DOCSLIB.ORG

Clinical and Molecular Characterization of a Family with Autosomal Recessive Cornea Plana

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Clinical and Molecular Characterization of a Family with Autosomal Recessive Cornea Plana OPHTHALMIC MOLECULAR GENETICS SECTION EDITOR: JANEY L. WIGGS, MD, PhD Clinical and Molecular Characterization of a Family With Autosomal Recessive Cornea Plana Neil D. Ebenezer, PhD; Chetankumar B. Patel, MD; Seenu M. Hariprasad, MD; Li L. Chen, MD, PhD; Reshma J. Patel, PhD; Alison J. Hardcastle, PhD; Richard C. Allen, MD, PhD Background: Autosomal recessive cornea plana is char- to the corneal endothelium. Affected individuals were ho- acterized by a flattened corneal surface associated with hy- mozygous for a novel mutation in KERA. The sequence peropia and various anterior segment abnormalities. Mu- change was found in exon 2, which results in an aspara- tations have been detected in the keratocan gene (KERA), gine to aspartic acid change at codon 131. This amino a member of the small leucine-rich proteoglycan family. acid change occurs within a highly conserved leucine- rich repeat of keratocan. Objective: To clinically and molecularly characterize a consanguineous family of Hispanic origin in which 3 Conclusions: The cause of disease in this family is likely individuals are affected with cornea plana. to be a mutation in exon 2 of KERA. Other mutations in KERA known to cause cornea plana also fall within the Methods: Clinical ophthalmic examination, including region encoding the leucine-rich repeat motifs and are corneal topography and axial eye length measurement, predicted to affect the tertiary structure of the protein. was performed on 7 family members. Molecular analy- sis of KERA was performed on DNA from each family Clinical Relevance: This is the first report of the iden- member who had been examined. tification of a mutation within KERA in a family of His- panic origin with autosomal recessive cornea plana. Al- Results: All 3 affected individuals showed extreme flat- though the vast majority of cases of cornea plana are in tening of the cornea (Ͻ36 diopters [D]), normal axial individuals of Finnish descent, this report demonstrates eye lengths, and hyperopia greater than 6.25 D (spheri- the occurrence of the disease in other populations. cal equivalent). Anterior segment abnormalities in- cluded scleralization of the cornea and central iris strands Arch Ophthalmol. 2005;123:1248-1253 ORNEA PLANA CAN BE IN- Autosomal dominant cornea plana herited as either a milder, (CNA1) has been described in a Cuban fam- autosomal dominant ily. The gene responsible for CNA1 was disease (CNA1; Mende- mapped by linkage analysis in this family lian Inheritance of Man to a region on chromosome 12, which in- 121400)C or as a more severe, autosomal cluded the locus causing CNA2. This sug- recessive form (CNA2; Mendelian Inher- gested that CNA1 and CNA2 may be alle- itance of Man 217300). The CNA2 form lic.4 However, linkage analysis on 2 Finnish is a rare disorder in which the curvature families with CNA1 excluded the area on Author Affiliations: Division of of the cornea is flattened, resulting in a de- chromosome 12 as containing the respon- Molecular Genetics, Institute of crease in the refractive power of the cor- sible gene(s) in these families, indicating that Ophthalmology, University nea.1 In addition, cornea plana is charac- there is genetic heterogeneity for the auto- College London, London, terized by a hazy corneal limbus and somal dominant form of this dystrophy.5 England (Drs Ebenezer, Chen, peripheral scleralization of the cornea, of- Pellegata et al6 identified mutations R. J. Patel, and Hardcastle); and ten with deep central corneal opacities. within the keratocan gene (KERA; Men- Cullen Eye Institute, Baylor Tahvanainen et al2 reported the initial link- delian Inheritance of Man 603288) that College of Medicine, Houston, age of CNA2 to a 