DOCSLIB.ORG

Chen Meng 512-203-4429

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chen Meng 512-203-4429 Chen Meng 512-203-4429 |[email protected]|https://www.linkedin.com/in/chen-meng-education-technologies/|Austin, TX SUMMARY I have 8 years of teaching English to high school students, junior college students, and undergraduates. I am now working on my Ph.D. career on the learning technologies program and doing research on Edtech-related projects in UT Austin. I know how to teach, to communicate, to deal with problems, to research, and to create in the educational technology field. I am particularly interested in making innovations in interdisciplinary fields of study and making positive changes to learning and education in my own ways. EDUCATION Phd in Learning Technologies The University of Texas at Austin Expected Graduation: 2024 MA in English Language and Literature Shandong University Graduation: 2017 BA of English Weifang University Graduation: 2006 Associate Degree of Foreign Affair Secretary University of Jinan Graduation: 2004 TEACHING/MANAGEMENT EXPERIENCE English Teacher and Educational Administrator 08/2017- 07/2019 Jinan Vocational College of Nursing, Jinan, Shandong, China Teach and coach students practical skills of college English Create, design and update course content, schedule and make collective lesson preparation Make classroom management and conduct daily teaching affairs English Teacher, IELTS speaking coach, and Educational Administrator 01/2010- 07/2017 Qilu Institute of Technology, Jinan, Shandong, China Teach and coach students practical skills of college English, bilingual translation, business English and hospitality English Design and update IELTS speaking test training program and coach students to handle speaking test skills Deal with daily educational administration including course schedule and grade management, file translation and reception of foreign universities visits. RESEARCH EXPERIENCE Edtech Startup Project Coordinator (internship) 06/2020-now ‘MoolahU’: EdTech startups project, Initiator: Gayle Reaume https://moolahu.com/ Design user questionnaire and collect user data for market analysis Make interviews with potential users and do the qualitative research Assist with CTO on the design of online learning environment Online Course Coordinator 04/2020-now ‘Hi Chinese’ Mobile App, Initiator: Fang Cao Check the instructional design structure and make improvement advice to the online teachers Design the instructional script for the AI instructor of the App Research Assistant 01/2020-now ‘SlowPitch’: Edtech startups Forum, Initiator: Dr. Joan Hughes https://slowpitchedu.org/ Collect first-hand research materials from the forum Check and clean the transcript of the forum interviews content Shadow academic interviews Research Assistant 09/2019-now ‘Alien Rescue’: Game-based Learning Project, Initiator: Dr. Min Liu https://alienrescue.education.utexas.edu/ Collect game data for the json file to build up the chatbot of the game Join the group meeting regularly to have project improvement discussion TRAINING Training on Information Technology Skills Development for Vocational College Teacher, Jinan 07/2018 Online Training on Application of Modern Education Technology in College Teaching, Jinan 01/2017 Instructor Training on Undergraduate Entrepreneurship and Innovation Education, Jinan 06/2016 SKILLS Course Design and Development Translation/Interpretation ESL Teaching HTML IELTS Speaking Coaching Microsoft Office HONORS Award of Teaching Master Qilu Institute of Technology 12/2012 Award of Teaching Master Qilu Institute of Technology 06/2012 Award of Teaching Master Qilu Institute of Technology 12/2011 Award of Excellent Teaching Plan Qilu Institute of Technology 12/2010 SEMESTER PROJECT Fall 2019 ● Coursework Project: Design IELTS Speaking Skill course with Articulate 360 https://drive.google.com/file/d/1DS9GxKUpT4E5d_rFkCmZ2ZBXeXTswgaD/view?usp=sharing ADDIE Model Design for IELTS Speaking Skill course https://drive.google.com/file/d/1lVfj7udsM6kt57-2OO6Fw9gIEiVK-hce/view?usp=sharing ● Group Work Project: Design computer supportive collaborative learning activities in Second Life Design demonstration video for Agile Model https://drive.google.com/file/d/1UnAi8Y2qPtEdtq9ilviwsaO7fyKtcjd8/view?usp=sharing Design online course “Digital Literacy” for pre-service teachers on Canvas https://canvas.instructure.com/enroll/7KNPE7 Spring 2020 ● Coursework Project: Design online course project “Never Too Old” to teach senior people how to apply digital technologies on YouTube https://www.youtube.com/channel/UCTjQinn8qQACHbbcveWp_og?view_as=subscriber Project Paper https://drive.google.com/file/d/1Hh5Co26VvKeJ9cIIxUY9uBbn661bAyaa/view?usp=sharing Online Course Experience Report https://drive.google.com/file/d/15AERwSXNNcfP4cZupAekiBgSSxCVNQQt/view?usp=sharing .
