Epitope-Tagged Pkhd1 Tracks the Processing, Secretion, and Localization of Fibrocystin

BASIC RESEARCH www.jasn.org

Jason L. Bakeberg,* Rachaneekorn Tammachote,† John R. Woollard,* Marie C. Hogan,* ʈ Han-Fang Tuan,* Ming Li,‡ Jan M. van Deursen,‡ Yanhong Wu, Bing Q. Huang,§ Vicente E. Torres,* Peter C. Harris,* and Christopher J. Ward*

*Division of Nephrology and Hypertension, Mayo Clinic, Rochester, Minnesota; †Department of Botany, Faculty of Science, Chulalongkorn University, Thailand; ‡Department of Pediatric and Adolescent Medicine and Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota; §Miles and Shirley Fiterman Center for ʈ Digestive Diseases, Division of Gastroenterology and Hepatology, Mayo Clinic, Rochester, Minnesota; Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota

ABSTRACT Mutations in the PKHD1 gene, which encodes fibrocystin, cause autosomal recessive polycystic kidney disease (ARPKD). Unfortunately, the lack of specific antibodies to the mouse protein impairs the study of splicing, post-translational processing, shedding, and temporal and spatial expression of endogenous fibrocystin at the cellular and subcellular level. Here, we report using a knock-in strategy to generate a null Pkhd1 strain and a strain that expresses fibrocystin along with two SV5-Pk epitope tags engineered in-frame into the third exon, immediately C-terminal to the signal-peptide cleavage site in a poorly conserved region. By 6 mo of age, the Pkhd1-null mouse develops massive cystic hepatomegaly and proximal tubule dilation, whereas the mouse with epitope-tagged fibrocystin has histologically normal liver and kidneys at 14 mo. Although Pkhd1 was believed to generate many splice forms, our western analysis resolved fibrocystin as a 500 kD product without other forms in the 15–550 kD range. Western analysis also revealed that exosome-like vesicles (ELVs) secrete the bulk of fibrocystin in its mature cleaved form, and scanning electron microscopy identified that fibrocystin on ELVs attached to cilia. Furthermore, the addition of ELVs with epitope-tagged fibrocystin to wild-type cells showed that label transferred to primary cilia within 5 min. In summary, tagging of the endogenous Pkhd1 gene facilitates the study of the glycosylation, proteolytic cleavage, and shedding of fibrocystin.

J Am Soc Nephrol 22: 2266–2277, 2011. doi: 10.1681/ASN.2010111173

Autosomal recessive polycystic kidney disease and small (100nm diameter) membrane bound (ARPKD MIM ID #263200) is characterized by di- particles which are shed into urine and bile, known lation of both the collecting ducts (CDs) in the kid- as PKD exosome–like vesicles (PKD–ELVs).6–10 It ney and hepatic fibrosis with or without nonobstruc- has been postulated that the mouse Pkhd1 and hu- tive biliary dilation, affecting 1:20,000 live births.1–3 The gene responsible for ARPKD is the polycystic kid- Received November 16, 2010. Accepted May 26, 2011. ney and hepatic disease gene (PKHD1: 472kb), which is encoded on chromosome 6p12.2, has 67 exons and Published online ahead of print. Publication date available at www.jasn.org. a full length mRNA of 16,235bp (mouse mRNA is 12,928bp).4 Fibrocystin/polyductin, the product of Correspondence: Dr. Christopher Ward, Division of Nephrol- ogy and Hypertension, Mayo Clinic, 703 Stabile Building, 200 the PKHD1 gene is a large type I membrane protein First Street SW, Rochester, MN 55905. Phone: 507-266-3050; of 4074 amino acids with a pro-protein convertase Fax: 507-266-9315; E-mail: ward.christopher@mayo. site between residues 3617..3620.5 Fibrocystin has edu been localized to the primary cilium, the basal body Copyright © 2011 by the American Society of Nephrology

2266 ISSN : 1046-6673/2211-2266 J Am Soc Nephrol 22: 2266–2277, 2011 www.jasn.org BASIC RESEARCH

man PKHD1genes undergo extensive differential splicing and the possibility that the smaller mRNAs of 9, 7.7 and 7.5kb that many of the putative fibrocystin products are secreted as represent differentially spliced forms of Pkhd1, but RT–PCR they have a signal peptide but no membrane anchor.11–13 If on mouse kidney poly–A mRNA showed that overlapping RT– so, these splice forms could be partially functional or antago- PCR products from exons 1–21, 19–34, 32–52, 48–52 and nistic to full length fibrocystin function and so mutations af- 48–67 only produced products of the predicted size, with only fecting a subset of splice forms are also thought to be respon- very faint products of different molecular mass. As there is only sible for some of the phenotypic variation seen in human one Pkhd1 promoter,18 these data suggests that there is one ARPKD and the range of renal phenotypes in the available full–length form of Pkhd1 mRNA at 13kb and that the smaller mouse models.14–18 However, there is debate as to the extent of forms are the products of premature poly–adenylation. We PKHD1 and Pkhd1 splicing, since Pkhd1 has a relatively simple sequenced all of the RT-PCR products and showed that they band pattern on northern blotting.4 Here we re-investigate the were 100% identical to the published full length cDNA se- splicing of Pkhd1 at an mRNA level. Furthermore, to investi- quence NM_153179 GI:126157465. There was no evidence of gate splicing at a protein level we developed mouse models of heterogeneity, deletions or insertions implying that there was ARPKD where the Pkhd1 gene is initially transcriptionally si- no differential splicing. However, it remains possible that there lenced by a STOP cassette flanked by two loxP sites, an LSL are rare minor splice forms not delineated by this RT-PCR Ϫ Ϫ module.19 Upon removal of the LSL (Pkhd1LSL( )/LSL( )) with analysis. Cre recombinase the Pkhd1 gene reactivates, producing the ϩ Pkhd1Pk( ) allele, and expresses a form of fibrocystin with two Generation of A Pkhd1 Null Mouse and An Epitope ϩ ϩ SV5–Pk tags on its extreme N–terminus. This Pkhd1Pk( )/Pk( ) Tagged Pkhd1Pk(؉)/Pk(؉) Mouse mouse is phenotypically wildtype and produces epitope tagged To investigate differential splicing at a protein level we gener- PKD–ELVs in its urine and bile. The epitope tags are inserted ated a Pkhd1 gene with an epitope tag at its extreme N–termi- into exon–3, an exon which has been shown to be present in 21 nus. To produce mice that were completely null for Pkhd1 of 22 of the putative splice forms described by Boddu.13 If mRNA we inserted a loxP flanked transcriptional STOP cas- differential splicing occurs after exon–3 and these events alter sette into intron–2. The loxP STOP loxP (LSL) cassette con- the length of the protein, these forms of fibrocystin will be tains a puromycin acetyltransferase (pac) gene and four copies detectable upon western blotting of kidney or urine. of an SV–40 viral transcriptional termination sequence that PKD–ELVs are thought to be shed from multivesicular terminates all Pkhd1 transcripts in intron 2.19 The LSL cassette bodies (MVB) and to interact with primary cilia in a rapid and can be removed by the action of the Cre recombinase, leaving specific manner.10 Such interactions have been observed in the an SbfI site and a SalI flanked loxP site in intron-2 (54bp in embryologic node by Tanaka and in the maturation of male length), 369bp 5Ј to the beginning of exon–3, allowing the gene germ cells in the epididymis, where ELVs fuse with the flagel- to restart. This results in the expression of an epitope tagged lum (modified cilium) of the maturing sperm cells.20,21 How- form of fibrocystin that has two SV5–Pk tags encoded in– ever, there is no simple assay for PKD–ELV/primary cilium frame in exon–3. These tags, 26 amino acids in length, were interactions. Here we show that Pkhd1Pk(ϩ)/Pk(ϩ) mouse urine inserted into one of the most evolutionary nonconserved re- can supply tagged PKD–ELVs that interact with WT primary gions of fibrocystin and, hence, were predicted not to influence cilia in vitro and be detected by immuno–scanning electron the function of the protein (Figure 2B). Furthermore, once the microscopy (ISEM). We further show that tagging of the en- signal peptide is cleaved, the two SV5–Pk tags are predicted to dogenous Pkhd1 gene allows the monitoring of fibrocystin in be on the extreme N–terminus of the protein, an ideal position its physiologically relevant context, in particular its glycosyla- from which to detect the native protein in tissue sections and tion, proteolytic cleavage and shedding of fibrocystin on PKD– monitor proteolytic processing, glycosylation and putative ELVs. splice forms, by western blotting (Figure 2D). Exon–3 was also chosen as it ought to be present in 95% of putative splice forms.13 RESULTS (Comparison of Pkhd1LSL(؊)/LSL(؊) and Pkhd1Pk(؉)/Pk(؉ Investigation of PKHD1 Splicing Mice Pkhd1 is highly expressed in the kidney,4,11 and resolves as a Northern blotting and RT–PCR analysis indicates that major 13kb mRNA with three smaller minor species of 9, 7.7 the Pkhd1LSL(Ϫ)/LSL(Ϫ) mouse makes no fibrocystin mRNA and 7.5kb when probed with probes encompassing exons (Figures 1 and 3). The Pkhd1LSL(Ϫ)/LSL(Ϫ) mouse, on an F10 3–13, and 22–32. A probe encompassing exons 44–50 detects inbred BALB/cJ or C57BL/6J background, develops cysts and fi- the 9kb product weakly and not the 7.7 and 7.5kb species. brosis in the liver, histologically visible at 1 mo of age, and females However, a probe encompassing exons 60–67 detects only the develop PT dilation at 6 mo of age, (Figures 4 and 5). Male mice longest 13kb product (Figure 1A). The 9, 7.7 and 7.5kb species are protected from kidney cyst development in a manner appear to be polyadenylated as they are detected on northern similar to the Pkhd1del2/del2 mice described by Woollard blots of poly–A selected mRNA (Figure 1B). We investigated (Pkhd1del2/del2 male mice never develop PT dilation).15 The

