DOCSLIB.ORG

Characterization of Two Aerobic Ultramicrobacteria Isolated from Urban Soil and a Description of Oxalicibacterium Solurbis Sp

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Two Aerobic Ultramicrobacteria Isolated from Urban Soil and a Description of Oxalicibacterium Solurbis Sp RESEARCH LETTER Characterization of two aerobic ultramicrobacteria isolated from urban soil and a description of Oxalicibacterium solurbis sp. nov. Nurettin Sahin1, Juan M. Gonzalez2, Takashi Iizuka3 & Janet E. Hill4 1Egitim Fakultesi, Mugla Universitesi, Mugla, Turkey; 2Instituto de Recursos Naturales y Agrobiologia, IRNAS-CSIC, Sevilla, Spain; 3Central Research Laboratories, Ajinomoto Co. Inc., Kawasaki, Japan; and 4Department of Veterinary Microbiology, University of Saskatchewan, SK, Canada Downloaded from https://academic.oup.com/femsle/article-abstract/307/1/25/471128 by guest on 13 February 2020 Correspondence: Nurettin Sahin, Egitim Abstract Fakultesi, Mugla University, TR-48170 Kotekli, Mugla, Turkey. Tel.: 190 252 211 1826; fax: Two strains of aerobic, non-spore-forming, Gram-negative, rod-shaped bacteria T 190 252 223 8491; e-mail: (ND5 and MY14 ), previously isolated from urban soil using the membrane-filter [email protected] enrichment technique, were characterized. Analysis of their 16S rRNA gene sequence grouped strains ND5 and MY14T within the family Oxalobacteraceae Received 10 February 2010; revised 2 March (Betaproteobacteria). The highest pairwise sequence similarities for strain ND5 2010; accepted 2 March 2010. were found with members of the genus Herminiimonas, namely with Herminiimo- Final version published online 30 March 2010. nas saxobsidens NS11T (99.8%) and Herminiimonas glaciei UMB49T (99.6%). Although some fatty acid profiles, physiological and biochemical differences exist DOI:10.1111/j.1574-6968.2010.01954.x between strain ND5 and the respective Herminiimonas-type strains, DNA–DNA hybridization experiments confirm that strain ND5 is a member of the H. glaciei Editor: Aharon Oren genospecies. Taxonomical analyses revealed a wider range of variability within this Keywords genus than considered previously. The highest pairwise nucleotide similarity for T Oxalicibacterium solurbis ; Herminiimonas ; strain MY14 was found with Oxalicibacterium flavum (96.8%). Phylogenetic ultramicrobacteria; Oxalobacteraceae. analyses based on 16S rRNA and cpn60 gene sequences, DNA–DNA hybridization, fatty acid profiles, physiological and biochemical tests allowed genotypic and phenotypic differentiation of strain MY14T from other Oxalicibacterium species representing a new species, for which the name Oxalicibacterium solurbis sp. nov. (type strain MY14T = NBRC 102665T, = CCM 7664T) is proposed. Herminiimonas arsenicoxydans (Muller et al., 2006), Hermi- Introduction niimonas saxobsidens (Lang et al., 2007) and Herminiimonas Extremely small free-living bacteria, showing biovolumes glaciei (Loveland-Curtze et al., 2009). The genus Oxalicibac- generally lower than 0.3 mm3 in situ (Koch, 1996), are known terium, with the type species Oxalicibacterium flavum, was to be present in a wide variety of natural environments and established by Tamer et al. (2002) and currently comprises have been classified with terms such as ultramicrobacteria three species. The species Oxalicibacterium horti and Oxali- (UMB), nanobacteria or picobacteria (Koch, 1996). With cibacterium faecigallinarum have been described recently the purpose of isolating copiotrophic and rapidly growing (Sahin et al., 2009). UMB, strains ND5 and MY14T were isolated from an urban The present paper deals with a polyphasic approach to soil sample using the 0.45-mm membrane filter enrichment describe strains ND5 and MY14T, which have been classified technique on 0.1 Â TSA (Iizuka et al., 1998). The site was