Load more

Recommended publications
  • Supplemental: First Observation of D+ → Ηµ +Νµ and Measurement of Its
    + + Supplemental: First Observation of D ! ηµ νµ and Measurement of its Decay Dynamics M. Ablikim1, M. N. Achasov10;c, P. Adlarson64, S. Ahmed15, M. Albrecht4, A. Amoroso63A;63C , Q. An60;48, Anita21, X. H. Bai54, Y. Bai47, O. Bakina29, R. Baldini Ferroli23A, I. Balossino24A, Y. Ban38;k, K. Begzsuren26, J. V. Bennett5, N. Berger28, M. Bertani23A, D. Bettoni24A, F. Bianchi63A;63C , J Biernat64, J. Bloms57, A. Bortone63A;63C , I. Boyko29, R. A. Briere5, H. Cai65, X. Cai1;48, A. Calcaterra23A, G. F. Cao1;52, N. Cao1;52, S. A. Cetin51B, J. F. Chang1;48, W. L. Chang1;52, G. Chelkov29;b, D. Y. Chen6, G. Chen1, H. S. Chen1;52, M. L. Chen1;48, S. J. Chen36, X. R. Chen25, Y. B. Chen1;48, W. S. Cheng63C , G. Cibinetto24A, F. Cossio63C , X. F. Cui37, H. L. Dai1;48, J. P. Dai42;g, X. C. Dai1;52, A. Dbeyssi15, R. B. de Boer4, D. Dedovich29, Z. Y. Deng1, A. Denig28, I. Denysenko29, M. Destefanis63A;63C , F. De Mori63A;63C , Y. Ding34, C. Dong37, J. Dong1;48, L. Y. Dong1;52, M. Y. Dong1;48;52, S. X. Du68, J. Fang1;48, S. S. Fang1;52, Y. Fang1, R. Farinelli24A, L. Fava63B;63C , F. Feldbauer4, G. Felici23A, C. Q. Feng60;48, M. Fritsch4, C. D. Fu1, Y. Fu1, X. L. Gao60;48, Y. Gao38;k, Y. Gao61, Y. G. Gao6, I. Garzia24A;24B, E. M. Gersabeck55, A. Gilman56, K. Goetzen11, L. Gong37, W. X. Gong1;48, W. Gradl28, M. Greco63A;63C , L. M. Gu36, M. H. Gu1;48, S. Gu2, Y. T.
    [Show full text]
  • Shaped Three-Dimensional Electrochemical Paper Microdevice
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2020 Origami-Based "Book" Shaped Three-Dimensional Electrochemical Paper Microdevice for Sample-to-Answer Detection of Pathogens Tao Hea, Jingwen Lia,b，Lisheng Liuc,d, Shenguang Gea, Mei Yana,e, Haiyun Liua,f,, Jinghua Yua,e a Collaborative Innovation Center of Technology and Equipment for Biological Diagnosis and Therapy in Universities of Shandong, Institute for Advanced Interdisciplinary Research (IAIR), University of Jinan, Jinan 250022, P.R. China b College of Biological Sciences and Technology, University of Jinan, Jinan 250022, P.R. China c Key Laboratory of Animal Resistance Research, College of Life Science, Shandong Normal University, Jinan, 250014, P. R. China d Clinical Laboratory，Shandong Cancer Hospital Affiliated to Shandong University，Shandong Academy of Medicine Science, Jinan, 250117, P. R. China. e School of Chemistry and Chemical Engineering, University of Jinan, Jinan, 250022, P. R. China f College of Chemistry, Chemical Engineering and Materials Science, Key Laboratory of Molecular and Nano Probes, Ministry of Education, Shandong Provincial Key Laboratory of Clean Production of Fine Chemicals, Shandong Normal University, Jinan, 250014, P. R. China Corresponding author.Tel.: +86-531-82767161; Fax: +86-531-82765956. E-mail address: [email protected] Table S1: LAMP primers set Primer Sequence (5 ～ 3) FIP: GACGACTGGTACTGATCGATAGTTTTTCAACGTTTCCTGCGG BIP: CCGGTGAAATTATCGCCACACAAAACGCCACCGCCAGG F3: GGCGATATTGGTGTTTATGGGG B3: AACGATAAACTGGACCACGG LF: GACGAAAGAGCGTGGTAATTAAC LB: GGGCAATTCGTTATTGGCGATAG Manufacturing procedures of wax-printing paper electrode The paper was first printed with wax using an office printer, then heated at 120 °C for 1 min on the hotplate to melt the printed wax, which diffused through the paper to form the same hydrophobic circle.