J Am Soc Nephrol 22: 2266–2277, 2011 2267 BASIC RESEARCH www.jasn.org

LSL was removed in the germline oocyte expression of Cre recombinase (the GDF–9–iCre transgenic mouse),22 to yield the Pkhd1Pk(ϩ) allele (the LoxP site and epitope tags were confirmed by sequencing). The Pkhd1Pk(ϩ)/Pk(ϩ) mouse produces a 13kb the 9kb, 7.7kb and 7.5kb products identical in length to the WT products on northern blotting (Figure 3) and is phenotypically normal with no liver or kidney pathology at all at 14 mo, showing that the SV5–Pk tagged form of fibrocystin is functionally normal, (Figures 4 and 5). To ensure that the Pkhd1 gene in the WT and Pkhd1Pk(ϩ)/Pk(ϩ) mice had identical levels of expression and that the Pkhd1LSL(Ϫ)/LSL(Ϫ) mice were null for Pkhd1 mRNA, we developed a TaqMan single tube RT-PCR assay for mouse Pkhd1 (ABI catalog# Mm01233728_m1) and the house keeping gene mouse transferrin receptor (Tfrc) (ABI catalog # Mm00441941_m1). Both probes span exon-exon junctions (ex- ons2to3inTfrc and exons 48 to 49 in Pkhd1) and in the WT cross the Ct within one cycle of one another. Using the delta Ct technique we obtained Pkhd1/Trfc ratios of 1.64 SD Ϯ 0.90 (n ϭ 6), 1.15 SD Ϯ0.2 (n ϭ6) and 0.018 SD Ϯ0.01 (n ϭ6), from 1 mo old WT, Pkhd1Pk(ϩ)/Pk(ϩ) and Pkhd1LSL(Ϫ)/LSL(Ϫ) kidney respectively. The WT versus Pkhd1LSL(Ϫ)/LSL(Ϫ) was significant at P ϭ 0.007, and Pkhd1Pk(ϩ)/Pk(ϩ) versus Pkhd1LSL(Ϫ)/LSL(Ϫ) at P ϭ 3.286eϪ5 (Welch Two Sample t test). The WT versus Pkhd1Pk(ϩ)/Pk(ϩ) was NS P ϭ 0.24, showing that the levels of Pkhd1 gene expression are similar in the WT and Pkhd1Pk(ϩ)/Pk(ϩ) mice and al- most undetectable in the Pkhd1LSL(Ϫ)/LSL(Ϫ) mouse (Supple- mental Figure 2). Liver/body weight ratios between the Pkhd1LSL(Ϫ)/LSL(Ϫ) and Pkhd1Pk(ϩ)/Pk(ϩ) animals were significant at 6, 9 and 12 mo of age as were the kidney/body weight ratios at 9 and 12 mo (P Ͻ 0.01, Welch two–sample t–test). At 12 mo liver/body weight ratios were significantly increased in both sexes in the Pkhd1LSL(Ϫ)/LSL(Ϫ) mouse, female (P ϭ 0.025) and male (P ϭ 0.02). However, in the case of sex and kidney/body weight ratios the female, but not male, Pkhd1LSL(Ϫ)/LSL(Ϫ) mice had very significantly heavier kidneys than the female Pkhd1Pk(ϩ)/Pk(ϩ) mice (P ϭ 0.0024) at 12 mo. The pancreas body weight ratios are NS at the P Ͻ 0.05 level for any time point. In total we examined 158 LSL(Ϫ)/LSL(Ϫ) Pk(ϩ)/Pk(ϩ) Figure 1. Pkhd1 shows minimal differential splicing. Northern blotting Pkhd1 mice and 90 Pkhd1 mice. and RT–PCR of mouse kidney mRNA for Pkhd1 and Lrp2 (megalin): ؉ ؉ 0.5% agarose, MOPS formaldehyde northern blots, (A) Mouse kidney Analysis of Tagged Fibrocystin In Pkhd1Pk( )/Pk( ) Mice total cellular RNA probed with probes to mouse Pkhd1 exons 1–13, As endogenous mouse Ig interferes with the secondary western 22–32, 44–50 and 60–67. The full length product is 13kb, whereas the detection of mouse monoclonal antibodies applied to mouse smaller forms are at 9, 7.7 and 7.5kb. (B) Mouse kidney poly–A mRNA tissues, we used a SV5–Pk1 antibody directly coupled to horse- probed with a probe to mouse Pkhd1 exons 1–18, showing that the radish peroxidase (HRP)(MCA1360P Serotec) (Figure6Aand Pkhd1 and its smaller forms are poly-adenylated. (C) Reverse tran- B). A survey of Pkhd1Pk(ϩ)/Pk(ϩ) mouse tissues, by western blot, scription PCR on poly–A selected mRNA from WT, Pkhd1del2/del2, Ϫ Ϫ ϩ ϩ showed that fibrocystin expression was highest in the kidney Pkhd1LSL( )/LSL( ) and Pkhd1Pk( )/Pk( ) kidney. PCRs were performed from exons 1 to 21, 19 to 34, 32 to 52 and 48 to 67 and generated followed by the pancreas, however we had difficulty detecting species with the expected molecular mass when compared with the fibrocystin in liver tissue, perhaps because cholangiocytes mouse sequence of fibrocystin [gi 126157465 ref NM 153179.3 ]. As make up only 1% of the liver cells and are much smaller than a loading control we amplified Lrp2 to show that an excess of hepatocytes. Probing western blots using the SV5-Pk1 anti- Ϫ Ϫ Pkhd1LSL( )/LSL( ) mRNA was used in these assays and that the Pkhd1 body as a primary and using an HRP conjugated anti-IgG2a Ϫ Ϫ in the Pkhd1LSL( )/LSL( ) mouse is completely transcriptionally silent. antibody as a secondary with prolonged exposure showed that liver did have a weak signal compared with kidney (Figure 6C).

