Sarcolipin a Novel Regulator of the Cardiac Sarcoplasmic

SARCOLIPIN A NOVEL REGULATOR OF THE CARDIAC SARCOPLASMIC

RETICULUM CALCIUM ATPase

Dissertation

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of The Ohio State University

Poornima Bhupathy, M.S.

*****

The Ohio State University

2008

Dissertation Committee:

Approved by

Dr. Muthu Periasamy, Advisor

Dr. Cynthia A. Carnes ______Dr. Paul ML. Janssen Advisor Graduate Program in Molecular, Dr. Jill Rafael-Fortney Cellular and Developmental Biology

ABSTRACT

Cardiac contraction and relaxation are tightly controlled by the activity of the cardiac sarco(endo)plasmic reticulum (SR) Ca2+ transport ATPase (SERCA2a). The SR Ca2+-uptake activity not only determines the rate of Ca2+ removal during relaxation, but also the SR Ca2+ content and therefore the amount of Ca2+ released for cardiomyocyte contraction. It has been well documented over the years that altered expression and activity of SERCA2a can lead to systolic and diastolic dysfunction. The activity of SERCA2a is closely regulated by two structurally similar proteins, phospholamban (PLB) and sarcolipin (SLN). Although, the relevance of PLB has been extensively studied over the years, the role SLN in cardiac physiology is an emerging field of study. Therefore, the purpose of this study was to investigate the physiological significance of Sarcolipin, a novel 31 amino acid protein in the heart. Our hypothesis was that SLN interacts directly with cardiac SERCA2a and inhibits its function and this inhibitory effect can be modulated by SLN phosphorylation-dephosphorylation. One of the goals of this study was to perform detailed analyses of SLN protein expression during muscle development and in the diseased myocardium. Our findings indicate that (i) SLN co-localizes with both SERCA2a and PLB in the cardiac SR membrane. Further, using co-immunoprecipitation we showed that SLN interacts with both SERCA2a and PLB in cardiac myocytes. (ii) in small mammals, SLN expression is predominant in the atria but low in the ventricle and in skeletal muscle tissues, whereas in large mammals, SLN is quite abundant in skeletal muscle tissues than the atria (iii) SLN and SERCA2a are co-expressed in all striated muscle tissues studied except ventricle and co-ordinately regulated during muscle development and (iv) SLN protein levels are ~3 fold upregulated in ii the atria of heart failure dogs and ~30% decreased in the atria of hearts prone to myocardial ischemia. In addition, we found that in the atria, loss of phospholamban is compensated by the upregulation of SLN and overexpression of SLN leads to a decrease in PLB levels. These results taken together suggest that SLN is an important regulator of SERCA2a and its expression is modulated both during muscle development and cardiac pathology. The present study critically evaluated the relevance of SLN in cardiac physiology by generating a transgenic (TG) mouse model in which the SLN to SERCA2a ratio was increased in the ventricle. Overexpression of SLN decreases SR calcium transport function and results in decreased calcium transient amplitude and rate of relaxation. SLN TG hearts exhibit a significant decrease in rates of contraction and relaxation when assessed by ex vivo work-performing heart preparations. Similar results were also observed with muscle preparations and myocytes from SLN TG ventricles. Interestingly, the inhibitory effect of SLN was partially relieved upon high dose of isoproterenol treatment and stimulation at high frequency. Biochemical analyses show that an increase in SLN level does not affect PLB levels, monomer to pentamer ratio, or its phosphorylation status. No compensatory changes were seen in the expression of other calcium- handling proteins. These studies suggest that the SLN effect on SERCA pump is direct and is not mediated through increased monomerization of PLB or by a change in PLB phosphorylation status. Protein and mRNA data indicate that sarcolipin is predominantly expressed in the atria. The role of SLN in atrial physiology however is unknown. Therefore in this study, we investigated the physiological significance of sarcolipin in the atria by generating a mouse model deficient for sarcolipin. The sarcolipin null mice do not show any developmental abnormalities or any cardiac pathology. The absence of sarcolipin does not modify the expression level of other Ca2+ handling proteins, in particular phospholamban, and its phosphorylation status. Calcium uptake studies revealed that in the atria, ablation of sarcolipin resulted in an increase in the affinity of the SERCA pump for Ca2+,

iii and the maximum velocity of Ca2+ uptake rates. An important finding is that ablation of sarcolipin resulted in an increase in atrial Ca2+ transient amplitudes and this resulted in enhanced atrial contractility. Furthermore, atria from sarcolipin null mice showed a blunted response to isoproterenol stimulation, implicating SLN as a mediator of β-adrenergic responses in atria. Our study documented for the first time that sarcolipin is a key regulator of SERCA2a in atria. Importantly, our data demonstrate the existence of distinct modulator of SERCA pump in the atria and ventricle. Data thus far indicate that SLN is a reversible inhibitor of SERCA2a. Therefore to dissect the mechanism of regulation of the inhibitory effect of SLN on SERCA2a we made use of adenoviral gene transfer and site directed mutagenesis. This study provides evidence for the first time that the highly conserved threonine 5 residue plays an important role in the regulation of SLN action on SERCA pump. We also provide evidence that threonine 5 can be phosphorylated by CaMKII in vitro. Future studies should be directed towards understanding the role of SLN as a target for CaMKII in mediating β -adrenergic response in the atria. In conclusion our data has identified SLN as a novel regulator of SERCA2a and as a mediator of β-adrenergic response in the atria.

DEDICATION

Dedicated to my parents

ACKNOWLEDGMENTS

First and foremost I would like to express my sincere gratitude to

my advisor Dr. Muthu Periasamy. I thank him for including me as part of his

outstanding research group. His dedication for science and expertise in the field

of cardiovascular physiology has instilled a deep sense of passion for science in

me as well. Dr. Periasamy’s long discussions with me over the years helped me

a great deal in coming up with novel ideas and testing them. He taught me how to become an independent thinker and scientist, and always encouraged me to write grants and papers which helped me develop my scientific writing skills. He also helped me improve my presentation and discussion skills. Without his constant guidance and support none of this thesis work would have been possible.

I will be eternally grateful to Dr.Gopal J Babu for his invaluable help and support during my entire PhD journey. He has been both a friend and a guide. I particularly thank him for believing enough in my abilities to entrust me with this exciting and at times difficult Sarcolipin project. I thank Babu for teaching me all the techniques over the years and being patient with me when I made mistakes.

He has been a great source of inspiration to me for his dedication and hardwork and all that he has achieved. I would also like to thank all the other past and present members of the Periasamy Lab.

vi I thank Dr. David Bisaro for his constant help and counsel. My special

thanks to Jan Zinaich for always lending a listening ear and for her sincere words

of advice and encouragement over these years. I want to express my thanks to the members of my thesis committee Drs. Cynthia Carnes, Paul Janssen and Jill

Rafael-Fortney for their invaluable advice and suggestions. I thank Dr. Christian

Dumitrescu, Debra Wheeler and Bob Kelley in helping me set up the cardiac myocyte culture system. I would like to thank Dr. Loren Wold for his help with the

Ion Optix set up. I also like to thank the faculty in the Department of Physiology

and Cell Biology, especially Dr. Paul Janssen, Dr. Mark Ziolo, Dr. Cynthia

Carnes, Dr. George Billman, Dr. Peter Reiser for their collaborations in this

project.

Finally, and most importantly my heart-felt thanks to each and everyone in

my family and my friends, who make everything worthwhile. Special thanks to my

parents to whom I dedicate my thesis. My mom for making me the person I am and my dad for his unconditional love and support and for believing in me and encouraging me to pursue my dreams.

It is believed that rodents have saved more lives than 911! I therefore, cannot end this acknowledgment without thanking the rats and mice which have been an integral part of my research.

This research was supported by grants from the National Institute of

Health to Dr. Muthu Periasamy (NIH grant RO1-HL64140) and an American

Heart Association predoctoral fellowship to Poornima Bhupathy (AHA Award

Number: 0415170B).

vii

VITA

April 3 1977 Born – Secunderabad, India

1995-1998 Bachelor of Science- Genetics, Zoology & Chemistry, Osmania University College for Women, Hyderabad, India.

1998-2000 Master of Science- Animal Sciences. Hyderbad Central University, Hyderabad, India

2002 Graduate Teaching Assistant. The Ohio State University, Columbus, OH

2001 – Present Graduate Student, The Ohio State University, Columbus, OH

FELLOWSHIP

July 2004- June 2006 American Heart Association Pre-doctoral Fellowship

viii

PUBLICATIONS

1) Muthu Periasamy, Poornima Bhupathy, Gopal J Babu Regulation of sarcoplasmic reticulum Ca2+ ATPase pump expression and its relevance to cardiac muscle physiology and pathology. Cardiovas .Res. 2008 Feb 1; 77(2):265-73.

2) Gopal J Babu, Poornima Bhupathy, Valeriy Timofeyev, Natalia N Petrashevskaya, Peter J. Reiser, Nipavan Chiamvimonvat, and Muthu Periasamy. Ablation of sarcolipin enhances sarcoplasmic reticulum calcium transport and atrial contractility PNAS. 2007 Nov,104 (45);17867– 72

3) M.A. Hassan Talukder Anuradha Kalyanasundaram, Xue Zhao, Li Zuo, Poornima Bhupathy, Gopal J. Babu, Arturo J. Cardounel, Muthu Periasamy, Jay L. Zweier. Expression of SERCA isoform with faster Ca2+ transport properties improves postischemic cardiac function and Ca2+ handling and decreases myocardial infarction. AJP Heart and Circulatory Physiology. 2007; Oct;293(4):H2418-28

4) Gopal.J.Babu, Poornima Bhupathy, Cynthia.A.Carnes, George E.Billman, and Muthu Periasamy. Differential expression of sarcolipin protein during muscle development and cardiac patho-physiology. J Mol Cell Cardiol. 2007 Aug; 43(2):215-22.

5) Poornima Bhupathy, Gopal.J.Babu and Muthu Periasamy. Sarcolipin and Phospholamban as regulators of cardiac sarcoplasmic reticulum Ca2+ ATPase. J Molecular and Cellular Cardiol Review. 2007 May;42(5):903-11

6) Gopal J. Babu, Poornima Bhupathy, Natalia N. Petrashevskaya, Honglan Wang, Sripriya Raman, Debra Wheeler, Ganapathy Jagatheesan, David Wieczorek, Arnold Schwartz, Paul M. L. Janssen, Mark T. Ziolo, and Muthu Periasamy. Targeted overexpression of sarcolipin in the mouse heart decreases sarcoplasmic reticulum calcium transport and cardiac contractility. J Biol. Chem., 2006, Feb 16; Vol. 281, Issue 7, 3972-3979.

7) Babu GJ, Zheng Z, Natarajan P, Wheeler D, Janssen PM, Periasamy M. Overexpression of sarcolipin decreases myocyte contractility and calcium transient. Cardiovasc Res. 2005 Jan 1; 65 (1):177-86.

FIELDS OF STUDY

MAJOR FIELD Molecular Cellular and Development Biology Program

TABLE OF CONTENTS

Page

ABSTRACT……………………………………………………………………… ii

DEDICATION…………………………………………………………………… v

ACKNOWLEDGEMENTS……………………………………………………… vi

VITA……………………………………………………………………………… viii

LIST OF TABLES……………………………………………………………… xiv

LIST OF FIGURES…………………………………………………………… xv

LIST OF ABBREVIATIONS…………………………………………………… xviii

CHAPTERS:

Chapter 1: Introduction……………………………………………………… 1

Cardiac excitation-contraction coupling………………………………… 1 The sarcoplasmic reticulum Ca2+ ATPase (SERCA) pump………… 2 Sarcolipin is structurally similar to PLB………………………………… 3 SLN and PLB are differentially expressed during development and 6 disease states………………………………………………………… Transgenic approaches to study the role of PLB and SLN in cardiac 7 physiology………………………………………………………………… SLN functionally differs from PLB……………………………………… 10 β -adrenergic response in the atria could be mediated by 14 SLN………………………………………………………………………… Key questions addressed in this study………………………………… 15

Chapter 2: Localization of Sarcolipin in cardiac myocytes and its differential expression during muscle development and cardiac patho- physiology……………………………………………………………………… 17 Abstract…………………………………………………………………… 17 Introduction……………………………………………………………… 18 Materials and Methods………………………………………………… 19 Results…………………………………………………………………… 25 Discussion………………………………………………………………… 36

Chapter 3: Cardiac specific overexpression of Sarcolipin in Mice leads to a decrease in sarcoplasmic reticulum calcium transport and cardiac contractility…………………………………………………………………… 40

Abstract…………………………………………………………………… 40 Introduction……………………………………………………………… 41 Materials and Methods………………………………………………… 43 Results……………………………………………………………………… 50 Discussion……………………………………………………………… 65

Chapter 4: Ablation of Sarcolipin enhances sarcoplasmic reticulum calcium transport and atrial contractility……………………………………… 69

Abstract…………………………………………………………………… 69 Introduction………………………………………………………………… 70 Materials and Methods…………………………………………………… 71 Results……………………………………………………………………… 76 Discussion……………………………………………………………… 89

Chapter 5: Role of Threonine 5 phosphorylation in Sarcolipin function…………………………………………………………………………. 94 Abstract…………………………………………………………………… 94 Introduction……………………………………………………………… 95 Materials and Methods…………………………………………………… 97 Results……………………………………………………………………… 102 Discussion……………………………………………………………… 109

xii

Chapter 6: Discussion……………………………………………………… 113

In my thesis work I tried to address the following key questions…… 114 Differential expression of SLN in atria vs. ventricle………………… 114 Sarcolipin inhibits SERCA2a activity in the heart……………………… 115 SLN function is independent of PLB…………………………………… 116 Physiological relevance of SLN in the atria…………………………… 117 SLN as a mediator of β-adrenergic response in the atria…………… 117 Conclusions and Perspectives………………………………………… 120

Bibliography…………………………………………………………………… 121

xiii

LIST OF TABLES

Table Page

3.1 Contractile parameters in SLN TG and NTG hearts in isolated work-performing heart preparations…………………………………. 57

4.1 Contractile parameters in sln-/- hearts in the isolated work- performing heart preparations at 6 Hz………………………... 82

xiv

LIST OF FIGURES

Figure Page 1.1 Schematic representation of homology between the PLB and SLN protein sequence…………………………………………….. 4 1.2 Sequence comparison of SLN from different species…………… 5 1.3 Illustration showing differences in the functional effect of PLB and SLN on SR Ca2+ uptake………………………………………. 11 1.4 A hypothetical model showing how PLB and SLN differ in their functional interaction with SERCA pump………………………….. 12 2.1 Confocal microscopic images of rat ventricular myocytes, showing the co-localization of SLN, SERCA2a and PLB……………………………………………………………………. 26 2.2 SLN co-immunoprecipitates SERCA 2a and PLB………………. 27 2.3 Expression of SLN, PLB and SERCA2a protein levels in striated muscle tissues of rodents and larger mammals…………………. 29 2.4 Expression analysis of SLN, SERCA2a, PLB and SERCA1a proteins during muscle development………………………………. 31 2.5 Altered SLN levels in the atria of heart failure and ischemic injured dog models………………………………………………….. 33 2.6 SLN protein levels are upregulated in plb−/− atria ……………… 34 2.7 PLB levels are downregulated in SLN TG atria………………….. 35

xv 3.1 Schematic representation of the α-MHC-SLN construct containing the mouse SLN cDNA…………………………………. 52 3.2 Quantification of SR calcium-handling proteins and sarcolemmal calcium transporters, NCXand PMCA…………………………….. 54 3.3 Basal phosphorylation and monomer to pentamer ratio of PLB, in SLN TG ventricles………………………………………………… 55 3.4 Calcium uptake function in NTG and SLN TG mice…………….. 56 3.5 Rate of contraction (+dP/dt) and relaxation (-dP/dt) in response to increase in force in work performing heart preparations for SLN TG and NTG littermates……………………………………… 58 3.6 Cumulative dose-response to isoproterenol in work-performing hearts…………………………………………………………………. 60 3.7 Rate of contraction (+dF/dt) and relaxation (-dF/dt) in muscle preparations from SLN TG and NTG hearts………………………. 62 3.8 Ca2+ transients in myocytes isolated from NTG and SLN TG hearts…………………………………………………………………. 64 4.1 Targeted disruption of SLN gene…………………………………... 77

4.2 Quantification of SR Ca2+ handling proteins……………………… 78 4.3 Quantitation of PLB monomer-pentamer ratio and phosphorylation status in SLN KO mice………………………….. 79 4.4 Calcium uptake function in sln-/- atria and ventricle……………… 80 4.5 Cumulative dose response to isoproterenol in isolated work- performing hearts from SLN KO and WT mice…………………… 83 4.6 Mechanical properties of sln-/- atria……………………………… 85 4.7 Ca2+ transients in atrial and ventricular myocytes isolated from WT and sln-/- mice…………………………………………………… 88

xvi

5.1 Confocal microscopic images of rat ventricular myocytes, showing the co-localization of WT and mutant SLN with SERCA2a……………………………………………………………. 103 5.2 Expression of SERCA, PLB, CSQ and phospho PLB levels in control and Ad.WT or Ad.T5 mutant SLN- infected myocytes…. 104 5.3 T5 mutation in SLN alters cardiac myocyte calcium transient….. 106 5.4 Mutation of T5 alters myocyte contractility………………………… 107 5.5 Contractility of myocytes in response to isoproterenol………….. 108 5.6 In vitro phosphorylation of mouse and human SLN by CaMKII… 109 6.1 Proposed model depicting the role of PLB and SLN in mediating β-adrenergic response………………………………….. 119

xvii

LIST OF ABBREVIATIONS

A Alanine

Ad Adenovirus

ATP Adenosine Triphosphate

Ca2+ Calcium

CaMKII Calcium calmodulin dependent kinase II

CSQ Calsequestrin

Cys Cysteine

DHPRα2 Dihydropyridine receptor α2

E Glutamic Acid

ER Endoplasmic reticulum

ISO Isoproterenol

Ile Isoleucine

xviii

KO Knockout

Leu Leucine

Met Methionine

MHC Myosin heavy chain

NCX Sodium calcium exchanger

NTG Non transgenic

PLB Phospholamban

PKA Protein Kinase A

Pp1 Protein phosphatase 1

RyR Ryanodine receptor

SERCA Sarco(endo)plasmic reticulum calcium ATPase

Ser Serine

SLN Sarcolipin

SR Sarcoplasmic reticulum

Thr Threonine

xix

TG Transgenic

Trp Tryptophan

Val Valine

WT Wild-type

CHAPTER 1

INTRODUCTION

In eukaryotic cells, cytosolic calcium (Ca2+) represents an almost universal second messenger controlling myriads of cells functions, amongst which cardiac muscle contraction was one of the first to be recognized. Cardiac excitation– contraction coupling (EC-coupling) is the process from electrical excitation of the myocyte to contraction of the heart (which propels blood out) (16). The ubiquitous second messenger Ca2+ is essential in cardiac electrical activity and is the direct activator of the myofilaments, which cause contraction. The molecular mechanisms regulating cardiac contractility have been the subject of intense investigation for several decades. In this regard, sarcoplasmic reticulum (SR) Ca2+ transport has received a great deal of attention because of its central role in regulating cardiac function in health and disease. The cardiac SR is an intracellular membrane network that surrounds the contractile machinery. It serves not only as a Ca2+ reservoir for Ca2+ release but also actively maintains cytosolic Ca2+ concentration during contraction-relaxation.

Cardiac excitation-contraction coupling During cardiac EC-coupling, Ca2+ entry through the L-type Ca2+ channel activates Ca2+ release from the SR Ca2+ stores via the ryanodine receptor (RyR) (18) (16). This raises cytosolic Ca2+ and initiates muscle contraction, and the free cytosolic Ca2+ concentration determines the extent of muscle contraction and therefore force development (16). Subsequent removal of cytosolic Ca2+ by the sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA) pump and sarcolemmal

1 Ca2+ transporters results in muscle relaxation. The rate of muscle relaxation is largely determined by the re-uptake of Ca2+ into the SR by SERCA2a (16, 88).

The sarcoplasmic reticulum Ca2+ ATPase (SERCA) pump The SR calcium transport ATPase (SERCA) is a pump that transports calcium ions from the cytoplasm into the SR (88). The SERCA pump utilizes the energy derived from ATP hydrolysis to transport Ca2+ across the membrane, such that two Ca2+ ions are transported for each molecule of ATP hydrolyzed. SERCA2a is the predominant isoform of SERCA expressed in the heart. SERCA2a is a pivotal molecule for maintaining a balanced concentration of intracellular Ca2+ during the cardiac contraction-relaxation cycle(88) (106). SERCA2a promotes muscle relaxation by lowering the cytosolic Ca2+ concentration through active Ca2+ transport into the SR and, thereby, restores the intracellular Ca2+ needed for the next contraction cycle (16, 69, 88). The expression and regulation of SERCA2a activity have been widely investigated, emphasizing its central role in the regulation of Ca2+ homeostasis during development and under a variety of patho-physiological conditions(3, 5, 94). Studies from a variety of animal models of heart disease (43, 47) and end stage human heart failure (62, 66) suggest that defects in SR Ca2+ uptake function is one of the major contributing factors for the progression of heart failure. Several studies have demonstrated the role of SERCA2a interacting proteins in modulating pump activity and in normal and failing hearts. It is well established that in the heart SERCA2a activity is regulated by a small phosphoprotein, phospholamban (PLB). Recent studies (9, 11, 12, 14, 19, 38, 82) have suggested that another small molecular weight protein, sarcolipin (SLN) is also involved in the regulation of SR Ca2+ ATPase activity. Current data suggest that these two proteins play important roles in regulating SERCA2a activity and cardiac physiology, however much remains to be understood.

Sarcolipin is structurally similar to PLB

Structural similarities between the PLB and SLN gene as well as the homology between their protein sequences (Fig 1.1), suggest that both PLB and SLN belong to the same family of proteins (71, 84). The 52 amino acids of PLB are organized into three domains. The cytoplasmic domain IA, consisting of residues 1–20, of which the first 16 are likely in an α-helical conformation, cytoplasmic domain IB consisting of residues 21–30 and domain II with residues 31–52 is the hydrophobic transmembrane domain which is probably in an α- helical conformation (71, 87, 100). On the other hand, SLN is a 31-amino-acid SR membrane protein and shows a distribution pattern similar to SERCA2a and PLB (14, 84). Similar to PLB, the amino acids in SLN are organized into three domains; cytoplasmic domain, transmembrane and lumenal domains. The first 7 amino acids in SLN are hydrophilic and are cytoplasmic, the next 19 hydrophobic amino acids form a single transmembrane α-helix, and the last 5 hydrophilic amino acids are lumenal (74, 84).

Figure 1.1. Schematic representation of homology between the PLB and SLN protein sequence. Horizontal lines denote the membrane boundaries and amino acids are shown in circles using their one letter code.

Amino acid sequence comparison and modeling studies have shown that the transmembrane helices of SLN and PLB share considerable homology (27, 84, 106, 108) In 19 transmembrane amino acids of SLN, 8 are identical, 7 share Val, Leu, or Ile, 3 share Thr, Trp, or Cys and one is Met for Ile substitution (27, 69, 84). Amino acid conservation in the transmembrane domains of SLN and PLB suggests that both proteins interact in a similar way with SERCA (8, 10). There is substantial similarity between the N-terminal part of the transmembrane

4 domain of SLN and domain Ib of PLB (27). Domain Ib of PLB is proposed to be important for the dynamic protein–protein interaction which is regulated by the phosphorylation–dephosphorylation of Ser16 and Thr17, which modulates PLB function (27, 57, 70). Although, the N-terminal cytoplasmic domain of SLN is not conserved among different species, threonine 5 in the cytoplasmic domain of SLN is conserved, suggesting that it could serve as a potential phosphorylation site (discussed below) (Fig 1.2). SLN has a unique C-terminal lumenal domain comprised of amino acids- RSYQY which is highly conserved among different species(84). A recent study suggests that the lumenal domain could be involved in the retention of SLN in the ER. However, the same study shows that when co- expressed with SERCA, C-terminus of SLN is not needed for its retention in the ER suggesting that C-terminus may have a different function (37). The flexible nature of the C-terminus also leaves Tyr-29 and Tyr-31 residues available for interactions with various aromatic residues in the transmembrane helices of SERCA and suggests that lumenal domain could be involved in the regulation of SERCA-SLN interaction (10, 37, 69) .

Figure 1.2. Sequence comparison of SLN from different species (37, 84). The amino acids in red differ among the species. The conserved lumenal amino acids are underlined.

5 SLN and PLB are differentially expressed during development and disease states

In the heart, PLB is expressed at higher levels in the ventricles, compared to the atria (60). On the other hand, SLN levels are predominant in the atria than the ventricle (78, 106). PLB is also expressed at low levels in slow-twitch skeletal muscles(26, 100). The expression of SLN in the skeletal muscles varies among species. In smaller mammals, SLN mRNA is found at low levels in slow-twitch skeletal muscle, whereas, in larger mammals including human, SLN is expressed at higher levels in both slow- and fast-twitch skeletal muscles (84, 105, 106). Thus there are chamber-specific and species-specific differences in the expression of PLB and SLN.

The expression of both PLB and SLN is regulated during development and modulated by the hormonal and patho-physiological state of the heart. The expression of SERCA2a (5, 35, 60), PLB (35, 60) (52) and SLN mRNA (78) increases several fold during heart development, displaying co-ordinate regulation and indicates the increase in SR function during heart development.