    [Show full text]
  • The 7Th Workshop on Hadron Physics in China and Opportunities Worldwide
    30 June 2016, 17:11 The 7th Workshop on Hadron Physics in China and OpportunitiesList of registrants Worldwide Name Institution City Country Dr. ADLARSON, Patrik Johannes Gutenberg Universität Mainz Germany Dr. ALLADA, Kalyan Massachusetts Institute of Technology United States Dr. BAKRY, Ahmed Institute of Modern Physics China Dr. BASHKANOV, Mikhail University of Edinburgh Edinburgh United Kingdom Prof. BRODSKY, Stanley J. SLAC National Accelerator Laboratory Menlo Park, CA 94025 United States Institute of Modern Physics, CAS, CAO, Xu China Lanzhou Prof. CHANG, Wen-Chen Institute of Physics, Academia Sinica Taiwan Dr. CHEN, Jian-ping Jefferson Lab Newport News, Virginia United States Shanghai Institute of Applied Prof. CHEN, Jinhui China Physics, CAS Huazhong University of Science and Prof. CHEN, Xiang-Song Wuhan China Technology Prof. CHEN, Xurong IMP China Prof. CHOI, Seonho Seoul National University Seoul Korea, Republic of Department of Physics , Tsinghua Dr. CUI, Yinping China University Prof. DESHPANDE, Abhay Stony Brook University United States Dr. DONG, Hui Shandong University China Dr. DONG, Xin Lawrence Berkeley National Laboratory Berkeley, CA United States Prof. DONG, Yubing Institute of High Energy Physics Beijing 1000498 China Dr. EN, Wang Zhengzhou University China Prof. FENG, Cunfeng shandong university China Mr. FERRERO, Andrea CEA-Saclay/IRFU/SPhN France University of North Carolina Prof. GAN, Liping Wilmington United States Wilmington Prof. GAO, Haiyan DKU Kunshan China Institute of Modern Physics, Chinese Dr. HE, Jun China Academy of Sciences University of Chinese Academy of Dr. HUANG, Fei China Sciences Prof. HUANG, Guangshun USTC Hefei China Dr. HUANG, Hongxia Nanjing Normal University Nanjing China Ms. HUANG, Yan Tsinghua University China Dr.
    [Show full text]
  • A Complete Collection of Chinese Institutes and Universities For
    Study in China——All China Universities All China Universities 2019.12 Please download WeChat app and follow our official account (scan QR code below or add WeChat ID: A15810086985), to start your application journey. Study in China——All China Universities Anhui 安徽 【www.studyinanhui.com】 1. Anhui University 安徽大学 http://ahu.admissions.cn 2. University of Science and Technology of China 中国科学技术大学 http://ustc.admissions.cn 3. Hefei University of Technology 合肥工业大学 http://hfut.admissions.cn 4. Anhui University of Technology 安徽工业大学 http://ahut.admissions.cn 5. Anhui University of Science and Technology 安徽理工大学 http://aust.admissions.cn 6. Anhui Engineering University 安徽工程大学 http://ahpu.admissions.cn 7. Anhui Agricultural University 安徽农业大学 http://ahau.admissions.cn 8. Anhui Medical University 安徽医科大学 http://ahmu.admissions.cn 9. Bengbu Medical College 蚌埠医学院 http://bbmc.admissions.cn 10. Wannan Medical College 皖南医学院 http://wnmc.admissions.cn 11. Anhui University of Chinese Medicine 安徽中医药大学 http://ahtcm.admissions.cn 12. Anhui Normal University 安徽师范大学 http://ahnu.admissions.cn 13. Fuyang Normal University 阜阳师范大学 http://fynu.admissions.cn 14. Anqing Teachers College 安庆师范大学 http://aqtc.admissions.cn 15. Huaibei Normal University 淮北师范大学 http://chnu.admissions.cn Please download WeChat app and follow our official account (scan QR code below or add WeChat ID: A15810086985), to start your application journey. Study in China——All China Universities 16. Huangshan University 黄山学院 http://hsu.admissions.cn 17. Western Anhui University 皖西学院 http://wxc.admissions.cn 18. Chuzhou University 滁州学院 http://chzu.admissions.cn 19. Anhui University of Finance & Economics 安徽财经大学 http://aufe.admissions.cn 20. Suzhou University 宿州学院 http://ahszu.admissions.cn 21.