2268 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 2266–2277, 2011 www.jasn.org BASIC RESEARCH

Ϫ Ϫ ϩ ϩ Figure 2. The strategy used to produce the Pkhd1LSL( )/LSL( ) and Pkhd1Pk( )/Pk( ) mouse. (A) A loxP flanked puromycin N–acetyltransferase (pac) and SV–40 derived transcriptional STOP cassette was inserted into Intron–2 of the Pkhd1, LSL. This terminated all Pkhd1 transcripts after this point. Two SV5–Pk epitope tags where also inserted in frame into exon–3 of the Pkhd1 gene. (B) A T–Coffee alignment of the signal peptides and first 27 amino acids of five vertebrate fibrocystins.29 The insertion site for the tag was chosen so that it was in a region of poor overall conservation and at the extreme N–terminus of the mature protein (once the signal peptide is removed in the endoplasmic reticulum). (C) The protein sequence of the signal peptide, SV5–Pk tag and mature fibrocystin junction in ϩ ϩ the Pkhd1Pk( )/Pk( ) mouse. (D) Schematic diagram of the fibrocystin protein showing the SV5–Pk tag site and the pro–protein ϩ Ϫ convertase site. (E) Diagnostic PCRs for the detection of the Pkhd1Pk( ) and Pkhd1LSL( ) alleles (Concise Methods). Fibrocystin was also detectable in Pkhd1Pk(ϩ)/Pk(ϩ) bile. The membrane fibrocystin from 500 kD to 450 kD showing that spleen, thymus, colon, cerebrum, cerebellum, hypothalamus about half of the kidney fibrocystin is in the ER (Figure 6D). and spinal cord had undetectable levels of fibrocystin (data not The fibrocystin in PKD–ELVs on the other hand was reduced shown). This agrees with the RT–PCR surveys, which suggest only 10 kD by Endo H treatment showing that it is mainly only kidney, pancreas, liver and lung make Pkhd1 mRNA.4 In resistant and has complex post–Golgi carbohydrate. In sum- this previous study we detected more fibrocystin mRNA in the mary, all of the PKD–ELV fibrocystin is proteolytically cleaved liver than pancreas, perhaps because mRNA was degraded by and has complex carbohydrates, both proxies for protein ma- pancreatic RNaseA. Western analysis of mouse kidney mem- turity. The idea that the Pkhd1 gene is extensively differentially brane in Pkhd1Pk(ϩ)/Pk(ϩ) mice showed that fibrocystin re- spliced, led us to investigate whether there were any smaller solved as a 500 kD doublet with no smaller forms visible on forms of fibrocystin that were secreted into the urine. We were western blotting (Figure 6 A and Bb). Upon N–linked degly- able to detect SV5-Pk tagged fibrocystin in unprocessed cosylation with PNGase, this doublet resolved as a single spe- Pkhd1Pk(ϩ)/Pk(ϩ) mouse urine by western blotting and specifi- cies at 450 kD, implying that the 500 kD doublet is due to cally searched for smaller forms in the 15–550 kD range (we differential N–linked glycosylation (Figure 6 D and E). Exo- can detect fibrocystin in this system by loading 30␮l of mouse some–like vesicles (ELVs) isolated from Pkhd1Pk(ϩ)/Pk(ϩ) urine onto a gel and western blotting). We were unable to detect mouse urine generate a single band at 450 kD which decreases any forms smaller than 450 kD (Figure 6 E and F), indicating that in size to about 390 kD on deglycosylation with PNGase and is there are no abundantly expressed, differentially spliced forms compatible with cleavage at the proprotein convertase site ob- (containing exon-3) without trans–membrane anchors in the served by Kaimori.5 This smaller cleaved form is not seen in urine. The 7.5 and 7.7 kb species seen in northern blots of Pkhd1 kidney tissue implying that the mature form of fibrocystin is would be predicted to make glycosylated protein products in the only present on PKD–ELVs (Figure 6 D, E, and G). To further 280 to 350 kD range, but we did not observe these products. How- show that the fibrocystin on PKD–ELVs is mature, we treated ever, we cannot completely exclude the possibility of rare, smaller kidney membrane and PKD–ELVs with Endo H, which cleaves products, but these would be only a few percent of the abundance the chitobiose core of high mannose oligosaccharides from of the full length product. Next we investigated the idea that fibro- N-linked glycoproteins. This reduced about half the kidney cystin could be shed in a soluble form from ELVs. We pelleted

J Am Soc Nephrol 22: 2266–2277, 2011 2269 BASIC RESEARCH www.jasn.org

the protein we used SEM to visualize the localization of the protein on the primary cilium and apical aspect of cultured renal epithelial cells. In previous experiments we used nano– gold and carbon coating to visualize exosome–primary cilia interactions.10 Although this gives excellent backscatter con- trast between the carbon Z ϭ 6 and gold Z ϭ 79, the carbon must be applied to a high thickness, 22nm, which can obscure structure. To avoid this we coated with 1nm osmium, and were able to visualize small (50–100nm) SV5–Pk positive blebs which we interpret as ELVs attached to the membrane of the primary cilium (Figure 7 A–D).

Use of the Pkhd1Pk(؉)/Pk(؉) Mouse To Develop An Assay for PKD–ELV/Primary Cilium Interactions To develop a faster assay for ELV/primary cilium interactions, we used fresh urine from Pkhd1Pk(ϩ)/Pk(ϩ) mice as a probe onto primary PT renal epithelial cells from WT mice. These cells were Ͼ90% ciliated with primary cilia of 7.12 SD Ϯ 3.05␮m (n ϭ 10). Control monolayers without the addition of ELVs or treated with WT urine, have only the occasional gold particle on their cilia membranes (1.9 SD Ϯ 2.02 particles/cilium (the background)) and there are no gold positive ELVs adherent to the primary cilium. However, cells treated with Pkhd1Pk(ϩ)/Pk(ϩ) urine for 1, 2, 5 and 10 min have, 1.5 SD Ϯ 1.5, 1.7 SD Ϯ 0.7, 0.55 SD Ϯ 0.68 and 0.36 SD Ϯ 0.67 ELVs with one or more gold particles on them respectively (Figure 8) versus 0atTϭ 0. This is reflected in the total amount of gold particles on the primary cilium 1.9 SD Ϯ 2.02 at T ϭ 0 to 7.63 SD Ϯ 6.0, 5.2 SD Ϯ 3.1,

