DOCSLIB.ORG

( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2019/0382802 A1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2019/0382802 A1 INDUS 20190382802A1 IN (19 ) United States (12 ) Patent Application Publication ( 10) Pub. No .: US 2019/0382802 A1 Keasling et al. (43 ) Pub . Date : Dec. 19 , 2019 (54 ) GENETICALLY MODIFIED HOST CELLS Publication Classification AND USE OF SAME FOR PRODUCING ( 51 ) Int. Ci. ISOPRENOID COMPOUNDS C12P 5/00 (2006.01 ) C12N 9/10 (2006.01 ) (71 ) Applicant: The Regents of the University of C12N 15/81 (2006.01 ) California , Oakland , CA (US ) C12P 23/00 (2006.01 ) C12N 9/04 (2006.01 ) ( 72 ) Inventors : Jay D. Keasling, Berkeley , CA (US ) ; C12N 9/88 ( 2006.01 ) James Kirby , Berkeley , CA (US ) ; Eric (52 ) U.S. CI. M. Paradise , Vienna , VA (US ) CPC C12P 5/007 ( 2013.01) ; C12N 9/1085 ( 2013.01 ) ; C12N 15/81 ( 2013.01 ) ; C12P 23/00 ( 2013.01 ); C12Y 402/03024 ( 2013.01) ; C12N ( 21) Appl. No .: 16 /554,125 9/88 ( 2013.01 ) ; C12Y 101/01034 (2013.01 ) ; C12Y 205/01092 (2013.01 ) ; C12N 9/0006 ( 2013.01) ( 22 ) Filed : Aug. 28 , 2019 (57 ) ABSTRACT The present invention provides genetically modified eukary otic host cells that produce isoprenoid precursors or iso Related U.S. Application Data prenoid compounds. A subject genetically modified host cell ( 63 ) Continuation of application No. 15/ 722,844 , filed on comprises increased activity levels of one or more of Oct. 2 , 2017 , now Pat . No. 10,435,717 , which is a mevalonate pathway enzymes , increased levels of prenyl continuation of application No. 14 /451,056 , filed on transferase activity , and decreased levels of squalene syn Aug. 4 , 2014 , now Pat. No. 9,809,829 , which is a thase activity . Methods are provided for the production of an continuation of application No. 11/ 571,315 , filed on isoprenoid compound or an isoprenoid precursor in a subject Nov. 13 , 2007, now Pat . No. 8,828,684 , filed as genetically modified eukaryotic host cell . The methods application No. PCT/ US2005 /026190 on Jul. 21, generally involve culturing a subject genetically modified 2005 . host cell under conditions that promote production of high ( 60 ) Provisional application No. 60 /592,009 , filed on Jul. levels of an isoprenoid or isoprenoid precursor compound . 27 ,9 2004 . Specification includes a Sequence Listing . Patent Application Publication Dec. 19 , 2019 Sheet 1 of 8 US 2019/0382802 A1 H3Cvia SCOA Acetyl - CoA 1 ERG10 H?? SCOA Acetoacetyl- COA ERG13 H3C OH O HO2C SCOA HMG - COA HMG1 HMG2 H3C OH HO2C OH Mevalonate ERG 12 H3C OH HO2C OPO3 Mevalonate - P ERG8 H3C OH HO2C OPO3PO3 Mevalonate -PP ERG19 IDI1 th OPO3PO3 OPO3PO3 Isopentenyl diphosphate ( IPP ) Dimethylallyl diphosphate (DMAPP ) FIG . 1 Patent Application Publication Dec. 19 , 2019 Sheet 2 of 8 US 2019/0382802 A1 diene11-Amorpha4, Dimethylallyldiphosphate(DMAPP) OPO3PO3 ERG20 ADSADS OPO3PO3 OPO3P03 IDI1 Geranyldiphosphate(GPP) ERG20 Farnesyldiphosphate(FPP) OPO3PO3 diphosphateIPP)Isopentenyl( FIG.2 IPP ERG9 Squalene 4 ERG1,7,11,24,25,6,2,3,4,5Ergosterolcopy HO Patent Application Publication Dec. 19, 2019 Sheet 3 of 8 US 2019/0382802 A1 HH 100 80 4060 Time(h) ADStHMGR&+ +ECM22&ADS FIG.3B ADS UPC2&ADS* 20 0 5.00 4.0 3.0 2.0 1.0 0.0 ) OD600/ mL / equivalent caryophyllene ug( Production Amorphadiene 100 80 60 Time(h) ADStHMGR&- +UPC2&ADS +ECM22&ADS FIG.3A 40 ADS 20 15.00 12.00 9.00 6.00 3.004 0.00+ ) OD600/ mL /equivalent caryophyllene ug( Production Amorphadiene Patent Application Publication Dec. 19, 2019 Sheet 4 of 8 US 2019/0382802 A1 10.00 9.00 - 64 hours 8.00 - N 87 hours 7.00 6.00 OD600equivalent/)mLcaryophyllene(ug 5.00 - ProductionAmorphadine 4.00 - 3.00 1. = 2.00 - 1.00 0.00 0 0.1 0.3 0.5 1 Methionine Concentration (MM ) FIG . 