in the genera Herminiimonas and Oxalicibacterium, respec- covered by a heap of fallen leaves and located in a grove in tively, and to propose a novel taxon for strain MY14T, the Tokyo metropolitan area. Analysis of the almost com- named Oxalicibacterium solurbis sp. nov. plete 16S rRNA gene sequence grouped strains ND5 and MY14T within the family Oxalobacteraceae (Betaproteobac- Materials and methods teria), most closely related to type strains of the genera MICROBIOLOGY LETTERS MICROBIOLOGY Herminiimonas and Oxalicibacterium, respectively. Phenotypic characterization The genus Herminiimonas presently comprises five validly described species: Herminiimonas fonticola (Fernandes et al., Physiological and biochemical tests were carried out at 2005), Herminiimonas aquatilis (Kampfer¨ et al., 2006), 30 1C. Conventional biochemical tests were performed FEMS Microbiol Lett 307 (2010) 25–29 c 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 26 N. Sahin et al. according to standard methods (Smibert & Krieg, 1994). 60 1C and 60 s at 72 1C, and a final extension period of Bacterial growth at different pH values (6–9.5), tempera- 10 min at 72 1C. PCR reactions were conducted using an tures (À 5to421C) and NaCl concentrations (0–5%) was Eppendorf Mastercycler EP thermocycler. determined in basal mineral medium supplemented with PCR products were sequenced using sequencing primers À1 glycolate and lactate that contained (L ): 1 g L-glycolate, 1 g M13(-40)F and M13(48)R described above. Sequence data DL-lactate, 0.1 g yeast extract (Difco), 100 mL RM1-mineral were assembled and edited using the STADEN PACKAGE (Staden, solution, 1 g (NH4)2SO4, 0.5 g KH2PO4 and 0.5 g K2HPO4. 1996). Finished sequences were deposited in GenBank and The pH of the medium was adjusted to 6.8 with NaOH. cpnDB (http://cpndb.cbr.nrc.ca) sequence databases (Hill À1 RM1-mineral solution contained (L ): 2.0 g MgCl2 Á 6H2O, et al., 2004). 0.4 g CaCl2 Á 2H2O, 2.0 g NaCl and 10 mL trace element Downloaded from https://academic.oup.com/femsle/article-abstract/307/1/25/471128 by guest on 13 February 2020 solution (Iizuka et al., 1998). API 20NE, API 20E strips (bioMerieux)´ and Biolog GN microplates were used accord- Chemotaxonomic characterization ing to the manufacturer’s instructions, and reactions were For the analysis of fatty acids, cells were grown on R2A agar observed for 7 days. Additional utilization and assimilations at 28 1C for 4 days. Cells were saponified, methylated to of sugars, alcohols and amino acids were determined in the create fatty acid methyl esters and extracted as described above-indicated basal mineral medium with addition of previously (Kampfer¨ & Kroppenstedt, 1996). Peaks were À1 filter-sterilized solutions of the following substrates (g L ). automatically integrated and fatty acid names and percen- Sugars and alcohols: ethanol, 0.5; methanol, 0.5; n-propa- tages were determined using the Microbial Identification nol, 0.5; D-ribose, 2.0; xylose, 2.0. Organic acids: acetate, 0.5 standard software package MIDI (Sasser, 1990). Polar lipid and 2.0; benzoate, 0.5; caprylate, 0.5; oxalate, 0.5 and 2.0; profiles were examined by two-dimensional thin-layer chro- fumarate, 2.0; glycolate, 2.0; L-malate, 2.0; L-tartarate, 2.0. matography as described by Rowe et al. (2000). Amino acids: aminobutyrate, 2.0; L-arginine HCl, 2.0; L-glycine, 2.0; L-lysine, 2.0; and L-tryptophan, 2.0. DNA--DNA hybridizations 16S rRNA gene sequencing and phylogenetic The degree of DNA–DNA relatedness was determined by analysis measuring the divergence between the thermal denaturation The 16S rRNA gene sequences were analysed as described by midpoint of homoduplex DNA and heteroduplex DNA Iizuka et al. (1998). Evolutionary distances were calculated (DTm) as described by Gonzalez´ & Saiz-Jim´ enez´ (2005). using