Ϫ Ϫ 1.6 SD Ϯ 2.2 and 2.4 SD Ϯ 3.6 at 1, 2, 5 and 10 min respectively. Figure 3. Pkhd1LSL( )/LSL( ) mice are null for Pkhd1 mRNA whereas ϩ ϩ As described in Hogan et al. PKD–ELV–primary cilium inter- Pkhd1Pk( )/Pk( ) mice have normal levels of Pkhd1 mRNA. Northern blots for Pkhd1, Pkd1 and Lrp2 (megalin): Northern blots of total actions are fast, with the peak of SV5–Pk (ELV) deposition 10 mouse kidney RNA, run on a MOPS, formaldehyde, 0.5% agarose occurring at 1–2 min. By 10 min the primary cilia are cleared Ϫ Ϫ ϩ ϩ gel. WT, Pkhd1del2/del2, Pkhd1LSL( )/LSL( ) and Pkhd1Pk( )/Pk( ) kidney of SV5–Pk ELVs. This interaction appears to be specific and at RNA probed with (A) the first 18 exons of Pkhd1, (B) the last 7 exons early time points (1 and 2 min) the primary cilia extrude small of Pkhd1, (C) a Pkd1 cDNA probe and (D) a Lrp2 megalin probe. The 100nm by 20nm tubes, ciliary side branches, toward the Ϫ Ϫ Pkhd1LSL( )/LSL( ) mouse does not make a Pkhd1 product with either SV5-PK positive ELVs (Figure 8A). The ELVs often appear to Pkhd1 probe but does synthesize Pkd1 and Lrp2 mRNA. The sit on the surface of these before integrating into the mem- Pk(ϩ)/Pk(ϩ) Pkhd1 kidney lane is somewhat under loaded, but the ratios of brane at 5 min. Pkhd1 and Lrp2/Pkd1 mRNA are similar to the control. This is reflected in the quantitative PCR in Supplemental Figure 2. DISCUSSION 100␮l aliquots of Pkhd1Pk(ϩ)/Pk(ϩ) urine at 100,000g for 1 h and compared the pellet to the supernatant. We also incubated 100␮l Our studies show that extensive differential splicing is not a aliquots of urine at 37 °C for6hintheabsence of proteinase major feature of Pkhd1 at an mRNA or protein level with one inhibitors and assessed whether fibrocystin could be shed. All of main mRNA species and one protein predominating in both. the urinary fibrocystin appeared to be closely associated The smaller minor 9, 7.7 and 7.5kb mRNA species are probably with the pellet. To absolutely exclude the presence of due to premature termination of the larger mRNA, and there is smaller forms of fibrocystin, we prepared four separate little evidence for smaller fibrocystin proteins in the kidney, preparations of Pkhd1Pk(ϩ)/Pk(ϩ) mouse ELVs and showed bile or pancreas. We think that the observations that suggest that these forms were not a feature of ELV fibrocystin, with all that Pkhd1 and PKHD1 have many different splice forms may four preparations resolving at 450 kD (Figure 6G). be due to the poor stability of the Pkhd1 transcripts. Differen- tial splicing products might occur at a low level in Pkhd1 but -Visualization of Pkhd1Pk(؉)/Pk(؉) Primary Cilia Using SEM could then be preferentially amplified by RT–PCR in a prepa As fibrocystin is predicted to be a type–1 membrane protein ration lacking significant amounts of the longer full-length and the N–terminal SV5-Pk tags are on the extracellular tip of mRNA.11–13 Alternatively, as Pkhd1 is a large gene, 472kb, there

2270 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 2266–2277, 2011 www.jasn.org BASIC RESEARCH

Ϫ Ϫ Ϫ Ϫ Figure 4. Female Pkhd1LSL( )/LSL( ) mice develop proximal tubule dilatation and cysts, whereas male Pkhd1LSL( )/LSL( ) mice and both ϩ ϩ ϩ ϩ Ϫ Ϫ sexes of Pkhd1Pk( )/Pk( ) mice have cyst-free kidneys. Comparison of WT, Pkhd1Pk( )/Pk( ) and Pkhd1LSL( )/LSL( ) kidneys: Comparison of Ϫ Ϫ Ϫ Ϫ ϩ ϩ Ϫ Ϫ the renal phenotype in WT, male Pkhd1LSL( )/LSL( ), female Pkhd1LSL( )/LSL( ) and female Pkhd1Pk( )/Pk( ) animals. Both Pkhd1LSL( )/LSL( ) ϩ ϩ and Pkhd1Pk( )/Pk( ) animals were inbred to F10 on a C57BL/6J background and compared with C57BL/6J WT mice. Only female Ϫ Ϫ Pkhd1LSL( )/LSL( ) mice begin to develop PT dilation at 3 to 6 mo of age. This is confirmed by immunohistology with Lotus ϩ ϩ tetragonolobus lectin (LTL) which is specific for the PT (DAPI counter-stain). The female Pkhd1Pk( )/Pk( ) mice have normal kidneys at 12 mo of age.

may be a great deal of aberrantly spliced Pkhd1 RNA which is fragments are disulfide linked (Figure 6G).5,10 The fact that not represented in the mature poly-A RNA pool (as they often only the PKD-ELV fibrocystin has undergone proteolytic pro- contain premature stop codons these aberrantly spliced tran- cessing and that it has complex Endo H resistant carbohydrate scripts may be degraded by nonsense mediated decay). In our demonstrates that the mature, (and by implication, func- hands, the use of total cellular RNA (nonpoly-A selected) leads tional) form of fibrocystin only exists on the PKD–ELVs. to the generation of smaller aberrantly spliced products which We were able to visualize SV5–Pk positive PKD–ELVs on are easily amplified but often contain premature stop codons.4 primary cilia by ISEM (Figure 7), and to visualize fibrocystin Removal of the Pkhd1LSL(Ϫ)/LSL(Ϫ) LSL cassette from the staining on the primary cilium in the absence of visible ELVs. germline yields the Pkhd1Pk(ϩ)/Pk(ϩ) mouse which never devel- We were also able to show that urinary Pkhd1Pk(ϩ)/Pk(ϩ) PKD– ops liver disease and is phenotypically normal, showing the ELVs are functional in our PKD–ELV/primary cilium interac- presence of two SV5–Pk tags in the N–terminus of fibrocystin tion assay with PKD–ELVs interacting with WT primary cilia have no influence on the function of the protein. Therefore, we within one minute and being cleared from the primary cilium are able to observe fibrocystin protein in its physiologic con- within 10 min. We also detected ciliary side branches emanat- text without the problems associated with overexpression of ing from primary cilia when challenged with diluted mouse cDNAs in transgenic animals. We are able to detect fibrocystin urine. Occasionally, these were seen to interact with PKD–ELVs in untreated and unconcentrated Pkhd1Pk(ϩ)/Pk(ϩ) urine, using (Figure 8A). We are unsure as to the nature of these structures and a directly labeled SV5–Pk1 HRP antibody, avoiding a common as far as we know this is the first time they have been observed. We problem of secondary detection in mice where endogenous Ig think that they are microtubule based short extensions which are overwhelms the true signal. Our data show that there is one actively stimulated by the proximity of PKD–ELVs. Further study fibrocystin polypeptide at the cellular level and is probably of these structures will be difficult unless there is a way to induce processed by a proprotein convertase on shedding on ELVs (at them at will and in abundance, as they are relatively rare structures ANSERKRKR NC in the mouse sequence). The N–terminal that are not suited for TEM. portion remains attached to the ELV as shown by our fraction- A fast PKD–ELV/primary cilium interaction is necessary ation data. Proteomics show that the C-terminal of fibrocystin in the context of urine flowing through a tubule, and the is also present in the human PKD-ELV, running at a molecular rapid clearance of ELVs from the primary cilium may be due weight of 55 to 60 kD and Kaimori suggests that the N and C to fibrocystin integrating with the retrograde motors in the