10-centimorgan (CM) were responsible for causing CNA2, and Tex (Drs C. B. Patel, interval on chromosome 12q22 in a Finn- they showed that the large number of Hariprasad, and Allen). Dr Allen is now with the ish pedigree. Linkage disequilibrium map- CNA2 cases previously reported in the Department of Ophthalmology ping on 32 Finnish families showed an al- Finnish population were owing to a and Visual Sciences, University lelic association between the polymorphic founder effect. More recently, a novel mu- of Iowa Hospitals and Clinics, marker D12S351 and CNA2, allowing the tation was identified in exon 2 of KERA Iowa City. disease interval to be refined to 1 cM.3 in a Bangladeshi family with both CNA2 (REPRINTED) ARCH OPHTHALMOL / VOL 123, SEP 2005 WWW.ARCHOPHTHALMOL.COM 1248 ©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/02/2021 12 I 1 2 3 4 II 1 2 III A/G A/G 12345 IV G G G A/G A/G Figure 1. Pedigree structure and electropherograms showing segregation of autosomal recessive cornea plana. The structure of the family is a consanguineous marriage with 5 children. Open circles indicate unaffected females; solid circles, affected females; open squares, unaffected males; and solid squares, affected males. Electropherograms show the sequence from a portion of exon 2 of the keratocan gene that has a mutation. The traces are green, adenine (A); blue, cytosine (C); black, guanine (G); and red, thymidine (T). Affected individuals IV:1, IV:2, and IV:3 are homozygous for an A to G base pair substitution in exon 2 of the keratocan gene (A391G). The father (III:1) and the mother (III:2) are heterozygous (A/G) for the mutation, as are unaffected siblings IV:4 and IV:5. and a mild form of microphthalmia.7 No mutations in ined clinically and molecular analysis was performed on KERA have been reported in CNA1 families. their DNA. A novel nucleic acid change was found in The core protein of a major corneal keratan sulfate pro- KERA that results in an amino acid change in a highly teoglycan is encoded by KERA. Although KERA is abun- conserved portion of the LRR motif of the protein. This dantly expressed in the cornea and sclera, it is ex- study contributes additional support to the occurrence pressed at lower levels in skin, ligament, cartilage, arteries, of CNA2 in individuals with no Finnish ancestry. and striated muscles.8,9 The gene spans 7.65 kilobases of genomic DNA, consists of 3 exons with complementary METHODS DNA of 2160 base pairs (bp), and encodes a protein of 352 amino acids. Exon 1 is untranslated while exon 2 PATIENTS contains the start codon and an N-terminal signal pep- tide followed by a highly conserved region containing 10 A 4-generation, consanguineous, Hispanic pedigree from north- leucine-rich repeat (LRR) motifs. ern Mexico (Figure 1) in which 3 of the 5 children were af- In this study, we investigated a consanguineous fam- fected with cornea plana was ascertained for a genetic study ily of Hispanic origin in which 3 individuals are affected that conformed to the tenets of the Declaration of Helsinki. A with cornea plana. Seven family members were exam- full ophthalmic examination was performed on all 7 family mem- (REPRINTED) ARCH OPHTHALMOL / VOL 123, SEP 2005 WWW.ARCHOPHTHALMOL.COM 1249 ©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Table. Primer Sequences and Conditions Used to Amplify the Coding Region of the Keratocan Gene Exon No. Sequence (Forward) Sequence (Reverse) Ta (°C) Amplimer (bp) 1 tggtgactgggacgagtagg ctttttcagaatagggttttgg 61 273 2a tgttgacatatttcacctcttcc agggctcctttttcaattcc 59 477 2b ctgtaggtgctataatggcagg gggtcaggttctccagattg 58 522 2c ctcatgcagctaaacatggc gatcaaggtgaaggtgctgc 59 292 3 ttgggggaaacagatagg gaaaatggtggccgagagc 59 463 Abbreviations: bp, base pair; T a, annealing temperature. bers from the third and fourth generations and included the cornea in each eye with many central and peripheral iris following: cycloplegic refraction, slitlamp examination, intra- strands