4 Patent Application Publication Dec. 19, 2019 Sheet 5 of 8 US 2019/0382802 A1 90.0 ads 80.0 hmgr upc2 70.0 + erg9 60.0 * erg20 (ugcaryophylleneequivalent/mLOD600) 50.0 ProductionAmorphadiene 40.0 30.0 20.0 10.0 0.0 0 24 48 72 96 120 144 Time (h ) FIG . 5 Patent Application Publication Dec. 19, 2019 Sheet 6 of 8 US 2019/0382802 A1 FIG . 6 Truncated HMGR coding sequence ATGGTTTTAACCAATAAAACAGTCATTTCTGGATCGAAAGTCAAAAGTTTATCATCTGCGCAATCGAGCTC ATCAGGACCTTCATCATCTAGTGAGGAAGATGATTCCCGCGATATTGAAAGCTTGGATAAGAAAATACGTC CTTTAGAAGAATTAGAAGCATTATTAAGTAGTGGAAATACAAAACAATTGAAGAACAAAGAGGTCGCTGCC TTGGTTATTCACGGTAAGTTACCTTTGTACGCTTTGGAGAAAAAATTAGGTGATACTACGAGAGCGGTTGC GGTACGTAGGAAGGCTCTTTCAATTTTGGCAGAAGCTCCTGTATTAGCATCTGATCGTTTACCATATAAAA ATTATGACTACGACCGCGTATTTGGCGCTTGTTGTGAAAATGTTATAGGTTACATGCCTTTGCCCGTTGGT GTTATAGGCCCCTTGGTTATCGATGGTACATCTTATCATATACCAATGGCAACTACAGAGGGTTGTTTGGT AGCTTCTGCCATGCGTGGCTGTAAGGCAATCAATGCTGGCGGTGGTGCAACAACTGTTTTAACTAAGGATG GTATGACAAGAGGCCCAGTAGTCCGTTTCCCAACTTTGAAAAGATCTGGTGCCTGTAAGATATGGTTAGAC TCAGAAGAGGGACAAAACGCAATTAAAAAAGCTTTTAACTCTACATCAAGATTTGCACGTCTGCAACATAT TCAAACTTGTCTAGCAGGAGATTTACTCTTCATGAGATTTAGAACAACTACTGGTGACGCAATGGGTATGA ATATGATTTCTAAAGGTGTCGAATACTCATTAAAGCAAATGGTAGAAGAGTATGGCTGGGAAGATATGGAG GTTGTCTCCGTTTCTGGTAACTACTGTACCGACAAAAAACCAGCTGCCATCAACTGGATCGAAGGTCGTGG TAAGAGTGTCGTCGCAGAAGCTACTATTCCTGGTGATGTTGTCAGAAAAGTGTTAAAAAGTGATGTTTCCG CATTGGTTGAGTTGAACATTGCTAAGAATTTGGTTGGATCTGCAATGGCTGGGTCTGTTGGTGGATTTAAC GCACATGCAGCTAATTTAGTGACAGCTGTTTTCTTGGCATTAGGACAAGATCCTGCACAAAATGTTGAAAG TTCCAACTGTATAACATTGATGAAAGAAGTGGACGGTGATTTGAGAATTTCCGTATCCATGCCATCCATCG AAGTAGGTACCATCGGTGGTGGTACTGTTCTAGAACCACAAGGTGCCATGTTGGACTTATTAGGTGTAAGA GGCCCGCATGCTACCGCTCCTGGTACCAACGCACGTCAATTAGCAAGAATAGTTGCCTGTGCCGTCTTGGC AGGTGAATTATCCTTATGTGCTGCCCTAGCAGCCGGCCATTTGGTTCAAAGTCATATGACCCACAACAGGA AACCTGCTGAACCAACAAAACCTAACAATTTGGACGCCACTGATATAAATCGTTTGAAAGATGGGTCCGTC ACCTGCATTAAATCCTAA ( SEQ ID NO : 1 ) Patent Application Publication Dec. 19 , 2019 Sheet 7 of 8 US 2019/0382802 A1 FIG . 7A Met Val Leu Thr Asn Lys Thr Val Ile Ser Gly Ser Lys Val Lys Ser 1 5 10 15 Leu Ser Ser Ala Gln Ser Ser Ser Ser Gly Pro Ser Ser Ser Ser Glu 20 25 30 Glu Asp Asp Ser Arg Asp Ile Glu Ser Leu Asp Lys Lys Ile Arg Pro 35 40 45 Leu Glu Glu Leu Glu Ala Leu Leu Ser Ser Gly Asn Thr Lys Gin Leu 50 55 60 Lys Asn Lys Glu Val Ala Ala Leu Val Ile His Gly Lys Leu Pro Leu 65 70 75 80 Tyr Ala Leu Glu Lys Lys Leu Gly Asp Thr Thr Arg Ala Val Ala Val 85 90 95 Arg Arg Lys Ala Leu Ser Ile Leu Ala Glu Ala Pro Val Leu Ala Ser 100 105 110 Asp Arg Leu Pro Tyr Lys Asn Tyr Asp Tyr Asp Arg Val Phe Gly Ala 115 120 125 Cys Cys Glu Asn Val Ile Gly Tyr Met Pro Leu Pro Val Gly Val Ile 130 135 140 Gly Pro Leu Val Ile Asp Gly Thr Ser Tyr His Ile Pro Met Ala Thr 145 150 155 160 Thr Glu Gly Cys Leu Val Ala Ser Ala Met Arg Gly Cys Lys Ala Ile 165 170 175 Asn Ala Gly Gly Gly Ala Thr Thr Val Leu Thr Lys Asp Gly Met Thr 180 185 190 Arg Gly Pro Val Val Arg Phe Pro Thr Leu Lys Arg Ser Gly Ala Cys 195 200 205 Lys Ile Trp Leu Asp Ser Glu Glu Gly Gin Asn Ala Ile Lys Lys Ala 210 215 220 Phe Asn Ser Thr Ser Arg Phe Ala Arg Leu Gin His