J Am Soc Nephrol 22: 2266–2277, 2011 2271 BASIC RESEARCH www.jasn.org

dine kinase gene for negative selection. The 5Ј HinDIII site was deleted by the insertion of oligonucleotides creating a SrfI site. The region 369bp 5Ј to 255bp 3Ј of exon–3 was replaced by a ␤–lactamase cassette flanked with an SbfI site and a PacI site, using the recombineering Escherichia coli stain DY380.23 Next, the region between 369bp 5Ј to 255 3Ј of exon–3 was amplified with the 5Ј end was modified to supply a SbfI site and SalI site, and the 3Ј end to supply a PacI site. Then exon–3 was opened at an endogenous XhoI site and two mutually priming oligonucleotides were inserted to generate the sequence PIPNPLLGLDSPGTPIPNPLLGLDS en- coding two copies of the SV5–Pk sequence described by Hanke.24 We then modified this construct by inserting the LSL cassette into the 5Ј SalI site such that the pac gene was expressed in an antisense direction to Pkhd1. The LSL–SV5–Pk–Exon3 construct was then Ϫ Ϫ ␤ Figure 5. Both sexes of Pkhd1LSL( )/LSL( ) mice develop polycystic liver disease and inserted SbfI PacI into the –lactamase tar- ϩ ϩ fibrosis, whereas Pkhd1Pk( )/Pk( ) mice always have normal livers. Comparison of geted phage to generate the final construct, ϩ ϩ Ϫ Ϫ WT, Pkhd1Pk( )/Pk( ) and Pkhd1LSL( )/LSL( ) liver: Comparison of the liver phenotype removing the ␤-lactamase cassette. The final Ϫ Ϫ Ϫ Ϫ ϩ ϩ in WT, male Pkhd1LSL( )/LSL( ), female Pkhd1LSL( )/LSL( ) and female Pkhd1Pk( )/Pk( ) targeting construct has arms of 5.4kb and Ϫ Ϫ ϩ ϩ animals. Both Pkhd1LSL( )/LSL( ) and Pkhd1Pk( )/Pk( ) animals were inbred to F10 on 6.2kb. SrfI was used to linearize the construct a C57BL/6J background and compared with C57BL/6J WT mice. Both male and and it was used to create targeted ES clones as LSL(Ϫ)/LSL(Ϫ) female Pkhd1 mice develop liver cysts and fibrosis at 3 mo of age and described by van Deursen,25 except that puro- this worsens with age until the liver is completely replaced by cysts at 12 mo of age. mycin was used as a selective agent at 1.5 ␮g/ This is confirmed by staining with PCK–26 (IgG1 monoclonal antibody ab6401) ml, the recombination rate was 19.6%. Two anti–cytokeratins 5, 6, and 8, which shows that the cyst lining are epithelial in origin ϩ ϩ independent clones went germline on a (DAPI counter-stain). Both sexes of the Pkhd1Pk( )/Pk( ) mouse have normal livers at 12 mo and this has been confirmed to the 14 mo time point. C57BL/6J background and were then inbred onto C57BL/6J and BALB/cJ backgrounds un- cilium. This ‘urocrine’ mechanism may be involved in til the 10th generation. Both strains had identical phenotypes. To transporting hydrophobic mediators and preformed com- produce the Pkhd1Pk(ϩ)/Pk(ϩ) animal we crossed both strains onto plexes over relatively long distances. For example, urinary GDF–9–iCre transgenic mice at generation F2 and then inbred the ELVs have been shown to contain polycystin–1 and 2, which resultant Pkhd1Pk(ϩ)/Pk(ϩ) animals onto C57BL/6J to F10.22 We ϩϩ are subunits of a large ligand gated Ca channel, and ensured that the LSL was appropriately removed by this manipu- smoothened, the constitutionally active seven-membrane lation leaving a single SbfI site and a SalI flanked loxP site in intron spanning receptor in the hedgehog pathway,10 raising the 2 as dictated by the original design. We confirmed that the possibility of PKD–ELVs being involved in transmitting a Pkhd1LSL(Ϫ)/LSL(Ϫ) mice could not make Pkhd1 mRNA and that range of signals. For example, alterations in fluid flow along the gene was reactivated in Pkhd1Pk(ϩ)/Pk(ϩ) mice by northern the tubule may dislodge or induce the secretion of ELVs blotting and RT–PCR. which interact with downstream cilia, inducing a flow de- pendent intracellular Caϩϩ flux. This would require a fast interaction between ELVs and primary cilia similar to the PCR Diagnostics for Pkhd1LSL(؊)/LSL(؊) and interaction observed in this study. Pkhd1Pk(؉)/Pk(؉) Mice Genomic DNA was extracted from tail samples using the Puregene DNA Purification Kit (Qiagen). The Pkhd1LSL(Ϫ) allele was de- CONCISE METHODS tected with primers TGGATGTGGAATGTGTGCGAG, and TTACGGCAACGGTGGTTTCTTCGG with cycling parameters of Generation of the Knockout Construct 32 cycles at 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 30 s and the A 11.526kb ␭–phage extending from an endogenous HinDIII 1.174kb product was 341bp. The Pkhd1Pk(ϩ) allele was detected with prim- 5Ј from the start of the first exon of Pkhd1 to a MboI (modified with an ers TTCTCTGGACCAATAATGCCTG and AAACCTACCGT- NotI adaptor) site 557bp 3Ј of exon 5 was utilized and cloned into the CAAATACAACTGTG with cycling parameters of 30 cycles at kanamycin resistance vector pZero–2. This had a 3Ј vector derived 94 °C for 30s, 60 °C for 30 s, and 72 °C for 1 min and the product NotI site which was used to introduce a PGK promoter driven thymi- was 351bp.

2272 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 2266–2277, 2011 www.jasn.org BASIC RESEARCH

