high-resolution structure of the pre-microRNA nuclear export machinery. Science 2009;326:1275-1279. 114. Bohnsack MT, Czaplinski K, Gorlich D. Exportin 5 is a RanGTP- dependent dsRNA-binding protein that mediates nuclear export of pre- miRNAs. Rna 2004;10:185-191. 115. Grishok A, Pasquinelli AE, Conte D, Li N, Parrish S, Ha I, Baillie DL, et al. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 2001;106:23-34. 116. Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T, Zamore PD. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 2001;293:834-838. 117. Knight SW, Bass BL. A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans. Science 2001;293:2269-2271. 118. Ketting RF, Fischer SE, Bernstein E, Sijen T, Hannon GJ, Plasterk RH. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev 2001;15:2654- 2659. 119. Chendrimada TP, Gregory RI, Kumaraswamy E, Norman J, Cooch N, Nishikura K, Shiekhattar R. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 2005;436:740-744. 120. Haase AD, Jaskiewicz L, Zhang H, Laine S, Sack R, Gatignol A, Filipowicz W. TRBP, a regulator of cellular PKR and HIV-1 virus expression, interacts with Dicer and functions in RNA silencing. EMBO Rep 2005;6:961-967. 121. Lee Y, Hur I, Park SY, Kim YK, Suh MR, Kim VN. The role of PACT in the RNA silencing pathway. EMBO J 2006;25:522-532. 122. Kim YK, Kim VN. Processing of intronic microRNAs. EMBO J 2007;26:775-783. 123. Han J, Pedersen JS, Kwon SC, Belair CD, Kim YK, Yeom KH, Yang WY, et al. Posttranscriptional crossregulation between Drosha and DGCR8. Cell 2009;136:75-84. 124. Ruby JG, Jan CH, Bartel DP. Intronic microRNA precursors that bypass Drosha processing. Nature 2007;448:83-86.

125

125. Okamura K, Hagen JW, Duan H, Tyler DM, Lai EC. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 2007;130:89-100. 126. Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC. Mammalian mirtron genes. Mol Cell 2007;28:328-336. 127. Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 2000;404:293-296. 128. Maniataki E, Mourelatos Z. A human, ATP-independent, RISC assembly machine fueled by pre-miRNA. Genes Dev 2005;19:2979-2990. 129. Gregory RI, Chendrimada TP, Cooch N, Shiekhattar R. Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell 2005;123:631-640. 130. Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, Rajewsky N. Widespread changes in protein synthesis induced by microRNAs. Nature 2008;455:58-63. 131. Baek D, Villen J, Shin C, Camargo FD, Gygi SP, Bartel DP. The impact of microRNAs on protein output. Nature 2008;455:64-71. 132. Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 2010;466:835- 840. 133. Wu L, Belasco JG. Let me count the ways: mechanisms of gene regulation by miRNAs and siRNAs. Mol Cell 2008;29:1-7. 134. Eulalio A, Huntzinger E, Izaurralde E. Getting to the root of miRNA- mediated gene silencing. Cell 2008;132:9-14. 135. Huntzinger E, Izaurralde E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet 2011;12:99-110. 136. Derry MC, Yanagiya A, Martineau Y, Sonenberg N. Regulation of poly(A)- binding protein through PABP-interacting proteins. Cold Spring Harb Symp Quant Biol 2006;71:537-543. 137. Wang B, Love TM, Call ME, Doench JG, Novina CD. Recapitulation of short RNA-directed translational gene silencing in vitro. Mol Cell 2006;22:553-560. 138. Thermann R, Hentze MW. Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. Nature 2007;447:875-878. 139. Mathonnet G, Fabian MR, Svitkin YV, Parsyan A, Huck L, Murata T, Biffo S, et al. MicroRNA inhibition of translation initiation in vitro by targeting the cap-binding complex eIF4F. Science 2007;317:1764-1767. 140. Kiriakidou M, Tan GS, Lamprinaki S, De Planell-Saguer M, Nelson PT, Mourelatos Z. An mRNA m7G cap binding-like motif within human Ago2 represses translation. Cell 2007;129:1141-1151. 141. Chendrimada TP, Finn KJ, Ji X, Baillat D, Gregory RI, Liebhaber SA, Pasquinelli AE, et al. MicroRNA silencing through RISC recruitment of eIF6. Nature 2007;447:823-828.