to the cornea resulting in corectopia (Figure 2A). ocular pressure measurement, optic disc assessment, corneal The patient’s corneas were too irregular for the Hum- topography, and A-scan ultrasonography to determine axial phrey machine to measure. Keratometer readings were length. less than 36 D in each eye. Axial lengths were 26.54 mm OD and 25.05 mm OS. DNA ANALYSIS Case IV:3 Blood specimens were obtained from all family members who were examined, and genomic DNA was extracted from periph- The third and last affected child was an 8-year-old girl. eral blood leukocytes using the Nucleon II kit (Scotlab Lim- ited, Strathclyde, Scotland) according to the manufacturer’s in- Her best-corrected visual acuity was 20/50 OU. Cyclople- gic refraction was ϩ6.00ϩ 2.25ϫ 065 OD and structions. Polymerase chain reaction amplification of KERA ϩ ϩ ϫ was performed using intronic oligonucleotide primers (Table) 8.50 1.75 095 OS. Extraocular motility, confron- to amplify the coding region. Because exon 2 is 893 bp long, it tation fields, pupillary reaction, intraocular pressures, and was amplified in 3 overlapping segments. The purified poly- fundus examination results were normal. Slitlamp ex- merase chain reaction samples were sequenced bidirection- amination revealed peripheral scleralization of the cor- ally on an automated sequencer (ABI 3100; Applied Biosys- nea in each eye with no iris strands in the right eye but tems, Foster City, Calif) using the ABI Prism Ready Reaction with a few iris strands to the cornea in the left eye Dye Terminator cycle sequencing kit (FS kit; Applied Biosys- (Figure 2B). Humphrey topography results (Figure 2C) tems) following the manufacturer’s protocol. showed simulated keratometric readings of OD 31.50 D at 30°, OD 33.75 D at 120°, OS 26.62 D at 160°, and OS RESULTS 33.50 D at 70°. Axial lengths were 23.33 mm OD and 23.55 mm OS. CLINICAL ANALYSIS Cases III:1, III:2, IV:4, and IV:5 Case IV:1 Individuals III:1, III:2, IV:4, and IV:5 all had normal oph- The first affected child was a 12-year-old girl who had a thalmic examination results (Figure 2D).
Load more

Recommended publications
  • National Study of Microphthalmia, Anophthalmia, and Coloboma (MAC
    16 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.39.1.16 on 1 January 2002. Downloaded from National study of microphthalmia, anophthalmia, and coloboma (MAC) in Scotland: investigation of genetic aetiology D Morrison, D FitzPatrick, I Hanson, K Williamson, V van Heyningen, B Fleck, I Jones, J Chalmers, H Campbell ............................................................................................................................. J Med Genet 2002;39:16–22 We report an epidemiological and genetic study attempting complete ascertainment of subjects with microphthalmia, anophthalmia, and coloboma (MAC) born in Scotland during a 16 year period beginning on 1 January 1981. A total of 198 cases were confirmed giving a minimum live birth preva- lence of 19 per 100 000. One hundred and twenty-two MAC cases (61.6%) from 115 different fami- See end of article for lies were clinically examined and detailed pregnancy, medical, and family histories obtained. A authors’ affiliations simple, rational, and apparently robust classification of the eye phenotype was developed based on ....................... the presence or absence of a defect in closure of the optic (choroidal) fissure. A total of 85/122 Correspondence to: (69.7%) of cases had optic fissure closure defects (OFCD), 12/122 (9.8%) had non-OFCD, and Dr D FitzPatrick, MRC 25/122 (20.5%) had defects that were unclassifiable owing to the severity of the corneal or anterior Human Genetics Unit, chamber abnormality. Segregation analysis assuming single and multiple incomplete ascertainment, Western General Hospital, respectively, returned a sib recurrence risk of 6% and 10% in the whole group and 8.1% and 13.3% Edinburgh EH4 2XU, UK; in the OFCD subgroup.