200␮M calcium chloride, with EDTA-free Complete 1x, proteinase inhibitors, 2.5ml per kidney. Nuclei and intact cells were removed by centrifugation at 500g for 5 min, the supernatant was then diluted four fold in 0.25M sucrose, 10mM Tris pH 7.5, 1mM EDTA with Complete, then centrifuged at 4000g for 15 min. The supernatant was underlayed by a 1M Sucrose cushion and ultracentrifuged at 30,000g for 1 h. The in- terface was collected diluted with the EDTA buffer to fill a 10 ml ultracentrifuge tube and spun at 100, 000g for 1 h. The pellet was recovered and resuspended in the EDTA buffer for long term storage in aliquots at Ϫ80 °C. WT, Pkhd1LSL(Ϫ)/LSL(Ϫ) and Pkhd1Pk(ϩ)/Pk(ϩ) urines were collected from mice in metabolic cages onto a single Complete (EDTA–free) mini tablet to ensure protease inhibition. Urine was precleared at 4000g for 15 min to remove debris. This urine could be used directly on western blotting. To prepare ELVs, precleared urine was centrifuged at 100,000g for1hat4°Cfor1h then the supernatant and pellet were collected. Western blotting was performed on Invitrogen, 10 well 4% polyacrylamide Tris–glycine gels to Figure 6. SV5-Pk tagged fibrocystin is easily detected in the kidney, urine, and urinary resolve 200–600 kD or 10 well 4–12% poly- ELVs. (A). A) 4–12% MOPS PAGE gel resolving from 15–550 kD, there is a 500 kD band in ϩ ϩ acrylamide MOPS gels to resolve between 15– Pkhd1Pk( )/Pk( ) kidney membrane preparation but no tagged material was seen in Ϫ Ϫ 600 kD. Blotting was performed with either Pkhd1LSL( )/LSL( ) or WT tissues. Note: there is an endogenous band at 50 kD which cross invitrogen Tris–glycine transfer buffer or Nu– reacts with SV5–Pk1 antibody (this can be used as a loading control). (B) (a) Coomassie blue staining of a duplicate 4 to 12% MOPS PAGE gel in A; (b) 4% slab gel showing that PAGE transfer buffer with 0.01% SDS onto ϩ ϩ ␮ fibrocystin runs as a doublet. (C) 3–8% Nu–PAGE gel comparing 30 ␮gofPkhd1Pk( )/Pk( ) Trans–Blot R® pure nitrocellulose (0.45 ) kidney and liver membrane protein, probed with SV5-Pk1 and a HRP conjugated second- membrane at 15V for 4 h. The membranes were ary antibody, the liver contains a small fraction of the kidney fibrocystin as biliary epithelial blocked in 20 mM Tris pH 7.5 0.15M NaCl and cells make up about 1% of hepatic cells. (D) 3–8% Nu–PAGE gel. Kidney membrane 0.05% Tween 20, with 5% non–fat milk added. preparations were treated with PNGase and Endo H. PNGase results in fibrocystin A HRP conjugated SV5-Pk1 antibody (Serotec resolving at 450 kD, whereas Endo H causes approximately half the kidney fibro- MCA1360P) was used to detect tagged protein cystin to resolve at 450 kD implying that about half of the fibrocystin is in the ER. at a concentration of 1:4000 at room tempera- Pk(ϩ)/Pk(ϩ) In the case of Pkhd1 ELVs, fibrocystin shifts from 450 kD to 390 kD after ture for 30 min then washed 3 times in TBS, treatment with PNGase (implying that it has undergone the pro–protein convertase before detection with SuperSignal R® West cleavage event upon release from the cell). Upon treatment with Endo H there is a Femto substrate (Thermo scientific). Film was very slight decrease in size, c10 kD, implying that the bulk of the glycosylation is mature complex type carbohydrate (post–Golgi). (E) Distribution of fibrocystin in Kodak BIOMAX MS and exposures were 20 s to ϩ ϩ urine of the Pkhd1Pk( )/Pk( ) mouse. We can use the SV5–Pk1 antibody to detect 2 min. fibrocystin in unconcentrated urine and again we detected no smaller forms. (F) ␮ Pk(ϩ)/Pk(ϩ) ␮ 200 l of fresh Pkhd1 mouse urine was harvested and 100 l brought to 1x Primary Cell Culture Complete proteinase. This 100␮l was centrifuged at 100,000g for1hat4°Cand Kidney tissue was sliced into 1 mm fragments and the supernatant carefully removed and the pellet resuspended. The remaining placed in a 1mg/ml collagenase type IV solution ␮ 100 l was then incubated at 37 °C for 6 h without proteinase inhibitors and the (Sigma) in dissection solution (Hanks Buffered pellet and supernatant collected. A 3–8% MOPS western showed that all of the Saline Solution (HBSS) with 10mM Glucose, fibrocystin remained in the PKD–ELV fraction despite the prolonged incubation at 5mM Glycine, 1mM ␤–Alanine and 15mM 37 °C, showing that the cleaved fibrocystin is firmly attached to the PKD–ELVs. (G) To exclude the possibility of differential splice forms or other processed forms we HEPES) for a 30 min digestion at 37 °C. Digested ␮ ran four different ELV samples ona4to12%gel. fragments were sieved through a 250 m pore size nylon sieve and washed with dissection solution. Western Blotting Flow-through of tissue fragments were then transferred to an 80␮m ny- Mouse kidney membrane preparations were prepared by mincing and lon sieve and washed with dissection solution. PT cells that were captured Dounce homogenization in 0.25M sucrose, 10mM Tris pH 7.5 with on the 80␮m sieve were resuspended in dissection solution with 1% BSA

J Am Soc Nephrol 22: 2266–2277, 2011 2273 BASIC RESEARCH www.jasn.org

room temperature with rabbit anti–mouse IgG diluted 1:1500 with blocking solution, washed 3x in blocking buffer, and then probed with protein A conjugated with 15nm gold particles (1:70 diluted with blocking solution) for 2 h. The samples were post–fixed in 1% glutaraldehyde for 10 min, incubated in

OsO4 for 2 h, dehydrated, critical-point dried, and carbon coated to 22nm or osmium plasma coated to a depth of 1nm. Images were generated at 5–10 kV by a Hitachi S-4700 microscope (Hitachi, Pleasanton, California).

PKD–ELV/Primary Cilium Assay Fresh urine from Pkhd1Pk(ϩ)/Pk(ϩ) mice was obtained by placing mice in a box with 96 well microtiter plates covering the bottom this separates urine from feces. Urine was gently spun at 1000g for 1 min to remove debris then diluted in serum free tissue culture medium and applied to WT ciliated PT cells and incubated for 1, 2, 5 or 10 min at 37 °C, before fixation in 2x fixation buffer and then stained for SV5-Pk and prepared for SEM as above. 15nm gold and 1nm Osmium coating was used.

Histology Mice were anesthetized with 50mg/kg sodium pentobarbital. The left ventricle was cannu- Figure 7. Fibrocystin is present on ELVs attached to the primary cilium. Immuno- lated and the inferior vena cava cut. The mice localization of SV5–Pk tagged fibrocystin in cultured PT cells by ISEM: Primary were perfused with PBS followed by a similar Pk(ϩ)/Pk(ϩ) LSL(Ϫ)/LSL(Ϫ) Pkhd1 PT cells, the affected cell type in Pkhd1 mice, were cultured for volume of 4% parafomaldehyde. Tissue was 7 d and serum starved for 2 d, fixed in paraformaldehyde/glutaraldehyde and stained for paraffin-embedded. Hemotoxylin/eosin and SV5–Pk1 with 15nm protein A gold. (Left) Secondary electrons, (Right) Backscattered Mallory trichrome staining was performed electrons (gold). (A–D) primary cilia with adherent PKD–ELVs staining with 15nm gold, there is also gold on the shaft of the primary cilium in D. according to standard procedures by the Mayo Clinic Histology laboratory. Slides were in dissection solution and centrifuged for 5 min at 200g.26 Cells were then observed using a Zeiss AxioObserver (Carl Zeiss) microscope at a resuspended in cell culture media (DMEM/F12 without Phenol red with magnification of ϫ5 and ϫ40 magnification. 15mM HEPES, 2.5mM L-glutamine, 10% Fetal Bovine Serum, 500nM Dexamethasone, 5 ␮g/ml Insulin, 5 ␮g/ml Transferrin, 50nM Sodium Immunofluorescence selenite, 0.55mM Sodium Pyruvate, and 10ml/L Nonessential amino ac- Neonatal mouse kidneys were placed in 4% parafomaldehyde and em- ids) and plated onto BD biocoat type IV collagen glass slides (BD biosci- bedded in paraffin. 4␮m sections were taken, mounted on positively ences). These cells were Ͼ90% LTA positive. charged slides and dried for 20 min at 60 °C. The staining protocol is identical to that of Tammachote,27 with the addition of 0.1% Sudan Black Scanning Electron Microscopy (SEM) B (Sigma) for 20 min after the series dehydration steps (to quench auto- PT explants were grown on poly–L–Lysine laminin coated glass fluorescence). Antigen retrieval was accomplished by either steaming in coverslips until confluence, and then for another7din10%fetal sodium citrate for 45 min or 1 ␮g/ml proteinase K treatment for 15 min bovine serum (FBS) containing medium which was then swapped at 37 °C. Slides were observed using a Zeiss AxioObserver (Carl Zeiss) for 0.4% FBS for another 3 d. For fixation cells were transferred to microscope at a magnification of ϫ100. 0.5ml of serum free medium and cultured for 2 h, then 0.5ml of 37 °C, 2x fixative (8% paraformaldehyde and 0.4% glutaraldehyde, PBS) was added. Samples were blocked with 10% FBS in PBS. After RNA Analysis rinsing with phosphate buffer 5 times, the samples were incubated Total cellular RNA was isolated using the acid phenol technique of overnight at 4 °C with SV5–Pk1 antibody diluted with blocking Chomczynski.28 mRNA was then obtained from total RNA using solution (1:10), washed 3x in blocking buffer, incubated for1hat PolyATtract mRNA Isolation System III (Promega) according to the