    [Show full text]
  • Partner Universities and Institutions List 1/ 19
    Partner Universities and Institutions List (May 19, 2017) Total : 63 Countries, 506iversities & Institutions Signature Country University / Institution Agreement Level Date Afghanistan Kabul University Department Level 2014.01. Australia Curtin University University Level 2012.06. Australia Macquarie University University Level 2011.04. Australia Murdoch University University Level 2008.05. Australia Swinburne University of Technology College Level 2012.09. Australia The University of Adelaide University Level 2012.07. Australia University of New England University Level 2008.06. Australia University of the Sunshine Coast University Level 2008.01. Austria International Institute for Applied Systems Analysis (IIASA) Research Center Level 2014.07. Austria University of Applied Sciences Technikum Wien (FH Technikum Wien) University Level 2008.05. Azerbaijan Azerbaijan University of Architecture and Construction University Level 2012.01. University Level (Glocal Azerbaijan Baku State University 2007.02. Campus) Belarus Belarusian State University of Culture and Arts University Level 2007.05. Belgium Ghent University, Global Campus University Level 2016.03. Belgium Vesalius College University Level 2009.11. Brazil Mackenzie Presbyterian University University Level 2012.11. Brazil Universidade de Ribeirão Preto (UNAERP) University Level 2014.02. Brazil Universidade Estadual Paulista (UNESP) University Level 2013.05. Brazil Universidade Federal Fluminese University Level 2013.04. University Level (Glocal Cambodia Build Bright University 2012.07. Campus) University Level (Glocal Cambodia Pannasastra University 2012.03. Campus) Cambodia Royal University of Phnom Penh University Level 2011.01. Canada Centennial College University Level 2015.02. Canada Douglas College University Level 2008.03. Canada Lethbridge College University Level 2012.03. Canada McGill University Department Level 2013.12. 1/ 19 Partner Universities and Institutions List Signature Country University / Institution Agreement Level Date Graduate School Level 2007.02.
    [Show full text]
  • Global Partners —
    AGREEMENT TYPES Global Student Exchange Agreement Study Abroad Agreement partners Utrecht Network (Exchange Program) — INSTITUTION TYPE INSTITUTION TYPE INSTITUTION TYPE Hong Kong Baptist University AUSTRIA CZECH REPUBLIC The Education University of Hong Karl-Franzens-Universität, Graz Masarykova Univerzita, Brno Kong The Hong Kong Polytechnic BELGIUM DENMARK University UOW College Hong Kong ECAM Brussels Åarhus Universitet Københavns Universitet Katholieke Universiteit Leuven HUNGARY Syddansk Universitet Universiteit Antwerpen Eötvös Loránd University (ELTE) ESTONIA BRAZIL ICELAND Tartu Ülikool Pontificia Universidade Catolica de Háskóli Íslands (University of Campinas (PUC-Campinas) FINLAND Iceland) Pontificia Universidade Catolica University of Eastern Finland do Rio De Janeiro (PUC-Rio) INDIA Universidade de Sao Paulo Birla Institute of Management FRANCE Universidade Federal Technology (BIMTECH) Audencia Business School de Santa Catarina IFIM Business School École Catholique d’Arts et Métiers Manipal Academy of Higher CANADA (ECAM Lyon) Education École Catholique d’Arts et Métiers Concordia University O.P. Jindal Global University HEC Montreal (ECAM Strasbourg) École Internationale des Sciences McMaster University INDONESIA du Traitement de I'Information University of Alberta Universitas Gadjah Mada École Spéciale de Mécanique et University of British Columbia D'Electricité (ESME – Sudria) IRELAND University of Calgary École Supérieure d’Electronique University of Manitoba de l’Ouest (ESEO) Dublin City University University of Montreal
    [Show full text]
  • University of Leeds Chinese Accepted Institution List 2021
    University of Leeds Chinese accepted Institution List 2021 This list applies to courses in: All Engineering and Computing courses School of Mathematics School of Education School of Politics and International Studies School of Sociology and Social Policy GPA Requirements 2:1 = 75-85% 2:2 = 70-80% Please visit https://courses.leeds.ac.uk to find out which courses require a 2:1 and a 2:2. Please note: This document is to be used as a guide only. Final decisions will be made by the University of Leeds admissions teams.