126

142. Nottrott S, Simard MJ, Richter JD. Human let-7a miRNA blocks protein production on actively translating polyribosomes. Nat Struct Mol Biol 2006;13:1108-1114. 143. Maroney PA, Yu Y, Fisher J, Nilsen TW. Evidence that microRNAs are associated with translating messenger RNAs in human cells. Nat Struct Mol Biol 2006;13:1102-1107. 144. Petersen CP, Bordeleau ME, Pelletier J, Sharp PA. Short RNAs repress translation after initiation in mammalian cells. Mol Cell 2006;21:533-542. 145. Behm-Ansmant I, Rehwinkel J, Doerks T, Stark A, Bork P, Izaurralde E. mRNA degradation by miRNAs and GW182 requires both CCR4:NOT deadenylase and DCP1:DCP2 decapping complexes. Genes Dev 2006;20:1885-1898. 146. Eulalio A, Rehwinkel J, Stricker M, Huntzinger E, Yang SF, Doerks T, Dorner S, et al. Target-specific requirements for enhancers of decapping in miRNA-mediated gene silencing. Genes Dev 2007;21:2558-2570. 147. Schickel R, Boyerinas B, Park SM, Peter ME. MicroRNAs: key players in the immune system, differentiation, tumorigenesis and cell death. Oncogene 2008;27:5959-5974. 148. Sayed D, Abdellatif M. MicroRNAs in development and disease. Physiol Rev 2011;91:827-887. 149. Kloosterman WP, Plasterk RH. The diverse functions of microRNAs in animal development and disease. Dev Cell 2006;11:441-450. 150. Erson AE, Petty EM. MicroRNAs in development and disease. Clin Genet 2008;74:296-306. 151. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006;103:2257-2261. 152. Croce CM. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 2009;10:704-714. 153. Mayr C, Hemann MT, Bartel DP. Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science 2007;315:1576-1579. 154. Lee YS, Dutta A. The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes Dev 2007;21:1025-1030. 155. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, et al. RAS is regulated by the let-7 microRNA family. Cell 2005;120:635-647. 156. Sampson VB, Rong NH, Han J, Yang Q, Aris V, Soteropoulos P, Petrelli NJ, et al. MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res 2007;67:9762-9770. 157. Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T. MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 2007;133:647-658.

127

158. Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, et al. MicroRNA gene expression deregulation in human breast cancer. Cancer Res 2005;65:7065-7070. 159. Markou A, Tsaroucha EG, Kaklamanis L, Fotinou M, Georgoulias V, Lianidou ES. Prognostic value of mature microRNA-21 and microRNA-205 overexpression in non-small cell lung cancer by quantitative real-time RT- PCR. Clin Chem 2008;54:1696-1704. 160. Ribas J, Ni X, Haffner M, Wentzel EA, Salmasi AH, Chowdhury WH, Kudrolli TA, et al. miR-21: an androgen receptor-regulated microRNA that promotes hormone-dependent and hormone-independent prostate cancer growth. Cancer Res 2009;69:7165-7169. 161. Schetter AJ, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, Yuen ST, et al. MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. JAMA 2008;299:425- 436. 162. Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, Morgan DL, et al. Expression profiling identifies microRNA signature in pancreatic cancer. Int J Cancer 2007;120:1046-1054. 163. Chan JA, Krichevsky AM, Kosik KS. MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 2005;65:6029-6033. 164. Fulci V, Chiaretti S, Goldoni M, Azzalin G, Carucci N, Tavolaro S, Castellano L, et al. Quantitative technologies establish a novel microRNA profile of chronic lymphocytic leukemia. Blood 2007;109:4944-4951. 165. Murakami Y, Yasuda T, Saigo K, Urashima T, Toyoda H, Okanoue T, Shimotohno K. Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene 2006;25:2537-2545. 166. Jiang J, Gusev Y, Aderca I, Mettler TA, Nagorney DM, Brackett DJ, Roberts LR, et al. Association of MicroRNA expression in hepatocellular carcinomas with hepatitis infection, cirrhosis, and patient survival. Clin Cancer Res 2008;14:419-427. 167. Wang Y, Lee AT, Ma JZ, Wang J, Ren J, Yang Y, Tantoso E, et al. Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA- 224-specific target. J Biol Chem 2008;283:13205-13215. 168. Sato F, Hatano E, Kitamura K, Myomoto A, Fujiwara T, Takizawa S, Tsuchiya S, et al. MicroRNA profile predicts recurrence after resection in patients with hepatocellular carcinoma within the Milan Criteria. PLoS ONE 2011;6:e16435. 169. Ladeiro Y, Couchy G, Balabaud C, Bioulac-Sage P, Pelletier L, Rebouissou S, Zucman-Rossi J. MicroRNA profiling in hepatocellular tumors is associated with clinical features and oncogene/tumor suppressor gene mutations. Hepatology 2008;47:1955-1963.