Kimura’s two-parameter model (Kimura, 1980) without The G1C content of the DNA was determined according to taking into account the alignment gaps and unidentified base the fluorimetric method described by Gonzalez´ & Saiz-´ positions. Phylogenetic trees were constructed from the dis- Jimenez´ (2002) using thermal denaturation temperature. tance data using the neighbour-joining (Saitou & Nei, 1987) and maximum-parsimony (Fitch, 1971) methods with boot- strap values based on 1000 replications (Felsenstein, 1985). Results and discussion cpn 60 universal target sequencing Phenotypic characteristics Approximately 50–100 ng of genomic DNA was used as a The strains studied showed a limited substrate spectrum as template in PCR reactions (50 mL total volume) containing observed from the analysis of API 20 NE, API 20E and Biolog 1 Â PCR buffer (Invitrogen, Burlington, Canada), 2.5 mM GN microplates. Strains ND5 and MY14T utilized oxalate, MgCl2, 200 nM dNTPs, 2.5 U Platinum Taq DNA polymer- formate, glycolate, lactate, pyruvate, succinate and malate. ase (Invitrogen) and 400 nM each of primers H1594 (50- Other carboxylic acids, alcohols and amino acids (except CGC CAG GGT TTT CCC AGT CAC GAC GAC GTC GCC alanine) were not utilized. Strain ND5 differs from H. glaciei 0 0 T GGT GAC GGC ACC ACC AC-3 ) and H1595 (5 -AGC UMB49 in its inability to utilize citrate and L-arabinose and GGA TAA CAA TTT CAC ACA GGA CGA CGG TCG CCG its capability to use acetate (Loveland-Curtze et al., 2009). AAG CCC GGG GCC TT-30). Amplification primers in- On the other hand, strain MY14T utilized an even cluded annealing sites for standard M13 sequencing primers narrower range of substrates: fumarate, glycolate, lactate, M13(-40)F and M13(48)R (underlined). The primers am- malate, malonate (weak), pyruvate, succinate, oxalate, plify the universal target region of the cpn60 gene (encoding L-alanine and L-glycine. Although both strains utilized the universally conserved 60-kDa chaperonin, also known as oxalate, the cell yield was lower than those with fumarate, groEL or hsp60), corresponding to nucleotides 274–828 of glycolate, lactate or malate. Differential phenotypic charac- the Escherichia
Load more

Recommended publications
  • Table S1. Bacterial Otus from 16S Rrna
    Table S1. Bacterial OTUs from 16S rRNA sequencing analysis including only taxa which were identified to genus level (those OTUs identified as Ambiguous taxa, uncultured bacteria or without genus-level identifications were omitted). OTUs with only a single representative across all samples were also omitted. Taxa are listed from most to least abundant. Pitcher Plant Sample Class Order Family Genus CB1p1 CB1p2 CB1p3 CB1p4 CB5p234 Sp3p2 Sp3p4 Sp3p5 Sp5p23 Sp9p234 sum Gammaproteobacteria Legionellales Coxiellaceae Rickettsiella 1 2 0 1 2 3 60194 497 1038 2 61740 Alphaproteobacteria Rhodospirillales Rhodospirillaceae Azospirillum 686 527 10513 485 11 3 2 7 16494 8201 36929 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Pedobacter 455 302 873 103 16 19242 279 55 760 1077 23162 Betaproteobacteria Burkholderiales Oxalobacteraceae Duganella 9060 5734 2660 40 1357 280 117 29 129 35 19441 Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas 3336 1991 3475 1309 2819 233 1335 1666 3046 218 19428 Betaproteobacteria Burkholderiales Burkholderiaceae Paraburkholderia 0 1 0 1 16051 98 41 140 23 17 16372 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Mucilaginibacter 77 39 3123 20 2006 324 982 5764 408 21 12764 Gammaproteobacteria Pseudomonadales Moraxellaceae Alkanindiges 9 10 14 7 9632 6 79 518 1183 65 11523 Betaproteobacteria Neisseriales Neisseriaceae Aquitalea 0 0 0 0 1 1577 5715 1471 2141 177 11082 Flavobacteriia Flavobacteriales Flavobacteriaceae Flavobacterium 324 219 8432 533 24 123 7 15 111 324 10112 Alphaproteobacteria