    [Show full text]
  • Dr. Ma's Curriculum Vitae
    Dr. Ma's Curriculum Vitae 1. Personal Particulars Name: Professor Wen-Xiu Ma (Ph.D.) Address: Department of Mathematics and Statistics University of South Florida 4202 E Fowler Avenue, CMC 342 Tampa, FL 33620-5700, USA Phone & Fax: +1-813-974-9563 & +1-813-974-2700 Email: [email protected], [email protected], [email protected] Web page: http://www.math.usf.edu/∼mawx 2. Education Background 1978-1982: B.S., Department of Mathematics University of Science and Technology of China, Hefei, P.R. China Major: Computational Mathematics 1982-1985: M.S., Graduate School of Academia Sinica, Beijing, P.R. China Major: Applied Mathematics 1987-1990: Ph.D., Computing Center of Academia Sinica, Beijing, P.R. China Major: Mathematical Physics 3. Professional Experience 1985-1987: Assistant Professor Department of Applied Mathematics Shanghai Jiao Tong University, Shanghai, P.R. China 1990-1992: National Postdoctoral Fellow Department of Mathematics, Fudan University, Shanghai, P.R. China Research area: Integrable Systems and Soliton Theory 1992-1997: Associate Professor Institute of Mathematics, Fudan University, Shanghai, P.R. China 1992-1995: Shanghai Qi Ming Xing (Outstanding Young Research Fellow) Shanghai Government, Shanghai, P.R. China 1993-1994: Visiting Scholar Chinese University of Hong Kong, Hong Kong, P.R. China 1 1994-1996: Humboldt Research Fellow Department of Mathematics and Computer Sciences University of Paderborn, Paderborn, Germany Research area: Soliton Theory and Computer Algebra Methods 1996.6-7: Visiting Scholar Institute of Theoretic Physics, University of Montpellier II, Montpellier, France 1996-1997: Research Fellow Department of Mathematics, UMIST, Manchester, UK Research area: Classical and Quantum Integrable Systems 1997-2002: Assistant Professor Department of Mathematics, City University of Hong Kong Hong Kong, P.R.
    [Show full text]
  • A Theoretical Study of the Mechanism of the Addition Reaction Between
    J. Serb. Chem. Soc. 75 (5) 649–657 (2010) UDC 547.15+547.235’512:541.124 JSCS–3995 Original scientific paper A theoretical study of the mechanism of the addition reaction between carbene and azacyclopropane XIAOJUN TAN1*, PING LI2, WEIHUA WANG2, GENGXIU ZHENG3 and QIUFEN WANG3 1College of Medical and Life Science, University of Jinan, Jinan, Shandong, 250022, 2Department of Chemistry, Qufu Normal University, Qufu, Shandong, 273165 and 3College of Chemistry and Chemical Engineering, University of Jinan, Jinan, Shandong, 250022, P. R. China (Received 3 March, revised 15 December 2009) Abstract: The mechanism of the addition reaction between carbene and aza- cyclopropane was investigated using the second-order Moller–Plesset pertur- bation theory (MP2). By using the 6-311+G* basis set, geometry optimization, vibrational analysis and the energy properties of the involved stationary points on the potential energy surface were calculated. From the surface energy pro- file, it can be predicted that there are two reaction mechanisms. The first one (1) is carbene attack at the N atom of azacyclopropane to form an intermediate, 1a (IM1a), which is a barrier-free exothermic reaction. Then, IM1a can iso- merize to IM1b via a transition state 1a (TS1a), in which the potential barrier is 30.0 kJ/mol. Subsequently, IM1b isomerizes to a product (Pro1) via TS1b with a potential barrier of 39.3 kJ/mol. The other one (2) is carbene attack at the C atom of azacyclopropane, firstly to form IM2 via TS2a, the potential barrier is 35.4 kJ/mol. Then IM2 isomerizes to a product (Pro2) via TS2b with a po- tential barrier of 35.1 kJ/mol.