Ile Gin Thr Cys 225 230 235 240 Leu Ala Gly Asp Leu Leu Phe Met Arg Phe Arg Thr Thr Thr Gly Asp 245 250 255 Ala Met Gly Met Asn Met Ile Ser Lys Gly Val Glu Tyr Ser Leu Lys 260 265 270 Gln Met Val Glu Glu Tyr Gly Trp Glu Asp Met Glu Val Val Ser Val 275 280 285 Ser Gly Asn Tyr Cys Thr Asp Lys Lys Pro Ala Ala Ile Asn Trp Ile 290 295 300 Glu Gly Arg Gly Lys Ser Val Val Ala Glu Ala Thr Ile Pro Gly Asp 305 310 315 320 Val Val Arg Lys Val Leu Lys Ser Asp Val Ser Ala Leu Val Glu Leu 325 330 335 Asn Ile Ala Lys Asn Leu Val Gly Ser Ala Met Ala Gly Ser Val Gly 340 345 350 Gly Phe Asn Ala His Ala Ala Asn Leu Val Thr Ala Val Phe Leu Ala 355 360 365 Leu Gly Gln Asp Pro Ala Gin Asn Val Glu Ser Ser Asn Cys Ile Thr 370 375 380 Leu Met Lys Glu Val Asp Gly Asp Leu Arg Ile Ser Val Ser Met Pro 385 390 395 400 Patent Application Publication Dec. 19, 2019 Sheet 8 of 8 US 2019/0382802 A1 FIG . 7B Ser Ile Glu Val Gly Thr Ile Gly Gly Gly Thr Val Leu Glu Pro Gln 405 410 415 Gly Ala Met Leu Asp Leu Leu Gly Val Arg Gly Pro His Ala Thr Ala 420 425 430 Pro Gly Thr Asn Ala Arg Gin Leu Ala Arg Ile Val Ala Cys Ala Val 435 440 445 Leu Ala Gly Glu Leu Ser Leu Cys Ala Ala Leu Ala Ala Gly His Leu 450 455 460 Val Gin Ser His Met Thr His Asn Arg Lys Pro Ala Glu Pro Thr Lys 465 470 475 480 Pro Asn Asn Leu Asp Ala Thr Asp Ile Asn Arg Leu Lys Asp Gly Ser 485 490 495 Val Thr Cys Ile Lys Ser ( SEQ ID NO : 2 ) 500 US 2019/0382802 A1 Dec. 19 , 2019 GENETICALLY MODIFIED HOST CELLS pharmaceuticals . A major obstacle to high level terpenoid AND USE OF SAME FOR PRODUCING biosynthesis is the production of terpene precursors . In ISOPRENOID COMPOUNDS Saccharomyces cerevisiae, the mevalonate pathway pro vides for production of isopentenyl diphosphate ( IPP ) , CROSS -REFERENCE which can be isomerized and polymerized into isoprenoids and terpenes of commercial value . Other valuable precursors [ 0001 ] This application claims the benefit of U.S. Provi are also produced , including farnesyl diphosphate ( FPP ) and sional Patent Application No.60 /592,009 filed Jul. 27 , 2004 , geranylgeranyl diphosphate (GPP ) . However , much of the which application is incorporated herein by reference in its reaction flux is directed towards the undesired later steps of entirety . the sterol pathway , resulting in the production of ergosterol . FIELD OF THE INVENTION [0006 ] There is a need in the art for improved isoprenoid producing or isoprenoid precursor -producing host cells that [ 0002 ] The present invention is in the field of production provide for high - level production of isoprenoid compounds, of isoprenoid compounds, and in particular host cells that are as well as the polyprenyl diphosphate precursors of such genetically modified to produce isoprenoid compounds . compounds . The present invention addresses this need and BACKGROUND OF THE INVENTION provides related advantages . [ 0003 ] Isoprenoids constitute an extremely large and LITERATURE diverse group of natural products that have a common biosynthetic origin , i.e., a single metabolic precursor , iso [0007 ] U.S. Patent Publication No.
Load more

Recommended publications
  • Multi-Substrate Terpene Synthases: Their Occurrence and Physiological