    [Show full text]
  • The Case of the Red Pigment Miltos
    Greco-Roman mineral (litho)therapeutics and their relationship to their microbiome: The case of the red pigment miltos E. Photos-Jones a,b, C.W.Knapp c, D. Venieri d, G.E.Christidis f, C.Elgy e, E. Valsami-Jones e, I. Gounaki c and N.C.Andriopoulou f. a Analytical Services for Art and Archaeology (Ltd), Glasgow G12 8JD, UK b Archaeology, School of Humanities, University of Glasgow, Glasgow G12 8QQ, UK c Civil and Environmental Engineering, University of Strathclyde, Glasgow G1 1XQ, UK d School of Environmental Engineering, Technical University of Crete, 73100 Chania, Greece e School of Geography, Earth and Environmental Sciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK f School of Mineral Resources Engineering, Technical University of Crete, 73100 Chania, Greece Journal of Archaeological Science: Reports. Volume 22, December 2018, Pages 179-192 https://doi.org/10.1016/j.jasrep.2018.07.017 corresponding author address: [email protected] Abstract This paper introduces a holistic approach to the study of Greco-Roman (G-R) lithotherapeutics. These are the minerals or mineral combinations that appear in the medical and scientific literature of the G-R world. It argues that they can best be described not simply in terms of their bulk chemistry/mineralogy but also their ecological microbiology and nanofraction component. It suggests that each individual attribute may have underpinned the bioactivity of the lithotherapeutic as an antibacterial, antifungal or other. We focus on miltos, the highly prized, naturally fine, red iron oxide-based mineral used as a pigment, in boat maintenance, agriculture and medicine.
    [Show full text]
  • A Report of 11 Unrecorded Bacterial Species in Korea Isolated in 2017
    Journal of Species Research 7(2):135-150, 2018 A report of 11 unrecorded bacterial species in Korea isolated in 2017 Soohyun Maeng1, Ju-Young Kim2, Jun Hwee Jang2, Myung-Suk Kang3 and Myung Kyum Kim2,* 1Department of Public Health Sciences, Graduate School, Korea University, Seoul 02841, Republic of Korea 2Department of Bio & Environmental Technology, College of Natural Science, Seoul Women’s University, Seoul 01797, Republic of Korea 3Microorganism Resources Division, National Institute of Biological Resources, Incheon 22689, Republic of Korea *Correspondent: [email protected] Eleven bacterial strains 17SD2_15, 17Sr1_23, 17SD2_13, 17Sr1_31, 17gy_18, 16B15D, 16B02D, 16B04G, 16B01D, 17U4-2 and 17J28-10 assigned to the phylum Proteobacteria were isolated from soil samples collected from Seoul Women’s University, in South Korea. The Belnapia species, strain 17SD2_15 was cocci-shaped and pink-colored. The Methylobacterium species, strain 17Sr1_23, 17SD2_13, 17Sr1_31, and 16B15D were short rod-shaped and pink-colored. The Microvirga species, strain 17gy_18, and 16B02D were short rod-shaped and pink-colored. The Oxalicibacterium species, strain 16B04G was short rod-shaped and pink-colored. The Sphingomonas species, strain 16B01D was short rod-shaped and yellow-colored. The Variovorax species, strain 17U4-2 was cocci-shaped and yellow-colored. The Paracoccus species, 17J28-10 was cocci-shaped and orange-colored. Phylogenetic analysis based on 16S rRNA gene sequence showed that strains 17SD2_15, 17Sr1_23, 17SD2_13, 17Sr1_31, 17gy_18, 16B15D, 16B02D, 16B04G, 16B01D, 17U4- 2 and 17J28-10 were most closely related to Belnapia soli (with 99.9% similarity), Methylobacterium gregans (99.1%), Methylobacterium isbiliense (99.6%), Methylobacterium oxalidis (99.9%), Microvirga aerilata (98.7%), Methylobacterium aerolatum (99.0%), Microvirga vignae (100.0%), Noviherbaspirillum canariense (100.0%), Sphingomonas desiccabilis (100.0%), Variovorax humicola (99.6%), and Paracoccus acridae (99.1%), respectively.