    [Show full text]
  • Intelligent Monitoring of Indoor Surveillance Video Based on Deep Learning
    1 Intelligent monitoring of indoor surveillance video based on deep learning Yun-Xia Liu*,**, Yang Yang***, Aijun Shi***, Peng Jigang****, Liu Haowei**** *School of Information Science and Engineering, University of Jinan, Jinan 250022, China **Shandong Provincial Key Laboratory of Network Based Intelligent Computing, University of Jinan, Jinan 250022, China ***School of Information Science and Engineering, Shandong University, Qingdao, Shandong Province, China ****Shandong province's electronic information products quality supervision and inspection Institute, Jinan, China [email protected]*,**, [email protected]*** Abstract—With the rapid development of information technology, video surveillance system has become a key part in the security and protection system of modern cities. Especially in prisons, surveillance cameras could be found almost everywhere. However, with the continuous expansion of the surveillance network, surveillance cameras not only bring convenience, but also produce a massive amount of monitoring data, which poses huge challenges to storage, analytics and retrieval. The smart monitoring system equipped with intelligent video analytics technology can monitor as well as pre-alarm abnormal events or behaviours, which is a hot research direction in the field of surveillance. This paper combines deep learning methods, using the state-of-the-art framework for instance segmentation, called Mask R-CNN, to train the fine-tuning network on our datasets, which can efficiently detect objects in a video image while simultaneously generating a high-quality segmentation mask for each instance. The experiment show that our network is simple to train and easy to generalize to other datasets, and the mask average precision is nearly up to 98.5% on our own datasets.
    [Show full text]
  • Download Article (PDF)
    Advances in Social Science, Education and Humanities Research, volume 298 2nd International Conference on Education Science and Social Development (ESSD 2019) Research on the Educational and Training Model of Excellent Engineers for Applied Undergraduates Oriented to New Engineering Tianwen Zhou Zhen Wang Lanhua Wang Engineering College Engineering College Engineering College University of Jinan Quancheng University of Jinan Quancheng University of Jinan Quancheng College College College Yantai China Yantai, China Yantai, China Abstract—The construction of the new engineering comprehensive recognition of the times, social needs, the department is an advanced direction for the development and current situation of engineering education and the reform of Higher Engineering Education in China. It aims to development law of Engineering discipline [4]. cultivate excellent engineering talents facing the industry, the world and the future. University of Jinan Quancheng College takes the construction of new engineering as its foothold and II. PROBLEMS IN HIGHER ENGINEERING EDUCATION strengthens the construction of mechanical specialty in the light of industry 4.0. It focuses on the practice and exploration A. Neglect Individuality Education of the training mode, curriculum system and training scheme In recent years, the expansion of college enrollment has of the specialty. Its experience can be used as a reference for solved many social hot issues, which is an undoubted the specialty construction of Applied Undergraduate colleges. advantage, but it can not deny its drawbacks. With the expansion of enrollment in colleges and universities, Keywords—new engineering, excellent engineer, training undergraduate training programs have changed to a certain mode, applied undergraduate extent. The same training program is adopted for the same major, ignoring the individual advantages of students and I.
    [Show full text]
  • GOMD 2018 Attendee Roster - 5.21.18
    GOMD 2018 Attendee Roster - 5.21.18 First Name Last Name Organization City State Country Emily Aaldenberg Rensselaer Polytechnic Institute West Chester PA United States Laura Adkins Corning Inc. Painted Post NY UNITED STATES Mario Affatigato Coe College Cedar Rapids IA UNITED STATES Gabriel Agnello Corning Inc. Corning NY UNITED STATES Mostafa Ahmadzadeh Washington State University Pullman WA UNITED STATES Ifty Ahmed University of Nottingham Nottingham UK UNITED KINGDOM Jaakko Akola Norwegian University of Science and Technology Trondheim NORWAY Oliver Alderman MDI Evanston IL UNITED STATES Quentin Aletmose Ursinus College Collegeville PA UNITED STATES Rui Almeida IST-ID Lisbon PORTUGAL Sezhian Annamalai PPG Aerospace Huntsville AL UNITED STATES Courtney Au-Yeung Bethlehem PA UNITED STATES Jincheng Bai Missouri Univ of Science & Tech Rolla MO United States Shefford Baker Cornell University Ithaca NY UNITED STATES Joy Banerjee Corning Research and Development Corporation Painted Post NY UNITED STATES Khagendra Baral University of Missouri-Kansas City Kansas City MO UNITED STATES Etienne BARTHEL CNRS PARIS Cedex05 FRANCE Mathieu Bauchy University of California, Los Angeles Los Angeles CA UNITED STATES George Beall Corning Incorporated Big Flats NY UNITED STATES Tobias Kjaer Bechgaard Aalborg Univ Aalborg Denmark Brooke Beckert Georgia Tech Research Institute Atlanta GA UNITED STATES Marco Bernasconi Milano ITALY Indrani Bhattacharyya Corning Inc Ithaca NY UNITED STATES Marin Bilandzic RWTH Aachen University, Insitute for Mineral Engineering
    [Show full text]