Thyroid hormone levels have been shown to modulate SR function by altering the expression of SERCA and its regulators. In hyperthyroidism, a decrease in both inhibitors PLB (4, 28, 79) and SLN (77) relative to SERCA2a is seen. In hypothyroidic hearts, SERCA levels are decreased, whereas PLB and SLN levels are unchanged (4, 28, 77, 79). These studies suggest that regulation of SERCA2a function can contribute to the altered contractile function in hypothyroid and hyperthyroid hearts.

In most forms of human and animal models of heart failure, alterations in the expression of SERCA and PLB are shown to be major contributors for the altered calcium homeostasis. Studies showed that downregulation of PLB and SERCA proteins and decreased basal phosphorylation of PLB in end-stage heart failure correlated well with diastolic and systolic dysfunction (42-44). Similarly, 6 the expression of SLN is also altered under a variety of pathological conditions. SLN mRNA is downregulated in atrial myocardium of patients with chronic atrial fibrillation (103) and hypertrophic remodeling of atria (78). A recent study also showed that SLN mRNA was upregulated ~ 50-fold in the hypertrophied ventricles of Nkx2-5 null mice (86). The lack of an antibody specific for SLN impeded the studies of SLN protein levels in normal and failing heart thus far. In this study, for the first time we generated a SLN specific antibody to study the expression of SLN in developing muscle tissues and in cardiac patho-physiology discussed in CHAPTER 2. Whether altered expression of SLN contributes to abnormal atrial calcium homeostasis and plays a critical role in cardiac patho- physiology in human heart failure remains to be investigated.

Transgenic approaches to study the role of PLB and SLN in cardiac physiology

The mechanism of PLB action on SERCA and its relevance in cardiac muscle physiology has been studied extensively over the past several years. Studies using genetically altered mouse models have given important insight into the role of PLB in cardiac physiology. Using a PLB knockout mouse model (67), Dr. Kranias and colleagues provided the crucial evidence that PLB is an important regulator of the SERCA2a. They showed that absence of PLB enhanced SR calcium uptake and increased rates of contraction and relaxation. This was associated with an increase in SERCA2a affinity for calcium (67). On the other hand, overexpression of PLB in the heart resulted in a decrease in SR Ca2+ uptake and depressed cardiac contractile performance in vivo (56). These studies revealed that a shift in PLB: SERCA ratio leads to a corresponding shift in SERCA affinity for Ca2+, so that an increase in the PLB: SERCA ratio leads to decreased Ca2+ affinity. Thus, an alteration in the PLB: SERCA ratio can affect SR Ca2+ transport.

7 The physiological relevance of SLN in the heart was only recently identified with the help of transgenic mouse models developed by the MacLennan laboratory and our laboratory. In the first case, Asahi et al. (9) used rabbit cDNA to overexpress SLN in the mouse, by targeting a single copy of the α-MHC-driven SLN construct into the Hprt locus of the X-chromosome. This resulted in heterogeneous expression of SLN in female mice due to X- chromosome inactivation. Therefore, only males were used in this study. Overexpression of SLN reduced the apparent Ca2+ affinity of the SERCA2a. In vivo measurements of cardiac function showed a significant decrease in + dP/dt and − dP/dt and led to ventricular hypertrophy. The inhibitory effect of SLN was reversed by treatment with the β-adrenergic agonist, isoproterenol, which restored contractile function. They also reported that basal phosphorylation of PLB was decreased in the SLN transgenic hearts and in the presence of isoproterenol, PLB phosphorylation was restored to the level seen in wild-type controls. This was interpreted as an enhanced PLB phosphorylation, resulting in the dissociation of SLN from PLB and leading to the restoration of contractile function in the SLN transgenic hearts during β-adrenergic stimulation. By co- immunoprecipitation analysis using microsomes prepared from transgenic hearts, it was observed that SLN was bound to both SERCA2a and PLB, forming a ternary complex. These data suggested that SLN mediates its inhibitory effect on SERCA2a through stabilization of the SERCA2a-PLB complex and through the inhibition of PLB phosphorylation. In this study (described in detail in CHAPTER 3) our laboratory used the cardiac specific α-MHC promoter to overexpress mouse SLN in the atria and ventricles(12). To study the role of SLN, the SLN: SERCA2a ratio was increased in the ventricle, where the level of SLN is naturally low. SLN overexpression in the ventricle leads to decreased SERCA2a affinity for calcium, Ca2+ transient amplitude and shortening, and slowed relaxation. Consistent with Asahi et al.(9) + dP/dt and − dP/dt were significantly decreased, due to SLN overexpression. Similar results were found in myocytes and muscle preparations from mice

8 overexpressing SLN, in comparison to the wild-type littermates. The inhibitory effect of SLN on SERCA2a was reversed upon β-adrenergic stimulation, suggesting that SLN is a reversible inhibitor of SERCA2a, similar to the role of PLB. In this study, we observed that an increase in SLN level does not affect PLB levels, PLB monomer to pentamer ratio and its phosphorylation status, and we concluded that the effect of SLN on SERCA2a is direct and is not mediated by a change in PLB monomer levels or its phosphorylation status. This was further confirmed by Gramolini et al. (38) by expressing SLN in the PLB-null (−/−) background. This was achieved by mating the SLN transgenic mice, with cardiac- specific overexpression of SLN, with the PLB KO mice. Overexpression of SLN in the absence of PLB led to a decrease in the affinity of SERCA2a for Ca2+, impaired contractility, reduced calcium transient amplitude and slower decay kinetics, compared to PLB (−/−) animals. Further, in the SLN/PLB (−/−), mice isoproterenol restored the calcium dynamics to the levels seen in PLB (−/−) mice, suggesting that SLN could mediate the β-adrenergic response. The ventricular myocytes from PLB (−/−) mice did not show an increase in calcium handling in response to isoproterenol (ISO) which is consistent with the lack of PLB and its phosphorylation effects, whereas ventricular myocytes from SLN/PLB (−/−) showed an increased calcium transient amplitude as well as increased calcium decay kinetics, which suggests that SLN could be a mediator of β-adrenergic response and this response is independent of PLB.

Sarcolipin is predominantly expressed in the atria. In this study, we also investigated the physiological significance of sarcolipin in the atria by generating a mouse model deficient for sarcolipin. The sarcolipin null mice do not show any developmental abnormalities or any cardiac pathology. The absence of sarcolipin does not modify the expression level of other Ca2+ handling proteins, in particular phospholamban, and its phosphorylation status. Calcium uptake studies revealed that in the atria, ablation of sarcolipin resulted in an increase in the affinity of the SERCA pump for Ca2+, and the maximum velocity of Ca2+ uptake rates. An

9 important finding is that ablation of sarcolipin resulted in an increase in atrial Ca2+ transient amplitudes and this resulted in enhanced atrial contractility. Furthermore, atria from sarcolipin null mice showed a blunted response to isoproterenol stimulation, implicating SLN as a mediator of β-adrenergic responses in the atria. Our study documented for the first time that sarcolipin is a key regulator of SERCA2a in atria. Importantly, our data demonstrate the existence of distinct modulator of SERCA pump in the atria and ventricle (Detailed description in CHAPTER 4). Based on the studies using genetically engineered mouse models it could be interpreted that an increase in the apparent ratio of either PLB or SLN, with respect to SERCA2a, may lead to depressed Ca2+ transport kinetics and contractile parameters in the mammalian heart.

SLN functionally differs from PLB

The available data suggest that SLN and PLB independently regulate SERCA2a activity (9, 12, 14, 38, 69). Both PLB and SLN inhibit SERCA activity in the heart by lowering the apparent calcium affinity of the pump(9, 12, 56). The inhibitory effect of SLN is relieved upon β-adrenergic stimulation, as observed for PLB (9, 12, 38, 71). Although, PLB and SLN inhibit SERCA2a activity, there might be subtle but important differences in their mechanism of regulation (Fig 1.4). For example, as illustrated in Fig 1.3 and Fig 1.4, the inhibitory effect of PLB on SERCA2a is relieved at high calcium concentrations (7, 56) whereas the inhibitory effect of SLN on SERCA2a is observed even at high calcium (9, 12). These functional differences could be attributed to the structural differences in the lumenal domains (C-terminus) of the two proteins. Although PLB and SLN are similar in their transmembrane domain, SLN has a longer C-terminal lumenal domain (84). The lumenal amino acids – RSYQY – in SLN are highly conserved

between species and suggested to be interacting with various aromatic residues in the transmembrane helices of SERCA (10, 37, 69, 84). Thus, the C-terminus of SLN could be involved in the Ca2+-independent inhibition of SERCA2a and could contribute for the inhibitory function of SLN at high calcium concentrations.

Figure 1.3. Illustration showing differences in the functional effect of 2+ PLB and SLN on SR Ca uptake: - Inhibitory effect of PLB overexpression (PLB O.E) on SERCA calcium uptake is relieved at high calcium concentrations [42] where as SLN overexpression (SLN O.E) is inhibitory even at high calcium compared to wild type (WT) [46, 47] indicating subtle differences in the mechanism of action of the two regulators.

Figure 1.4- A hypothetical model showing how PLB and SLN differ in their functional interaction with SERCA pump. The dephosphorylated phospholamban (PLB) binds to SERCA pump and regulates its activity (Top, middle panel). This interaction is disrupted by either phosphorylation of PLB (Top, left panel) or in the presence of high calcium concentration (Top, right panel). Sarcolipin (SLN) interacts with SERCA in its unphosphorylated form (Bottom, middle). This interaction is mainly affected by phosphorylation (Bottom, left panel) and is less affected by Ca2+ concentration (Bottom, right panel).

It is well documented that PLB interacts with and inhibits SERCA2a activity in a reversible manner (97, 99, 106).The inhibitory function of PLB is modulated by phosphorylation–dephosphorylation and by an increase in intracellular Ca2+ concentration as depicted in Fig 1.4 (7, 16, 30). Phospholamban can be phosphorylated at two distinct sites—serine 16 by

12 cAMP-dependent protein kinase (PKA), and threonine 17 by Ca2+-calmodulin- dependent protein kinase (CaMKII) during β-adrenergic stimulation (30, 33, 96). Phosphorylation disrupts the physical interaction of PLB with SERCA2a and thus stimulates SR Ca2+ transport by increasing the affinity of the SERCA2a for Ca2+, without a significant change in Vmax (29, 34, 83, 97). This, in turn, leads to an increase in the velocity of relaxation, SR Ca2+ load and, as a consequence, increased SR Ca2+ release and myocardial contractility (31, 80, 97) whereas dephosphorylation of PLB by type 1 phosphatase (pp1) leads to the inhibition of the SERCA (68).

Unlike PLB, the exact mechanism of SLN action on SERCA2a is not well understood. Data suggest that SLN can regulate SERCA2a activity by one of the following mechanisms: (1) the inhibitory function of SLN is mediated through PLB or (2) through the direct interaction of SLN with SERCA2a. The first evidence of the inhibitory function of SLN came from studies performed in HEK293 cells, where co-expression of SLN with either SERCA1a or SERCA2a resulted in a decreased pump affinity for Ca2+ (10, 69). These studies further suggested that when SLN is co-expressed with PLB, the inhibitory effect is enhanced. This super inhibitory effect on SERCA function is attributed to direct interaction of SLN with PLB leading to the destabilization of PLB pentamers. Accordingly, SLN forms a complex with PLB and thereby prevents polymerization of PLB to form pentamers. This leads to the formation of more monomers, the inhibitory form of PLB and super-inhibition of SERCA2a (6, 106, 112). However, results from circular dichroism using chemically synthesized SLN and PLB, suggest that SLN in a hydrophobic environment is a highly stable protein, similar to the transmembrane region of PLB. These studies also suggest that, unlike PLB, SLN has only a weak ability to form oligomers and does not form heterodimers with PLB (46, 106). Therefore, it is unlikely that the inhibitory function of SLN on the SERCA2a is through polymerization. Further, this mechanism is feasible only when SLN and PLB are co-expressed. However, SLN is expressed at high levels in tissues which express either low amount of PLB (as in atria and slow-twitch 13 skeletal muscle) or no PLB (as in fast-twitch skeletal muscles). These observations suggest a possible independent role for SLN, where SLN directly binds to SERCA2a and alters its affinity for Ca2+. Co-immunoprecipitation studies have shown that SLN can interact with SERCA2a. SLN can bind SERCA either alone or in association with PLB (10). Biochemical data and structural modeling using NMR suggest that both SLN and PLB bind SERCA in the same molecular groove and with similar mechanisms (27, 69). Mutagenesis studies by MacLennan and co-workers revealed that both SLN and PLB occupy the same interaction site in SERCA (8, 10, 69). Results from a mouse model overexpressing SLN in PLB-null background, further suggest that SLN is an effective inhibitor of SERCA2a and supports the hypothesis that SLN can regulate cardiac SERCA2a independent of PLB (38).

β -adrenergic response in the atria could be mediated by SLN

Phospholamban is a major regulator of the β-adrenergic stimulatory effects in the heart(65, 97, 107). An interesting observation in this regard is that some contractile response to β-adrenergic stimulation persists in animal models and cardiac myocytes totally devoid of PLB (53, 55). In particular, there is compelling data suggesting that the β -adrenergic response in the atria may depend on proteins other than PLB. Atrial SR has been shown to exhibit a four- fold lower level of PLB and a two-fold higher level of SERCA2a compared to ventricular SR. However, a recent report by Kaasik et al (53) suggests that the decreased PLB levels in rat atria are not associated with a smaller response of SR Ca2+ uptake to β-adrenergic stimulation. On the contrary, Ca2+ uptake in the isoproterenol treated atria shows a much larger increase. In addition, rat atria respond to isoproterenol with much larger increases in developed tension, contractility and relaxation rates than ventricular muscle. Thus, the observed increase in both Ca2+ uptake and contractile function could not be explained by decreased PLB levels and phosphorylation status. This suggests that the β- adrenergic response in the atria could be mediated by proteins other than PLB. 14 SLN could be one such candidate. Results from the transgenic mouse model which overexpress SLN in PLB-null background showed that the inhibitory effect of SLN can be relieved upon β-adrenergic activation and suggested that SLN can act as a mediator of β-adrenergic response in the atria(38). These studies further identified Threonine -5 as a potential phosphorylation site and showed that a serine threonine protein kinase 16 (STK16) could phosphorylate SLN (38). The physiological relevance of STK16 and its role during β-adrenergic stimulation is yet to be investigated. In this study we further investigated the physiological relevance of threonine 5 phosphorylation in sarcolipin function (CHAPTER 5).

Key questions addressed in this study

Sarcolipin was discovered nearly 20 years ago; however the role of SLN has only been investigated in the past few years. A number of recent in vitro studies have suggested that SLN could act as an inhibitor of SR Ca2+ ATPase (6, 8, 10, 69, 82). We have previously studied the role of SLN as a regulator of cardiac SERCA2a using adenoviral gene transfer into adult rat ventricular myocytes(14). These studies found that transient overexpression of SLN in the adult rat ventricular myocytes decrease both the Ca2+ transient amplitude and myocyte contractility. Available data point out that SLN is predominantly expressed in the atria and is a critical regulator of atrial physiology (14, 77, 78, 103). However, the precise physiological role of SLN in the mammalian heart is not completely understood. It is even perplexing to find that SLN levels are high in the atria where PLB levels are low. Does it mean that SLN acts as a substitute for PLB or plays a unique role in the atrial muscle of the heart? Considering that atrium has two fold higher SERCA levels and relaxes faster, the regulation of SERCA pump by SLN could facilitate a faster rate of relaxation. This interpretation is also supported by the finding that SLN is expressed in faster contracting skeletal muscles. In addition, recent studies reported that SLN mRNA

15 levels are elevated during cardiac and skeletal muscle patho-physiology, however the functional relevance is yet to be understood. A major goal of this study was to better define the role of SLN in the atrial muscle and its role in overall cardiac function. To address the functional significance of SLN in heart we made use of the following transgenic (TG) mouse models 1) targeted overexpression of SLN in the heart and 2) SLN null (KO) mouse. Despite our knowledge of the functional effects of SLN on SERCA activity, fundamental questions remain with regard to mechanisms by which SLN exerts its inhibitory action. In the last part of this study we dissect the mechanism of SLN action on SERCA2a using site directed mutagenesis and adenoviral gene transfer into adult rat ventricular myocytes. Taken together, this study was designed to critically examine the role of SLN in the beat-to-beat function of the myocardium and to explore how its level of expression might have an effect on cardiac patho- physiology

CHAPTER 2

LOCALIZATION OF SARCOLIPIN IN CARDIAC MYOCYTE AND ITS

DIFFERENTIAL EXPRESSION DURING MUSCLE DEVELOPMENT AND

CARDIAC PATHO-PHYSIOLOGY

2.1. ABSTRACT

Sarcolipin is a small molecular weight sarcoplasmic reticulum (SR) membrane protein expressed both in cardiac and skeletal muscle tissues.

Sarcolipin has been shown to be an important regulator of SERCA activity using both in vitro systems and genetically altered mouse models. However, there is a paucity of information regarding SLN protein expression and its regulation during development and cardiac patho-physiology. In this study, we used a highly specific SLN antibody to perform detailed analyses of SLN protein expression during muscle development and in the diseased myocardium. We have for the first time shown that SLN co-localizes with both SERCA2a and PLB in the cardiac SR membrane. Our findings also indicate that in small mammals, SLN expression is predominant in the atria but low in the ventricle and in skeletal

17 muscle tissues, whereas in large mammals, SLN is abundant in skeletal muscle

tissues than the atria. SLN and SERCA2a are co-expressed in all striated muscle

tissues studied except ventricle and co-ordinately regulated during muscle

development. We have shown that SLN expression is altered during patho-

physiology- SLN protein levels are 3 fold upregulated in the atria of heart failure dogs and 30% decreased in the atria of hearts prone to post myocardial

ischemic ventricular tachyarrhythmia. In addition, we found that in the

phospholamban null atria, SLN protein levels are upregulated, and PLB levels are downregulated in atria of mice with transgenic overexpression of SLN.

2.2. INTRODUCTION

Sarcolipin (SLN) is a small molecular weight protein (31 amino acids) originally identified to co-purify with the skeletal muscle sarcoplasmic reticulum

Ca2+ ATPase (SERCA1a) (84, 108). Subsequent studies at the mRNA level

showed that SLN is expressed both in cardiac and skeletal muscle tissues of all

mammals (14, 36, 78, 84). Within the cardiac muscle, SLN mRNA expression is

more abundant in the atria compared to the ventricle (14, 78). The expression

pattern of SLN mRNA varies between small and larger mammals. In rodents,

SLN mRNA is abundant in the atria and expressed at low levels in the ventricle

and slow skeletal muscles (14, 78). In contrast, in larger mammals including

humans, SLN mRNA is more abundant in fast-twitch skeletal muscle tissues

compared to the heart (84).

18 Further, SLN mRNA levels is shown to be developmentally regulated (14,

78) and is altered by thyroid hormones (77, 101) and during patho-physiological

conditions(36) (78, 86, 95, 103). Pressure-overload hypertrophy induced by

transverse aortic constriction in mice or by monocrotaline administration in rats

significantly decreased the expression of SLN, SERCA2a and phospholamban mRNAs in the atrium (95). In humans, SLN mRNA has been reported to be down-regulated in the atria of patients with chronic atrial fibrillation (103)

Although SLN expression is low in the ventricle, it was shown to be ~50 fold upregulated in the hypertrophied ventricles of Nkx2–5 null mice (86). However, most of these studies were carried out at the mRNA level and to date there is no available protein data. In the present study, we made use of a highly specific

SLN antibody and studied SLN expression during muscle development and in cardiac pathology.

2. 3. MATERIALS AND METHODS

All experiments were performed in accordance with the National Institute of Health guidelines and approved by the Institutional Laboratory Animal Care and Use Committee at The Ohio State University. Sprague–Dawley rats, B6 mice, SLN transgenic mice (12) and PLB knockout mice (67) were used for this study. Developmental studies were done in timed pregnant Sprague–Dawley rats purchased from Harlan/Taconic farms. Pacing induced heart failure canine model

(81) was described previously. The myocardial infarction model susceptible or resistant to ventricular fibrillation was generated as described previously (21, 40)

19 and. In brief, the anterior myocardial infarction was produced by ligation of the left anterior descending artery approximately one-third of the distance from its origin. A hydraulic occluder was also placed around the left circumflex coronary artery so that ischemia can be induced at a site distant to the previous injury.

After a post MI recovery phase, susceptibility to ventricular fibrillation was tested by a two minute coronary occlusion during the last minute of a submaximal exercise test. The susceptible dogs had either ventricular fibrillation or ventricular tachycardia during this exercise plus ischemia test while the resistant dogs do not have arrhythmias. In this particular study, the animals were assigned to either a 10 week sedentary period or a 10 week exercise training (running on a treadmill) groups after the classification.

2.3.1. Isolation of rat ventricular myocytes

Cardiac myocytes were isolated from adult Sprague Dawley rats as described previously. The isolated cells were washed three times using phosphate buffered saline and plated in medium 199 (Gibco-BRL) supplemented with (in mmol/L) 5 creatine, 2 L-carnitine, 5 taurine and 0.2% BSA at a field density of 10,000 cells/cm2 on 35-mm culture dishes precoated with laminin

(Sigma). After 1 h, the media was changed to remove the nonadherent cells and then infected with control Ad.GFP (adenovirus without transgene) or recombinant adenovirus containing NF-SLN at a multiplicity of infection (MOI) of 50 for 48 h in serum-free DMEM.

2.3.2. Generation of NF-SLN adenovirus

The adenoviral construct containing either N-terminal FLAG tagged (NF)-

SLN or SLN was generated using the method described by He et al. (45). Rat

sarcolipin cDNA was cloned in frame to FLAG tag and subcloned into the shuttle

vector, pShuttle-CMV (Stratagene). Recombinant adenoviruses (Ad) containing

NF-SLN or SLN were harvested 7–10 days later. The viral titers were determined

by plaque assay with the final yield at 1010 to 1011 pfu/ml. Adenovirus without

transgene was used as a control.

2.3.3. Immunostaining of isolated cardiac myocytes

Isolated adult rat ventricular myocytes were infected with control or Ad.NF-

SLN (multiplicity of infection 50) and processed for immunostaining and confocal imaging as described earlier (39). Cells were incubated in primary antibody

(rabbit polyclonal SERCA2a (49), mouse monoclonal FLAG antibody [Sigma]or

α-actinin antibodies (39)) in phosphate buffered saline (PBS) containing 2% normal goat serum and 1% Triton X-100 for 1.5 h. The glass coverslips were washed three times with PBS containing 1% Triton X-100. Cells were incubated with Texas Red-conjugated goat anti-rabbit and FITC-conjugated goat anti- mouse (Molecular Probes) secondary antibodies for 1 h followed by washing three times with PBS containing 1% Triton X-100. After immunostaining, cells

21 were visualized by excitation at 488 nm for FITC and 543 nm for Texas Red

using a Zeiss Laser Scanning Microscope (LSM510).

Indirect immunoflouresence for NF-SLN and PLB was done as previously

described (92). Briefly, myocytes on coverslips were fixed in 4%

paraformaldehyde, washed with PBS, and treated with 50 mM ammonium

chloride to remove the excess formaldehyde. Cells were blocked with 20%

normal goat serum in 0.5% Triton X-100, and treated with anti-mouse PLB

monoclonal antibody (Upstate) for 1.5 h. Cells were washed with PBS containing

0.5% Triton X-100 and blocked with 2% normal goat serum in 0.5% Triton X-100, and treated with secondary antibody conjugated to FITC (Molecular Probes) for 1 h. After washing, cells were incubated with 1:20 dilution of goat anti-mouse IgG antibody (Sigma) overnight at 4°C. Coverslips were then washed as above and incubated with a 1:20 dilution of goat anti-mouse Fab fragments (Jackson

ImmunoResearch Laboratories) for 1.5 h. After blocking with 20% normal goat serum in 0.5% Triton X-100, cells were treated with anti-FLAG antibody (Sigma).

Coverslips were washed, blocked, and incubated with a secondary antibody conjugated to Texas Red (Molecular Probes) as described above.

2.3.4. Co-immunoprecipitation

After 48-h infection with Ad.NF-SLN, myocytes were suspended in a buffer containing (in mmol/L) 25 Tris, pH 7.4, 150 NaCl, 1 CaCl2 and 1% Triton X-100

by gently pipetting and allowed to lyse on ice for 30 min. The cell lysate was

22 centrifuged at 12,000×g for 20 min at 4 °C and the supernatant was stored at −80

°C. Immunoprecipitation was carried out using Sigma FLAG Tagged protein immunoprecipitation kit (cat. #FLAGIPT-1). Briefly, about 1 mg of total protein isolated from Ad.NF-SLN myocytes was incubated on the Anti-FLAG M2 Affinity gel and washed extensively with Tris-buffered saline. The bound proteins were eluted with 0.1 M glycine pH 3.5 and analyzed by Western blot.