    [Show full text]
  • A Case of Hallermann-Streiff Syndrome with Aphakia
    Korean Journal of Pediatrics Vol. 51, No. 6, 2008 DOI : 10.3345/kjp.2008.51.6.646 Case report 1) A case of Hallermann-Streiff syndrome with aphakia Myung Chul Lee, M.D., Im Jeong Choi, M.D., and Jin Wha Jung, M.D. Department of Pediatrics, Maryknoll Medical Center, Busan, Korea = Abstract = Hallermann-Streiff syndrome is a rare disease. Approximately 150 cases have been reported, including 6 cases in Korea. The authors experienced a case of Hallermann-Streiff syndrome in a 6-year-old female with aphakia. The syndrome is charac- terized by a bird-like face, dental abnormalities, hypotrichosis, atrophy of the skin, bilateral microphthalmia, and proportionate dwarfism. A brief review of the literature was conducted. (Korean J Pediatr 2008;51 :646-649) Key Words : Hallermann-Streiff syndrome, Aphakia, Bird-like face age of 40 weeks and her mother’s obstetric history revealed Introduction no record of systemic disease or drug administration. Her parents and only brother showed no specific finding. On Hallermann-Streiff Syndrome is a rare genetic disorder admission, she was 5 years and 7 months old and her that is characterized by bird-like face, dental abnormalities, height was 83.2 cm (less than 3rd percentile) while her hypotrichosis, atrophy of skin, congenital cataracts, bilateral body weight was 13 kg (less than 3rd percentile), showing microphthalmia, and proportionate nanism. It was first pub- a growth disorder. She showed a developmental disorder lished by Aubry in 18931),butthecasewasincomplete.This showing unassisted self-ambulation at the age of 4 years. syndrome was first described completely in 1948 by She had a pointed nose and frontal bossing as well as Hallermann2) and then in 1950 by Streiff3).
    [Show full text]
  • Novel Mutations in ALDH1A3 Associated with Autosomal Recessive Anophthalmia/ Microphthalmia, and Review of the Literature Siying Lin1, Gaurav V
    Lin et al. BMC Medical Genetics (2018) 19:160 https://doi.org/10.1186/s12881-018-0678-6 RESEARCH ARTICLE Open Access Novel mutations in ALDH1A3 associated with autosomal recessive anophthalmia/ microphthalmia, and review of the literature Siying Lin1, Gaurav V. Harlalka1, Abdul Hameed2, Hadia Moattar Reham3, Muhammad Yasin3, Noor Muhammad3, Saadullah Khan3, Emma L. Baple1, Andrew H. Crosby1 and Shamim Saleha3* Abstract Background: Autosomal recessive anophthalmia and microphthalmia are rare developmental eye defects occurring during early fetal development. Syndromic and non-syndromic forms of anophthalmia and microphthalmia demonstrate extensive genetic and allelic heterogeneity. To date, disease mutations have been identified in 29 causative genes associated with anophthalmia and microphthalmia, with autosomal dominant, autosomal recessive and X-linked inheritance patterns described. Biallelic ALDH1A3 gene variants are the leading genetic causes of autosomal recessive anophthalmia and microphthalmia in countries with frequent parental consanguinity. Methods: This study describes genetic investigations in two consanguineous Pakistani families with a total of seven affected individuals with bilateral non-syndromic clinical anophthalmia. Results: Using whole exome and Sanger sequencing, we identified two novel homozygous ALDH1A3 sequence variants as likely responsible for the condition in each family; missense mutation [NM_000693.3:c.1240G > C, p. Gly414Arg; Chr15:101447332G > C (GRCh37)] in exon 11 (family 1), and, a frameshift mutation [NM_000693.3:c. 172dup, p.Glu58Glyfs*5; Chr15:101425544dup (GRCh37)] in exon 2 predicted to result in protein truncation (family 2). Conclusions: This study expands the molecular spectrum of pathogenic ALDH1A3 variants associated with anophthalmia and microphthalmia, and provides further insight of the key role of the ALDH1A3 in human eye development.