128

170. Morgan TR, Mandayam S, Jamal MM. Alcohol and hepatocellular carcinoma. Gastroenterology 2004;127:S87-96. 171. Wong QW, Lung RW, Law PT, Lai PB, Chan KY, To KF, Wong N. MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1. Gastroenterology 2008;135:257-269. 172. Fan CG, Wang CM, Tian C, Wang Y, Li L, Sun WS, Li RF, et al. miR-122 inhibits viral replication and cell proliferation in hepatitis B virus-related hepatocellular carcinoma and targets NDRG3. Oncol Rep 2011;26:1281- 1286. 173. Cheung O, Puri P, Eicken C, Contos MJ, Mirshahi F, Maher JW, Kellum JM, et al. Nonalcoholic steatohepatitis is associated with altered hepatic MicroRNA expression. Hepatology 2008;48:1810-1820. 174. Pineau P, Volinia S, McJunkin K, Marchio A, Battiston C, Terris B, Mazzaferro V, et al. miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A 2010;107:264-269. 175. Fornari F, Gramantieri L, Giovannini C, Veronese A, Ferracin M, Sabbioni S, Calin GA, et al. MiR-122/cyclin G1 interaction modulates p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res 2009;69:5761-5767. 176. Bai S, Nasser MW, Wang B, Hsu SH, Datta J, Kutay H, Yadav A, et al. MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem 2009;284:32015- 32027. 177. Fornari F, Gramantieri L, Ferracin M, Veronese A, Sabbioni S, Calin GA, Grazi GL, et al. MiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinoma. Oncogene 2008;27:5651- 5661. 178. Garofalo M, Di Leva G, Romano G, Nuovo G, Suh SS, Ngankeu A, Taccioli C, et al. miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell 2009;16:498-509. 179. Yamamoto Y, Kosaka N, Tanaka M, Koizumi F, Kanai Y, Mizutani T, Murakami Y, et al. MicroRNA-500 as a potential diagnostic marker for hepatocellular carcinoma. Biomarkers 2009;14:529-538. 180. Xu J, Wu C, Che X, Wang L, Yu D, Zhang T, Huang L, et al. Circulating microRNAs, miR-21, miR-122, and miR-223, in patients with hepatocellular carcinoma or chronic hepatitis. Mol Carcinog 2011;50:136- 142. 181. Qi P, Cheng SQ, Wang H, Li N, Chen YF, Gao CF. Serum MicroRNAs as Biomarkers for Hepatocellular Carcinoma in Chinese Patients with Chronic Hepatitis B Virus Infection. PLoS ONE 2011;6:e28486. 182. Zhou J, Yu L, Gao X, Hu J, Wang J, Dai Z, Wang JF, et al. Plasma MicroRNA Panel to Diagnose Hepatitis B Virus-Related Hepatocellular Carcinoma. J Clin Oncol 2011;29:4781-4788.