2.3.5. Protein preparations

The following muscles were sampled in (i) rodents—atria, ventricle,

soleus, quadriceps, diaphragm and tongue, (ii) rabbit—left and right atria, left and

right ventricle, diaphragm, extensor digitorum longus (EDL) and soleus and (iii)

dog—left and right atria, left and right ventricle, diaphragm, gastrocnemius

muscle (a synergist of the soleus muscle in other species) and EDL. For

developmental studies, atria, ventricle, tongue and quadriceps from rat embryos

of different days of post coitum (dpc) and neonatal rats were used. Frozen

tissues were homogenized in 8 volumes of homogenizing buffer containing (in

mM) 50, Tris–Cl, pH 7.5, 150 NaCl, 1 Na2P2O7, 1 benzamidine, 5 Na3VO4, 10

NaF and 0.5% Nonidet P-40 (12). To express rat and human SLN in the bacteria,

the coding sequence of rat or human SLN was cloned into the bacterial

expression vector pET 23d (Novagen Inc). Cell growth, protein induction and protein extraction were followed precisely as described by the manufacturer's instructions. Protein concentrations were determined by the Bradford method

23 using bovine serum albumin for the standard curve. The SR enriched microsomal

fractions for rat atria and ventricles were prepared as described earlier (13).

2.3.6. Western blot analysis

Protein samples were analyzed by sodium dodecyl sulfate–polyacrylamide

gel electrophoresis (SDS–PAGE) and loading was normalized for Western blot

analysis. The homogenates were electrophoretically separated on (8% for

SERCA2a, SERCA1a and CSQ, 14% for PLB) SDS–PAGE or 16% Tricine gel

(for SLN) and transferred to nitrocellulose membrane. Membranes were

immunoprobed with primary antibodies [anti-rabbit SLN, 1:3000 (present study);

anti-rabbit SERCA2a, 1:5000; anti-rabbit PLB, 1:3000; anti-rabbit calsequestrin

(CSQ), 1:5000 (12); anti-rabbit SERCA1a, 1:2000 (Custom made)] followed by

HRP-conjugated secondary antibodies. Signals were detected by Super Signal

WestDura substrate (Pierce) and quantitated by densitometry (12).

2.3.7. Statistics

Data shown are mean ± SEM. Statistical significance was estimated by an unpaired Student's t test. A value of p < 0.05 was considered statistically

significant.

2.4. RESULTS

2.4.1. SLN and SERCA2a are co-localized in the cardiac SR membrane

To determine whether NF-SLN targets appropriately to the cardiac SR in transfected myocytes, we performed immunostaining and confocal microscopy using FLAG antibody. (The SLN antibody generated in our lab does not work for immunostaining or co-immunoprecipitation.) Control myocytes showed no staining with FLAG antibody (Data not shown), whereas Ad.NF-SLN-infected myocytes showed a distinctive horizontal and vertical pattern (Fig 2.1, Panel A, green and Panel E, red), which was indistinguishable from that seen with

SERCA2a (Panel B, red) and PLB (Panel D, green) antibody staining. Our data thus demonstrate that SLN is localized within SR membrane and its distribution pattern is similar to SERCA2a and PLB (Fig 2.1, yellow color in Panel C and

Panel F) indicating that it may be co-localized with SERCA and PLB.

ABC

DEF

Figure 2.1. Confocal microscopic images of rat ventricular myocytes, showing the co-localization of SLN, SERCA2a and PLB. Ventricular myocytes were infected with Ad.SLN and stained with FLAG antibody (A and E) and SERCA2a antibody (B) or PLB antibody (D). Panel C—overlay of images A and B; panel F— overlay of images D and E.

2.4.2. SLN interacts with SERCA2a and PLB

To test the hypothesis that SLN interacts with PLB and SERCA, we performed co-immunoprecipitation analysis using FLAG antibody. Results shown in Fig 2.2 demonstrate that FLAG antibody against NF-SLN co-

26 immunoprecipitates both SERCA2a (Fig 2.2A) and PLB (Fig 2.2 B). These results are consistent with the previous reports showing that PLB and NF-SLN form a binary complex and inhibit SERCA function (10, 69).

1 2 3 4

SERCA2a

A B

Figure 2.2. SLN co-immunoprecipitates SERCA 2a and PLB. (A)

Microsomes isolated from SLN-TG ventricle with cardiac specific overexpression of NF-SLN was immunoprecipitated with FLAG antibody and analyzed by Western blot analysis using SERCA2a antibody. Lane 1—total

protein from ventricle as positive control; lane 2 and 3 —final wash before elution; lane 4- FLAG antibody immunoprecipitates SERCA2a. (B) Total protein isolated from Ad.SLN-infected myocytes was immunoprecipitated with FLAG antibody and analyzed by Western blot analysis using PLB antibody. Lane 1—total protein from ventricular myocytes; lane 2—final wash before elution; lanes 3 and 4—FLAG antibody immunoprecipitates. PLB —PLB P pentamer and PLBM—PLB monomer.

2.4.3. The expression pattern of SLN differs between small and larger mammals

To determine whether SLN protein expression follows its mRNA pattern

(14, 36, 78, 84), total protein prepared from various muscle tissues of mouse, rat, rabbit and dog was analyzed by Western blot analysis. Our results in Fig 2.3A indicate that: (1) SLN protein is abundant in the atria regardless of species and

(2) mouse and rat atria have higher levels of SLN protein when compared to atria

27 from larger mammals. In rodents, SLN protein is also expressed at high levels in

the tongue and at moderate levels in slow-twitch soleus muscle and diaphragm

(Fig 2.3A and Table 2.1). In contrast, the expression of PLB was most abundant

in ventricle compared to the atria. On the other hand, SERCA2a protein

expression was significantly higher in the rodent atria ( 1.3 fold) compared to

the ventricle (Fig 2.3A). In rodents, SERCA2a is also expressed at moderate

levels in soleus and at low levels in diaphragm and tongue. Interestingly, the

expression of SLN, SERCA2a and PLB proteins could not be detected in the fast-twitch quadriceps muscles (Fig 2.3A). SLN protein was also not detected in smooth and non-muscle tissues

The expression pattern of SERCA, PLB and SLN was quite different between the skeletal muscle types in larger mammals (rabbit and dog). SLN protein levels were abundant both in slow- and fast-twitch skeletal muscles and diaphragm compared to that of atria (Fig 2.3B and Table 2.1). Slow-twitch muscles (soleus and gastrocnemius) and diaphragm expressed high levels of

SERCA2a and very low levels of PLB. Unlike rodents, the fast-twitch muscle

(EDL) expressed high levels of SERCA2a (Fig 2.3 B), whereas PLB was not detectable.

MOUSE A RAT

2 μg220 μg μg 2 μg 20 μg

LA A T RA V V Q D D S S Q

SLN

SERCA2a

PLB

B RABBIT DOG

SLN 20 μg2 μg 20 μg2 μg E RV D D E RV S LV LV RA RA LA LA G 2 μg 2 μg

SERCA2a

PLB

Figure 2.3. Expression of SLN, PLB and SERCA2a protein levels in striated muscle tissues of rodents (panel A—mouse and rat) and larger mammals (panel B—rabbit and dog). Total homogenates from atria (A), ventricle (V), diaphragm (D), soleus (S), quadriceps (Q), gastrocnemius (G) tongue (T) and EDL (E) from different species were resolved on polyacrylamide gel electrophoresis and probed with SLN, PLB and SERCA2a specific antibodies. LA—left atria, RA—right atria, LV—left ventricle and RV—right ventricle. Data are representative of two independent experiments.

29 2.4.4. Expression of SLN is developmentally regulated in the rat atria and skeletal muscle tissues

We next determined whether SLN expression is developmentally regulated. Fig 2.4 shows the temporal pattern of SLN expression in the rat atria, ventricle, quadriceps and tongue during embryonic and neonatal development.

As shown in Fig 2.4A, the SLN protein was detected in the atria at 17.5 dpc and its level increases throughout development, whereas in the ventricle it was below detectable levels. In contrast, the expression of PLB and SERCA2a proteins was detectable both in the atria and ventricle at 17.5 dpc and their expression remained high throughout the course of development. At all the developmental stages analyzed PLB levels were higher in the ventricle compared to the atrium.

We also examined SLN expression in rat tongue muscle. At 17.5 dpc, SLN and SERCA2a were expressed at high levels in the tongue and remain high throughout embryonic development (Fig 2.4B). After birth, SERCA2a protein level declined gradually but continued to be expressed at a modest level in the adult. In contrast, SERCA1 expression which was detectable at 17.5 dpc increased after birth and became the predominant SERCA isoform in the adult tongue. PLB expression was undetectable at all developmental stages studied.

In the fast twitch skeletal muscle, SLN protein level was detectable at 15 dpc in the quadriceps muscles and its level increased gradually during embryonic development along with SERCA2a. However, after birth SLN expression started

30 to decline and completely disappeared by 21 days (Fig 2.4B). The pattern of

SERCA2a expression was also identical to that of SLN. These data indicate that, in rodents, the expression of SLN and SERCA2a is co-ordinately regulated during fast-twitch skeletal muscle development. In contrast, SERCA1a that is expressed at low levels in quadriceps during embryonic development increased after birth and became the major SERCA isoform in the adult (Fig 2.4B).

Atria A Ventricle

1 d 5 d 1 d 3 d 5 d 21 d 17.5 dpc 3 d 10 d 21 d 10 d 12.5 dpc 12.5 21 dpc 21 dpc 15 dpc 17.5 dpc SLN

SERCA2a

PLB

Tongue B Quadriceps

17.5 dpc 17.5 dpc 1 d 12.5 dpc 15 dpc 5 d 15 dpc 5 d 3 d 21 d 21 d 10 d 21 3 d 1 d 21 dpc 10 d 21 dpc

SLN SERCA2a

PLB

Figure 2.4. Expression analysis of SLN, SERCA2a, PLB and SERCA1a proteins during muscle development. Total homogenates of atria, ventricular (upper panel A), fast-twitch quadriceps muscle and tongue (lower panel B) from rat embryos of different days of postcoitum (dpc) and from neonatal rats was separated on polyacrylamide gel electrophoresis and immunoprobed with specific antibodies. Data are representative of two independent experiments.

2.4.5. SLN expression is altered during cardiac patho-physiology

To determine whether SLN protein level is altered during cardiac patho- physiology, we analyzed SLN protein expression in the atrial tissues of (i) a canine model of heart failure induced by tachypacing (81) and (ii) ischemic injured dogs either susceptible or resistant to ventricular fibrillation (21). Results shown in Fig 2.5A indicate that SLN protein levels were significantly increased

( 3 fold higher) in the atria of HF dogs. Whereas, SLN protein was significantly down-regulated in the atria of ischemic injured dogs either susceptible

(73.25 ± 3.7%) or resistant (71.75 ± 8.1%) to ventricular fibrillation (Fig 2.5B).

Interestingly, exercise training which is suggested to improve cardiac function in ischemic injury model (22-24) restored SLN levels to that seen in control atria

(Fig 2.5B). The expression of SERCA2a, PLB and calsequestrin (CSQ) was not significantly altered in both the dog models (Fig 2.5).

A Ctr HF Ctr HF Ctr S R S/ExT B 10 20 10 20 10 20 10 20 μg 10 20 10 20 10 20 10 20 μg SLN SLN SERCA2a SERCA2a PLB

PLB CSQ

3 * 150

125 ** 2 100 * * 1 75 50 Fold induction of SLN of induction Fold 0 25

Ctr HF Percent SLNexpression 0 Ctr S R S/ExT

Fig. 2.5. SLN levels are altered in the atria of heart failure and ischemic injured dog models. (A) Representative Western blots showing the expression of SLN, SERCA2a and PLB in the atria of tachypacing induced heart failure dog model. SLN is upregulated in the heart failure (HF) atria. SERCA2a and PLB levels are unchanged between control (Ctr) and HF groups. Bar diagram showing the fold induction of SLN in HF atria. (B) Representative Western blots showing the protein levels of SLN, SERCA2a, PLB and CSQ in ischemic injured but either susceptible (S) or resistant (R) to ventricular fibrillation and exercise trained susceptible dogs (S/ExT). SLN expression is significantly downregulated in the atria of susceptible (S) and resistant groups but its level restored in the S/ExT groups to the levels of control atria (Ctr). SERCA2a, PLB and CSQ levels are unchanged between the groups. Bar diagram showing the percent expression of SLN in different groups. * Indicates values significantly different from control groups and ** indicates values not significantly different from control groups.

2.4.6. SLN is upregulated in the plb−/− atria

To determine if loss of PLB alters the expression of SLN, we analyzed

SLN protein levels in the plb−/− atria and ventricle. Results in Fig 2.6 indicate

that SLN levels were significantly increased in the plb−/− atria compared to that of wildtype controls (WT = 100% vs. plb−/− = 152.4 ± 10.8). The SLN levels were not detectable in WT as well as in plb−/− ventricles with total protein loading

(data not shown). These results suggest that, in the atria, loss of PLB could be compensated by SLN.

WT plb-/- WT plb-/- 175 * 1 2 1 2 1 2 1 2 μg 150 SLN 125 100 75 PLB 50 25 SERCA2a Percent SLN expression Percent 0 WT plb-/-

Figure 2.6. SLN protein levels are upregulated in plb−/− atria. Representative Western blotting showing the expression of SLN and SERCA2a in the atria of plb−/− mice. SLN protein levels are 52% more in the plb−/− atria. SERCA2a levels are unchanged between WT and plb−/− atria. Bar diagram showing the percent expression of SLN in WT and plb−/− atria. * Indicates values significantly different from WT atria.

2.4.7. PLB is downregulated in SLN TG atria.

SLN compensates for loss of PLB in the atria. We therefore, wanted to

test if PLB levels are affected by overexpression of SLN in the atria. Results

shown in Fig 2.7 indicate that PLB levels were significantly decreased in atria of mice with transgenic overexpression of SLN (TG) compared to non-transgenic

(NTG) littermates. (NTG = 100% vs. SLN TG= 69.00 ± 6.570). There was no change in SERCA2a and CSQ levels. This suggests that there is regulation of stoichiometric ratios of SLN and PLB with respect to SERCA2a in the atria.

NTG TG NTG TG 120 100 4 8 4 8 4 8 4 8 μg 80 * PLB 60

SERCA2a 40 expression Percent PLB Percent CSQ 20 0 NTG TG

Figure 2.7. PLB levels are downregulated in SLN TG atria. Representative Western blotting showing the expression of PLB, SERCA2a and CSQ in the atria of mice with overexpression of SLN (TG) compared to wild-type littermates (NTG). The expression of PLB protein is 31% lower in the TG atria. SERCA2a and CSQ levels are unchanged. Bar diagram showing the percent expression of PLB in NTG and SLN TG atria. * Indicates values significantly different from the NTG atria.

2.5. DISCUSSION

In the present study we used a highly specific SLN antibody generated in our lab to study the expression pattern of SLN during muscle development and cardiac patho-physiology. Since the SLN antibody does not recognize SLN in immunostaining, we made use of adenoviral overexpression of SLN in rat ventricular myocytes to study localization of SLN using FLAG antibody. We present evidence that SLN is localized in the cardiac SR membrane and shows a distribution pattern similar to SERCA2a and PLB. Further, we show that SLN can physically interact with both SERCA2a and phospholamban. These data provide important evidence that SLN may play a critical role in regulating the cardiac SR calcium transport function possibly by interacting directly with SERCA2a.

Our protein data clearly demonstrate that SLN exhibits both tissue and species-specific differences in its expression pattern. Within the heart, SLN protein expression is abundant in atria and confirmed the previous reports on the

SLN mRNA expression pattern (14, 78). A critical question that remains to be answered is how SLN compares to PLB, whether they play complementary or distinct functional roles. The data showing the up-regulation of SLN in the PLB null atria suggest that loss of PLB function may be compensated by SLN. The protein structure (69, 71) and expression analyses [present study] of SLN and

PLB indicate that both are closely related proteins and the differential expression

36 of these protein may play unique roles in the chamber specific regulation of Ca2+ transport function.

SLN expression shows species specific differences in various skeletal muscle types. In rodents, the slow-twitch muscle expresses SLN, PLB and

SERCA2a (slower isoform), whereas the fast-twitch muscles express primarily

SERCA1a (the isoform shown to transport Ca2+ with faster kinetics) and do not express either SLN or PLB that regulate SERCA pump activity. Based on these data, we speculate that differences in the expression of Ca2+ handling proteins

(SERCA 1a, 2a and its regulators PLB and SLN) and contractile proteins in slow- twitch vs. fast-twitch fibers (15, 20, 93) could contribute to the unique contractile

properties of these muscle types.

In larger mammals like rabbit and dog, SLN and SERCA2a are expressed

at high levels both in soleus and EDL muscles. In larger mammals the fast-twitch

muscles are composed of type I (slow) and type II (fast) fibers (20, 63) and

therefore we predict that the expression of SERCA2a and SLN in the EDL

muscle is due to the presence of slow-fiber types. Similarly, SLN and SERCA2a

proteins are found at high levels in tongue which also has both slow- and fast-

twitch skeletal muscle fibers (76). Taken together our data suggest that the

expression of SLN and SERCA2a is restricted to slow-twitch skeletal muscle

fibers. The co-ordinate expression of SLN and SERCA2a suggests that SLN is the major regulator of SERCA2a in skeletal muscle tissues. In skeletal muscle tissues, SERCA2a isoform is expressed primarily in slow-twitch fibers whereas in

37 the fast-twitch muscle, SERCA1a is the predominant isoform and plays a major

role in maintaining SR Ca2+ stores needed for excitation–contraction coupling

(89). Our findings suggest that SLN expression correlates well with SERCA2a

but not with SERCA1a.

Interestingly, the expression of SLN closely follows SERCA2a during

cardiac and skeletal muscle development. We found that SERCA2a and SLN

proteins are expressed at high levels in developing fast-twitch skeletal muscle

but are absent in the adult muscle. Similar pattern of co-expression of SERCA2a

and SLN has been observed during tongue muscle development. These results

suggest that SLN is a major regulator of SERCA2a in developing skeletal muscles.

The role of SLN in cardiac patho-physiology is less well understood.

Recent studies showed that SLN mRNA is altered animal model of hypertrophy and in humans with chronic atrial fibrillation. However, there are no protein data available to date to validate the importance of SLN in cardiac pathology. Here, for the first time we demonstrate that SLN protein levels are significantly upregulated in the atria of pacing induced canine model of chronic heart failure.

This canine model mimics many aspects of chronic human heart failure (81) and exhibits decreased SR Ca2+ release characteristic of failing myocardium (61).

Since SLN has shown to have an inhibitory effect on SR calcium transport, we speculate that increased expression of SLN in the HF atria should inhibit SERCA pump activity and decrease Ca2+ transport and result in slowing of atrial function.

38 The findings that SLN protein levels were significantly down-regulated in the atria

of ischemic hearts (21) could be a compensatory mechanism to accelerate the

SR Ca2+ uptake function during myocardial infarction. Exercise training program

that improved cardiac function (22-24) also restored SLN protein levels further

supports the view that SLN levels are critical for maintaining normal Ca2+ homeostasis.

In conclusion, SLN has an expression pattern which is distinct in comparison to that of PLB. The findings that SLN and SERCA2a are co- expressed in the atria and skeletal muscle tissues along with functional studies reported from SLN transgenic mouse models (9, 12, 38) strongly suggest that

SLN is an important regulator of SERCA2a isoform. The findings that SLN expression is modified in the atria in dog models of heart failure, suggest that

SLN levels could critically determine SERCA pump activity and Ca2+ homeostasis

and could play an important role in atrial patho-physiology. Future research

should be aimed at understanding the physiological relevance of alteration in

SLN in heart failure, which would help in using SLN as a target for therapeutic

intervention.

CHAPTER 3

CARDIAC SPECIFIC OVEREXPRESSION OF SARCOLIPIN IN MICE LEADS

TO A DECREASE IN SARCOPLASMIC RETICULUM CALCIUM TRANSPORT

AND CARDIAC CONTRACTILITY

3.1. ABSTRACT

To determine the role of Sarcolipin in cardiac physiology we developed a

transgenic (TG) mouse model in which the SLN to SERCA2a ratio was increased

in the ventricle. Overexpression of SLN leads to a i) decrease in the rate of SR calcium uptake and decreased calcium transient amplitude and slower rate of

relaxation. ii) SLN TG hearts exhibit a significant decrease in rates of contraction

and relaxation when assessed by ex vivo work-performing heart preparations.

Interestingly, the inhibitory effect of SLN was partially relieved upon isoproterenol

treatment and stimulation at high frequency. Biochemical analyses show that an

increase in SLN level does not affect PLB levels, monomer to pentamer ratio, or

its phosphorylation status. No compensatory changes were seen in the

expression of other calcium-handling proteins. These studies suggest that the

SLN effect on SERCA pump is direct and is not mediated through increased

monomerization of PLB or by a change in PLB phosphorylation status. In

40 conclusion, SLN is a novel regulator of SERCA pump activity, and its inhibitory effect can be reversed by β-adrenergic agonists.

3.2iNTRODUCTION

The sarco (endo) plasmic reticulum (SR) Ca2+ ATPase (SERCA) plays a

dominant role in transporting Ca2+ into the SR during the contraction-relaxation

cycle of the heart. The rate and amount of Ca2+ transported into the SR

determines both the rate of muscle relaxation and the SR Ca2+ load available for

the next cycle of contraction (16, 18, 32, 88). It is well established that SERCA function is regulated by phospholamban (PLB), whose inhibitory effect is reversed by phosphorylation by protein kinase A and the calcium/calmodulin- dependent protein kinase (CAMKII) during adrenergic activation (16, 19, 58).

Recent studies have shown that in addition to PLB, sarcolipin (SLN) could also

play an important role in the regulation of SERCA pump activity (6, 19, 71).

SLN is a 31-amino acid protein expressed in both cardiac and skeletal muscle (14, 36, 78, 84). We have recently demonstrated that SLN is localized in

the cardiac SR membrane, and its distribution pattern is similar to SERCA2a and

PLB (14). SLN mRNA is differentially expressed in small as opposed to larger

mammals. In rodents, SLN mRNA is abundant in the atria with very low levels in

the ventricle and skeletal muscles (14, 36, 78). In contrast, in larger mammals

including humans, SLN mRNA is abundant in fast-twitch skeletal muscle

compared with atria and ventricle (84). SLN expression is developmentally

regulated (14), and its expression levels are modified under certain pathological

41 conditions of the muscle (86, 103). Decreased expression of SLN mRNA has

been shown in the atria of patients with atrial fibrillation (103). A recent study also showed that SLN mRNA was up-regulated 50-fold in the hypertrophied ventricles of Nkx2–5-null mice (86).

Structural similarities between SLN and PLB indicate that they are homologous proteins and may functionally substitute for each other (8, 46, 69,

82). Recent studies carried out in HEK cells showed that SLN could inhibit the

SERCA pump activity (6, 82). Co-expression of SLN with either SERCA1a or

SERCA2a decreases the apparent Ca2+ affinity of the SERCA pump.

Furthermore, when SLN and PLB are co-expressed, SLN was shown to inhibit the polymerization of PLB, resulting in more monomers and super-inhibition of the

SERCA pump (6, 10). Using adenoviral gene transfer into cardiac myocytes, we

recently demonstrated that overexpression of SLN resulted in decreased myocyte

contractility and calcium handling. However, overexpression of SLN did not alter

the PLB pentamer/monomer ratio in cardiac myocytes (14).

Based on our adenoviral gene transfer studies in cardiac myocytes (14),

we hypothesized that SLN can directly modulate SERCA pump activity and affect

cardiac contractility. To test this hypothesis, we specifically altered the SLN to

SERCA ratio in the ventricle by overexpressing SLN using the -MHC gene

promoter. Results presented in this study suggest that SLN directly inhibits the

SERCA pump activity, and its inhibitory effect can be reversed upon adrenergic

stimulation and increased frequency.

42 3.3. MATERIALS AND METHODS

All experiments were performed in accordance with National Institutes of

Health guidelines and approved by the Institutional Laboratory Animal Care and

Use Committee at The Ohio State University.

3.3.1. Generation of Transgenic Mice—N-terminal FLAG-tagged mouse SLN

cDNA (14) was amplified by PCR and ligated into the SalI and HindIII sites

downstream of the 5.5-kb mouse -MHC promoter and upstream of the poly(A)

signal sequence from the human growth hormone. The complete recombinant

construct was excised from the plasmid backbone by NotI restriction digestion

and gel-purified. To generate transgenic founder mice, DNA samples were

microinjected into the pronuclei of C57BL/6 murine embryos at the core facility for

transgenics, University of Cincinnati.

Mice carrying the transgene were identified by PCR analysis using primers

specific for -MHC (5'-GCCCACACCAGAAATGACAGA-3') and the antisense

primer specific for the 3'-end of SLN cDNA (5'-TCAGTATTGGTAGGACCTCA-3').

The copy number of the transgene was identified by Southern blot analysis of

DNA samples from TG mice as described earlier (39).