    [Show full text]
  • A Novel Keratocan Mutation Causing Autosomal Recessive Cornea Plana
    A Novel Keratocan Mutation Causing Autosomal Recessive Cornea Plana Ordan J. Lehmann,1,2 Mohamed F. El-ashry,1,2 Neil D. Ebenezer,1 Louise Ocaka,1 Peter J. Francis,1 Susan E. Wilkie,1 Reshma J. Patel,1 Linda Ficker,3 Tim Jordan,1 Peng T. Khaw,3 and Shomi S. Bhattacharya1 PURPOSE. Mutations in keratocan (KERA), a small leucine-rich exhibits the more severe phenotype and includes the presence proteoglycan, have recently been shown to be responsible for of a degree of corneal opacity and sclerocornea (OMIM cases of autosomal recessive cornea plana (CNA2). A consan- 181700). Two mutations in keratocan (KERA; OMIM 603288), guineous pedigree in which cornea plana cosegregated with a small leucine-rich proteoglycan (SLRP), have recently been microphthalmia was investigated by linkage analysis and direct shown to be responsible for autosomal recessive cornea plana sequencing. in a series of patients of Finnish and American extraction. The METHODS. Linkage was sought to polymorphic microsatellite cause of the autosomal dominant form of the disease remains markers distributed around the CNA2 and microphthalmia loci to be determined. (arCMIC, adCMIC, NNO1, and CHX10) using PCR and nonde- The combined phenotype of cornea plana and microphthal- naturing polyacrylamide gel electrophoresis before KERA was mia has not been previously described. Microphthalmia is a directly sequenced for mutations. heterogeneous group of developmental anomalies in which the eye fails to attain its normal dimensions with the axial RESULTS. Positive lod scores were obtained with markers en- 4 compassing the CNA2 locus, the maximum two-point lod diameter reduced to less than the age-adjusted 5th centile.
    [Show full text]
  • Molecular Genetics of Corneal Dystrophy
    Molecular Genetics of Corneal Dystrophy A THESIS SUBMITTED FOR THE M.D. TO THE UNIVERSITY OF LONDON MOHAMED EL-ASHRY, MB CHB FRCS (Ed) CLINICAL RESEARCH FELLOW DEPARTMENT OF MOLECULAR GENETICS INSTITUTE OF OPHTHALMOLOGY UNIVERSITY COLLEGE LONDON BATH STREET LONDON AND MOORFIELDS EYE HOSPITAL CITY ROAD LONDON 2001 ProQuest Number: 10013866 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest 10013866 Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 Abstract Abstract Comeal dystrophies are inherited disorders characterised by progressive accumulation of deposits in the cornea causing visual impairment. They occur in either an autosomal dominant or recessive form and are usually manifested in the first few decades of life. The present classification is solely based on the layer or layers of the cornea involved. This study aimed at better understanding of the underlying molecular basis of such disorders via linkage to specific chromosomal loci and then mutation screening of the disease genes by means of amplification of the genomic DNA using polymerase chain reaction and then sequencing and restriction enzyme digest analysis.
    [Show full text]
  • A New Phenotype of Recessively Inherited Foveal Hypoplasia and Anterior Segment Dysgenesis Maps to a Locus on Chromosome 16Q23.2–24.2
    772 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.020040 on 1 October 2004. Downloaded from A new phenotype of recessively inherited foveal hypoplasia and anterior segment dysgenesis maps to a locus on chromosome 16q23.2–24.2. B Pal, M D Mohamed, T J Keen*, G A Williams, J A Bradbury, E Sheridan, C F Inglehearn ............................................................................................................................... J Med Genet 2004;41:772–777. doi: 10.1136/jmg.2004.020040 he phrase anterior segment dysgenesis (ASD), also Key points sometimes known as anterior segment ocular or Tmesenchymal dysgenesis (ASOD or ASMD, OMIM #107250), was first used in 1981 by Hittner and colleagues N We document a new phenotype of recessively inherited to describe a range of developmental defects in structures at foveal hypoplasia and anterior segment dysgenesis in the front of the eye.1 These defects are thought to result from a large consanguineous pedigree. abnormal migration or differentiation of the neural crest N Five members of the pedigree presented with nystag- derived mesenchymal cells that give rise to the cornea, iris, mus and poor vision. These individuals, their siblings, and other components of the anterior chamber during eye and their parents underwent full systemic and ophthal- 23 development. Conditions falling within the ASD spectrum mic examination. Ophthalmic examination revealed include aniridia, posterior embryotoxon, Axenfeld’s anomaly, foveal hypoplasia and anterior segment dysgenesis in Reiger’s anomaly/syndrome, Peters’ anomaly, and iridogo- all five cases, in the absence of any other abnormal- niodysgenesis. Aniridia (OMIM #106210) ranges from ities. Parents were unaffected. almost complete absence of the iris, through enlargement N and irregularity of the pupil mimicking a coloboma, to small Linkage analysis identified a region on chromosome slit-like defects in the anterior layer visible only with a slit 16q23.2-24.2 that showed highly significant co- lamp.