    [Show full text]
  • Abstract Tracing Hydrocarbon
    ABSTRACT TRACING HYDROCARBON CONTAMINATION THROUGH HYPERALKALINE ENVIRONMENTS IN THE CALUMET REGION OF SOUTHEASTERN CHICAGO Kathryn Quesnell, MS Department of Geology and Environmental Geosciences Northern Illinois University, 2016 Melissa Lenczewski, Director The Calumet region of Southeastern Chicago was once known for industrialization, which left pollution as its legacy. Disposal of slag and other industrial wastes occurred in nearby wetlands in attempt to create areas suitable for future development. The waste creates an unpredictable, heterogeneous geology and a unique hyperalkaline environment. Upgradient to the field site is a former coking facility, where coke, creosote, and coal weather openly on the ground. Hydrocarbons weather into characteristic polycyclic aromatic hydrocarbons (PAHs), which can be used to create a fingerprint and correlate them to their original parent compound. This investigation identified PAHs present in the nearby surface and groundwaters through use of gas chromatography/mass spectrometry (GC/MS), as well as investigated the relationship between the alkaline environment and the organic contamination. PAH ratio analysis suggests that the organic contamination is not mobile in the groundwater, and instead originated from the air. 16S rDNA profiling suggests that some microbial communities are influenced more by pH, and some are influenced more by the hydrocarbon pollution. BIOLOG Ecoplates revealed that most communities have the ability to metabolize ring structures similar to the shape of PAHs. Analysis with bioinformatics using PICRUSt demonstrates that each community has microbes thought to be capable of hydrocarbon utilization. The field site, as well as nearby areas, are targets for habitat remediation and recreational development. In order for these remediation efforts to be successful, it is vital to understand the geochemistry, weathering, microbiology, and distribution of known contaminants.
    [Show full text]
  • Changes in Microbial Communities and Associated Water and Gas Geochemistry Across a Sulfate Gradient in Coal Beds: Powder River Basin, USA
    Changes in microbial communities and associated water and gas geochemistry across a sulfate gradient in coal beds: Powder River Basin, USA Authors: Hannah D. Schweitzer, Daniel Ritter, Jennifer McIntosh, Elliott Barnhart, Alfred B. Cunningham, David Vinson, William Orem, and Matthew W. Fields NOTICE: this is the author’s version of a work that was accepted for publication in Geochimica et Cosmochimica Acta. Changes resulting from the publishing process, such as peer review, editing, corrections, structural formatting, and other quality control mechanisms may not be reflected in this document. Changes may have been made to this work since it was submitted for publication. A definitive version was subsequently published in Geochimica et Cosmochimica Acta, VOL# 245, (January 2019), DOI# 10.1016/j.gca.2018.11.009. Schweitzer, Hannah D., Daniel Ritter, Jennifer McIntosh, Elliott Barnhart, Alfred B. Cunningham, David Vinson, William Orem, and Matthew W. Fields, “Changes in microbial communities and associated water and gas geochemistry across redox gradients in coal beds: Powder River Basin, US,” Geochimica et Cosmochimica Acta, January 2019, 245: 495-513. doi: 10.1016/ j.gca.2018.11.009 Made available through Montana State University’s ScholarWorks scholarworks.montana.edu *Manuscript Title: Changes in microbial communities and associated water and gas geochemistry across a sulfate gradient in coal beds: Powder River Basin, USA Authors: Hannah Schweitzer1,2,3, Daniel Ritter4, Jennifer McIntosh4, Elliott Barnhart5,3, Al B. Cunningham2,3, David Vinson6, William Orem7, and Matthew Fields1,2,3,* Affiliations: 1Department of Microbiology and Immunology, Montana State University, Bozeman, MT, 59717, USA 2Center for Biofilm Engineering, Montana State University, Bozeman, MT, 59717, USA 3Energy Research Institute, Montana State University, Bozeman, MT, 59717, USA 4Department of Hydrology and Atmospheric Sciences, University of Arizona, Tucson, Arizona 85721, USA 5U.S.