3.3.2. Determination of SERCA/SLN Ratio by RT-PCR—Total RNA was

isolated from ventricle or atria (pooled from two mice) using the ULTRASPEC-II

RNA Isolation System (Biotecx Labs., Houston, TX). RT-PCR analysis was done

using 1 µg of total RNA from ventricle or atria as described earlier (90). Following

43 oligo(dT)-primed first-strand cDNA synthesis, 1-µl portions of the first-strand

cDNA mixture were subjected to PCR using primers specific for mouse SERCA

(forward, 5'-CTGTGGAGACCCTTGGTTGT-3' and reverse, 5'-

CAGAGCACAGATGGTGGCTA-3'), mouse SLN (forward, 5'-

GCACTAGGTCCTTGGCATGT-3' and reverse, 5'-

ACTCAAGGGACTGGCAGAGA-3'), NF-SLN (FLAG forward, 5'-

CTACAAGGACGACGATGACAA and human growth hormone poly(A) reverse,

5'-AGGTTGTCTTCCCAACTTGC) and mouse GAPDH (forward, 5'-

CCCATCACCATCTTCC AGGA-3' and reverse, 5'-TTGTCATACCAGG

AAATGAGC-3'). PCR was adjusted to obtain equal amounts of SERCA2a, and

the number of cycles was chosen to fall within the exponential phase of

amplification. Total SLN mRNA levels were calculated by adding endogenous

and NF-SLN mRNA levels. The PCR protocols were as follows: 94 °C for 30 s, 55

°C for 30 s, and 75 °C for 60 s (35 cycles) with a 72 °C extension for 7 min.

3.3.3. Western Blot Analysis—Cardiac homogenate was prepared from transgenic and non-transgenic ventricles, and Western blot analysis was carried

out as described earlier (14, 39). Briefly, equal amounts of total homogenates

from SLN TG and NTG ventricles were separated on: 5% (for RyR, NCX, and

PMCA) 8% (for SERCA and CSQ), 10% (for DHPR 2 and triadin), and 14% (for

PLB and NF-SLN) SDS-polyacrylamide gel electrophoresis and transferred to

nitrocellulose membranes. Membranes were immunoprobed with the following

primary antibodies: anti-rabbit SERCA2a, anti-rabbit PLB, anti-rabbit CSQ (ABR),

44 anti-mouse DHPR 2, anti-rabbit triadin, anti-mouse PMCA (ABR), anti-mouse

NCX (Swant, Switzerland), anti-rabbit S16 or T17 PLB antibody (Cyclacel,

Dundee, UK). Protein loading was normalized to Coomassie Blue staining and -

actin levels. Signals were detected by SuperSignal WestDura substrate (Pierce)

and quantitated by densitometry.

To determine β-adrenergic agonist-mediated PLB phosphorylation, SLN

TG hearts were perfused with isoproterenol in an isolated work-performing heart

setup as described below. One set of hearts was freeze-clamped after 30 min

without isoproterenol, and the other set was treated with isoproterenol (1 µM) for

5 min after 25 min of perfusion. PLB phosphorylation was estimated by Western

blotting analyses.

3.3.4. Calcium Uptake Assay—Ventricles from TG and NTG mice were used for calcium uptake assays as described earlier (39, 51). Briefly, ventricular tissue

was homogenized in 8 volumes of protein extraction buffer (in mmol/liter, 50 KPi,

10 NaF, 1 EDTA, 300 sucrose, 0.5 dithiothreitol, and 0.3 phenylmethylsulfonyl

fluoride), and calcium uptake was measured by the Millipore filtration technique.

Ventricular homogenates (150 µg) from NTG and SLN TG animals were

incubated at 37 °C in a 1.5 ml of calcium uptake medium (in mmol/liter, 40

imidazole, pH 7.0, 100 KCl, 5 MgCl2, 5NaN3, 5 potassium oxalate, and 0.5 EGTA)

2+ and various concentrations of CaCl2 to yield 0.03–3 µmol/liter free Ca

(containing 1 µCi/µmol 45Ca2+). To obtain the maximal stimulation of SR Ca2+ uptake, 1 µM ruthenium red was added immediately prior to the addition of the

45 substrates to begin the calcium uptake. The reaction was initiated by the addition of 5 mM ATP and terminated at 1 min by filtration. The rate of calcium uptake and

2+ 2+ the Ca concentration required for half-maximal velocity of Ca uptake (EC50) were determined by non-linear curve fitting analysis using Graph Pad PRISM 4.0 software.

3.3.5. Isolated Work-performing Heart Preparations—Work-performing heart

preparations were performed as described previously (39). Mice were anesthetized via intraperitoneal injection with 100 mg/kg sodium nembutal and

1.5 units of heparin to prevent intracoronary micro thrombi. The aorta was

cannulated, and retrograde perfusion (Langendorff mode) was carried out at a

constant perfusion pressure of 50 mmHg with Krebs-Henseleit buffer containing

(in mmol/liter) 118 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgSO4, 0.5 Na-EDTA, 25

NaHCO3, 1.2 KH2PO4, and 11 glucose. All perfusion buffers were equilibrated

with 95% O2 plus 5% CO2, yielding a pH of 7.4. A water-filled catheter (P-50) was

inserted through mitral valve into the left ventricle. After a short period of

stabilization on retrograde perfusion, the pulmonary vein was cannulated, and

perfusion of the heart was switched from retrograde to anterograde. A 20-gauge

cannula was tied into the left pulmonary vein to accommodate regulation on

recording of venous return. Anterograde work-performing perfusion was initiated at a workload of 250 mmHg ml/min, which was achieved using a custom

micrometer-controlled venous return of 5 ml/min and an aortic pressure of 50

mmHg. After establishment of the base line, responses to infusion of β-adrenergic

46 receptor agonist, isoproterenol, by a microperfusion pump (Master flex) were

measured with varying concentrations for 2 min. The signals were digitized, and

the following indices of cardiac performance were measured off-line using

Biobench software (National Instruments, Inc): left ventricular systolic pressure, end diastolic pressure, diastolic pressure, the minimum (–dP/dt) and maximum

(+dP/dt) derivatives of left ventricular pressure, time to peak systolic pressure

(TPP), and time to reach 50% of relaxation (TR1/2). TPP and TR1/2 were

normalized with respect to peak left ventricular pressure because they are

dependent upon extent of pressure development. Force-frequency relationship

was carried out to assess frequency-dependent contractile reserve. For these experiments, hearts were paced with frequencies from 4 to 12 Hz, and +dP/dt

and –dP/dt were determined at multiple intervals.

3.3.6. Preparation of Muscle Fibers and Experimental Set-up—Small,

unbranched trabeculae or the smallest of the RV papillary muscles were

dissected from the right ventricle as previously described (98). The dimensions of

the preparations were 221 ± 21 µm, 174 ± 18, and 1401 ± 78 (width x thickness x length in µm, n = 15) and are not different between the two groups. Using the

dissection microscope, muscles were mounted between a platinum-iridium

basket-shaped extension of a force transducer (KG7, Scientific Instruments

GmbH, Heidelberg, Germany) and a hook (valve end) connected to a

2+ micromanipulator. Muscles were superfused with Krebs-Henseleit buffer ([Ca ]o

1.5 mmol/liter) at 37 °C and stimulated at baseline (4 Hz). Muscles were

47 stretched to a length where a small increase in length resulted in nearly equal

increases in resting tension and active developed tension (98). This length was

selected to be comparable to a length close to the end of diastole.

After stabilization, contractile parameters were recorded at 4 different

muscle lengths between slack and optimal length, stimulated at rates between 4

and 14 Hz in a second protocol, and finally the response to a concentration-

response curve of isoproterenol was assessed. SR calcium load was estimated

via rapid cooling contracture (RCC) experiments (17).

In all the experiments performed, the parameters of developed force (Fdev)

and diastolic force (Fdia) were determined and normalized to the cross-sectional

area of the muscle. Additionally, the maximum speed of contraction (dF/dtmax)

and relaxation (dF/dtmin) were measured. Preparations that did not exceed 10

mN/mm2 sometime during the protocol or muscles that displayed excessive

rundown of Fdev (>10%/hour) were excluded. Multiple analyses of variance were

used to determine significant differences between the interventions, with post-hoc

t test when appropriate. A two-sided p value of < 0.05 was considered significant.

n = 6–8 experiments are included in each protocol, and all values are expressed

as the mean ± S.E. unless stated otherwise.

3.3.7. Simultaneous Measurement of Ca2+ Transient and Myocyte

Shortening—Ventricular myocytes from SLN TG and NTG hearts were isolated

as described previously (64). Briefly, mice were injected intraperitoneally (IP) with

48 0.04 ml of heparin (10,000 units/ml) 20 min before a 0.2-ml IP injection of sodium

pentobarbital until unreactive. After aortic cannulation, heart was mounted on

Langendorff apparatus and cleared of all blood with modified MEM (Sigma

M0518, 37 °C, bubbled with 95%O2, 5%CO2). The heart was then perfused with

blenzyme solution (Roche Applied Science, 37 °C, bubbled with 95%O2,

5%CO2). The tissue was then dissected in a Petri dish with fresh blenzyme

solution, removing atria, and chopping into fine pieces. After triturating with a large bore pipette, the remaining pieces were post-digested with additional blenzyme solution and filtered through a 200 micron nylon mesh. All myocyte

suspensions were spun for 20 s at 1000 rpm, supernatant decanted, and

resuspended in modified MEM to which 0.1% bovine serum albumin and 50 µM

Ca2+ were added. After gravity-settle, cells were resuspended in MEM containing

200 µM Ca2+.

Myocytes were loaded at 22 °C with Fluo-4 AM (10 µM, Molecular Probes,

Eugene, OR) for 30 min for intracellular de-esterification. The instrumentation used for cell fluorescence measurement was a Cairn Research Limited

(Faversham, UK) epifluorescence system. Myocytes were field-stimulated and

superfused with (in mM/liter): 140 NaCl, 4 KCl, 1 MgCl2, 1 CaCl2, 10 glucose, and

2+ 5 HEPES (pH 7.4). [Ca ]i was measured by Fluo-4 epifluorescence with excitation at 480 ± 20 nm and emission at 535 ± 25 nm. The illumination field was

restricted to a small spot to get emission from a single cell. Data were expressed

as F/Fo, where F is the fluorescence intensity and Fo is the intensity at rest.

49 Simultaneous measurement of shortening was also performed using an edge

detection system (Crescent Electronics, Sandy, UT). Data were expressed as %

of resting cell length. Myocytes were field-stimulated via platinum electrodes connected to a Grass S48 stimulator, with Ca2+ transients and myocyte

shortening simultaneously measured (111). Force-frequency relationship (0.2,

0.5, 1, and 2 Hz) and isoproterenol dose-response curves were generated.

3.3.8. Statistics—Results are expressed as mean ± S.E. Statistical significance

was estimated by a paired Student's t test. A value of p < 0.05 was considered

statistically significant.

3.4. RESULTS

3.4.1. Generation of SLN TG Mice—To determine how SLN regulates cardiac function and SR calcium transport, we overexpressed FLAG-tagged mouse SLN cDNA under the control of the -MHC promoter (Fig 3.1A). The TG mice were

generated in a CB56 background and the progeny screened for germline

transmission of the transgene. PCR analysis indicated that 4 of 52 of initial F0 mice carried the transgene. Out of 4 founders, only 2 of them (line 20 and line 26)

were fertile and produced progeny. Southern blot analysis revealed mouse lines

20 and 26 carried 1 and 2 copies of the transgene, respectively. Transgenic mice

were born in the expected Mendelian ratio and were indistinguishable from their

NTG control littermates; there were no signs of phenotypic alterations or reduced

viability.

50 Western blot analysis of NF-SLN expression in various muscle tissues including cardiac, skeletal, and vascular smooth muscle indicates that NF-SLN

expression is restricted to heart and not detectable in other tissues analyzed (Fig

3.1B). Further, our data suggest that NF-SLN expression is 3-fold higher in the ventricle than in the atria of TG mice. This finding may suggest that high levels of

endogenous SLN present in the atria may limit the amount of transgenic NF-SLN

expression.

To quantitate the NF-SLN expression in line 20 and line 26, Western blot

analysis was carried out. Results shown in Fig 3.1C indicate that line 26

expresses 2-fold higher NF-SLN protein than line 20. The transgenic mouse line

26 at 18–25 weeks old was chosen for further studies.

To determine whether TG expression of NF-SLN has modified the levels of endogenous SLN, RT-PCR analysis was carried out, because we did not have a

suitable antibody for SLN at that time. Our results show that overexpression of

NF-SLN did not alter the endogenous SLN mRNA levels in both atria and

ventricle (data not shown). We additionally wanted to determine the relative ratio of SLN to SERCA2a in the NTG and TG atria and ventricle. The data shown in

Fig 3.1D indicate the percent expression level of SLN mRNA to SERCA2a mRNA

levels. Our results suggest that the ratio of SLN/SERCA is higher in atria than in the ventricle. In the transgenic ventricle, the ratio of SLN to SERCA was

increased 57% more (from 107.35 ± 2.3% to 169.47 ± 2.7%) indicating that we

altered the SLN to SERCA2a ratio successfully.

(A) Sal 1 Hind III

Ex1 Ex2 Ex3 NF- Mouse SLN cDNA

SV40 Poly A+ 5.5 kb α-MHC

(B) Quadriceps Atria Soleus Ventricle Aorta

NF-SLN

(C)

NTG TG26 TG20 10 20 10 20 10 20 μg

NF-SLN

(D) 250 204.04±9.1%

200 169.47±2.7%

150 123.18±2.8% 107.35±2.3% 100

mRNA SLN/SERCA %Total 0 NTG-V TG-V NTG-A TG-A

Figure 3.1. A - Schematic representation of the α-MHC-SLN construct containing the mouse SLN cDNA. B- NF-SLN expression in various muscle tissues. Proteins were separated on a 14% SDS-PAGE and immunoprobed with anti-mouse FLAG antibody. C- Quantification of NF- SLN expression in ventricles of TG lines 20 and 26. D- Percent total SLN/SERCA levels in NTG and TG hearts. RT-PCR was adjusted to obtain equal amounts of SERCA2a, and the number of cycles was chosen to fall within the exponential phase of amplification as described under Materials and methods section.

52 3.4.2. Overexpression of SLN Is Not Associated with Any Cardiac

Pathology—We next examined whether overexpression of SLN led to any

structural abnormalities and caused muscle pathology. There was no difference in

the heart weight to body weight ratio in SLN TG mice when compared with age-

and sex-matched littermate controls. Histological analysis of hearts from lines 20

and 26 at the age of 3, 6, and 12 months (via conventional microscopic

evaluation of hematoxylin/eosin and Masson's trichrome stained slices) revealed

no difference in tissue morphology or evidence of fibrosis (Data not shown).

3.4.3. Expression Levels of the key SR Calcium-handling Proteins Are

Unchanged in Transgenic Mice—Quantitative Western blot analysis was

carried out to determine if increased SLN expression affected the levels of

SERCA and PLB in the TG ventricle. Our results show that the expression levels

of SERCA2a, PLB, and CSQ were unchanged in the TG ventricle (Fig 3.2A)

indicating that expression of these proteins was not affected by SLN

overexpression. We also quantitated the expression levels of ryanodine receptor

(RyR), L-type calcium channel subunit-dihydropyridine receptor 2 (DHPR 2),

and triadin to determine changes in Ca2+ release and entry mechanisms. As

shown in Fig 3.2B, SLN overexpression did not affect the RyR, DHPR 2, or triadin levels. To determine whether SLN inhibition of the SERCA pump is associated with compensatory changes in the expression of other plasma

membrane calcium extrusion systems, we quantitated the sodium-calcium

exchanger (NCX) and plasma membrane calcium ATPase (PMCA) levels.

53 Results in Fig 3.2B indicate that SLN overexpression did not alter the expression of NCX and PMCA protein levels.

A NTG SLN TG NTG SLN TG 4 8 4 8 4 8 4 8 μg SERCA2a

PLB

CSQ

B 10 20 10 20 10 20 10 20 μg DHPRα2

RyR

Triadin

NCX

PMCA

Figure 3.2. Quantification of SR calcium-handling proteins and

sarcolemmal calcium transporters, NCX and PMCA. Western blotting with different SDS-PAGE gel concentrations (5% for RyR, NCX, and PMCA, 8%

for SERCA and CSQ, 10% for DHPR_2 and triadin, and 14% for PLB) were used to resolve total ventricular homogenates from NTG and TG mice and

immunoprobed

3.4.4. Basal Phosphorylation of PLB Is Not Affected by SLN

Overexpression—In a recent study, Asahi et al. (9) reported that cardiac-specific

overexpression of SLN resulted in decreased basal phosphorylation of PLB and an increase in the monomer to pentamer ratio. To test whether overexpression of

54 SLN resulted in monomerization of PLB and decreased phosphorylation, Western blot analysis was carried out using appropriate antibodies. Our results (Fig 3.3) clearly show that the monomer to pentamer ratio was not altered in the TG ventricle. Further, the basal phosphorylation of PLB at serine 16 (Ser16) and threonine 17 (Thr17) was not different between the TG and NTG ventricles (Fig

3.3). These results contradict a previous report (9) and show that SLN overexpression did not alter either PLB basal phosphorylation or the monomer to pentamer ratio.

NTG SLN TG NTG SLN TG 10 20 10 20 10 20 10 20 μg

PLBP

PLB M

PLBS16

PLBT17

Figure 3.3. Basal phosphorylation and monomer to pentamer ratio of PLB, in SLN TG ventricles. Total homogenates were unboiled and analyzed for PLB monomers (PLBM) and pentamers (PLBP) by Western blot analysis. To detect PLB monomer levels, higher amounts of protein (10 and 20 ug) were loaded. To determine the basal phosphorylation of PLB, snap-frozen samples were processed for protein extraction and immunoprobed with Ser16- or Thr17-specific PLB antibodies. Data are representative of three independent experiments.

55 3.4.5. SLN Overexpression Decreases the Apparent Ca2+ Affinity and Rate

of Ca2+ Uptake—To determine the effect of the increased SLN to SERCA ratio

on SR calcium transport, the rate of calcium dependence of calcium uptake was

measured in total ventricular homogenates from SLN TG and NTG ventricles.

Results show that there is a significant rightward shift in the sigmoid curve

measuring calcium dependence of calcium uptake in TG mice indicating a

2+ 2+ reduced Ca affinity in SLN TG ventricles (Fig 3.4). The EC50 value for Ca increased significantly in the TG ventricle (NTG, 163.8 ± 12.64 nM versus SLN

TG, 209.3 ± 20.62 nM; n = 4; p < 0.05) when compared with the NTG ventricle.

2+ However, the maximum velocity (Vmax) of Ca uptake was not significantly

different between NTG and TG ventricles (NTG, 84.92 ± 13.86 nM versus SLN

TG, 74.24 ± 13.95 nM n = 4; p < NS).

120 NTG 100 SLN TG

40 (nmol/mg/min)

Rate of Ca uptake Ca of Rate 20

0 8.0 7.5 7.0 6.5 6.0 5.5 5.0 pCa

Figure 3.4. Calcium uptake function in NTG and SLN TG mice. Ca2+uptake assays were performed using ventricle homogenates from 2+ 24-week-old mice (n =4 for each group). The Vmax of Ca uptake was obtained at pCa 6.0 in both groups.

56 3.4.6. SLN TG Hearts Showed a Decreased Cardiac Performance in Isolated

Work-performing Heart Preparations—The functional consequences of SLN overexpression in the heart were determined by measuring indices of cardiac

performance with the anterograde-perfused work-performing heart preparations.

The SLN TG hearts showed significant decreases in the maximum rate of

contraction (+dP/dt) and relaxation (–dP/dt) compared with NTG hearts (Table

3.1). A tendency toward decreased baseline systolic and diastolic pressure was

also observed in TG hearts; however, these decreases were not statistically

different from NTG hearts. The other parameters of cardiac function such as time

to peak pressure and half-relaxation pressure derived from intraventricular

pressure tracings were not altered (Table 3.1).

Wild type, n=6 SLN TG, n=5

SP, mmHg 114.3±5.0 112±5.1 DP, mmHg -8.4±0.9 -10.5±1.23 EDP, mmHg 9.4±3.8 10.6.3±3.2 +dP/dt, mmHg/s 3769±317 3275±143*

-dP/dt, mmHg/s- 3635±176 3036±133*

HR, beats/min 304±27 331±10.5 TPP, ms/mmHg 0.42±0.041 0.44±0.03

TR1/2, ms/mmHg 0.55±0.09 0.57±0.06

Table 3. 1: Contractile parameters in SLN TG and NTG hearts in isolated work-performing heart preparations

57 We next examined the force-frequency relationship to determine the frequency-dependent contractile reserve in the SLN TG heart. For these

experiments, TG and NTG hearts were paced with frequencies from 4 to 11 Hz,

and the rates of contraction (+dP/dt) and relaxations were determined at multiple

intervals. As shown in Fig 3.5 both SLN TG and NTG control hearts

demonstrated the flattened force-frequency dependence (no ascending limb).

However in mice overexpressing SLN, the force-frequency relation was shifted to

the right, indicating that contractility is decreased in the SLN TG hearts. However,

at very high stimulation frequencies (11 Hz), rates of contraction and relaxation of

SLN TG hearts were not significantly different from NTG controls.

NTG NTG 5000 SLN TG 5000 SLN TG * * * * 4000 * * 4000 3000 3000

2000 2000 /dt, mmHg/s /dt, mmHg/s /dt, P P -d +d 1000 1000

0 0 3 4 5 6 7 8 9 10 11 12 3 4 5 6 7 8 9 10 11 12 Frequency, Hz Frequency, Hz

Figure 3.5. Rate of contraction (+dP/dt) and relaxation (-dP/dt) in response to increase in force in work performing heart preparations for SLN TG and NTG littermates. Data were derived from 6 NTG and 5 SLN TG mice. * indicates significant difference between groups, p<0.05

58 3.4.7. Contractility Is Restored in Isoproterenol-stimulated TG Hearts—It

was of significant interest to determine how an increase in SLN levels affect the

hearts ability to respond to β-adrenergic stimulation. Both NTG and TG hearts

responded to increasing doses of isoproterenol with increase in contractility as

well as relaxation parameters (Fig 3.6A). Interestingly, diminished base line

+dP/dt and –dP/dt were restored to the level of control hearts after infusion of

high doses of isoproterenol.

The phosphorylation status of PLB at Ser16 and Thr17 was estimated using quantitative Western blot analysis in isoproterenol-treated hearts as described

under Materials and methods. Our results showed that PLB phosphorylation was

increased significantly in response to isoproterenol, but there was no difference

between NTG and TG hearts (Fig 3.6B).

A 5500 5500 NTG NTG 5000 SLN TG 5000 SLN TG

4500 4500 * 4000 * 4000 * * /dt, mmHg/s/dt, 3500 /dt, mmHg/s 3500 P P -d +d 3000 3000

2500 2500 -12 -11 -10 -9 -8 -7 -6 -5 -12 -11 -10 -9 -8 -7 -6 -5 Log[M] iso Log[M] iso

B NTG SLN TG -Iso +Iso -Iso +Iso 10 20 10 20 10 20 10 20 μ g

PLBS16

PLBT17

Figure 3.6. Cumulative dose-response to isoproterenol in work- performing hearts. A -Data derived from 5 NTG and 4 SLN TG mice. * indicates significant difference between groups, p<0.05. B - Western blot analysis of PLB phosphorylation in isolated work-performing hearts before (-Iso) and after (+Iso) isoproterenol (1uM) perfusion. Tissue samples were processed for total protein extraction and immunoprobed with Ser16- or Thr17-specific PLB antibodies.

3.4.8. Contractility Is Decreased in Muscle Preparations from SLN TG

Hearts—At a base frequency of 4 Hz, length-dependent activation was similar between muscles from SLN TG and NTG littermates. Upon an increase in muscle length, active developed force increased in parallel. At optimal lengths, the developed force was lower, but not significantly, in TG versus NTG mice. Force- frequency (FF) behavior in NTG mice was biphasic. At lower rates of stimulation,

60 a small positive FF relationship was observed, after which force declined upon

further increase in stimulation frequency. In SLN TG mice, the loss of developed

force with increasing frequency was larger, resulting in lower force development

compared with NTG mice at 12 and 14 Hz. From Fig 3.7A, it can be seen that at 4

Hz, the speed of contraction was slower in TG mice at low frequency, but not

different at 14 Hz.

To determine the effect of isoproterenol on muscle contraction, a typical

isoproterenol dose-response behavior was recorded. Under maximal and near-

maximal concentration, force development was impaired in TG muscle compared

with NTG. However, at maximal isoproterenol stimulation, the differences noted for the speed of contraction and relaxation, observed at 4 Hz between the groups

became insignificant (Fig 3.7B).

In addition, RCC experiments were carried out to determine the SR Ca2+ load. At a baseline frequency of 4 Hz, TG mice showed an RCC amplitude of

7.29 ± 1.76 mN/mm2 compared with 11.65 ± 1.62 mN/mm2 in NTG mice (NS, p =

0.12). At a stimulation of 12 Hz, TG mice showed a decreased RCC amplitude of

6.13 ± 1.56 mN/mm2 (n = 6), compared with the NTG littermates (11.03 ± 1.19

mN/mm2, n = 7, p < 0.05). These data suggest that overexpression of SLN

decreases SR calcium load.

61 A

2000 NTG 1500 SLN TG /s) 2 1000 500

0 -500

-1000dF/dt (mN/mm * -1500

414

Frequency (Hz)

2000 NTG 1500 SLN TG /s) 2 1000 500 * 0 -500 * -1000dF/dt (mN/mm -1500

Base 1μM Isoproterenol

Figure 3.7. Rate of contraction (+dF/dt) and relaxation (-dF/dt) in muscle preparations from SLN TG and NTG hearts. (A)- force-frequency response of muscle contraction and relaxation at 6 and 14 Hz. (B) isoproterenol (1uM) response of muscle contraction from SLN TG and NTGhearts. * indicates significant difference between groups (p<0.05). NTG, n= 6 and SLN TG, n=8.