2274 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 2266–2277, 2011 www.jasn.org BASIC RESEARCH

Figure 8. PKD-ELVs interact with primary cilia and are cleared within 10 minutes. PKD–ELV/primary cilium interaction visualized by SEM: ϩ ϩ Primary WT PT cells are incubated with PKD–ELVs from Pkhd1Pk( )/Pk( ) mouse urine. (A and B) WT PT primary cilia at 1 min with (A) a ciliary side branch interacting with SV5-Pk positive PKD–ELVs. (C and D) SV–Pk5 positive PKD–ELVs interacting with a primary cilia at 2 min. Left hand panels secondary electrons, right hand panels backscattered electrons – gold (SV5–Pk label, 15nm gold). (E) The number of exosomes positive for SV5–Pk gold adherent to WT primary cilia and the total amount of gold particles on primary cilium after adding ϩ ϩ 1:10 dilution of Pkhd1Pk( )/Pk( ) urine, as a function of time. For adherent PKD–ELVs the time points 1 and 2 min were significant versus control (T ϭ 0) at P ϭ 0.0015, and P ϭ 0.001 respectively (an ELV is defined as a 100nm vesicle attached to the primary cilium with Ͼ1 gold particle), for total gold per primary cilium the 1 min time point was significant versus control P ϭ 0.038 (One–way ANOVA with Tukey’s HSD, data presented as Tukey box plots). manufacturer’s instruction. 200–300ng of mRNA was reverse tran- CCAAGTGGTTCG Ϫ3 and reverse primer 5-ATGACTGCCT- scribed with Random Primers and Super-Script III Reverse Tran- GATACACCGTCC-3. PCR was with Kapa Long–Range PCR (KAPA- scriptase (Invitrogen) using the manufacturers protocol. Amplifica- BIOSYSTEMS). tion of fibrocystin was accomplished by generating primers from the cDNA sequence of fibrocystin using Macvector 8.1.1 (Accelrys). Northern Blotting. Primer sequences (see Table 1). Northern blotting was done with 10 ␮g of total cellular RNA dena- The megalin primers are forward primer 5-GAGGAGAATC- tured in formaldehyde/formamide and run on a MOPS–formaldehyde 0.5% agarose gel, 50V overnight. The gels were washed in milliQ Table 1. Oligonucleotides used in long RT-PCR water 3 times and transfered onto Zeta–Probe Nylon blotting mem- Exon in Pkhd1 Oligonucleotide branes. The blots were probed with the first 18 or the last 7 exons of Ex. 1_21F TCATTTGAGGCACAAGGCTGAC Pkhd1,aPkd1 or Lrp2 cDNA probe. Ex. 1_21R GGAACCACGGGGCGGATG Ex. 19_34F CTCCAGGTCTGATGGGGTCC Ex. 19_34R CACAGGGAACTCTCTTCACAAAGG TaqMan Assay. Ex. 32_52F AACTTCTTCATCGTGCCTCAGGTGC The expression studies of the selected genes are analyzed in a TaqMan Ex. 32_52R TCCCCAGCCTTTTTCAACATCTTGC probe-based quantitative real-time reverse transcriptase PCR (qRT- Ex. 48_67F AGATTGTCCCTGGCAGCGTC PCR) system. TaqMan probes and primers are purchased through Ex. 48_67R GGTTTCTGGTGGAGCAGTATGG Applied Biosystems. Specifically, products of ϳ200bp or less will be