    [Show full text]
  • The Rieger Syndrome: a Case Report with Unusual Dental Findings
    10.2478/bjdm-2018-0010 Y T E I C O S L BALKAN JOURNAL OF DENTAL MEDICINE A ISSN 2335-0245 IC G LO TO STOMA The Rieger Syndrome: a Case Report with Unusual Dental Findings SUMMARY Smaragda Kavadia1, Konstantinos Anto- niades2, Eleni Markovitsi1, Eleftherios G. Background/Aim: The Rieger syndrome is a rare, autosomal dominant Kaklamanos3 and phenotypically variable disorder, characterized by abnormalities of the 1 Department of Orthodontics, School of Dentistry, Faculty of Health Sciences, Aristotle anterior chamber of the eye, coincident with missing or misshapen teeth. University of Thessaloniki, Thessalonki, Greece 2 Department of Oral and Maxillofacial Case report: This report features a case of the Rieger syndrome associated Surgery, School of Dentistry, Faculty of Health Sciences, Aristotle University of Thessaloniki, with bilateral cleft lip and palate and a severe open bite, findings not usually Thessalonki, Greece 3 Hamdan Bin Mohammed College of Dental reported in association with this condition. Conclusions: The findings Medicine, Mohammed Bin Rashid University of Medicine and Health Sciences, Dubai, United described in the present case of Rieger syndrome are unusual and expand Arab Emirates the spectrum of manifestations of the condition. CASE REPORT (CR) Key words: Rieger Syndrome, Hypodontia, Iridogoniodysgenesis, Cleft Lip And Palate Balk J Dent Med, 2018;53-56 Introduction and craniofacial defects help to distinguish the Rieger syndrome from other anterior chamber malformations Rieger syndrome is characterized by hypodontia (Axenfeld’s syndrome, Peters’ anomaly) or other and primary mesodermal dysgenesis of the anterior syndromes in which goniodysgenesis is a component chamber of the eye1-4. The ocular component is usually (goniodysgenesis associated with juvenile glaucoma, bilateral and manifests partial or complete hypoplasia of anal atresia and goniodysgenesis, arachnodactyly the anterior stromal leaf of the iris, anterior iris synechiae and goniodysgenesis, deafness and goniodysgenesis, and iridogoniodysgenesis5-7.
    [Show full text]
  • Whole Exome Sequencing in Coloboma/Microphthalmia: Identification of Novel and Recurrent Variants in Seven Genes
    G C A T T A C G G C A T genes Article Whole Exome Sequencing in Coloboma/Microphthalmia: Identification of Novel and Recurrent Variants in Seven Genes Patricia Haug 1 , Samuel Koller 1 , Jordi Maggi 1 , Elena Lang 1,2, Silke Feil 1, Agnès Wlodarczyk 1, Luzy Bähr 1, Katharina Steindl 3, Marianne Rohrbach 4 , Christina Gerth-Kahlert 2,† and Wolfgang Berger 1,5,6,*,† 1 Institute of Medical Molecular Genetics, University of Zurich, 8952 Schlieren, Switzerland; [email protected] (P.H.); [email protected] (S.K.); [email protected] (J.M.); [email protected] (E.L.); [email protected] (S.F.); [email protected] (A.W.); [email protected] (L.B.) 2 Department of Ophthalmology, University Hospital and University of Zurich, 8091 Zurich, Switzerland; [email protected] 3 Institute of Medical Genetics, University of Zurich, 8952 Schlieren, Switzerland; [email protected] 4 Division of Metabolism and Children’s Research Centre, University Children’s Hospital Zurich, 8032 Zurich, Switzerland; [email protected] 5 Neuroscience Center Zurich (ZNZ), University and ETH Zurich, 8006 Zurich, Switzerland 6 Zurich Center for Integrative Human Physiology (ZIHP), University of Zurich, 8006 Zurich, Switzerland * Correspondence: [email protected] † Both authors contributed equally to this work. Abstract: Coloboma and microphthalmia (C/M) are related congenital eye malformations, which can cause significant visual impairment. Molecular diagnosis is challenging as the genes associated to date with C/M account for only a small percentage of cases. Overall, the genetic cause remains unknown in up to 80% of patients.