    [Show full text]
  • Co-Variation of Bacterial and Fungal Communities in Different Sorghum Cultivars and Growth Stages Is Soil Dependent
    Microb Ecol https://doi.org/10.1007/s00248-017-1108-6 SOIL MICROBIOLOGY Co-Variation of Bacterial and Fungal Communities in Different Sorghum Cultivars and Growth Stages is Soil Dependent Thiago R. Schlemper1,2 & Johannes A. van Veen1 & Eiko E. Kuramae1 Received: 22 August 2017 /Accepted: 3 November 2017 # The Author(s) 2017. This article is an open access publication Abstract Rhizosphere microbial community composition Keywords 16S rRNA . 18S rRNA . Rhizosphere . Sorghum can be influenced by different biotic and abiotic factors. bicolor genotypes We investigated the composition and co-variation of rhizo- sphere bacterial and fungal communities from two sor- ghum genotypes (BRS330 and SRN-39) in three different Introduction plant growth stages (emergence of the second leaf, (day10), vegetative to reproductive differentiation point The rhizosphere harbors a wide range of microorganisms, (day 35), and at the last visible emerged leaf (day 50)) in which have been shown to influence significantly plant two different soil types, Clue field (CF) and Vredepeel growth, root architecture, and nutrient uptake [1–4]. (VD). We observed that either bacterial or fungal commu- Conversely, the composition of microbial rhizosphere com- nity had its composition stronger influenced by soil follow- munities is influenced by biotic and abiotic factors including ed by plant growth stage and cultivar. However, the influ- plant species (or genotypes) and soil management [5–7]. ence of plant growth stage was higher on fungal commu- Studies on the impact of different soil fertilization manage- nity composition than on the bacterial community compo- ments on the composition of the bacterial community in the sition.
    [Show full text]
  • Supporting Online Information
    Supplementary Table 1 Initial PyOM and corn stover properties Property (units) Value PyOM Stover Total C (%) 61.0 41.9 Total N (%) 2.7 1.96 C:N (by mass) 22 21 C isotope signature (δ13C, ‰) +37.5 +1.7 Total H (%) 3.9 Total O (%) 15 pHDIW (1:20 w/v) 10.0 Feedstock Corn Particle size (mm) < 2 Heating rate (°C min-1) 5 Final temp (°C) 350 Residence time (min) 45 Surface area (m2 g-1) 92.8 ASTM Ash (%) 17 ASTM Volatiles (%) 35 ASTM Fixed C (%) 48 Supplementary Table 2 Initial soil properties Property (units) Value Texture (Channery) silt loam Bulk density (g cm-3) pHDIW 6.0 % sand 28.1 % silt 54.7 % clay 17.2 Total C (%) 1.48 Total N (%) 0.16 C:N (mass) 9.39 C isotope signature (δ13C, ‰) -25.5 Microbial biomass N* (mg kg-1 dry soil) (Vance et 8.5 al., 1987) *Microbial biomass C data were compromised, but based on a measured C:N ratio of 10.2 in the DOM, we predict roughly 87 mg MB-C kg-1 dry soil. Supplementary Table 3 Forward primer (full) sequences (adapterbarcodepad&link16Sfwdprimer) AATGATACGGCGACCACCGAGATCTACACATCGTACGAATGTTTTAATGGTG YCAGCMGCMGCGGTRA AATGATACGGCGACCACCGAGATCTACACACTATCTGAATGTTTTAATGGTG YCAGCMGCMGCGGTRA AATGATACGGCGACCACCGAGATCTACACTAGCGAGTAATGTTTTAATGGTG YCAGCMGCMGCGGTRA AATGATACGGCGACCACCGAGATCTACACCTGCGTGTAATGTTTTAATGGTG YCAGCMGCMGCGGTRA AATGATACGGCGACCACCGAGATCTACACTCATCGAGAATGTTTTAATGGTG YCAGCMGCMGCGGTRA AATGATACGGCGACCACCGAGATCTACACCGTGAGTGAATGTTTTAATGGTG YCAGCMGCMGCGGTRA AATGATACGGCGACCACCGAGATCTACACGGATATCTAATGTTTTAATGGTG YCAGCMGCMGCGGTRA AATGATACGGCGACCACCGAGATCTACACGACACCGTAATGTTTTAATGGTG YCAGCMGCMGCGGTRA Supplementary
    [Show full text]
  • VALIDATING APPROACHES for STUDYING MICROBIAL DIVERSITY to CHARACTERIZE COMMUNITIES from ROOTS of Populus Deltoides
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 8-2013 VALIDATING APPROACHES FOR STUDYING MICROBIAL DIVERSITY TO CHARACTERIZE COMMUNITIES FROM ROOTS OF Populus deltoides Migun Shakya [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Environmental Microbiology and Microbial Ecology Commons Recommended Citation Shakya, Migun, "VALIDATING APPROACHES FOR STUDYING MICROBIAL DIVERSITY TO CHARACTERIZE COMMUNITIES FROM ROOTS OF Populus deltoides. " PhD diss., University of Tennessee, 2013. https://trace.tennessee.edu/utk_graddiss/2482 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Migun Shakya entitled "VALIDATING APPROACHES FOR STUDYING MICROBIAL DIVERSITY TO CHARACTERIZE COMMUNITIES FROM ROOTS OF Populus deltoides." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Mircea Podar, Major Professor We have read this dissertation and recommend its acceptance: Christopher W. Schadt, Mitch