J Am Soc Nephrol 22: 2266–2277, 2011 2275 BASIC RESEARCH www.jasn.org amplified using Taqman gene Expression Master Mix (Applied Bio- Cunningham JM, Bacallao R, Ishibashi M, Milliner DS, Torres VE, Harris PC: systems, Foster City, California) combined with specific TaqMan as- The gene mutated in autosomal recessive polycystic kidney disease encodes say mix consists of a TaqMan MGB probe and two PCR primers. In a large, receptor-like protein. Nat Genet 30: 259–269, 2002 5. Kaimori JY, Nagasawa Y, Menezes LF, Garcia-Gonzalez MA, Deng J, this case, we developed a TaqMan single tube assay for mouse Pkhd1 Imai E, Onuchic LF, Guay-Woodford LM, Germino GG: Polyductin (ABI catalog# Mm01233728_m1) and the house keeping gene, mouse undergoes notch-like processing and regulated release from primary transferrin receptor (Tfrc) (ABI catalog # Mm00441941_m1). Both cilia. Hum Mol Genet 16: 942–956, 2007 probes span exon-exon junctions (exons 2 to 3 in Tfrc and exons 48 to 6. Yoder BK, Hou X, Guay-Woodford LM: The polycystic kidney disease 49 in the case of Pkhd1) and in the WT cross the Ct within a cycle of proteins, polycystin-1, polycystin-2, polaris, and cystin, are co-localized in renal cilia. J Am Soc Nephrol 13: 2508–2516, 2002 one another. Samples are run on a 7900 real-time PCR System (Applied 7. Ward CJ, Yuan D, Masyuk TV, Wang X, Punyashthiti R, Whelan S, Biosystems) at 95 °C for 10 min followed by 40 cycles of 15 sat 95 °C and Bacallao R, Torra R, LaRusso NF, Torres VE, Harris PC: Cellular and 60 s at 60 °C. All reactions are performed in Ͼtriplicates to assure the subcellular localization of the ARPKD protein: Fibrocystin is expressed accuracy of the assay. The values obtained for the target gene expression on primary cilia. Hum Mol Genet 12: 2703–2710, 2003 are normalized to endogenous control gene and quantified relative to the 8. Wang S, Luo Y, Wilson PD, Witman GB, Zhou J: The autosomal recessive polycystic kidney disease protein is localized to primary cilia, expression of control samples. For the calculation of relative quantifica- with concentration in the basal body area. J Am Soc Nephrol 15: tion, the ⌬⌬CT method will be used to calculate the fold-differences in 592–602, 2004 target genes between case samples and control samples. 9. Menezes LFC, Cai Y, Nagasawa Y, Silva AMG, Watkins ML, Silva AMD, Somlo S, Guay-Woodford LM, Germino GG, Onuchic LF, Polyductin: The Ethical Treatment of Animals PKHD1 gene product, comprises isoforms expressed in plasma mem- This study was carried out in strict accordance with the recommenda- brane, primary cilium, and cytoplasm. Kidney Int 66: 1345–1355, 2004 10. Hogan MC, Manganelli L, Woollard JR, Masyuk AI, Masyuk TV, Tam- tions in the Guide for the Care and Use of Laboratory Animals of the machote R, Huang BQ, Leontovich AA, Beito TG, Madden BJ, National Institutes of Health. The protocol was approved by the Com- Charlesworth MC, Torres VE, Larusso NF, Harris PC, Ward CJ: Char- mittee on the Ethics of Animal Experiments of the Mayo Clinic, Roches- acterization of PKD protein-positive exosome-like vesicles. JAmSoc ter, MN (“Production of mouse models for autosomal recessive polycys- Nephrol 20: 278–288, 2009 tic kidney disease [ARPKD],” IACUC: A35808). There was no recovery 11. Onuchic LF, Furu L, Nagasawa Y, Hou X, Eggermann T, Ren Z, Berg- mann C, Senderek J, Esquivel E, Zeltner R, Rudnik-Schoneborn S, surgery and all efforts were made to minimize suffering. Mrug M, Sweeney W, Avner ED, Zerres K, Guay-Woodford LM, Somlo S, Germino GG: PKHD1, the polycystic kidney and hepatic disease 1 gene, encodes a novel large protein containing multiple immunoglob- ACKNOWLEDGMENTS ulin-like plexin-transcription-factor domains and parallel beta-helix 1 repeats. Am J Hum Genet 70: 1305–1317, 2002 12. Nagasawa Y, Matthiesen S, Onuchic LF, Hou X, Bergmann C, Esquivel This study was funded by the National Institutes of Health (NIH) E, Senderek J, Ren Z, Zeltner R, Furu L, Avner E, Moser M, Somlo S, grant 5R01DK065056–02 ‘Analysis of ARPKD by Targeted Manipu- Guay-Woodford L, Buttner R, Zerres K, Germino GG: Identification lation of Pkhd1’ and the PKD Foundation grant ‘Analysis of the In- and characterization of PKHD1, the mouse orthologue of the human teraction of Polycystin–1 positive exosome–like vesicles with the Pri- ARPKD gene. J Am Soc Nephrol 13: 2246–2258, 2002 13. Boddu R, Germino GG, Onuchic LF, Guay-Woodford LM: Intragenic mary Cilium’ as well as the Mayo Translational PKD Center (MTCP), motifs may regulate Pkhd1/PKHD1 transcriptional complexity. Amer- Molecular Genetics and Proteomics Core. We would also like to thank ican Society of Nephrology: [TH-PO684], 2009 Dave Tuveson for the gift of pBS.DAT-LoxStop plasmid which con- 14. Moser M, Matthiesen S, Kirfel J, Schorle H, Bergmann C, Senderek J, tains the LSL cassette. Rudnik-Schneborn S, Zerres K, Buettner R: A mouse model for cystic biliary dysgenesis in autosomal recessive polycystic kidney disease (ARPKD). Hepatology 41: 1113–1121, 2005 15. Woollard JR, Punyashtiti R, Richardson S, Masyuk TV, Whelan S, DISCLOSURES Huang BQ, Lager DJ, van-Deursen J, Torres VE, Gattone VH, LaRusso None. NF, Harris PC, Ward CJ: A mouse model of autosomal recessive polycystic kidney disease with biliary duct and proximal tubule dilatation. Kidney Int 72: 328–336, 2007 16. Garcia-Gonzalez MA, Menezes LF, Piontek KB, Kaimori J, Huso DL, REFERENCES Watnick T, Onuchic LF, Guay-Woodford LM, Germino GG: Genetic interaction studies link autosomal dominant and recessive polycystic 1. Zerres K, Mucher G, Becker J, Steinkamm C, Rudnik-Schoneborn S, kidney disease in a common pathway. Hum Mol Genet 16: 1940– Heikkila P, Rapola J, Salonen R, Germino GG, Onuchic L, Somlo S, 1950, 2007 Avner ED, Harman LA, Stockwin JM, Guay-Woodford LM: Prenatal 17. Gallagher AR, Esquivel EL, Briere TS, Tian X, Mitobe M, Menezes LF, diagnosis of autosomal recessive polycystic kidney disease (ARPKD): Markowitz GS, Jain D, Onuchic LF, Somlo S: Biliary and pancreatic Molecular genetics, clinical experience, and fetal morphology. Am J dysgenesis in mice harboring a mutation in PKHD1. Am J Pathol 172: Med Genet 76: 137–144 1998 417–429, 2008 2. Jorgensen MJ: The ductal plate malformation. Acta Pathol Microbiol 18. Williams SS, Cobo-Stark P, James LR, Somlo S, Igarashi P: Kidney Scand Suppl : 1–87, 1977 cysts, pancreatic cysts, and biliary disease in a mouse model of auto- 3. Zerres K, Rudnik-Schoneborn S, Steinkamm C, Becker J, Mucher G: somal recessive polycystic kidney disease. Pediatr Nephrol 23: 733– Autosomal recessive poly-cystic kidney disease. J Mol Med 76: 303– 741, 2008 309, 1998 19. Tuveson DA, Shaw AT, Willis NA, Silver DP, Jackson EL, Chang S, 4. Ward CJ, Hogan MC, Rossetti S, Walker D, Sneddon T, Wang X, Kubly V, Mercer KL, Grochow R, Hock H, Crowley D, Hingorani SR, Zaks T, King

2276 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 2266–2277, 2011 www.jasn.org BASIC RESEARCH

C, Jacobetz MA, Wang L, Bronson RT, Orkin SH, De-Pinho RA, Jacks 26. Terryn S, Jouret F, Vandenabeele F, Smolders I, Moreels M, Devuyst T: Endogenous oncogenic K-ras(G12D) stimulates proliferation and O, Steels P, Kerkhove EV: A primary culture of mouse proximal tubular widespread neoplastic and developmental defects. Cancer Cell 5: cells, established on collagen-coated membranes. Am J Physiol Renal 375–387, 2004 Physiol 293: F476–F485, 2007 20. Tanaka Y, Okada Y, Hirokawa N: FGF-induced vesicular release of 27. Tammachote R, Hommerding CJ, Sinders RM, Miller CA, Czarnecki Sonic hedgehog and retinoic acid in leftward nodal flow is critical for PG, Leightner AC, Salisbury JL, Ward CJ, Torres VE, Gattone VH, left-right determination. Nature 435: 172–177, 2005 Harris PC: Ciliary and centrosomal defects associated with mutation 21. Sullivan R, Saez F, Girouard J, Frenette G: Role of exosomes in sperm and depletion of the meckel syndrome genes MKS1 and MKS3. Hum maturation during the transit along the male reproductive tract. Blood Mol Genet 18: 3311–3323, 2009 Cells Mol Dis 35: 1–10, 2005 28. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid 22. Lan ZJ, Xu X, Cooney AJ: Differential oocyte-specific expression of guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem Cre recombinase activity in GDF-9-iCre, Zp3cre, and Msx2Cre trans- 162: 156–159, 1987 genic mice. Biol Reprod 71: 1469–1474, 2004 29. Notredame C, Higgins DG, Heringa J: T-coffee: A novel method for 23. Lee EC, Yu D, de Velasco JM, Tessarollo L, Swing DA, Court DL, fast and accurate multiple sequence alignment. J Mol Biol 302: 205– Jenkins NA, Copeland NG: A highly efficient escherichia coli-based 217, 2000 chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73: 56–65, 2001 24. Hanke T, Szawlowski P, Randall RE: Construction of solid matrix- antibody-antigen complexes containing simian immunodeficiency vi- See related editorial, “Tagged Fibrocystin Sheds Its Secrets,“ on pages 2148– rus p27 using tag-specific monoclonal antibody and tag-linked anti- 2150. gen. J Gen Virol 73 (Pt 3): 653–660, 1992 25. van Deursen J: Gene targeting in mouse embryonic stem cells. Meth- Supplemental information for this article is available online at http://www.jasn. ods Mol Biol 209: 145–158, 2003 org/.

J Am Soc Nephrol 22: 2266–2277, 2011 2277