    FOCUSED REVIEW published: 12 July 2016 doi: 10.3389/fpls.2016.01019 Multi-Substrate Terpene Synthases: Edited by: Joshua L. Heazlewood, The University of Melbourne, Australia Their Occurrence and Physiological Reviewed by: Maaria Rosenkranz, Significance Helmholtz Zentrum München, Germany Leila Pazouki 1* and Ülo Niinemets 1, 2* Sandra Irmisch, University of British Columbia (UBC), 1 Department of Plant Physiology, Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Canada Tartu, Estonia, 2 Estonian Academy of Sciences, Tallinn, Estonia Pengxiang Fan, Michigan State University, USA Terpene synthases are responsible for synthesis of a large number of terpenes *Correspondence: in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15), and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5), mono- (C10), and diterpenes (C20). Leila Pazouki did her undergraduate Recent advances in characterization of genes and enzymes responsible for substrate and degree at the University of Tehran and master degree in Plant Biotechnology end product biosynthesis as well as efforts in metabolic engineering have demonstrated at the University of Bu Ali Sina in Iran. existence of a number of multi-substrate terpene synthases. This review summarizes the She worked as a researcher at the progress in the characterization of such multi-substrate terpene synthases and suggests Agricultural Biotechnology Research Institute of Iran (ABRII) for four years. that the presence of multi-substrate use might have been significantly underestimated.
    [Show full text]
  • Biosynthetic Origin of Complex Terpenoid Mixtures by Multiproduct Enzymes, Metal Cofactors, and Substrate Isomers
    Natural Products Chemistry & Research Review Article Biosynthetic Origin of Complex Terpenoid Mixtures by Multiproduct Enzymes, Metal Cofactors, and Substrate Isomers Vattekkatte A, Boland W * Department of Bioorganic Chemistry, Max Planck Institute for Chemical Ecology, Beutenberg Campus, Hans-Knöll-Strasse 8, D-07745 Jena, Germany ABSTRACT Terpenoids form a substantial portion of chemical diversity in nature. The enormous terpenoid diversity of more than 80,000 compounds is supported by the multisubstrate and multiproduct nature of certain enzymes from the various terpene synthases and terpene cyclases. These highly versatile enzymes are not only able to accept multiple substrates in their active site, but also simultaneously catalyze multiple reactions to the resultant multiple products. Interestingly, apart from the substrates and catalytic mechanisms, multiple regulation factors are able to alter the product profile of multiproduct terpene synthases. Simple variations in cellular conditions by changes in metal cofactors, assay pH, temperature and substrate geometry lead to significant shifts in product profiles. Switch in substrate stereochemistry for multiproduct terpene synthases in some case shows enhanced biocatalysis and in others initiates even a novel cyclization cascade. Hence, organisms can get access to a greater chemodiversity and avoid the expensive process of developing new biocatalysts just by simple changes in the cellular environment. This possibility of modulating chemical diversity provides immobile plants in the same generation access to an enhanced chemical arsenal for defense and communication by simply altering cofactors, pH level, and temperature and substrate geometry. Keywords: Terpenoids; Biocatalysis; Polymers; Substrate isomers; Catalysis INTRODUCTION and waxy cuticles acts as sunscreen, plant polymers like lignin Plants being immobile organisms do not have the ability to and rubber provide support and wound healing.