    [Show full text]
  • (Title of the Thesis)*
    Bacterial diversity and denitrifier communities in arable soils by Sara Victoria Coyotzi Alcaraz A thesis presented to the University of Waterloo in fulfillment of the thesis requirement for the degree of Master of Science in Biology Waterloo, Ontario, Canada, 2014 © Sara Victoria Coyotzi Alcaraz 2014 AUTHOR'S DECLARATION I hereby declare that I am the sole author of this thesis. This is a true copy of the thesis, including any required final revisions, as accepted by my examiners. I understand that my thesis may be made electronically available to the public. ii Abstract Agricultural management is essential for achieving optimum crop production and maintaining soil quality. Soil microorganisms are responsible for nutrient cycling and are an important consideration for effective soil management. The overall goal of the present research was to better understand microbial communities in agricultural soils as they relate to soil management practices. For this, we evaluated the differential impact of two contrasting drainage practices on microbial community composition and characterized active denitrifiers from selected agricultural sites. Field drainage is important for crop growth in arable soils. Controlled and uncontrolled tile drainage practices maintain water in the field or fully drain it, respectively. Because soil water content influences nutrient concentration, moisture, and oxygen availability, the effects of these two disparate practices on microbial community composition was compared in paired fields that had diverse land management histories. Libraries of the 16S rRNA gene were generated from DNA from 168 soil samples collected from eight fields during the 2012 growing season. Paired-end sequencing using next-generation sequencing was followed by read assembly and multivariate statistical analyses.
    [Show full text]
  • Isolation and Identification of Potential Bioinoculants Based on Phosphate Solubilizing and Plant Growth Promoting Benefits Rachel Raths South Dakota State University
    South Dakota State University Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange Electronic Theses and Dissertations 2019 Isolation and Identification of Potential Bioinoculants based on Phosphate Solubilizing and Plant Growth Promoting Benefits Rachel Raths South Dakota State University Follow this and additional works at: https://openprairie.sdstate.edu/etd Part of the Agronomy and Crop Sciences Commons, Microbiology Commons, Plant Biology Commons, and the Soil Science Commons Recommended Citation Raths, Rachel, "Isolation and Identification of Potential Bioinoculants based on Phosphate Solubilizing and Plant Growth Promoting Benefits" (2019). Electronic Theses and Dissertations. 3359. https://openprairie.sdstate.edu/etd/3359 This Thesis - Open Access is brought to you for free and open access by Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. For more information, please contact [email protected]. ISOLATION AND IDENTIFICATION OF POTENTIAL BIOINOCULANTS BASED ON PHOSPHATE SOLUBILIZING AND PLANT GROWTH PROMOTING BENEFITS BY RACHEL RATHS A thesis submitted in partial fulfillment of the requirements for the Master of Science Major in Biological Sciences Specialization in Microbiology South Dakota State University 2019 iii I would like to dedicate this to my husband who encouraged me and made me laugh every day of the last two years and helping keep Elam alive during this crazy time of life. iv ACKNOWLEDGMENTS I would like to thank Heike Bücking for all her help and guidance in my research as my PI, as well as my committee members.