129

183. Budhu A, Ji J, Wang XW. The clinical potential of microRNAs. J Hematol Oncol 2010;3:37. 184. Hou J, Lin L, Zhou W, Wang Z, Ding G, Dong Q, Qin L, et al. Identification of miRNomes in human liver and hepatocellular carcinoma reveals miR- 199a/b-3p as therapeutic target for hepatocellular carcinoma. Cancer Cell 2011;19:232-243. 185. Ji J, Shi J, Budhu A, Yu Z, Forgues M, Roessler S, Ambs S, et al. MicroRNA expression, survival, and response to interferon in liver cancer. N Engl J Med 2009;361:1437-1447. 186. Li D, Liu X, Lin L, Hou J, Li N, Wang C, Wang P, et al. MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma. J Biol Chem 2011;286:36677- 36685. 187. Thun MJ, DeLancey JO, Center MM, Jemal A, Ward EM. The global burden of cancer: priorities for prevention. Carcinogenesis 2010;31:100- 110. 188. Kumar M, Zhao X, Wang XW. Molecular carcinogenesis of hepatocellular carcinoma and intrahepatic cholangiocarcinoma: one step closer to personalized medicine? Cell Biosci 2011;1:5. 189. Zeisel SH. Nutritional importance of choline for brain development. J Am Coll Nutr 2004;23:621S-626S. 190. Denda A, Kitayama W, Kishida H, Murata N, Tsutsumi M, Tsujiuchi T, Nakae D, et al. Development of hepatocellular adenomas and carcinomas associated with fibrosis in C57BL/6J male mice given a choline-deficient, L-amino acid-defined diet. Jpn J Cancer Res 2002;93:125-132. 191. Ghoshal K, Li X, Datta J, Bai S, Pogribny I, Pogribny M, Huang Y, et al. A folate- and methyl-deficient diet alters the expression of DNA methyltransferases and methyl CpG binding proteins involved in epigenetic gene silencing in livers of F344 rats. J Nutr 2006;136:1522- 1527. 192. Bruix J, Boix L, Sala M, Llovet JM. Focus on hepatocellular carcinoma. Cancer Cell 2004;5:215-219. 193. Yeh MM, Brunt EM. Pathology of nonalcoholic fatty liver disease. Am J Clin Pathol 2007;128:837-847. 194. Torres DM, Harrison SA. Diagnosis and therapy of nonalcoholic steatohepatitis. Gastroenterology 2008;134:1682-1698. 195. Peters L, Meister G. Argonaute proteins: mediators of RNA silencing. Mol Cell 2007;26:611-623. 196. Stefani G, Slack FJ. Small non-coding RNAs in animal development. Nat Rev Mol Cell Biol 2008;9:219-230. 197. Croce CM. Oncogenes and cancer. N Engl J Med 2008;358:502-511. 198. Braconi C, Patel T. MicroRNA expression profiling: a molecular tool for defining the phenotype of hepatocellular tumors. Hepatology 2008;47:1807-1809.

130

199. Liu CG, Calin GA, Volinia S, Croce CM. MicroRNA expression profiling using microarrays. Nat Protoc 2008;3:563-578. 200. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-408. 201. Nasser MW, Datta J, Nuovo G, Kutay H, Motiwala T, Majumder S, Wang B, et al. Downregulation of microRNA-1 (miR-1) in lung cancer: Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin induced apoptosis bymiR-1. J Biol Chem 2008. 202. Gorski K, Carneiro M, Schibler U. Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 1986;47:767-776. 203. Ghoshal K, Majumder S, Zhu Q, Hunzeker J, Datta J, Shah M, Sheridan JF, et al. Influenza virus infection induces metallothionein gene expression in the mouse liver and lung by overlapping but distinct molecular mechanisms. Mol Cell Biol 2001;21:8301-8317. 204. O'Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A 2007;104:1604-1609. 205. Kutay H, Bai S, Datta J, Motiwala T, Pogribny I, Frankel W, Jacob ST, et al. Downregulation of miR-122 in the rodent and human hepatocellular carcinomas. J Cell Biochem 2006;99:671-678. 206. Gatto G, Rossi A, Rossi D, Kroening S, Bonatti S, Mallardo M. Epstein- Barr virus latent membrane protein 1 trans-activates miR-155 transcription through the NF-kappaB pathway. Nucleic Acids Res 2008;36:6608-6619. 207. Tomizawa M, Watanabe K, Saisho H, Nakagawara A, Tagawa M. Down- regulated expression of the CCAAT/enhancer binding protein alpha and beta genes in human hepatocellular carcinoma: a possible prognostic marker. Anticancer Res 2003;23:351-354. 208. O'Connell RM, Rao DS, Chaudhuri AA, Boldin MP, Taganov KD, Nicoll J, Paquette RL, et al. Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. J Exp Med 2008;205:585-594. 209. Costinean S, Zanesi N, Pekarsky Y, Tili E, Volinia S, Heerema N, Croce CM. Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice. Proc Natl Acad Sci U S A 2006;103:7024-7029. 210. Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M. Silencing of microRNAs in vivo with 'antagomirs'. Nature 2005;438:685-689. 211. Aravalli RN, Steer CJ, Cressman EN. Molecular mechanisms of hepatocellular carcinoma. Hepatology 2008;48:2047-2063. 212. Winter J, Jung S, Keller S, Gregory RI, Diederichs S. Many roads to maturity: microRNA biogenesis pathways and their regulation. Nat Cell Biol 2009;11:228-234.