    [Show full text]
  • Surgical Correction of Hallermann-Streiff Syndrome: a Case Report of Esotropia, Entropion, and Blepharoptosis
    Korean J Ophthalmol 2011;25(2):142-145 pISSN: 1011-8942 eISSN: 2092-9382 DOI: 10.3341/kjo.2011.25.2.142 Case Report Surgical Correction of Hallermann-Streiff Syndrome: A Case Report of Esotropia, Entropion, and Blepharoptosis Won-Kyung Cho, Joo Wan Park, Mi Ra Park Department of Ophthalmology and Visual Science, Yeouido St. Mary’s Hospital, The Catholic University of Korea School of Medicine, Seoul, Korea We report a case of surgical treatment for Hallermann-Streiff syndrome in a patient with ocular manifestations of esotropia, entropion, and blepharoptosis. A 54-year-old man visited Yeouido St. Mary’s Hospital complaining of oc- ular discomfort due to cilia touching the corneas of both eyes for several years. He had a bird-like face, pinched nose, hypotrichosis of the scalp, mandibular hypoplasia with forward displacement of the temporomandibular joints, a small mouth, and proportional short stature. His ophthalmic features included sparse eyelashes and eyebrows, microphthalmia, nystagmus, lower lid entropion in the right eye, and upper lid entropion with blepharoptosis in both eyes. There was esodeviation of the eyeball of more than 100 prism diopters at near and distance, and there were limitations in ocular movement on lateral gaze. The capsulopalpebral fascia was repaired to treat the right lower lid entropion, but an additional Quickert suture was required to prevent recurrence. Blepharoplasty and levator palpe- brae repair were performed for blepharoptosis and dermatochalasis. Three months after lid surgery, the right medial rectus muscle was recessed 7.5 mm, the left medial rectus was recessed 7.25 mm, and the left lateral rectus muscle was resected 8.0 mm.
    [Show full text]
  • Aniridia (PAX6) Sequencing & Deletion/Duplication
    Lab Dept: Anatomic Pathology Test Name: ANIRIDIA (PAX6) SEQUENCING & DELETION /DUPLICATION General Information Lab Order Codes: PAX Synonyms: Developmental Eye Disorders Gene Testing; WT1 Sequencing; DCDC1 Sequencing; ELP4 Sequencing CPT Codes: 81479 – Unlisted Molecular Pathology procedure (PAX6 del/dup) Test Includes: Using genomic DNA obtained from an EDTA blood sample, bi-directional sequence of the coding and non-coding exons of the PAX6 gene (exons 1- 13), the alternatively spliced exon 5a and splice junctions are obtained and analyzed. Deletion/duplication testing by targeted array CGH analysis with exon-level resolution (EXONArrayDx) is performed concurrently to evaluate for a deletion or duplication of one or more exons of the PAX6, DCDC1m ELP4 and WT1 genes. Mutations are confirmed by repeat analysis using sequencing, restriction fragment analysis, or another appropriate method. Logistics Test Indications: Aniridia is a developmental anomaly of the entire eye, characterized by varying degrees of iris hypoplasia. Ocular abnormalities associated with aniridia include persistent papillary membrane, congenital cataracts, ectopia lentis, developmental glaucoma, corneal pannus with progressive keratophathy and foveal hypoplasia. The most severe presentation of aniridia is the complete absence of the iris. Milder disease may include enlargement and irregularity of the pupil and small, slit-like defects in the anterior layer. Vision is variably affected, and the severity of vision loss tends to correlate with the presence of other associated
    [Show full text]
  • Ocular Abnormalities in the Myopathic Hamster (UM-X7.1 Strain)