3.4.9. Overexpression of SLN Decreases Ca2+ Transient Amplitude and

Slows Relaxation in Ventricular Myocytes—The effect of SLN overexpression

on myocyte Ca2+ handling was studied using isolated ventricular myocytes from

TG and NTG hearts (Fig 3.8). Myocytes from SLN TG ventricles showed a

decrease in Ca2+ transient amplitude by 57% (Fig 3.8B) and significantly

prolonged the rate of relaxation (NTG, 163 ± 14 ms versus TG, 255 ± 16 ms).

Interestingly, β-adrenergic stimulation with isoproterenol restored calcium

transient amplitude in TG myocytes to the same level as NTG control myocytes

(Fig 3.8 A and B). Myocyte relaxation was also similar after isoproterenol

stimulation (Fig 3.8C). We further investigated the force-frequency relationship in

myocytes isolated from SLN TG and NTG ventricle. At lower frequencies, there

was a significant difference in Ca2+ transient amplitude and relaxation (0.2 Hz,

NTG: 429 ± 31 ms versus SLN TG, 520 ± 43 ms, p < 0.05). However, at higher

frequencies, the relaxation times were similar in both groups (2 Hz, NTG: 170 ±

7ms versus SLN TG, 171 ± 4ms, p = NS).

A ISO NTG SLN TG

CONT

250 ms Δ F/F0 0.5

B C Ca Transient- Amplitude Ca Transient- RT 50 1.50 300 NTG * NTG 1.25 SLN TG 250 SLN TG 1.00 200 0

F/F 0.75 150 msec Δ 0.50 * 100 0.25 50 0.00 0 ISO ISO CONT ISO ISO CONT -8 -7 (10-8 M) (10-7 M) (10 M) (10 M)

Figure 3.8. A- Ca2+ transients in myocytes isolated from NTG and SLN TG hearts. CONT, Ca2+ transients in normal tyrode (solid lines); ISO, Ca2+ transients in the presence of isoproterenol (10-7 M) (dashed lines). B- + Summary data (expressed as mean ±S.E.) of Ca2 transient amplitude (*, p <0.05 versus NTG). C -Summary data (expressed as mean ± S.E.) of Ca2+ transient relaxation (RT50) (p< 0.05 versus NTG).

64 3.5. DISCUSSION

To better define the role of SLN in cardiac physiology, we chose to

increase the ratio of SLN to SERCA2a in the ventricle (because it is naturally low)

and study how an increase in SLN affects calcium homeostasis and heart

function. The major finding of our study is that overexpression of SLN in the

ventricle resulted in decreased SERCA pump affinity for calcium, Ca2+ transient

amplitude and shortening, and slowed relaxation. More importantly, our data indicate that the inhibitory effect of SLN can be reversed by the β-adrenergic

agonist, isoproterenol, suggesting that SLN acts as a reversible inhibitor similar to

PLB.

The finding that overexpression of SLN results in decreased pump affinity

for Ca2+ and depressed SR Ca2+ load (as measured by RCC experiments)

suggests that SLN is an inhibitor of the SERCA pump. This is further supported

by decreased Ca2+ transient amplitudes and slowed rates of relaxation in isolated myocytes. Consistent with the myocyte studies, both +dP/dt and –dP/dt were

found to be significantly decreased in the SLN TG heart as assessed by the hemodynamic measurements. Similar observations have also been made in

muscle preparations. These results corroborate nicely with our recent report on

myocyte contractility and Ca2+ transients using adenoviral-mediated SLN

overexpression in rat ventricular myocytes (14). These functional changes,

however, are not sufficient to cause any cardiac pathology. It is quite likely that

65 some of these functional changes could be compensated by mechanisms yet to

be determined.

An interesting finding of this study is that the inhibitory effect of SLN on

contractile function could be reversed by treatment with isoproterenol and at high frequency. MacLennan and co-workers (9) also reported similar findings in SLN

TG hearts, where isoproterenol restored contractile function. They reported that

basal PLB phosphorylation was decreased in SLN TG hearts and upon adrenergic stimulation, PLB phosphorylation was restored to the same extent as

control hearts. The authors interpreted that enhanced PLB phosphorylation

(which may result in dissociation of SLN from PLB) could be the mechanism for restoration of function in SLN TG hearts during β-adrenergic stimulation.

However, in the present study, we did not see an appreciable difference in the β- adrenergic agonist-mediated phosphorylation of PLB between the NTG and TG

ventricle. These results suggest that SLN could play a direct role in mediating the

β-adrenergic response in the SLN TG hearts. SLN has a conserved threonine

(Thr5) residue at the N terminus that can be phosphorylated during β-adrenergic

stimulation by serine/threonine kinases such as CaMKII, which may relieve its

inhibitory effect on SERCA pump. Mutation of Thr5 to Ala leads to a slight gain in

inhibitory function (82) further supporting the idea that phosphorylation of Thr5 could play a role in regulating SLN function. Recent studies also suggest that

there are additional mechanisms independent of PLB phosphorylation, which

may play a significant role in mediating the positive inotropic effects of the β-

adrenergic agonist (85) and force-frequency-dependent relaxation (104).

66 However, the potential role of Thr5 as a target for calcium/calmodulin-dependent

protein kinase II or protein kinase A phosphorylation during β-adrenergic

stimulation and increasing frequency needs to be demonstrated.

MacLennan and co-workers (8, 10) have demonstrated that SLN can form a binary complex with PLB. In a recent study we have also observed that PLB

can be co-immunoprecipitated with NF-SLN (14). These studies suggest a

physical interaction between SLN and PLB, and such a binary complex may

enhance its inhibitory effect on SERCA (8). Phosphorylation of PLB during β-

adrenergic stimulation could dissociate the PLB-SLN binary complex from

SERCA2a as effectively as it would remove PLB alone. It has also been

suggested that SLN interaction with PLB could prevent PLB polymerization

resulting in an increase in the active form, the monomer (6) thus promoting super-inhibition of SERCA pump. However, this model does not apply to

situations where PLB is very low (atria) or non-existent such as in fast-twitch

skeletal muscle. Further, our published data (14) and results from this study show

that overexpression of SLN did not alter PLB levels, monomer to pentamer ratio,

or its phosphorylation status. Therefore it is unlikely that the SLN effect is

mediated by monomerization of PLB. However, this does not exclude the

possibility that SLN could influence the inhibitory action of PLB, by binding

allosterically to the same or to a different site. It should also be taken into account

that, SLN is expressed at higher levels in fast-skeletal muscles of larger mammals, where PLB is absent, which readily suggests that SLN can regulate

67 SERCA pump, independent of PLB. Future studies will be directed toward

understanding the mechanism of SLN action on the SERCA pump in the absence

of PLB.

In conclusion, we found that overexpression of SLN in mouse hearts decreases both SR calcium handling and cardiac contractility. The inhibitory

effect of SLN can be relieved upon β-adrenergic receptor stimulation and

increased frequency, suggesting that it is a reversible inhibitor. The decreased

contractility observed in SLN TG hearts is primarily caused by changes in the

SLN/SERCA ratio, not alteration in PLB expression or phosphorylation status.

Taken together our results suggest that SLN is a novel regulator of SERCA pump

and plays an important role in cardiac physiology.

CHAPTER 4

ABLATION OF SARCOLIPIN ENHANCES SARCOPLASMIC RETICULUM

CALCIUM TRANSPORT AND ATRIAL CONTRACTILITY

4.1. ABSTRACT

Sarcolipin(SLN) is a novel regulator of cardiac sarcoplasmic reticulum

(SR) Ca2+ ATPase 2a, (SERCA2a) and is expressed abundantly in atria. In this

study, we investigated the physiological significance of sarcolipin in the heart by

generating a mouse model deficient for sarcolipin. The sarcolipin null mice do not

show any developmental abnormalities or any cardiac pathology. The absence of

sarcolipin does not modify the expression level of other Ca2+ handling proteins, in

particular phospholamban, and its phosphorylation status. Calcium uptake

studies revealed that in the atria, ablation of sarcolipin resulted in an increase in

the affinity of the SERCA pump for Ca2+, and the maximum velocity of Ca2+ uptake rates. One key finding in this study was that ablation of sarcolipin resulted in an increase in atrial Ca2+ transient amplitudes and this resulted in enhanced

atrial contractility. Furthermore, atria from sarcolipin null mice showed a blunted

response to isoproterenol stimulation, implicating SLN as a mediator of β-

69 adrenergic responses in atria. Our study documented for the first time that

sarcolipin is a key regulator of SERCA2a in atria. Importantly, our data

demonstrate the existence of distinct modulators for SERCA pump in the atria and ventricle.

4.2. INTRODUCTION

Sarcolipin (SLN), a low molecular weight protein (31 amino acids) is expressed in both cardiac and skeletal muscles (11, 14, 78, 84, 105). It co- localizes with sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA) in the cardiac

SR (14) and physically interacts with SERCA pump (10). Protein expression

analyses have demonstrated that within the heart, there are chamber specific

differences in the expression pattern of SLN and PLB (4). Sarcolipin is

predominantly expressed in the atrial compartment, whereas PLB is abundant in

the ventricle. Furthermore, SLN expression levels are altered in atria during

cardiac pathology both in animal models (11, 77, 78, 95, 101) and in human

(103) suggesting that SLN levels may play an important role in maintaining atrial

Ca2+ homeostasis during cardiac patho-physiology.

The importance of SLN as a regulator of cardiac SERCA pump was recently demonstrated using adenoviral gene transfer into adult rat ventricular myocytes (3) and transgenic overexpression of SLN in the heart (9, 12, 38).

These studies suggest that overexpression of SLN into ventricular myocytes resulted in decreased rates of SR Ca2+ uptake, Ca2+ transient amplitude and

myocyte contractility. Overexpression of SLN in the PLB null heart revealed that

70 SLN can inhibit the SERCA pump activity independent of PLB and can be

relieved upon treatment with isoproterenol (38). Based on the available data, we hypothesized that SLN is a key regulator of SERCA2a in atria and ablation of

SLN would modify atrial Ca2+ transport and contractility. To test these hypotheses and to establish its role in atrial physiology, we generated a SLN knockout mouse model. Data obtained in this study demonstrated that SLN acts as a major regulator of SERCA2a and could mediate the β-adrenergic responses in atria.

4.3. MATERIALS AND METHODS

All experiments were performed in accordance with the National Institutes of Health guidelines and approved by the Institutional Animal Care and Use

Committee at The Ohio State University, the University of Cincinnati, and the

University of California Davis.

4.3.1. Generation of SLN knockout mice: A 20 kilobase (kb) genomic DNA fragment, containing the entire coding and 5’ and 3’ region of the SLN gene, was isolated from a λ/129 mouse genomic library. To ablate the SLN gene, a targeting vector consisted of 7.9 kb of mouse genomic sequence in which the internal 2.1 kb Hind III fragment, containing the coding exon of SLN gene and some 5’ and 3’untranslated regions, was replaced with a neomycin gene under the phosphoglycerate kinase (PGK) promoter. A copy of the thymidine kinase (tk) gene was attached to the 3’ end of the targeting construct (Fig.1A).

Electroporation and blastocyst injection of targeted embryonic stem (ES) cells were performed by the University of Cincinnati Gene Knockout Mouse service

71 facility. Chimeric male mice were mated to B6 females and germline transmission of the targeted allele was detected by PCR, as described above. Heterozygous

male and female mice were intercrossed to generate SLN null mice. Five

chimeric male mice were generated by blastocyst injection of targeted ES cell

lines. To generate heterozygous mice for SLN (sln+/-), male chimeras were

mated to C56 Black-Swiss female mice. Heterozygous mice were intercrossed to generate SLN homozygous knockout (sln-/-) mice.

4.3.2. Determination of SLN expression by RT-PCR: Total RNA was isolated

from atria and ventricle using the ULTRASPEC-II RNA Isolation System (Biotecx

Laboratories, Houston, TX, USA). RTPCR analysis was performed using 1 μg of

total RNA, as described earlier (14). Following oligo-dT primed first-strand cDNA

synthesis, 1μl portion of the first-strand cDNA mixture was subjected to PCR, using primers specific for mouse SLN (forward: 5’ GCACTAGGTCCTTGGCAT

GT-3’ and reverse: 5’-ACTCAAGGGACTGGCA GAGA-3’), and mouse GAPDH

(forward 5’- CCCATCACCATCTTCC AGGA-3’ and reverse 5’-

TTGTCATACCAGG AAATGAGC-3’). The PCR protocols were as follows: 94°C for 30 sec, 55°C for 30sec, and 75°C for 60 sec (35 cycles) with a 72°C extension for 7 min.

4.3.3. Western-Blot analysis: Total tissue homogenate and microsomal fraction enriched with SR membrane proteins were prepared from wildtype and sln-/- atria and ventricle as described earlier (11, 12). For Western blot analysis, equal amounts of protein from SLN wildtype and sln-/- tissues were separated using

SDS polyacrylamide gel electrophoresis (5% for RyR, 8% for SERCA and CSQ,

72 10% for DHPRα2 and triadin and 14% for PLB) or 16% Tricine gel for SLN and

transferred to nitrocellulose membrane. Membranes were immunoprobed with

following primary antibodies: antirabbit SLN (11), anti-rabbit SERCA2a, anti-

rabbit PLB, anti-rabbit CSQ (ABR), anti-mouse DHPRα2, anti-rabbit triadin, anti- rabbit S16 or T17 PLB antibody (Cyclacel, Dundee, UK). Protein loading was normalized to α-actin levels, using Coomassie staining. Signals were detected by

Super Signal WestDura substrate (Pierce) and quantitated by densitometry.

4.3.4. Ca2+uptake assay: Atria and ventricles from WT and sln-/- mice were

used for SR Ca2+ uptake assays, as described earlier (12, 51). Briefly, atrial or

ventricular tissue was homogenized in 8 volumes of protein extraction buffer (in

mmol/L, 50 KPi, 10 NaF, 1 EDTA, 300 sucrose, 0.5 dithiothreitol and 0.3 PMSF)

and Ca2+ uptake was measured by the Millipore filtration technique. The rate of

SR Ca2+ uptake and the Ca2+ concentration required for half maximal velocity of

Ca2+ uptake (EC50) were determined by non-linear curve fitting analysis using

Graph Pad PRISM 4.0 software.

4.3.5. Isolated work-performing heart preparations: Work-performing hearts

were studied as described previously (12).

4.3.6. Mechanical Studies on Atria: Left atria from wildtype and sln-/- mice

were used for this study and the right atria were excluded due to automatic

pacemaker activity. The left atrium from mice (14-16 weeks old) was attached to

an isometric force transducer (model 400A, Aurora Scientific; sensitivity: 2 V/gm)

and a fixed post, using quick-setting glue, and suspended in a 20 ml organ bath,

containing constantly oxygenated (95% O2 and 5% CO2) Ringers-bicarbonate

73 buffer containing (in mM) 137 NaCl, 5 KCl, 13 NaHCO3, 1.8 KH2PO4, 2 CaCl2,

11 glucose, 1 MgSO4, pH 7.4 at 23oC. The tip of the atrial appendage was glued

to a fine wire that was attached to the force transducer and the base of the atrium

(just below the atrio-ventricular septum) was glued to the plastic rim of a syringe

needle that was clamped to the fixed post in the chamber. The chamber was held

in the frame of an in vitro muscle test apparatus (model 800A, Aurora Scientific)

with an integrated electrode assembly, consisting of two parallel platinum

electrodes. Most of the isolated atria that were studied contracted at a frequency

of ~1.5 Hz. The atria were stretched to determine the maximum contraction

amplitude. We measured the amplitude of force generation, the time to peak

isometric force, and the times to 50% and 90% relaxation. These parameters

were measured in Ringers’s solution containing 2, 4, and 6 mM Ca2+ and in

Ringer’s solution containing 2 mM Ca2+ plus 1μM isoproterenol. The force transducer output was digitized using DaqBoard/2000 and Daqview software

(IOtech, Cleveland, OH). Force records were viewed and analyzed using

DASYLab (version 5.5, DASYTEC, Amherst, NH).

4.3.7. Confocal Ca2+ imaging of atrial myocytes: Single mouse free-wall LV

and atrial myocytes were isolated from 10–12 week old wildtype and sln-/- mice,

as previously described (1, 109). Mice were anaesthetized with pentobarbital

(I.P. 40 mg kg–1) and hearts were rapidly excised. Due to the known

electrophysiological heterogeneity in various regions of the heart, we used only

left ventricular free-wall cells for our recordings. Enzymatically isolated free-wall

LV and atrial myocytes were loaded with the Ca2+ indicator fluo 4-AM. Cells were

74 field-stimulated at a frequency of 1 Hz (IonOptix, Milton, MA). Confocal line-scan

imaging was performed using a Zeiss Pascal confocal microscope equipped with

an argon laser (488 nm) and a 40 x, 1.3 NA oil immersion objectives. Line-scan

images were acquired at sampling rates of 0.7 ms per line and 0.07 μm per pixel, with radial and axial resolutions of 0.4 and 1.0 μm, respectively. Ca2+ transients

were expressed as the normalized local fluorescence (F/Fo), where Fo refers to

the fluorescence level before depolarization, as described (41). Where

appropriate, pooled data are presented as means ± SEM. Significant differences

between groups were tested using ANOVA. The null hypothesis was rejected

when the two-tailed P value < 0.05.

4.3.8. Statistics: Results are expressed as mean ±SEM. Statistical significance

was estimated by unpaired Student’s t-test. A value of p<0.05 was considered

statistically significant.

75 4.4. RESULTS

4.4.1. Successful generation of SLN knockout mouse model: Given the small

size of SLN cDNA, we reasoned that the best strategy to create a null mouse

was to eliminate the entire SLN coding sequence. The targeting vector consisted

of 7.9 kb of mouse genomic sequence in which the internal 2.1 kb Hind III

fragment containing the coding exon (Exon 2) of SLN gene was replaced with a

neomyocin-resistance cassette by homologous recombination (Fig. 4.1A). Details

on the generation of SLN knockout mice are described in Materials and Methods

section. The heterozygous (sln+/-) mice appeared normal and were fertile.

Heterozygous mice have been intercrossed to generate SLN homozygous knockout (sln-/-) mice. Pups lacking SLN were born at the expected Mendelian ratio, and appeared normal. Further, sln-/- mice were viable and reached the adult stage without any gross morphological abnormalities. The absence of SLN expression was confirmed by analyzing the SLN mRNA by reverse- transcriptase

(RT) - PCR analysis and protein expression by Western blot analysis using a

SLN-specific antibody (11). As expected, SLN mRNA and protein were absent in atria and ventricles of sln-/- mice (Fig. 4.1B and 4.1C). These results demonstrate that we were successful in generating a mouse model deficient in

SLN.

Figure 4.1: Targeted disruption of SLN gene. (A) Schematic representation of the SLN gene knockout strategy. Exon 2 was replaced with neomycin gene in reverse orientation. (B) RT-PCR analysis of SLN mRNA expression in the atria and ventricles of wildtype (WT) and homozygous SLN knockout (sln-/-) mice. (C) Western blotting analysis of SLN protein expression. SR enriched microsomal fractions prepared from atria (A, 1 μg), and ventricle (V, 5 μg) of WT and sln-/- mice were separated on a 16% Tricine-PAGE and immunoprobed with antirabbit SLN antibody.

4.4.2. Expression levels of SR Ca2+ handling proteins are unchanged in the

SLN knockout heart: To determine whether ablation of SLN caused alterations

in the expression levels of SERCA2a and PLB, quantitative Western blot analysis

was carried out. Our results show that the expression levels of SERCA2a and

77 PLB were unchanged in the sln-/- atria and ventricle (Fig. 4.2). We also

quantitated the expression levels of other major Ca2+ handling proteins:

ryanodine receptor (RyR), the L-type Ca2+ channel subunit dihydropyridine

receptor α2 (DHPRα2), calsequestrin (CSQ), and triadin to determine changes in

Ca2+ release and entry mechanisms. As shown in Fig. 4.2, RyR, DHPRα2, CSQ, and triadin protein levels were unaffected in the sln-/- hearts.

Figure 4.2: Quantification of SR Ca2+ handling proteins. Two different concentrations of total homogenates [4 and 8 μg for SERCA2a, PLB and calsequestrin (CSQ); 10 and 20 μg for dihydropyridine receptor (DHPRα), ryanodine receptor (RyR) and triadin] prepared from atria and ventricular tissues of WT and sln-/- mice were separated on SDS-PAGE and immunoprobed with specific antibodies.

78 4.4.3. Basal phosphorylation of PLB and its monomer-to-pentamer ratio are not affected in the sln-/- heart: SLN was shown to affect PLB monomer-to- pentamer ratio (6). Therefore, we tested if the absence of SLN altered the PLB monomer-to-pentamer ratio and the basal phosphorylation of PLB by Western blot analysis. Fig. 4.3 clearly shows that the monomer-to-pentamer ratio of PLB was not altered in the sln-/- atria (WT=23.93/76.07± 1.6 versus sln-/- =

25.18/74.82± 1.0) and ventricles (WT=21.93/78.07± 0.6 versus sln-/- =

21.54/78.46± 0.9). Further, the basal phosphorylation of PLB at serine 16 (Ser16) and threonine 17 (Thr17) were not different between sln-/- and WT control hearts

(Fig. 4.3). These results suggest that ablation of SLN did not affect PLB basal phosphorylation or its monomer-to-pentamer ratio.

Figure 4.3 Quantitation of PLB monomer-pentamer ratio and phosphorylation status in SLN KO mice: Total homogenates prepared from sln-/- atria and ventricle were unboiled and analyzed for PLB monomers (PLBm) and pentamers (PLBp) by Western blot analysis. To determine the basal phosphorylation of PLB at serine 16 (PLB-S16) and threonine 17 (PLB- T17), snap-frozen samples were processed for protein extraction and immunoprobed with S16 or T17 specific PLB antibodies. Data represented are representative of three independent experiments.

79 4.4.5. Ablation of SLN increases the apparent Ca2+ affinity and rate of Ca2+

uptake: Previously we have shown that overexpression of SLN in the heart

decreases the rate of Ca2+ uptake by the SR (12). To determine how loss of SLN affected the SR Ca2+ transport function, we measured rates of SR Ca2+uptake in

total homogenates from sln-/- atria and ventricles.

A 35 WT 30 sln-/- 25 Uptake 20

2+ 15 10 (nmol/mg/min) 5

Ca of Rate 0 8.0 7.5 7.0 6.5 6.0 5.5 5.0

pCa

100 B WT sln-/- 75 Uptake

2+ 50

25 (nmol/mg/min) Rate of Ca of Rate 0 8.0 7.5 7.0 6.5 6.0 5.5 5.0 pCa

Figure 4.4: Calcium uptake function in sln-/- atria and ventricle. Ca2+ uptake assays were performed using total homogenates from atria (A) and ventricles (B) of 24 weeks old mice. For each atrial experiment, atria from 2+ four mice were pooled. n=4 for each group. The Vmax of Ca uptake was obtained at pCa 6 0

80 Results in Fig. 4.4 suggest that SLN plays a more prominent role in atrial

myocytes in comparison to the ventricles. Ca2+ uptake was only slightly altered in the ventricular myocytes compared to atrial myocytes in sln-/- hearts (see Fig.

4.4). Specifically, the rate of Ca2+ dependent Ca2+ uptake was significantly

increased both in atria (Fig. 4.4A) and ventricles (Fig. 4.4B) of sln-/- mice, when

compared to the age and sex matched WT control hearts. The EC50 value for

Ca2+ decreased significantly in sln-/- atria (WT=119± 9 nM versus sln-/- =95 ± 7

nM; p<0.03) and ventricle (WT=215.0 ± 21 nM versus sln-/- =153.4 ± 10 nM;

p<0.02) when compared to WT hearts. On the other hand, the maximum velocity

(Vmax) of Ca2+ uptake was significantly increased in the sln-/- atria (WT=17.11±

0.5 nmoles of Ca2+ per mg.min-1 versus sln-/- =27.47± 1.0 nmoles of Ca2+ per mg.min-1; p <0.01) but not in the sln-/- ventricle.

4.4.6. SLN knockout mice showed an increased maximum rate of contraction in isolated work-performing heart preparations: We next examined the effects of SLN ablation on myocardial contractility using the anterograde-perfused work-performing heart preparation in parallel with WT control hearts, under identical load conditions. The maximum rate of contraction

(+dP/dt) was significantly increased in sln-/- hearts (Table 1). The maximum rate of relaxation (-dP/dt), systolic and end diastolic pressures in the sln-/- hearts were not significantly different from WT control hearts. The other parameters of cardiac function, such as time to peak pressure and half-relaxation pressure

81 derived from intraventricular pressure tracings were not altered in the sln-/- hearts (Table 1).