131

213. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009;136:215-233. 214. Visone R, Croce CM. MiRNAs and cancer. Am J Pathol 2009;174:1131- 1138. 215. Wang B, Majumder, Sarmila, Nuovo, Gerard, Kutay, Huban, Volinia, Stefano, Patel, Tushar, Schmittgen, Thomas D., Croce, Carlo, Ghoshal, Kalpana, Jacob, Samson T. . Role of miR-155 at early stages of hepatocarcinogenesis induced by choline-deficient and amino acid defined diet in C57BL/6 mice. Hepatology 2009;in press. 216. Nasser MW, Datta J, Nuovo G, Kutay H, Motiwala T, Majumder S, Wang B, et al. Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem 2008;283:33394-33405. 217. Menghini R, Menini S, Amoruso R, Fiorentino L, Casagrande V, Marzano V, Tornei F, et al. Tissue inhibitor of metalloproteinase 3 deficiency causes hepatic steatosis and adipose tissue inflammation in mice. Gastroenterology 2009;136:663-672 e664. 218. Selaru FM, Olaru AV, Kan T, David S, Cheng Y, Mori Y, Yang J, et al. MicroRNA-21 is overexpressed in human cholangiocarcinoma and regulates programmed cell death 4 and tissue inhibitor of metalloproteinase 3. Hepatology 2009;49:1595-1601. 219. Gabriely G, Wurdinger T, Kesari S, Esau CC, Burchard J, Linsley PS, Krichevsky AM. MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol 2008;28:5369-5380. 220. Day CP. Genes or environment to determine alcoholic liver disease and non-alcoholic fatty liver disease. Liver Int 2006;26:1021-1028. 221. Kong W, Yang H, He L, Zhao JJ, Coppola D, Dalton WS, Cheng JQ. MicroRNA-155 is regulated by the transforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell Biol 2008;28:6773-6784. 222. Sun Q, Zhang Y, Yang G, Chen X, Cao G, Wang J, Sun Y, et al. Transforming growth factor-beta-regulated miR-24 promotes skeletal muscle differentiation. Nucleic Acids Res 2008;36:2690-2699. 223. Davis BN, Hilyard AC, Lagna G, Hata A. SMAD proteins control DROSHA- mediated microRNA maturation. Nature 2008;454:56-61. 224. Thomas M. Molecular targeted therapy for hepatocellular carcinoma. J Gastroenterol 2009;44 Suppl 19:136-141. 225. Yan LX, Huang XF, Shao Q, Huang MY, Deng L, Wu QL, Zeng YX, et al. MicroRNA miR-21 overexpression in human breast cancer is associated with advanced clinical stage, lymph node metastasis and patient poor prognosis. RNA 2008;14:2348-2360. 226. Nakajima G, Hayashi K, Xi Y, Kudo K, Uchida K, Takasaki K, Yamamoto M, et al. Non-coding MicroRNAs hsa-let-7g and hsa-miR-181b are