    Ocular abnormalities in the myopathic hamster (UM-X7.1 strain) /. H. Thakar,9 D. H. Percy,90 and K. P. Strickland9 Eyes from cardiomyopathic hamsters (UM-X7.1 strain) were examined histologically for evi- dence of ocular defects. Changes observed included microphthalmia, scleral ectasia, scleral rupture, keratoconus, retinal detachment, retinal dysplasia, retinal fragmentation, retinal thinning, fibrosis of iris and ciliary body, ectopia lentis, and cataract formation. Lesions charac- teristic of cardiomyopathic hamsters were observed in the myocardium and skeletal muscle. This strain may be a suitable animal model to study the pathogenesis of ocular changes seen in certain congenital connective tissue disorders in man. Key words: Cardiomyopathic hamster, animal model, microphthalmia, scleral ectasia, retinal dysplasia, ectopia lentis, cataract formation. I n the strains BIO 14.6 and UM-X7.1 of cardiac muscle are present in virtually all 2 3 Syrian hamster, there is a hereditary poly- mature animals. - Death is usually due to 2 myopathy characterized by primary cardio- terminal congestive heart failure. In this myopathy and muscular dystrophy.13 Both animal model, abnormalities of membrane- 4 of these strains are considered to be ap- bound enzymes have been observed. Of propriate animal models of the Duchenne particular interest are the elevated calcium type of human muscular dystrophy.1"3 Mus- levels in serum, skeletal, and cardiac mus- 5 6 cular dystrophy in these polymyopathic cles. ' The purpose of this communication hamsters is transmitted by an autosomal is to describe concurrent ocular changes recessive gene, and histological evidence of observed in animals of the UM-X7.1 strain. skeletal muscle lesions may be observed in animals as young as 20 days old.2 In the Materials and methods UM-X7.1 strain, lesions in skeletal and Animals of the UM-X7.1 strain were obtained from Dr.
    [Show full text]
  • Ocular Manifestations of Inherited Diseases Maya Eibschitz-Tsimhoni
    10 Ocular Manifestations of Inherited Diseases Maya Eibschitz-Tsimhoni ecognizing an ocular abnormality may be the first step in Ridentifying an inherited condition or syndrome. Identifying an inherited condition may corroborate a presumptive diagno- sis, guide subsequent management, provide valuable prognostic information for the patient, and determine if genetic counseling is needed. Syndromes with prominent ocular findings are listed in Table 10-1, along with their alternative names. By no means is this a complete listing. Two-hundred and thirty-five of approxi- mately 1900 syndromes associated with ocular or periocular manifestations (both inherited and noninherited) identified in the medical literature were chosen for this chapter. These syn- dromes were selected on the basis of their frequency, the char- acteristic or unique systemic or ocular findings present, as well as their recognition within the medical literature. The boldfaced terms are discussed further in Table 10-2. Table 10-2 provides a brief overview of the common ocular and systemic findings for these syndromes. The table is organ- ized alphabetically; the boldface name of a syndrome is followed by a common alternative name when appropriate. Next, the Online Mendelian Inheritance in Man (OMIM™) index num- ber is listed. By accessing the OMIM™ website maintained by the National Center for Biotechnology Information at http://www.ncbi.nlm.nih.gov, the reader can supplement the material in the chapter with the latest research available on that syndrome. A MIM number without a prefix means that the mode of inheritance has not been proven. The prefix (*) in front of a MIM number means that the phenotype determined by the gene at a given locus is separate from those represented by other 526 chapter 10: ocular manifestations of inherited diseases 527 asterisked entries and that the mode of inheritance of the phe- notype has been proven.
    [Show full text]