Parameters Wildtype, n=5 sln-/-, n=8

+dP/dt, mmHg/s 3295±98 3840±108*

-dP/dt, mmHg/s- 3186±207 3770±170

SP, mmHg 107.7±5.6 122.0±6.1

DP, mmHg -8.4±1.6 -8.2±2.1

EDP, mmHg 8.3±1.6 11.6±3.7

TPP, ms/mmHg 0.43±0.039 0.42±0.021

TR1/2, ms/mmHg 0.52±0.024 0.49±0.051

+dP/dt-maximal rate pressure development -dP/dt- maximal rate pressure decline SP-left ventricular systolic pressure DP-left ventricular diastolic pressure EDP-left ventricular end diastolic pressure TPP-time to peak pressure TR1/2- half relaxation pressure * Statistically significant from WT

Table 4.1 Contractile parameters in sln-/- hearts in the isolated work-performing heart preparations at 6 Hz

82 To determine the sln-/- heart’s ability to respond to β-adrenergic

stimulation, hearts from sln-/- and WT littermates were subjected to perfusion with increasing concentrations of isoproterenol (ISO) under similar load

conditions and the maximal rates of pressure development (dP/dt) were

measured. At low concentrations of ISO, the rate of contraction (+dP/dt) was

significantly higher in the sln-/- hearts than the WT control hearts. However, at

high doses of ISO infusion, maximal rate of contraction in sln-/- heart was not

different from that of control hearts (Fig 4.5).

5500 5500 WT WT sln-/- 5000 5000 sln-/-

4500 4500 * * 4000 4000 /dt, mmHg/s

3500 /dt, mmHg/s P 3500 P

+d 3000 -d 3000

2500 2500 -12 -11 -10 -9 -8 -7 -6 -5 -12 -11 -10 -9 -8 -7 -6 -5 Log[M] iso Log[M] iso

Figure 4.5. Cumulative dose response to isoproterenol in isolated work-performing hearts from SLN KO and WT mice. (A) Rate of contraction and (B), rate of relaxation in response to increasing dose of isoproterenol. Data were derived from 6 WT and 7 KO hearts. * indicates that the rate of contraction was significantly increased in sln-/- hearts compared to the WT littermates.

4.4.7. Ablation of SLN increases contractility of the atria: SLN is abundant in

atria (11, 78, 105) and therefore we next studied how loss of SLN affects atrial

muscle contractility. The left atria contracted spontaneously and the frequency of

83 contraction was not different between WT and sln-/- atria. Under basal conditions

with 2 mmol/l [Ca]o, isometric force generation was ~1.6 times higher in the sln-/-

atria (WT=3.74 ± 0.40 mN versus sln-/-= 6.00 ± 0.47 mN; p<0.01), compared to

the age- and sex-matched WT controls (Fig. 4A). When the extracellular Ca2+ was increased from 2 mM to 4 and 6 mM, the force generation gradually increased in the WT atria. However, this increase did not reach the basal (in 2 mM Ca2+) contractility of sln-/- atria (Fig.4.6A). Increase in [Ca]o did not have any

significant effect on the isometric force generation of sln-/- atria, indicating that

the basal contraction is already maximal in these tissues. The time taken for 50%

(RT50) and 90% (RT90) relaxation were significantly decreased in the sln-/- atria

(Fig. 4.6B &C), compared to the WT controls, indicating faster relaxation of sln-/-

atria. Time to peak tension was similar between WT and sln-/- atria (WT= 83 ± 6

ms versus sln-/-= 84 ± 4 ms; p

To determine how loss of SLN affects β-adrenergic-mediated atrial

contraction, the atrial muscles were challenged with 1μM ISO and the contractile

parameters were studied. ISO significantly increased the frequency of contraction

in WT and sln-/- atria, as expected, but no difference was observed between the

groups. In response to ISO, the force generation in the WT atria was increased

(WT: -ISO= 3.74 ± 0.40 mN versus +ISO= 7.35 ± 0.52 mN; p<0.01) and reached

the levels similar to that of sln-/- atria (Fig. 4.6B). On the other hand, ISO

stimulation of sln-/- atria did not have an effect on isometric force generation,

indicating a blunted response of the sln-/- atria to β-adrenergic response.

A NS 9 WT 8 * 7 # sln-/- 6 5 * 4 3 Force (mN) 2 1 0 2mM 4mM 6mM 1μM ISO Ca2+

B C 70 140 60 120 * * 50 100 40 80 (ms) (ms) 90 50 30 60 RT RT 20 40 10 20 0 0 WT sln-/- WT sln-/-

Figure 4.6: Mechanical properties of sln-/- atria. (A) Effect of extracellular Ca2+ and ISO on the isometric force generation in isolated left atria from WT and sln-/- mice. # indicates that isometric force generation in sln-/- atria (at 2mM Ca2+) were significantly different from 2+ concentrations. *indicates that isometric force WT atria at all Ca generation in WT atria at 6mM Ca2+ and ISO stimulation were significantly different from the basal contraction at 2mM Ca2+ (p<0.05). NS= Not significant. Time taken for (B) 50% (RT50) and (C) 90% (RT90) relaxation were significantly faster in the sln-/- atria. *indicates the significant difference between WT and sln-/- groups (p<0.05). n=5.

85 4.4.8. Ca2+ transient amplitude was significantly increased in sln-/- atrial

myocytes: Increased Ca2+ uptake, as observed in the sln-/- atria, could affect

overall Ca2+ homeostasis. Therefore, we determined how loss of SLN affects

Ca2+ transient amplitudes in sln-/- atrial compared to ventricular myocytes using confocal line scan imaging. Ca2+ transients were fitted using two exponential

functions. Confocal line scan images of Ca2+ transients for WT and sln-/- cardiac

myocytes (Fig. 4.7A) show a significant increase in the Ca2+ transients in atrial

myocytes of sln-/- compared to WT. In contrast, there were no significant changes in the Ca2+ transient in the ventricular myocytes. Further analyses

shown in Fig. 4.7B indicate that the amplitude of the total Ca2+ transient (A) was

significantly increased in the atrial myocytes from sln-/- compared to WT control.

In addition, there were no significant differences in the amplitude of the total Ca2+ transient in ventricular myocytes isolated from WT and sln-/- mice. These data implicate SLN as an important modulator of SERCA pump activity in atria. Fig.

4.7C shows the summary data for the fast and slow time constants (τ1 and τ2) of the Ca2+ transient decay at baseline using two exponential functions. There were

no significant differences in the fast or slow time constants between atrial or

ventricular myocytes isolated from WT and sln-/- animals.

Effects of Isoproterenol: We additionally evaluated the effect of β-adrenergic

stimulation on Ca2+ transients in atrial and ventricular myocytes using

isoproterenol (ISO). As shown in Fig. 4.7, in WT atrial myocytes, the total Ca2+ transient amplitude were significantly increased upon ISO treatment. In contrast, in sln-/- atrial myocytes, the total Ca2+ transient amplitude did not further increase

86 after ISO treatment. These results indicate that the SERCA pump is maximally

activated in the sln-/-atrial myocytes and ISO stimulation did not further increase

pump activity. In sln-/- ventricular myocytes, ISO stimulation resulted in a

significant increase in the amplitude of the total Ca2+ transient (A), and these increases were similar to that of ISO stimulated WT myocytes.

87 Figure 4.7: Ca2+ transients in atrial and ventricular myocytes isolated from WT and sln-/- mice. (A) Representative examples of line scan images in response to ISO stimulation showing kinetics of Ca2+i transients recorded from atrial and ventricular myocytes of sln-/- mice compared with respective wildtype littermates. Sample records showing line-scan fluorescence image (top), and Ca2+ i, measured as F/Fo (bottom). (B) Summary data for the amplitude of the total Ca2+ transient (A) obtained at baseline and after ISO stimulation for atrial and ventricular myocytes. (n=28 (WT A (-ISO), 17 (sln-/- A (-ISO)), 20 (WT V (-ISO)), 19 (sln-/- V (-ISO), 9 (WT A (+ISO), 13 (sln-/- A (+ISO)), 17 (WT V (+ISO)), 32 (sln-/- V (+ISO) isolated from 5-7 animals per group). (C) Summary data for the fast and slow time constants (τ1 and τ2) of the Ca2+ transient decay at baseline using two exponential functions.

WT sln-/- -ISO +ISO -ISO +ISO

Atrial myocytes

Ventricular myocytes Ventricular

Figure 4.7 continued

B * * * 3.0 WT A (-ISO)

sln-/- A (-ISO) 2.0 WT A (+ISO) sln-/- A (+ISO) WT V (-ISO) transient sln-/- V (-ISO)

2+ 1.0 WT V (+ISO) Ca sln-/- V (+ISO)

Amplitudeof the total 0.0 ATRIA VENT

C 700.0 100.0 WT A 600.0 sln-/- A 80.0 500.0 WT V sln-/- V 400.0 60.0

(ms) 300.0 (ms)

2 1 40.0 τ

τ 200.0 20.0 100.0 0.0 0.0

4.5. DISCUSSION

Sarcolipin was discovered nearly 20 years ago; however the role of SLN

has only been investigated in the past few years. Although recent studies have demonstrated that SLN is an inhibitor of SERCA2a (19, 71, 73, 106), its precise role in cardiac contractility is not fully understood. In this study, we generated a

SLN knockout mouse model and demonstrated that SLN is a key regulator of

SERCA2a in atrial myocytes. Ablation of SLN resulted in an increase in the affinity of the SERCA pump for Ca2+, resulting in the enhanced rates of SR Ca2+

uptake. Our data also lend support to the previous findings which showed that

SLN overexpression can decrease the rates of SR Ca2+ uptake and cardiac

contractility (9, 12, 14, 38). In addition, loss of SLN in the ventricle resulted in an

enhanced rate of Ca2+ uptake suggesting that low levels of SLN in the ventricle

(11) may have functional significance. This was further supported by the increased basal contractility observed in ex vivo heart preparations. On the other hand, SLN is predominantly expressed in atrial myocytes and the effects of SLN ablation is more pronounced in atria compared to the ventricles. Although SLN has been shown to affect the affinity of SERCA pump for Ca2+, its effect on the

maximum velocity (Vmax) of Ca2+ uptake is less well defined. We report for the

first time that ablation of SLN is associated with an increase in the Vmax of Ca2+ uptake rates in atria, suggesting that SLN could regulate the kinetics of the

ATPase activity at one or more steps. Our data are also supported by the previous findings by Tupling et al (102) which showed transient expression of

90 SLN in rat soleus muscle can decrease the maximal Ca2+ transport activity. In

contrast, the absence of SLN did not affect the Vmax of Ca2+ uptake rates in the ventricle. This could be explained by the differential expression of SLN and PLB in the ventricle (11, 14, 78). PLB is the predominant regulator of SERCA2a in the ventricle, whereas SLN is a minor component. Therefore, ablation of SLN function is not expected to have a significant effect on the Vmax of Ca2+ uptake rates in the ventricle. The finding that SLN regulates Vmax of Ca2+ uptake suggests that SLN functionally differs from PLB. Taken together, our data suggest that SLN could play a unique role in atrial Ca2+ uptake and may

contribute to the differences in Ca2+ handling between atria and ventricle (73).

Another important finding of this study is increased Ca2+ transient

amplitude in the sln-/- atrial myocytes and this is most likely due to the increase

in the rate of Ca2+ uptake. Consistent with the enhanced SR Ca2+ uptake, the rate

of atrial muscle relaxation is also faster in the sln-/- mice. On the other hand,

ablation of SLN in the ventricle did not affect the rates of Ca2+ transient amplitude

and muscle relaxation. We also found that loss of SLN function resulted in an increase in rate of contraction in isolated atria. This is in contrast to PLB, which

has been shown to be only a repressor of basal relaxation in the atria (55). Thus,

our data strongly suggest that SLN is the major regulator of SERCA pump in the atria and muscle contraction.

91 In this study, we further investigated the role of SLN as a mediator of β- adrenergic responses in atria. Earlier studies have shown that the β-adrenergic activation of SR Ca2+ uptake and contractile indices are higher in atria, despite

low levels of PLB (54). Studies from PLB transgenic and knockout mouse models

also suggest that PLB contributes, only in part, to the β-adrenergic mediated

atrial contractile response (55) and there may be proteins other than PLB

involved in mediating the β-adrenergic response in atria. In this study, we

demonstrate that ablation of SLN in the atria resulted in a blunted response to

ISO. Whereas the ventricular myocytes from sln-/- preserve the β-adrenergic

response. These results suggest that SLN is a key player in mediating the β-

adrenergic responses in atria. This finding is further supported by data from a

transgenic mouse model overexpressing SLN in PLB null background, which

demonstrate that the inhibitory effect of SLN can be relieved upon treatment with

isoproterenol. Taken together, our results point to the important distinction

between atrial and ventricular myocytes under β-adrenergic control, namely, the

increase in SERCA pump function under β-adrenergic stimulation in the atria is

largely mediated by SLN, whereas in the ventricle, it is mediated by PLB as

suggested by previous literature (30, 75).

In summary, using a SLN deficient mouse model, we have demonstrated

that SLN is a key modulator of SERCA function and plays a critical role in atrial

contractility. Increased Ca2+ uptake, Ca2+ transient amplitudes, and muscle

contractility observed in sln-/- atria provide strong evidence for the regulatory role

92 of SLN in SR Ca2+ uptake function and the functional significance of SLN expression in the atria. Furthermore, our study provides evidence that SLN could play a major role in mediating β-adrenergic responses in atria.

CHAPTER 5

THE ROLE OF THREONINE 5 PHOSPHORYLATION IN SARCOLIPIN

FUNCTION

5.1 ABSTRACT

The cardiac SR Ca2+ ATPase (SERCA2a) pump is a pivotal molecule for maintaining a balanced concentration of intracellular Ca2+ during the cardiac contraction-relaxation cycle. Recent data suggest that the activity of SERCA2a is closely regulated by Sarcolipin (SLN), which is predominantly expressed in the atria. Data from transgenic mice revealed that SLN inhibits SR calcium transport function and decreases the calcium transient amplitude and rate of relaxation.

The inhibitory effect of SLN is relieved upon stimulation with the β-adrenergic agonist, isoproterenol, indicating that SLN could play a role in mediating β - adrenergic response in the heart. However, the mechanism of SLN action on

SERCA2a is not well understood. In this study, we tested the hypothesis that the reversible phosphorylation of SLN at highly conserved Threonine 5 (T5) modulates its inhibitory effect on SERCA2a. Using site directed mutagenesis and adenoviral gene transfer into rat ventricular myocytes we showed that T5 at the

N-terminus of SLN plays an important role in modulating the SLN function. 94 Mutation of T5 alters myocyte contractility as well as calcium transient. Further,

in vitro phosphorylation revealed that SLN can be phosphorylated at the T5

residue by CaMKII. We conclude that SLN modulates the SERCA2a function in

the atria in a manner similar to phospholamban in the ventricle.

5.2 INTRODUCTION

Sarcolipin (SLN) is a 31 amino acid SR membrane protein expressed in

cardiac and skeletal muscles (11, 84, 105). Within the heart, SLN is expressed

predominantly in atria and in trace amounts in the ventricles (11, 14). Sarcolipin

co-localizes and physically interacts with cardiac sarcoplasmic reticulum Ca2+

ATPase 2a (SERCA2a) (8, 14, 69). The expression of SLN is developmentally regulated and altered in the atria of various animal models of cardiac pathology

(11, 14). Altered expression of SLN without any changes in SERCA or PLB protein levels in these animal models suggest that SLN levels could play a critical role in the altered SR calcium handling observed in the diseased myocardium(11).

The physiological importance of SLN was elucidated recently using genetically engineered mouse models with alterations in SLN expression levels

(9, 12, 38). Ablation of SLN was associated with significantly enhanced Ca2+ affinity of SERCA2a, resulting in increased atrial contraction (described in

CHAPTER 4). The SLN null atria showed a blunted response to -agonist isoproterenol stimulation. On the other hand, cardiac specific overexpression of

SLN was associated with significant decrease in SR calcium uptake and

95 depressed contractile parameters, which could be reversed upon -agonist

stimulation (9, 12). These studies further showed that the inhibitory effect of SLN

is independent of PLB. Overexpression of SLN in the PLB null background (38)

further supports the fact that the inhibitory effect of SLN on SERCA pump is

independent of PLB. Taken together, data from transgenic mouse models

indicate that SLN is a reversible inhibitor of SERCA2a and its inhibitory effect can

be relieved upon β- adrenergic stimulation. However, the molecular mechanisms

which regulate SLN function are yet to be studied.

SLN has a conserved threonine residue (T5) at the N-terminus (37, 84)

that could be phosphorylated by serine/threonine kinases in response to -

adrenergic stimulation, which may relieve its inhibitory effect on SERCA2a.

Calcium uptake studies have shown that mutation of T5 to alanine (A) resulted in

a gain on inhibitory function, whereas mutation of T5 to glutamic acid (E) leads

to a loss of inhibitory effect (38, 82). These results suggest that phosphorylation/dephosphorylation of T5 could play a regulatory role in

modulating SLN function. A recent study also identified T5 as a potential

phosphorylation site and suggests that SLN can be phosphorylated by a putative

serine/threonine protein kinase 16 (STK16) (38). However, these data were

derived using HEK293 cells and the physiological relevance of STK16 in the

heart is unknown.

Based on the analogy of reversible inhibition of SLN and PLB on

SERCA2a, we hypothesize that SLN inhibits the SERCA pump in its

unphosphorylated state and phosphorylation at T5 relieves its inhibitory effect. To

96 demonstrate the role of T5 in modulating SLN function, we made use of site- directed mutagenesis and adenoviral gene transfer into adult rat ventricular myocytes and studied the effect of phosphorylation mutant SLN on calcium transients and myocyte contractility. The data presented here demonstrate that mutation of threonine 5 to alanine (T5A) preserved the inhibitory effect of SLN,

whereas substituting T5 with glutamic acid (T5E), which mimics phosphorylation,

abolished the inhibitory effect of SLN. Further, we provide evidence that SLN can

be phosphorylated by calcium-calmodulin dependent kinase II (CaMKII).

5.3 MATERIALS AND METHODS

5.3.1 Mutagenesis and generation of recombinant adenovirus

The amino acid mutations of Thr 5 Ala (ACT GCA) and Thr 5 Glu

(ACT GAG) were introduced into Rat SLN cDNA by polymerase chain reaction

(PCR). The adenoviral construct containing either N-terminal FLAG tagged SLN

(NF-SLN) (14) or N-terminal FLAG tagged SLN mutants (NF-SLNT5A or NF-

SLNT5E) were generated as described in our previous publication (14). Briefly,

mutant or wild-type SLN was cloned in frame to FLAG tag and subcloned into the

shuttle vector, pAdTrack-CMV (Stratagene). The shuttle vector containing the

cDNA of interest (with a CMV promoter) was transformed into BJ5183-AD1 to produce recombinant adenoviral plasmids. The recombinant plasmids were

transfected into AD-293 HEK cells and amplified by 3-4 passages. Cells were

collected after full cytopathic effect became evident, 2-3 days after plaque

97 appearance. Virus was released by 3 cycles of freezing and thawing, and virus was collected by centrifuging at 2,500 rpm for 10 minutes and collecting the supernatant that contained the viral stock. The final viral titers were determined by plaque assay with the final yield at 109 to 1010 pfu/ml. (45)

5.3.2 Myocyte Isolation and culture

Cardiac myocytes were isolated from adult Sprague Dawley rats as

described earlier with modifications (2) (92). Briefly, the heart was removed from

an adult male rat and mounted on a modified Langendorff perfusion apparatus.

The heart was perfused with Krebs-Henseleit buffer (KHB) (118 mmol/L NaCl, 4.8

mmol/L KCl, 25 mmol/L HEPES, 1.25 mmol/L K2HPO4, 1.25 mmol/L MgSO4, and

11 mmol/L glucose) containing 1 mM Ca2+ for 5 minutes, and then the perfusion

was switched to Ca2+-free KHB with 20µM EGTA. After 10 minutes, collagenase

(1 mg/mL) and BSA (1mg/mL) were added to the Ca2+-free KHB, and the heart

was perfused for 20 minutes. After 20 minutes, the Ca2+ concentration in the

perfusing solution was raised to 1 mM, in 4 stepwise increments. The heart was

removed to a sterile beaker containing enzyme solution (1 mM Ca2+-KHB + 1

mg/mL collagenase+ 1mg/mL BSA). After removing the atria, the ventricles were

minced gently and incubated in a 37°C water bath for 5 minutes with gentle

swirling. Digests were collected by centrifugation and the cells were resuspended

in 1 mM Ca2+-KHB + 2% BSA. The cells were allowed to gravity settle, the supernatant was removed, and the cells were resuspended in DMEM + 5% FBS

+ 1% penicillin/streptomycin (P/S) and plated on laminin coated coverslips for 2 h

98 prior to replacing the media with serum-free DMEM containing recombinant

adenovirus. Myocytes were infected with either wild-type (NF-SLN) or mutant

(NF-SLNT5A or NF-SLNT5E) adenovirus, at a multiplicity of infection (MOI) of

100 for 48 h. Uninfected cardiac myocytes maintained in culture for 48 h, referred

as control(s) were also used for all subsequent experiments .

5.3.3. Western Blot analysis

Cultured ventricular myocytes were lyzed in 6x sample buffer[(30% glycerol, 10% SDS, 600mM dithiothreitol, 350mM Tris-Cl ph 6.8, trace of

Bromophenol blue) supplemented with NaF(6mM) and protease inhibitors] and were immediately frozen in liquid N2. (48) Protein samples were analyzed by

sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and

protein loading was normalized using Coomasie staining. For Western blot

analysis, myocyte protein samples were electrophoretically separated by SDS-

PAGE (10% for SERCA2a and CSQ, 14% for FLAG and PLB) and transferred to

nitrocellulose membrane. Membranes were immunoprobed with following primary

antibodies: anti-rabbit SERCA2a, anti-rabbit PLB, anti-rabbit CSQ (ABR), anti-

mouse FLAG (SIGMA), anti-rabbit S16 or T17 PLB antibody (Badrilla, UK).

Signals were detected by Super Signal WestDura substrate (Pierce) and

quantitated by densitometry.

5.3.4. Immunostaining of isolated cardiac myocytes.

Isolated rat ventricular myocytes were infected with either wildtype NF-

SLN or mutant NF-SLNT5A or NF-SLNT5E adenovirus (at 100 MOI) and

processed for immunostaining and confocal imaging (92) (14). Cells were incubated in primary antibody (rabbit polyclonal SERCA2a, mouse monoclonal

FLAG antibody, [Sigma]) in phosphate buffered saline (PBS) containing

2%normal goat serum and 1% Triton-X-100 for 1.5 h. The glass coverslips were

washed three times with PBS containing 1% Triton-X-100(PBS-T). Cells were

incubated with Texas Red conjugated goat anti-rabbit and FITC-conjugated goat

anti-mouse (Molecular Probes) secondary antibodies for 1h, followed by three

washes with PBS-T. After immunostaining, cells were visualized by excitation at

488nm for FITC and 543nm for Texas Red using the Zeiss Laser Scanning

Microsope (LSM510)

5.3.5. Myocyte shortening measurements

Cardiac myocyte shortening measurements were done as described

earlier (59, 91) using the IonOptix system. The myocytes placed in tissue

chambers (Cell microcontrols), were kept on the stage of the inverted microscope

(Nikon TE-2000S). Myocytes were field stimulated at 1Hz and superfused with

Tyrode solution (in mM/L: - 140 NaCl, 4 KCl, 1 MgCl2, 1 CaCl2, 10 glucose, and 5

HEPES (pH 7.4). Myocytes used for all functional experiments were rod-shaped

without spontaneous contraction and could react to pacing and to different

100 reagents throughout the experiment. After being equilibrated in Tyrode’s solution,

5-6 cells were studied randomly in each preparation for each group. Cells from 3-

4 different preparations were studied for each group. The soft-edge software

(IonOptix) was used to capture changes in cell length during shortening and

relengthening. Data were expressed as percent of resting cell length (%RCL). To

determine the β-adrenergic receptor mediated contraction, the isoproterenol dose-response curve was generated.

5.3.6. Calcium transient measurements

Myocytes were loaded at 22 °C with Fluo-4 AM (5 µM, Molecular Probes,

Eugene, OR) for 10 min. Myocytes are placed in a chamber on the stage of a

Nikon-TE2000S inverted microscope and imaged through a Fluor 40X oil

objective. Myocytes were field-stimulated at 1Hz and superfused with Tyrode’s

2+ solution containing 1mmol/L CaCl2. Intracellular calcium [Ca ]i was measured by

Fluo-4 epifluorescence with excitation at 480 ± 20 nm and emission at 535 ± 25

nm. The illumination field was restricted to a small spot to get emission from a single cell. 5-6 cells were studied randomly in each preparation for each group.

Cells from 3-4 different preparations were studied for each group. Calcium transients were analyzed using the IonOptix software. Data were expressed as

F/Fo, where F is the fluorescence intensity and Fo is the intensity at rest. To

determine the effect of β-adrenergic receptor stimulation on calcium transients, an isoproterenol dose-response curve was generated.

101 5.3.7. In vitro CaMKII phosphorylation

WT and T5A mutant human and mouse SLN were cloned into the bacterial expression vector pET23d (Novagen) and the protein was purified according to the manufacturer’s instructions. In vitro phosphorylation was carried out using a CaMKII phosphorylation kit (New England Biolabs) according to manufacturer’s instructions. Briefly, prior to SLN protein phosphorylation, CaMKII was activated by autophosphorylation by incubating for 10 min at 30°C in a

CaMKII buffer (in mM/L 50 Tris-HCl, 10 MgCl2, 2 dithiothretol and 0.1 Na2 EDTA) supplemented with 100µMATP, 1.2 µM Calmodulin and 2mM CaCl2. The T5A mutant and WT proteins were labeled with 100µCi/µmol γ-P32 ATP and phosphorylated using activated CaMKII. Labeled proteins were resolved on 14%

SDS-PAGE and autoradiographed.