132

Associated with Chemoresponse to S-1 in Colon Cancer. Cancer Genomics Proteomics 2006;3:317-324. 227. Shi L, Cheng Z, Zhang J, Li R, Zhao P, Fu Z, You Y. hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. Brain Res 2008;1236:185-193. 228. Calin GA, Pekarsky Y, Croce CM. The role of microRNA and other non- coding RNA in the pathogenesis of chronic lymphocytic leukemia. Best Pract Res Clin Haematol 2007;20:425-437. 229. Ji J, Yamashita T, Budhu A, Forgues M, Jia HL, Li C, Deng C, et al. Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells. Hepatology 2009. 230. Mohammed FF, Smookler DS, Taylor SE, Fingleton B, Kassiri Z, Sanchez OH, English JL, et al. Abnormal TNF activity in Timp3-/- mice leads to chronic hepatic inflammation and failure of liver regeneration. Nat Genet 2004;36:969-977. 231. Massague J. TGFbeta in Cancer. Cell 2008;134:215-230. 232. Coulouarn C, Factor VM, Thorgeirsson SS. Transforming growth factor- beta gene expression signature in mouse hepatocytes predicts clinical outcome in human cancer. Hepatology 2008;47:2059-2067. 233. Miller TE, Ghoshal K, Ramaswamy B, Roy S, Datta J, Shapiro CL, Jacob S, et al. MicroRNA-221/222 Confers Tamoxifen Resistance in Breast Cancer by Targeting p27Kip1. J Biol Chem 2008;283:29897-29903. 234. Soifer HS, Rossi JJ, Saetrom P. MicroRNAs in disease and potential therapeutic applications. Mol Ther 2007;15:2070-2079. 235. Esau C, Davis S, Murray SF, Yu XX, Pandey SK, Pear M, Watts L, et al. miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab 2006;3:87-98. 236. Elmen J, Lindow M, Schutz S, Lawrence M, Petri A, Obad S, Lindholm M, et al. LNA-mediated microRNA silencing in non-human primates. Nature 2008;452:896-899. 237. Medina PP, Nolde M, Slack FJ. OncomiR addiction in an in vivo model of microRNA-21-induced pre-B-cell lymphoma. Nature 2010;467:86-90. 238. Costinean S, Sandhu SK, Pedersen IM, Tili E, Trotta R, Perrotti D, Ciarlariello D, et al. Src homology 2 domain-containing inositol-5- phosphatase and CCAAT enhancer-binding protein beta are targeted by miR-155 in B cells of Emicro-MiR-155 transgenic mice. Blood 2009;114:1374-1382. 239. Sekine S, Ogawa R, Ito R, Hiraoka N, McManus MT, Kanai Y, Hebrok M. Disruption of Dicer1 induces dysregulated fetal gene expression and promotes hepatocarcinogenesis. Gastroenterology 2009;136:2304-2315 e2301-2304. 240. Han ZB, Chen HY, Fan JW, Wu JY, Tang HM, Peng ZH. Up-regulation of microRNA-155 promotes cancer cell invasion and predicts poor survival of

133

hepatocellular carcinoma following liver transplantation. J Cancer Res Clin Oncol 2012;138:153-161. 241. Esquela-Kerscher A, Trang P, Wiggins JF, Patrawala L, Cheng A, Ford L, Weidhaas JB, et al. The let-7 microRNA reduces tumor growth in mouse models of lung cancer. Cell Cycle 2008;7:759-764. 242. Kota J, Chivukula RR, O'Donnell KA, Wentzel EA, Montgomery CL, Hwang HW, Chang TC, et al. Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model. Cell 2009;137:1005-1017. 243. Ma L, Reinhardt F, Pan E, Soutschek J, Bhat B, Marcusson EG, Teruya- Feldstein J, et al. Therapeutic silencing of miR-10b inhibits metastasis in a mouse mammary tumor model. Nat Biotechnol 2010;28:341-347. 244. Dean M, Fojo T, Bates S. Tumour stem cells and drug resistance. Nat Rev Cancer 2005;5:275-284.

134