    [Show full text]
  • Description of Oxalicibacterium Horti Sp. Nov. and Oxalicibacterium
    RESEARCH LETTER Description of Oxalicibacterium horti sp.nov.andOxalicibacterium faecigallinarum sp.nov.,newaerobic,yellow-pigmented, oxalotrophic bacteria Nurettin Sahin1, Maria C. Portillo2, Yuko Kato3 & Peter Schumann4 1Mugla University, Egitim Fakultesi, Mugla, Turkey; 2Instituto de Recursos Naturales y Agrobiologia, CSIC, Sevilla, Spain; 3Microbiological and Analytical Group, Food Research Laboratories, Mitsui Norin Co. Ltd, Shizuoka, Japan; and 4DSMZ – Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany Downloaded from https://academic.oup.com/femsle/article/296/2/198/604407 by guest on 30 September 2021 Correspondence: Nurettin Sahin, Mugla Abstract University, Egitim Fakultesi, TR-48170 Kotekli, Mugla, Turkey. Tel.: 190 252 211 1826; fax: Three strains of aerobic, Gram-negative, rod-shaped, non-spore-forming, yel- T T 190 252 223 8491; e-mail: low-pigmented bacteria (OD1 ,YOx and NS13), which were isolated in [email protected] previous studies by enrichment in a mineral medium with potassium oxalate as the sole carbon source, were characterized. On the basis of 16S rRNA gene Received 7 April 2009; accepted 17 April 2009. sequence similarity, strains OD1T,YOxT and NS13 belong to the Betaproteobac- Final version published online 15 May 2009. teria, most closely related to Oxalicibacterium flavum TA17T (97.2–99.7% sequence similarity). The major whole-cell fatty acids were C16:0,C16:1o7c and DOI:10.1111/j.1574-6968.2009.01636.x C17:0 cyclo. The results of DNA–DNA hybridization and physiological and biochemical tests allowed genotypic and phenotypic differentiation of strains Editor: Aharon Oren OD1T and YOxT from O. flavum TA17T and from each other. Therefore, it is concluded that the strains OD1T and YOxT represent novel species within the Keywords oxalate-oxidizing bacteria; Oxalobacteraceae; genus Oxalicibacterium, for which the names Oxalicibacterium horti sp.
    [Show full text]
  • Huanglongbing Alters the Structure and Functional Diversity of Microbial Communities Associated with Citrus Rhizosphere
    The ISME Journal (2011), 1–21 & 2011 International Society for Microbial Ecology All rights reserved 1751-7362/11 www.nature.com/ismej ORIGINAL ARTICLE Huanglongbing alters the structure and functional diversity of microbial communities associated with citrus rhizosphere Pankaj Trivedi1, Zhili He2,3, Joy D Van Nostrand2,3, Gene Albrigo4, Jizhong Zhou2,3 and Nian Wang1 1Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, Lake Alfred, FL, USA; 2Department of Botany and Microbiology, Institute for Environmental Genomics, University of Oklahoma, Norman, OK, USA; 3Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA, USA and 4Citrus Research and Education Center, Department of Horticultural Science, University of Florida, Lake Alfred, FL, USA The diversity and stability of bacterial communities present in the rhizosphere heavily influence soil and plant quality and ecosystem sustainability. The goal of this study is to understand how ‘Candidatus Liberibacter asiaticus’ (known to cause Huanglongbing, HLB) influences the structure and functional potential of microbial communities associated with the citrus rhizosphere. Clone library sequencing and taxon/group-specific quantitative real-time PCR results showed that ‘Ca. L. asiaticus’ infection restructured the native microbial community associated with citrus rhizosphere. Within the bacterial community, phylum Proteobacteria with various genera typically known as successful rhizosphere colonizers were significantly greater in clone libraries from healthy samples, whereas phylum Acidobacteria, Actinobacteria and Firmicutes, typically more dominant in the bulk soil were higher in ‘Ca. L. asiaticus’-infected samples. A comprehensive functional microarray GeoChip 3.0 was used to determine the effects of ‘Ca. L. asiaticus’ infection on the functional diversity of rhizosphere microbial communities.
    [Show full text]