5.3.8 Statistics

Data shown are mean ± SEM. Statistical significance was estimated by unpaired Student's t test. A value of p < 0.05 was considered statistically significant.

5.4. RESULTS

5.4.1. Mutant SLN targets to the SR and co-localizes with SERCA2a

To determine if the mutant SLN targets the SR membrane and co- localizes with SERCA2a in a pattern similar to that of WT–SLN, we performed

102 immunostaining and confocal imaging of myocytes overexpressing mutant SLN using FLAG and SERCA2a antibodies. Our data in Figure 5.1 show that both

T5A and T5E SLN mutants have a distinct horizontal and vertical pattern similar to WT-SLN. Further, this pattern (green) is indistinguishable from that seen with

SERCA2a antibody (red and orange overlay). These results indicate that point mutation of T5 did not affect the SR membrane targeting and co-localization with

SERCA pump.

FLAG SERCA OVERLAY

Negative Control

Ad.NF-SLN

Ad.NF-T5A

Ad.NF-T5E

Figure 5.1. Confocal microscopic images of rat ventricular myocytes, showing the co-localization of WT and mutant SLN with SERCA2a. Rat ventricular myocytes were infected with Ad. WT SLN, Ad. T5A or Ad.T5E or left uninfected and stained with FLAG antibody (green) and SERCA2a (red) antibody. Orange-overlay of images showing co-localization.

103

5.4.2. Expression of mutant SLN does not alter the expression and

functional status of PLB

To determine if the overexpression of mutant SLN altered the levels of

SERCA and PLB protein levels and its basal phosphorylation status, quantitative

Western blot analysis was performed. Our results in Figure 5.2 show that

SERCA2a, PLB and CSQ protein levels were not altered in myocytes infected

with either SLN WT or mutant adenoviruses. The basal phosphorylation of PLB

at serine 16 (PLB-S16) and threonine 17 (PLB-T17) in myocytes expressing WT or

mutant SLN were not different from control myocytes (Fig 5.2). These results

suggest that the overexpression of mutant SLN did not alter the expression levels

of SERCA and PLB proteins.

C WT T5A T5E

SERCA

PLB

CSQ

PLB-S16

PLB-T17

Figure 5.2- Expression of SERCA, PLB, CSQ and phospho PLB levels in control and Ad.WT or Ad.T5 mutant SLN- infected myocytes. Representative western blots analysis with different SDS-PAGE gel concentrations (10% for SERCA and CSQ, 14% for PLB and phospho-PLB) were used to resolve protein samples from control myocytes (C) or myocytes infected with adenovirus for WT, T5A or T5A and immunoprobed.

104

5.4.3. Mutation of T5 alters the rate and amplitude of Ca2+ transients

Threonine 5 at the N-terminus was shown to modulate the SLN function on SR calcium uptake (38, 82). Therefore to evaluate the effect T5A or T5E

2+ mutation on [Ca ]i transients, we measured the amplitude, half-time to relaxation

(RT50) and time to peak value (TTp) of calcium transients. Our results in Fig 5.3

2+ show that the T5A mutant affected [Ca ]i levels in a pattern similar to wild-type

SLN. Interestingly, T5E mutant which mimics phosphorylation has no effect on

2+ [Ca ]i. (∆ F/Fo Control=0.104 ± 0.02, WT=0.052 ± 0.007, T5A=0.038 ± 0.006,

T5E=0.09 ± 0.01) (Fig 5.3A). The time to 50% decay of calcium (Fig 5.3C) was

significantly prolonged to a similar extent in both WT and T5A mutant, where as

T5E has no effect and was similar to that of uninfected control myocytes.

(Control= 0.068 ± 0.005s, WT=0.102 ± 0.012s, T5A=0.11± 0.01 and T5E=0.07 ±

0.007s) Time to 50% peak amplitude (Fig 5.3B) was not significantly different

between the groups. (Control= 0.041 ± 0.002s, WT= 0.035± 0.002s, T5A= 0.043

± 0.002s, and T5E= 0.037 ± 0.001s)

105 A 0.15 Control 0.12 SLN-WT ** T5A 0.09 T5E F/Fo

Δ 0.06 * * 0.03

0.00 Control SLN-WT T5A T5E

0.05 ** 0.04 ** **

0.03

0.02 TTp50(s) 0.01

0.00 Control WT T5A T5E

C 0.125 * * 0.100 ** 0.075

0.050 RT50(s) 0.025

0.000 Control WT T5A T5E

Figure 5.3- T5 mutation in SLN alters cardiac myocyte calcium 2+ transient:- Summary data (expressed as mean ±S.E.M.) of A- Ca transient amplitude B-Time to 50% peak amplitude and C of Ca2+ transient relaxation (RT50) * Significantly different from control (p<0.05) . ** Not significantly different from control myocytes.

106 5.4.4. Effect of mutant SLN on myocyte contractility

To determine whether the mutation of SLN at T5 has an effect on

contractile function of myocytes, we analyzed myocyte contractility by edge detection. After 48h of infection with either Ad. WT, Ad.T5A or Ad.T5E myocytes

were paced at 1Hz and cell shortening was measured. Results in Fig 5.4 show that overexpression of WT SLN significantly decreased the cell shortening

compared to control myocytes consistent with our previous report (14). The point

mutation of T5A had similar inhibitory effect on myocyte contractility as that of

WT, whereas the T5E mutant which mimics phosphorylation lost its inhibitory effect. (%RCL:-6.3 ± 0.54% in control, 4.0 ± 0.79% WT, 3.89 ± 0.39% for T5A and 5.429 ± 0.54% in T5E myocytes). Consistent with cell shortening, WT and

T5A mutant showed prolonged time to 50% relaxation, but T5E mutant had no

effect on relaxation and comparable to control myocytes. (RT50:- Control- 0.1004

± 0.006s, WT- 0.1302 ± 0.01s, T5A- 0.1320 ± 0.012s and T5E- 0.1021 ± 0.008s).

The time to peak contraction was not significantly different between the groups

(data not shown). B A 7 0.15 Control * * 6 ** SLN-WT ** 5 * SLN-T5A * 0.10 4 SLN-T5E 3 %RCL RT50 (s) 0.05 2 1 0 0.00 Control SLN-WT SLN-T5A SLN-T5E Control SLN-WT SLN-T5A SLN-T5E

Figure 5.4- Mutation of T5 alters myocyte contractility - Contraction amplitude (A) and time to 50% relaxation (B) in control myocytes and myocytes infected with SLN-WT, T5A or T5E adenovirus. Myocyte contractility was analyzed after 48 h by pacing at 1Hz. * Significantly different from control myocytes; ** Not significant. (p<0.05)

107 5.4.5. Effects of Isoproterenol on Myocyte Contractility

To determine the role of T5 on mediating the β-adrenergic responses, myocyte infected with either Ad. WT or Ad.T5A or Ad.T5E was challenged sequentially with 10-9M and 10-6M isoproterenol (ISO) and myocyte contractility was measured. Data shown in Fig. 5.5 indicate that under low concentrations of

ISO (10-9M), myocytes expressing Ad.T5A continue to inhibit myocyte contractility but at high concentration, the inhibitory effect is abolished. This effect is similar to that observed in WT-SLN. On the other hand, myocytes infected with

Ad.T5E respond to ISO in a manner comparable to control myocytes.

C 17.5 WT 15.0 T5A 12.5 * T5E

10.0 * 7.5 %RCL

5.0 2.5 0.0 C WT T5AT5E C WT T5AT5E C WT T5AT5E

-ISO 10-9 M ISO 10-6M ISO

Figure 5.5 Contractility of myocytes in response to isoproterenol: - Summary data of contraction amplitude in response to low (10-9 M) and high concentrations (10-6 M) of isoproterenol (ISO). Contractility of control myocytes (C) and myocytes infected with either adenovirus SLN - WT, T5A or T5E was measured after 48 h. * Significantly different from control. P<0.05 (N=5 for each group)

108 5.4.6. CaMKII phosphorylates SLN at T5 in vitro

To determine if CaMKII can phosphorylate SLN at T5, in vitro

phosphorylation of purified WT and mutant SLN was carried out. Our results show that SLN can be phosphorylated by CaMKII and this phosphorylation can be abolished by mutating T5 to alanine. These results suggest that T5 is a potential phosphorylation site for CaMKII.

Mouse SLN Human SLN

WT T5A T5A WT

10 20 10 20 10 20 10 20 µl

Phospho SLN

Figure 5.6:- In vitro phosphorylation of mouse and human SLN by CaMKII- Representative autoradiogram showing phosphorylated SLN in bacterially expressed mouse and human SLN. (Details in materials and methods section)

5.6. DISCUSSION

Recent studies have identified SLN as an important regulator of SERCA2a and a mediator of β-adrenergic responses in atria (9, 12, 38). However, the

mechanism which modulates SLN function is largely unknown. In this study,

using adenoviral gene transfer and site-directed mutagenesis, we demonstrated

that threonine 5 at the N-terminus of SLN plays a critical role in modulating SLN

function.

109

First we demonstrated that point mutation of T5 to alanine or glutamic acid has no effect on the SR membrane targeting and its co-localization with

SERCA2a. Overexpression of T5A mutant SLN, which mimics the dephosphorylated form, was able to inhibit calcium transients and myocyte contractility to the same extent as the wild-type SLN, indicating that mutation of threonine to alanine did not alter the functional integrity of SLN. On the other hand, mutation of T5 to glutamic acid, which mimics phosphorylation resulted in loss of inhibitory function of SLN. These results suggest that threonine 5 plays a critical role in SLN function. Our results were further supported by studies in which point mutation of SLN T5 to glutamic acid has been shown to lost its inhibitory effect on calcium uptake function in a heterologous cell system (82).

These results along with the high conservation of T5 among all species (84) (37) further suggesting the importance of T5 in SLN function.

Although our studies have pointed out the importance of T5 phosphorylation in modulating SLN function, the signaling pathway which mediates the SLN phosphorylation during β-adrenergic responses is yet to be analyzed. One of the recent studies suggests that a serine-threonine protein kinase, STK16 could phosphorylate SLN at Thr5 (38). However, the physiological relevance of STK16 in cardiac function and its role during β-adrenergic stimulation are not known. On the other hand, the role of CaMKII in SR calcium handling is well established. (16, 50, 64)Therefore, we predict that CaMKII could be involved in the phosphorylation of SLN at Thr5. In vitro phosphorylation of SLN

110 by CaMKII and blended responses to ISO by T5E mutant SLN further supports our hypothesis. However, in our studies the inhibitory effect of T5A mutant was relieved upon ISO stimulation. This could be due to the use of ventricular myocytes which express high levels of PLB. (60) It is well known that PLB is the major mediator of β-adrenergic responses in ventricular myocytes (16, 71).

Therefore, any effect elicited by T5A mutant SLN during high ISO infusion could possibly be overridden by PLB.

Role of CaMKII in mediating β-adrenergic responses of heart is not fully understood. CaMKII has been shown to phosphorylate phospholamban at Thr17

during β-adrenergic receptor stimulation(16, 71). However, experiments using transgenic mouse models have indicated that Ser16 phosphorylation alone is

sufficient for mediating the β-adrenergic responsiveness in the ventricles(30).

Further, studies have shown that Thr17 phosphorylation of PLB is mainly involved

in the frequency-dependent activation of myocyte contraction and relaxation

rather than mediating β-adrenergic responses (110). In the atria, PLB levels are

relatively low in comparison to the ventricle (11, 60), suggesting that SLN could be the major mediator of β-adrenergic responses in atria. This was further supported by the blunted ISO responses observed in the SLN null atria

(CHAPTER 4). In this study, we hypothesized that phosphorylation of SLN at T5 by CaMKII mediates the β-adrenergic responses in atria. This idea was further supported by our findings which showed phosphorylation of SLN at T5 by

CaMKII.

111 In summary, our studies suggest that T5 at the N-terminus of SLN plays an important role in modulating the SLN function. Phosphorylation of T5 by

CaMKII could be the major mechanism which mediates the β-adrenergic responses in atria. Future studies should be directed towards understanding the

CaMKII signaling pathway in mediating β-adrenergic responses through SLN in the atria.

112

CHAPTER 6

DISCUSSION

Sarcolipin a 31aa proteolipid, was originally identified to co-purify with the

rabbit skeletal muscle SR Ca2+ ATPase (82). Subsequent studies at the mRNA

level have shown that SLN is abundant in the skeletal muscles and expressed at low levels in the heart of rabbit and human (14, 78). Additionally, co-expression studies suggested that SLN is a skeletal muscle counterpart of PLB and regulates SERCA1a (8, 69, 82). These were however, in vitro studies using heterologous cell culture systems. Recent mRNA data suggested that SLN is expressed at high levels in the atrial compartment of the heart (14, 78). However, there was a complete lack of data elucidating the physiological role of SLN in the

heart. Therefore, the major goal of my thesis project was to define the functional

significance of SLN expression in the atria and its role in SR Ca2+ homeostasis.

113 In my thesis work I tried to address the following key questions:

1) Is SLN a regulator of SERCA pump in the heart?

2) Is SLN expression altered during cardiac pathology?

3) How does SLN mediate its inhibitory effect on SERCA pump?

4) How does alterations in the SERCA: SLN ratio influence cardiac calcium

transport and physiology?

5) Is SLN an important mediator of the β-adrenergic response in the atria?

6) Is phosphorylation of T5 in SLN an important mechanism of regulation of

SERCA pump?

Differential expression of SLN in atria vs. ventricle

In the first part of this study, we performed detailed analyses of SLN

protein expression in different species and during muscle development and

compared it to PLB expression. In addition, we evaluated SLN expression in the

atria of diseased myocardium. Our data clearly demonstrate that SLN exhibits

both tissue and species specific differences in its expression. In the heart SLN

and PLB show a complementary pattern of expression. While SLN protein is

predominantly expressed in the atria, PLB is expressed more in the ventricle compared to the atria (25). The differential expression of these two regulators in atria vs. ventricle could in part explain the difference in calcium handling and contractile properties of the two chambers.

The data showing upregulation of SLN in the PLB null atria and the corresponding downregulation of PLB in the atria of SLN TG mice, suggest that

114 PLB function can be compensated by SLN. These findings also indicate the fine

tuning of the stoichiometric ratio between these two regulators and the SERCA pump is necessary to maintain the atrial calcium uptake function.

An important finding in this study is that SLN expression closely follows

SERCA2a expression during development in atria and skeletal muscles.

Interestingly, SLN levels are undetectable in the ventricle throughout

development. Whereas, PLB levels are high throughout development. This

indicates that PLB is the main regulator of SERCA2a in the ventricle, while SLN

predominantly regulates SERCA2a in the atria. Further, this is the first study to

investigate altered SLN protein levels in atria of diseased myocardium. We

showed that SLN protein levels are altered in the atria of canine model of chronic

heart failure. These findings suggest that SLN levels could critically determine

SERCA pump activity and Ca2+ homeostasis in diseased myocardium.

Sarcolipin inhibits SERCA2a activity in the heart

SLN protein level in the normal ventricle is almost undetectable (extremely difficult to detect by conventional western blotting) (11, 105). This however, does

not exclude developmental or disease related SLN expression in this chamber.

To better define the role of SLN in cardiac physiology, we generated a mouse

model with cardiac specific overexpression of SLN in the heart. The

overexpression of SLN in the ventricle resulted in decreased SERCA pump

affinity for calcium, Ca2+ transient amplitude and shortening, and slowed

relaxation. More importantly, our data indicate that the inhibitory effect of SLN

115 can be reversed by the β-adrenergic agonist, isoproterenol, suggesting that SLN acts as a reversible inhibitor similar to PLB.

SLN function is independent of PLB

A critical question regarding the inhibitory effect of SLN on SERCA2a is whether SLN mediates its inhibitory effect 1) via PLB, or 2) independently through direct interaction with SERCA2a (19). Previous findings from

MacLennnan lab (6) indicated that the inhibitory effect of SLN on SERCA pump is mediated through PLB. Studies using HEK293 cells suggested that SLN forms a binary complex with PLB and thereby prevents polymerization of PLB to form pentamers (6) (10). This leads to the formation of more monomers, the inhibitory form of PLB and super-inhibition of SERCA2a (6, 8, 10). However this mechanism is feasible only when SLN and PLB are co-expressed. SLN is expressed at high levels in tissues which express either low amount of PLB (as in atria and slow-twitch skeletal muscle) or no PLB (as in fast-twitch skeletal muscles) (11, 13, 14). These studies point to a possible independent role for

SLN. Data from this study indicate that SLN co-localizes and interacts with

SERCA2a in cardiac myocytes. Further, overexpression of SLN in the ventricle did not alter PLB monomer: pentamer ratio or its basal phosphorylation. This suggests that the inhibitory effect of SLN on SERCA2a is independent of PLB.

This finding is further supported by data from a transgenic mouse model overexpressing SLN in PLB null background (38), which demonstrate that the inhibitory effect of SLN is independent of PLB.

116

Physiological relevance of SLN in the atria

SLN is predominantly expressed in the atria (11, 14, 19, 78, 105). SLN-

mediated superinhibition in the atria appears counter-intuitive and contradicts the

fact that the kinetics of atrial Ca2+ removal is faster than that of the ventricles (53,

72). This characteristic of the atrial compartment was previously attributed to the

higher SERCA levels and the lower PLB expression in atria versus ventricle (25,

72). In this study we addressed the relevance of SLN in atrial physiology using a

SLN knockout mouse model. We report for the first time that ablation of SLN is

associated with an increase in the Vmax of Ca2+ uptake rates in atria, suggesting

that SLN could regulate the kinetics of the ATPase activity at one or more steps.

Interestingly, the ablation of sarcolipin resulted in an increase in atrial Ca2+ transient amplitudes and this resulted in enhanced atrial contractility. Further, atria from sarcolipin null mice showed a blunted response to isoproterenol stimulation, implicating SLN to be a mediator of β-adrenergic response in atria.

Taken together, studies from the SLN null mice have identified the existence of distinct modulators of SERCA2a in atria and ventricle.

SLN as a mediator of β-adrenergic response in the atria

Despite our knowledge of the functional effects of SLN on SERCA activity, fundamental questions remain with regard to mechanisms by which SLN exerts its inhibitory action. Data from transgenic mice suggest that the inhibitory effect of

SLN on SERCA2a is relieved upon β-adrenergic stimulation (9, 12, 19, 38). This

117 implies that the inhibition of SERCA2a by SLN is reversible. In the last part of this

study we explored the possibility of phosphorylation being the mechanism of by which SLN exerts its reversible inhibition on SERCA2a. Our data indicate that

Threonine 5 residue at the N-terminus of SLN is a key residue which could be

phosphorylated. Using in vitro phosphorylation we have identified that SLN can

be phosphorylated by CaMKII at the Threonine 5 residue.

It is well established that PLB is a major regulator of the β-adrenergic

stimulatory effects in the heart (55, 67, 71, 85) . Activation of β-adrenergic

receptors in the sarcolemma, by increased levels of catecholamines, leads to the

phosphorylation of PLB at Ser16 and Thr 17 sites via the cAMP-dependent

kinase(PKA) and Ca2+ /calmodulin dependent kinase (CaMKII) signaling

pathways, respectively (30, 71). It is important to note that Ser16 phosphorylation

is a prerequisite for the phosphorylation of Thr 17 (30). Further, there is evidence

suggesting that Ser16 can be phosphorylated independently of Thr 17 in vivo and

that phosphorylation of Ser16 by PKA is sufficient for mediating the maximal β-

adrenergic response(30, 50). This indicates that PKA pathway is the major

signaling pathway in response to β-adrenergic stimulation and that PLB is one of

the main targets in the ventricle. In the heart SLN shows a differential pattern of

expression in atria vs. ventricle. SLN is predominantly expressed in the atria (11)

(78). In this study, we showed that SLN can be phosphorylated at threonine 5 by

CaMKII. Based on these results and its abundant expression in the atria, we

propose a model that shows SLN as a mediator of β-adrenergic response in the

atria (Fig 6.1). Future studies should be directed towards understanding the role 118 of SLN and CaMKII in mediating the β-adrenergic response in the atria. These studies are important towards understanding the regulation of SERCA2a in the atria and identify SLN as a potential therapeutic target to improve cardiac contractility

Figure 6.1:-Proposed model depicting the role of PLB and SLN in

mediating β-adrenergic response: Active calcium transport into the SR is facilitated by the SERCA2a pump and its activity is regulated by PLB and SLN

.In the ventricle PLB is the principal mediator of the β−adrenergic response. In its dephosphorylated form PLB is an inhibi tor of SERCA2a. Phosphorylation of PLB in response to β-adrenergic stimulation by protein kinase A (PKA) or Calcium calmodulin dependent kinase (CAMKII) relieves the inhibitory effect of PLB on SERCA2a. In the atria, SLN predominates and plays an important role in mediating the β-adrenergic response. Phosphorylation of SLN by CAMKII relieves the inhibitory effect of SLN on SERCA2a in the atria, activating SERCA2a leading the atrial muscle relaxation.

119 Conclusions and Perspectives

This study sheds new light on SLN as a novel regulator of SERCA2a which can mediate β-adrenergic responses in atria. However, several questions remain unanswered with respect to the mechanism of SLN action. Most importantly, does the CaMKII pathway mediate SLN phosphorylation during β- adrenergic stimulation? Does phosphorylation of T5 affect the binding of SLN to

SERCA2a? In addition, the phosphatases which dephosphorylate SLN involved are yet to be identified. At this time it is also unclear why there are two different inhibitors of SERCA2a in the heart. It is quite likely that PLB and SLN evolved independently and adapted to unique functions in their cellular environments. A better understanding of the mechanism of SLN action and role in atrial calcium handling is important in treating atrial pathology including atrial fibrillation.

120

BIBLIOGRAPHY

1. Ahmmed GU, Xu Y, Hong Dong P, Zhang Z, Eiserich J, and Chiamvimonvat N. Nitric oxide modulates cardiac Na(+) channel via protein kinase A and protein kinase G. Circulation research 89: 1005-1013, 2001.

2. ALtschuld R, Gibb L, Ansel A, Hohl C, Kruger FA, and Brierley GP. Calcium tolerance of isolated rat heart cells. Journal of molecular and cellular cardiology 12: 1383-1395, 1980.

3. Arai M, Matsui H, and Periasamy M. Sarcoplasmic reticulum gene expression in cardiac hypertrophy and heart failure. Circulation research 74: 555- 564, 1994.

4. Arai M, Otsu K, MacLennan DH, Alpert NR, and Periasamy M. Effect of thyroid hormone on the expression of mRNA encoding sarcoplasmic reticulum proteins. Circulation research 69: 266-276, 1991.

5. Arai M, Otsu K, MacLennan DH, and Periasamy M. Regulation of sarcoplasmic reticulum gene expression during cardiac and skeletal muscle development. The American journal of physiology 262: C614-620, 1992.

6. Asahi M, Kurzydlowski K, Tada M, and MacLennan DH. Sarcolipin inhibits polymerization of phospholamban to induce superinhibition of sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs). The Journal of biological chemistry 277: 26725-26728, 2002.

7. Asahi M, McKenna E, Kurzydlowski K, Tada M, and MacLennan DH. Physical interactions between phospholamban and sarco(endo)plasmic reticulum Ca2+-ATPases are dissociated by elevated Ca2+, but not by phospholamban phosphorylation, vanadate, or thapsigargin, and are enhanced by ATP. The Journal of biological chemistry 275: 15034-15038, 2000. 121 8. Asahi M, Nakayama H, Tada M, and Otsu K. Regulation of sarco(endo)plasmic reticulum Ca2+ adenosine triphosphatase by phospholamban and sarcolipin: implication for cardiac hypertrophy and failure. Trends in cardiovascular medicine 13: 152-157, 2003.

9. Asahi M, Otsu K, Nakayama H, Hikoso S, Takeda T, Gramolini AO, Trivieri MG, Oudit GY, Morita T, Kusakari Y, Hirano S, Hongo K, Hirotani S, Yamaguchi O, Peterson A, Backx PH, Kurihara S, Hori M, and MacLennan DH. Cardiac-specific overexpression of sarcolipin inhibits sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA2a) activity and impairs cardiac function in mice. Proceedings of the National Academy of Sciences of the United States of America 101: 9199-9204, 2004.

10. Asahi M, Sugita Y, Kurzydlowski K, De Leon S, Tada M, Toyoshima C, and MacLennan DH. Sarcolipin regulates sarco(endo)plasmic reticulum Ca2+- ATPase (SERCA) by binding to transmembrane helices alone or in association with phospholamban. Proceedings of the National Academy of Sciences of the United States of America 100: 5040-5045, 2003.

11. Babu GJ, Bhupathy P, Carnes CA, Billman GE, and Periasamy M. Differential expression of sarcolipin protein during muscle development and cardiac pathophysiology. Journal of molecular and cellular cardiology 43: 215- 222, 2007.

12. Babu GJ, Bhupathy P, Petrashevskaya NN, Wang H, Raman S, Wheeler D, Jagatheesan G, Wieczorek D, Schwartz A, Janssen PM, Ziolo MT, and Periasamy M. Targeted overexpression of sarcolipin in the mouse heart decreases sarcoplasmic reticulum calcium transport and cardiac contractility. The Journal of biological chemistry 281: 3972-3979, 2006.

13. Babu GJ, Wheeler D, Alzate O, and Periasamy M. Solubilization of membrane proteins for two-dimensional gel electrophoresis: identification of sarcoplasmic reticulum membrane proteins. Analytical biochemistry 325: 121- 125, 2004.

14. Babu GJ, Zheng Z, Natarajan P, Wheeler D, Janssen PM, and Periasamy M. Overexpression of sarcolipin decreases myocyte contractility and calcium transient. Cardiovascular research 65: 177-186, 2005.

122

15. Batkai S, Racz IB, Ivanics T, Toth A, Hamar J, Slaaf DW, Reneman RS, and Ligeti L. An in vivo model for studying the dynamics of intracellular free calcium changes in slow- and fast-twitch muscle fibres. Pflugers Arch 438: 665- 670, 1999.

16. Bers DM. Cardiac excitation-contraction coupling. Nature 415: 198-205, 2002.

17. Bers DM. Ryanodine and the calcium content of cardiac SR assessed by caffeine and rapid cooling contractures. The American journal of physiology 253: C408-415, 1987.

18. Bers DM and Perez-Reyes E. Ca channels in cardiac myocytes: structure and function in Ca influx and intracellular Ca release. Cardiovascular research 42: 339-360, 1999.

19. Bhupathy P, Babu GJ, and Periasamy M. Sarcolipin and phospholamban as regulators of cardiac sarcoplasmic reticulum Ca2+ ATPase. Journal of molecular and cellular cardiology 42: 903-911, 2007.

20. Bicer S and Reiser PJ. Myosin light chain isoform expression among single mammalian skeletal muscle fibers: species variations. Journal of muscle research and cell motility 25: 623-633, 2004.

21. Billman GE. A comprehensive review and analysis of 25 years of data from an in vivo canine model of sudden cardiac death: implications for future anti- arrhythmic drug development. Pharmacology & therapeutics 111: 808-835, 2006.

22. Billman GE and Kukielka M. Effect of endurance exercise training on heart rate onset and heart rate recovery responses to submaximal exercise in animals susceptible to ventricular fibrillation. J Appl Physiol 102: 231-240, 2007.

23. Billman GE and Kukielka M. Effects of endurance exercise training on heart rate variability and susceptibility to sudden cardiac death: protection is not due to enhanced cardiac vagal regulation. J Appl Physiol 100: 896-906, 2006.

123

24. Billman GE, Kukielka M, Kelley R, Moustafa-Bayoumi M, and Altschuld RA. Endurance exercise training attenuates cardiac beta2-adrenoceptor responsiveness and prevents ventricular fibrillation in animals susceptible to sudden death. American journal of physiology 290: H2590-2599, 2006.

25. Boknik P, Unkel C, Kirchhefer U, Kleideiter U, Klein-Wiele O, Knapp J, Linck B, Luss H, Muller FU, Schmitz W, Vahlensieck U, Zimmermann N, Jones LR, and Neumann J. Regional expression of phospholamban in the human heart. Cardiovascular research 43: 67-76, 1999.

26. Briggs FN, Lee KF, Wechsler AW, and Jones LR. Phospholamban expressed in slow-twitch and chronically stimulated fast-twitch muscles minimally affects calcium affinity of sarcoplasmic reticulum Ca(2+)-ATPase. The Journal of biological chemistry 267: 26056-26061, 1992.

27. Buffy JJ, Buck-Koehntop BA, Porcelli F, Traaseth NJ, Thomas DD, and Veglia G. Defining the intramembrane binding mechanism of sarcolipin to calcium ATPase using solution NMR spectroscopy. Journal of molecular biology 358: 420-429, 2006.

28. Carr AN and Kranias EG. Thyroid hormone regulation of calcium cycling proteins. Thyroid 12: 453-457, 2002.

29. Chiesi M and Schwaller R. Reversal of phospholamban-induced inhibition of cardiac sarcoplasmic reticulum Ca(2+)-ATPase by tannin. Biochemical and biophysical research communications 202: 1668-1673, 1994.

30. Chu G and Kranias EG. Functional interplay between dual site phospholambam phosphorylation: insights from genetically altered mouse models. Basic research in cardiology 97 Suppl 1: I43-48, 2002.

31. Frank K, Tilgmann C, Shannon TR, Bers DM, and Kranias EG. Regulatory role of phospholamban in the efficiency of cardiac sarcoplasmic reticulum Ca2+ transport. Biochemistry 39: 14176-14182, 2000.

124 32. Frank KF, Bolck B, Erdmann E, and Schwinger RH. Sarcoplasmic reticulum Ca2+-ATPase modulates cardiac contraction and relaxation. Cardiovascular research 57: 20-27, 2003.

33. Fujii J, Maruyama K, Tada M, and MacLennan DH. Expression and site- specific mutagenesis of phospholamban. Studies of residues involved in phosphorylation and pentamer formation. The Journal of biological chemistry 264: 12950-12955, 1989.

34. Fujii J, Ueno A, Kitano K, Tanaka S, Kadoma M, and Tada M. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban. The Journal of clinical investigation 79: 301-304, 1987.

35. Fujii J, Zarain-Herzberg A, Willard HF, Tada M, and MacLennan DH. Structure of the rabbit phospholamban gene, cloning of the human cDNA, and assignment of the gene to human chromosome 6. The Journal of biological chemistry 266: 11669-11675, 1991.

36. Gayan-Ramirez G, Vanzeir L, Wuytack F, and Decramer M. Corticosteroids decrease mRNA levels of SERCA pumps, whereas they increase sarcolipin mRNA in the rat diaphragm. The Journal of physiology 524 Pt 2: 387- 397, 2000.

37. Gramolini AO, Kislinger T, Asahi M, Li W, Emili A, and MacLennan DH. Sarcolipin retention in the endoplasmic reticulum depends on its C-terminal RSYQY sequence and its interaction with sarco(endo)plasmic Ca(2+)-ATPases. Proceedings of the National Academy of Sciences of the United States of America 101: 16807-16812, 2004.

38. Gramolini AO, Trivieri MG, Oudit GY, Kislinger T, Li W, Patel MM, Emili A, Kranias EG, Backx PH, and Maclennan DH. Cardiac-specific overexpression of sarcolipin in phospholamban null mice impairs myocyte function that is restored by phosphorylation. Proceedings of the National Academy of Sciences of the United States of America 103: 2446-2451, 2006.

39. Greene AL, Lalli MJ, Ji Y, Babu GJ, Grupp I, Sussman M, and Periasamy M. Overexpression of SERCA2b in the heart leads to an increase in

125 sarcoplasmic reticulum calcium transport function and increased cardiac contractility. The Journal of biological chemistry 275: 24722-24727, 2000.

40. Hamlin RL. Animal models of ventricular arrhythmias. Pharmacology & therapeutics 113: 276-295, 2007.

41. Harkins AB, Kurebayashi N, and Baylor SM. Resting myoplasmic free calcium in frog skeletal muscle fibers estimated with fluo-3. Biophysical journal 65: 865-881, 1993.

42. Hasenfuss G. Alterations of calcium-regulatory proteins in heart failure. Cardiovascular research 37: 279-289, 1998.

43. Hasenfuss G and Pieske B. Calcium cycling in congestive heart failure. Journal of molecular and cellular cardiology 34: 951-969, 2002.

44. Hasenfuss G, Reinecke H, Studer R, Meyer M, Pieske B, Holtz J, Holubarsch C, Posival H, Just H, and Drexler H. Relation between myocardial function and expression of sarcoplasmic reticulum Ca(2+)-ATPase in failing and nonfailing human myocardium. Circulation research 75: 434-442, 1994.

45. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, and Vogelstein B. A simplified system for generating recombinant adenoviruses. Proceedings of the National Academy of Sciences of the United States of America 95: 2509-2514, 1998.

46. Hellstern S, Pegoraro S, Karim CB, Lustig A, Thomas DD, Moroder L, and Engel J. Sarcolipin, the shorter homologue of phospholamban, forms oligomeric structures in detergent micelles and in liposomes. The Journal of biological chemistry 276: 30845-30852, 2001.

47. Hobai IA and O'Rourke B. Decreased sarcoplasmic reticulum calcium content is responsible for defective excitation-contraction coupling in canine heart failure. Circulation 103: 1577-1584, 2001.

126 48. Huke S and Bers DM. Temporal dissociation of frequency-dependent acceleration of relaxation and protein phosphorylation by CaMKII. Journal of molecular and cellular cardiology 42: 590-599, 2007.

49. Ji Y, Lalli MJ, Babu GJ, Xu Y, Kirkpatrick DL, Liu LH, Chiamvimonvat N, Walsh RA, Shull GE, and Periasamy M. Disruption of a single copy of the SERCA2 gene results in altered Ca2+ homeostasis and cardiomyocyte function. The Journal of biological chemistry 275: 38073-38080, 2000.

50. Ji Y, Li B, Reed TD, Lorenz JN, Kaetzel MA, and Dedman JR. Targeted inhibition of Ca2+/calmodulin-dependent protein kinase II in cardiac longitudinal sarcoplasmic reticulum results in decreased phospholamban phosphorylation at threonine 17. The Journal of biological chemistry 278: 25063-25071, 2003.

51. Ji Y, Loukianov E, and Periasamy M. Analysis of sarcoplasmic reticulum Ca2+ transport and Ca2+ ATPase enzymatic properties using mouse cardiac tissue homogenates. Analytical biochemistry 269: 236-244, 1999.

52. Jiang MT, Moffat MP, and Narayanan N. Age-related alterations in the phosphorylation of sarcoplasmic reticulum and myofibrillar proteins and diminished contractile response to isoproterenol in intact rat ventricle. Circulation research 72: 102-111, 1993.

53. Kaasik A, Paju K, Minajeva A, and Ohisalo J. Decreased expression of phospholamban is not associated with lower beta-adrenergic activation in rat atria. Molecular and cellular biochemistry 223: 109-115, 2001.

54. Kaasik A, Paju K, Vetter R, and Seppet EK. Thyroid hormones increase the contractility but suppress the effects of beta-adrenergic agonist by decreasing phospholamban expression in rat atria. Cardiovascular research 35: 106-112, 1997.

55. Kadambi VJ, Koss KL, Grupp IL, and Kranias EG. Phospholamban modulates murine atrial contractile parameters and responses to beta-adrenergic agonists. Journal of molecular and cellular cardiology 30: 1275-1284, 1998.

127 56. Kadambi VJ, Ponniah S, Harrer JM, Hoit BD, Dorn GW, 2nd, Walsh RA, and Kranias EG. Cardiac-specific overexpression of phospholamban alters calcium kinetics and resultant cardiomyocyte mechanics in transgenic mice. The Journal of clinical investigation 97: 533-539, 1996.

57. Kimura Y, Asahi M, Kurzydlowski K, Tada M, and MacLennan DH. Phospholamban domain I/cytochrome b5 transmembrane sequence chimeras do not inhibit SERCA2a. FEBS letters 425: 509-512, 1998.

58. Kimura Y, Kurzydlowski K, Tada M, and MacLennan DH. Phospholamban regulates the Ca2+-ATPase through intramembrane interactions. The Journal of biological chemistry 271: 21726-21731, 1996.

59. Klein AL, Wold LE, and Ren J. The cyclooxygenase-2 product prostaglandin E2 modulates cardiac contractile function in adult rat ventricular cardiomyocytes. Pharmacol Res 49: 99-103, 2004.

60. Koss KL, Ponniah S, Jones WK, Grupp IL, and Kranias EG. Differential phospholamban gene expression in murine cardiac compartments. Molecular and physiological analyses. Circulation research 77: 342-353, 1995.

61. Kubalova Z, Terentyev D, Viatchenko-Karpinski S, Nishijima Y, Gyorke I, Terentyeva R, da Cunha DN, Sridhar A, Feldman DS, Hamlin RL, Carnes CA, and Gyorke S. Abnormal intrastore calcium signaling in chronic heart failure. Proceedings of the National Academy of Sciences of the United States of America 102: 14104-14109, 2005.

62. Kubo H, Margulies KB, Piacentino V, 3rd, Gaughan JP, and Houser SR. Patients with end-stage congestive heart failure treated with beta-adrenergic receptor antagonists have improved ventricular myocyte calcium regulatory protein abundance. Circulation 104: 1012-1018, 2001.

63. Lexell J, Jarvis JC, Currie J, Downham DY, and Salmons S. Fibre type composition of rabbit tibialis anterior and extensor digitorum longus muscles. Journal of anatomy 185 ( Pt 1): 95-101, 1994.

128 64. Li L, Chu G, Kranias EG, and Bers DM. Cardiac myocyte calcium transport in phospholamban knockout mouse: relaxation and endogenous CaMKII effects. The American journal of physiology 274: H1335-1347, 1998.

65. Lindemann JP, Jones LR, Hathaway DR, Henry BG, and Watanabe AM. beta-Adrenergic stimulation of phospholamban phosphorylation and Ca2+- ATPase activity in guinea pig ventricles. The Journal of biological chemistry 258: 464-471, 1983.

66. Lindner M, Erdmann E, and Beuckelmann DJ. Calcium content of the sarcoplasmic reticulum in isolated ventricular myocytes from patients with terminal heart failure. Journal of molecular and cellular cardiology 30: 743-749, 1998.

67. Luo W, Grupp IL, Harrer J, Ponniah S, Grupp G, Duffy JJ, Doetschman T, and Kranias EG. Targeted ablation of the phospholamban gene is associated with markedly enhanced myocardial contractility and loss of beta-agonist stimulation. Circulation research 75: 401-409, 1994.

68. MacDougall LK, Jones LR, and Cohen P. Identification of the major protein phosphatases in mammalian cardiac muscle which dephosphorylate phospholamban. European journal of biochemistry / FEBS 196: 725-734, 1991.

69. MacLennan DH, Asahi M, and Tupling AR. The regulation of SERCA-type pumps by phospholamban and sarcolipin. Annals of the New York Academy of Sciences 986: 472-480, 2003.

70. MacLennan DH, Kimura Y, and Toyofuku T. Sites of regulatory interaction between calcium ATPases and phospholamban. Annals of the New York Academy of Sciences 853: 31-42, 1998.

71. MacLennan DH and Kranias EG. Phospholamban: a crucial regulator of cardiac contractility. Nature reviews 4: 566-577, 2003.

72. Maier LS, Barckhausen P, Weisser J, Aleksic I, Baryalei M, and Pieske B. Ca(2+) handling in isolated human atrial myocardium. American journal of physiology 279: H952-958, 2000.

129 73. Maier LS, Bers DM, and Pieske B. Differences in Ca(2+)-handling and sarcoplasmic reticulum Ca(2+)-content in isolated rat and rabbit myocardium. Journal of molecular and cellular cardiology 32: 2249-2258, 2000.

74. Mascioni A, Karim C, Barany G, Thomas DD, and Veglia G. Structure and orientation of sarcolipin in lipid environments. Biochemistry 41: 475-482, 2002.

75. Mattiazzi A, Mundina-Weilenmann C, Guoxiang C, Vittone L, and Kranias E. Role of phospholamban phosphorylation on Thr17 in cardiac physiological and pathological conditions. Cardiovascular research 68: 366-375, 2005.

76. McComas AJ. Oro-facial muscles: internal structure, function and ageing. Gerodontology 15: 3-14, 1998.

77. Minamisawa S, Uemura N, Sato Y, Yokoyama U, Yamaguchi T, Inoue K, Nakagome M, Bai Y, Hori H, Shimizu M, Mochizuki S, and Ishikawa Y. Post- transcriptional downregulation of sarcolipin mRNA by triiodothyronine in the atrial myocardium. FEBS letters 580: 2247-2252, 2006.

78. Minamisawa S, Wang Y, Chen J, Ishikawa Y, Chien KR, and Matsuoka R. Atrial chamber-specific expression of sarcolipin is regulated during development and hypertrophic remodeling. The Journal of biological chemistry 278: 9570- 9575, 2003.

79. Nagai R, Zarain-Herzberg A, Brandl CJ, Fujii J, Tada M, MacLennan DH, Alpert NR, and Periasamy M. Regulation of myocardial Ca2+-ATPase and phospholamban mRNA expression in response to pressure overload and thyroid hormone. Proceedings of the National Academy of Sciences of the United States of America 86: 2966-2970, 1989.

80. Napolitano R, Vittone L, Mundina C, Chiappe de Cingolani G, and Mattiazzi A. Phosphorylation of phospholamban in the intact heart. A study on the physiological role of the Ca(2+)-calmodulin-dependent protein kinase system. Journal of molecular and cellular cardiology 24: 387-396, 1992.

81. Nishijima Y, Feldman DS, Bonagura JD, Ozkanlar Y, Jenkins PJ, Lacombe VA, Abraham WT, Hamlin RL, and Carnes CA. Canine nonischemic left

130 ventricular dysfunction: a model of chronic human cardiomyopathy. Journal of cardiac failure 11: 638-644, 2005.

82. Odermatt A, Becker S, Khanna VK, Kurzydlowski K, Leisner E, Pette D, and MacLennan DH. Sarcolipin regulates the activity of SERCA1, the fast-twitch skeletal muscle sarcoplasmic reticulum Ca2+-ATPase. The Journal of biological chemistry 273: 12360-12369, 1998.

83. Odermatt A, Kurzydlowski K, and MacLennan DH. The vmax of the Ca2+- ATPase of cardiac sarcoplasmic reticulum (SERCA2a) is not altered by Ca2+/calmodulin-dependent phosphorylation or by interaction with phospholamban. The Journal of biological chemistry 271: 14206-14213, 1996.

84. Odermatt A, Taschner PE, Scherer SW, Beatty B, Khanna VK, Cornblath DR, Chaudhry V, Yee WC, Schrank B, Karpati G, Breuning MH, Knoers N, and MacLennan DH. Characterization of the gene encoding human sarcolipin (SLN), a proteolipid associated with SERCA1: absence of structural mutations in five patients with Brody disease. Genomics 45: 541-553, 1997.

85. Pan BS, Hannon JD, Wiedmann R, Potter JD, Kranias EG, Shen YT, Johnson RG, Jr., and Housmans PR. Effects of isoproterenol on twitch contraction of wild type and phospholamban-deficient murine ventricular myocardium. Journal of molecular and cellular cardiology 31: 159-166, 1999.

86. Pashmforoush M, Lu JT, Chen H, Amand TS, Kondo R, Pradervand S, Evans SM, Clark B, Feramisco JR, Giles W, Ho SY, Benson DW, Silberbach M, Shou W, and Chien KR. Nkx2-5 pathways and congenital heart disease; loss of ventricular myocyte lineage specification leads to progressive cardiomyopathy and complete heart block. Cell 117: 373-386, 2004.

87. Paterlini MG and Thomas DD. The alpha-helical propensity of the cytoplasmic domain of phospholamban: a molecular dynamics simulation of the effect of phosphorylation and mutation. Biophysical journal 88: 3243-3251, 2005.

88. Periasamy M and Huke S. SERCA pump level is a critical determinant of Ca(2+)homeostasis and cardiac contractility. Journal of molecular and cellular cardiology 33: 1053-1063, 2001.

131 89. Periasamy M and Kalyanasundaram A. SERCA pump isoforms: their role in calcium transport and disease. Muscle & nerve 35: 430-442, 2007.

90. Reed TD, Babu GJ, Ji Y, Zilberman A, Ver Heyen M, Wuytack F, and Periasamy M. The expression of SR calcium transport ATPase and the Na(+)/Ca(2+)Exchanger are antithetically regulated during mouse cardiac development and in Hypo/hyperthyroidism. Journal of molecular and cellular cardiology 32: 453-464, 2000.

91. Ren J, Porter JE, Wold LE, Aberle NS, Muralikrishnan D, and Haselton JR. Depressed contractile function and adrenergic responsiveness of cardiac myocytes in an experimental model of Parkinson disease, the MPTP-treated mouse. Neurobiology of aging 25: 131-138, 2004.

92. Rust EM, Albayya FP, and Metzger JM. Identification of a contractile deficit in adult cardiac myocytes expressing hypertrophic cardiomyopathy- associated mutant troponin T proteins. The Journal of clinical investigation 103: 1459-1467, 1999.

93. Schiaffino S and Reggiani C. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiological reviews 76: 371-423, 1996.

94. Schultz Jel J, Glascock BJ, Witt SA, Nieman ML, Nattamai KJ, Liu LH, Lorenz JN, Shull GE, Kimball TR, and Periasamy M. Accelerated onset of heart failure in mice during pressure overload with chronically decreased SERCA2 calcium pump activity. American journal of physiology 286: H1146-1153, 2004.

95. Shimura M, Minamisawa S, Yokoyama U, Umemura S, and Ishikawa Y. Mechanical stress-dependent transcriptional regulation of sarcolipin gene in the rodent atrium. Biochemical and biophysical research communications 334: 861- 866, 2005.

96. Simmerman HK, Collins JH, Theibert JL, Wegener AD, and Jones LR. Sequence analysis of phospholamban. Identification of phosphorylation sites and two major structural domains. The Journal of biological chemistry 261: 13333- 13341, 1986.

132 97. Simmerman HK and Jones LR. Phospholamban: protein structure, mechanism of action, and role in cardiac function. Physiological reviews 78: 921- 947, 1998.

98. Stull LB, Leppo MK, Marban E, and Janssen PM. Physiological determinants of contractile force generation and calcium handling in mouse myocardium. Journal of molecular and cellular cardiology 34: 1367-1376, 2002.

99. Tada M and Katz AM. Phosphorylation of the sarcoplasmic reticulum and sarcolemma. Annual review of physiology 44: 401-423, 1982.

100. Tada M and Toyofuku T. Molecular regulation of phospholamban function and expression. Trends in cardiovascular medicine 8: 330-340, 1998.

101. Trivieri MG, Oudit GY, Sah R, Kerfant BG, Sun H, Gramolini AO, Pan Y, Wickenden AD, Croteau W, Morreale de Escobar G, Pekhletski R, St Germain D, Maclennan DH, and Backx PH. Cardiac-specific elevations in thyroid hormone enhance contractility and prevent pressure overload-induced cardiac dysfunction. Proceedings of the National Academy of Sciences of the United States of America 103: 6043-6048, 2006.

102. Tupling AR, Asahi M, and MacLennan DH. Sarcolipin overexpression in rat slow twitch muscle inhibits sarcoplasmic reticulum Ca2+ uptake and impairs contractile function. The Journal of biological chemistry 277: 44740-44746, 2002.

103. Uemura N, Ohkusa T, Hamano K, Nakagome M, Hori H, Shimizu M, Matsuzaki M, Mochizuki S, Minamisawa S, and Ishikawa Y. Down-regulation of sarcolipin mRNA expression in chronic atrial fibrillation. European journal of clinical investigation 34: 723-730, 2004.

104. Valverde CA, Mundina-Weilenmann C, Said M, Ferrero P, Vittone L, Salas M, Palomeque J, Petroff MV, and Mattiazzi A. Frequency-dependent acceleration of relaxation in mammalian heart: a property not relying on phospholamban and SERCA2a phosphorylation. The Journal of physiology 562: 801-813, 2005.

133

105. Vangheluwe P, Schuermans M, Zador E, Waelkens E, Raeymaekers L, and Wuytack F. Sarcolipin and phospholamban mRNA and protein expression in cardiac and skeletal muscle of different species. The Biochemical journal 389: 151-159, 2005.

106. Vangheluwe P, Sipido KR, Raeymaekers L, and Wuytack F. New perspectives on the role of SERCA2's Ca2+ affinity in cardiac function. Biochimica et biophysica acta 1763: 1216-1228, 2006.

107. Vittone L, Mundina C, Chiappe de Cingolani G, and Mattiazzi A. cAMP and calcium-dependent mechanisms of phospholamban phosphorylation in intact hearts. The American journal of physiology 258: H318-325, 1990.

108. Wawrzynow A, Theibert JL, Murphy C, Jona I, Martonosi A, and Collins JH. Sarcolipin, the "proteolipid" of skeletal muscle sarcoplasmic reticulum, is a unique, amphipathic, 31-residue peptide. Archives of biochemistry and biophysics 298: 620-623, 1992.

109. Xu Y, Zhang Z, Timofeyev V, Sharma D, Xu D, Tuteja D, Dong PH, Ahmmed GU, Ji Y, Shull GE, Periasamy M, and Chiamvimonvat N. The effects of intracellular Ca2+ on cardiac K+ channel expression and activity: novel insights from genetically altered mice. The Journal of physiology 562: 745-758, 2005.

110. Zhao W, Uehara Y, Chu G, Song Q, Qian J, Young K, and Kranias EG. Threonine-17 phosphorylation of phospholamban: a key determinant of frequency-dependent increase of cardiac contractility. Journal of molecular and cellular cardiology 37: 607-612, 2004.

111. Ziolo MT, Martin JL, Bossuyt J, Bers DM, and Pogwizd SM. Adenoviral gene transfer of mutant phospholamban rescues contractile dysfunction in failing rabbit myocytes with relatively preserved SERCA function. Circulation research 96: 815-817, 2005.

112. Zvaritch E, Backx PH, Jirik F, Kimura Y, de Leon S, Schmidt AG, Hoit BD, Lester JW, Kranias EG, and MacLennan DH. The transgenic expression of highly inhibitory monomeric forms of phospholamban in mouse heart impairs cardiac contractility. The Journal of biological chemistry 275: 14985-14991, 2000.

134