    [Show full text]
  • Metabolomics for Plant Improvement: Status and Prospects
    fpls-08-01302 August 3, 2017 Time: 16:49 # 1 View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by ICRISAT Open Access Repository REVIEW published: 07 August 2017 doi: 10.3389/fpls.2017.01302 Metabolomics for Plant Improvement: Status and Prospects Rakesh Kumar1,2, Abhishek Bohra3, Arun K. Pandey2, Manish K. Pandey2* and Anirudh Kumar4* 1 Department of Plant Sciences, University of Hyderabad (UoH), Hyderabad, India, 2 International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India, 3 Crop Improvement Division, Indian Institute of Pulses Research (IIPR), Kanpur, India, 4 Department of Botany, Indira Gandhi National Tribal University (IGNTU), Amarkantak, India Post-genomics era has witnessed the development of cutting-edge technologies that have offered cost-efficient and high-throughput ways for molecular characterization of the function of a cell or organism. Large-scale metabolite profiling assays have allowed researchers to access the global data sets of metabolites and the corresponding metabolic pathways in an unprecedented way. Recent efforts in metabolomics have been directed to improve the quality along with a major focus on yield related traits. Importantly, an integration of metabolomics with other approaches such as quantitative Edited by: genetics, transcriptomics and genetic modification has established its immense Manoj K. Sharma, Jawaharlal Nehru University, India relevance to plant improvement. An effective combination of these modern approaches Reviewed by: guides researchers to pinpoint the functional gene(s) and the characterization of massive Stefanie Wienkoop, metabolites, in order to prioritize the candidate genes for downstream analyses and University of Vienna, Austria ultimately, offering trait specific markers to improve commercially important traits.
    [Show full text]
  • Transcriptome Analysis of Thapsia
    PUBLISHED VERSION Drew, Damian; Dueholm, Bjorn; Weitzel, Corinna; Zhang, Ye; Sensen, Christoph W.; Simonsen, Henrik Transcriptome analysis of Thapsia laciniata rouy provides insights into terpenoid biosynthesis and diversity in apiaceae, International Journal of Molecular Sciences, 2013; 14(5):9080-9098. © 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/). PERMISSIONS http://www.mdpi.com/about/openaccess All articles published by MDPI are made immediately available worldwide under an open access license. This means: everyone has free and unlimited access to the full-text of all articles published in MDPI journals, and everyone is free to re-use the published material if proper accreditation/citation of the original publication is given. 8th August 2013 http://hdl.handle.net/2440/79105 Int. J. Mol. Sci. 2013, 14, 9080-9098; doi:10.3390/ijms14059080 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Transcriptome Analysis of Thapsia laciniata Rouy Provides Insights into Terpenoid Biosynthesis and Diversity in Apiaceae Damian Paul Drew 1,2, Bjørn Dueholm 1, Corinna Weitzel 1, Ye Zhang 3, Christoph W. Sensen 3 and Henrik Toft Simonsen 1,* 1 Department of Plant and Environmental Sciences, Faculty of Sciences, University of Copenhagen, Frederiksberg DK-1871, Denmark; E-Mails: [email protected] (D.P.D.); [email protected] (B.D.); [email protected] (C.W.) 2 Wine Science and Business, School of Agriculture Food and Wine, University of Adelaide, South Australia, SA 5064, Australia 3 Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Calgary, Calgary, AB T2N 1N4, Canada; E-Mails: [email protected] (Y.Z.); [email protected] (C.W.S.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +45-353-33328.
    [Show full text]
  • (Vitis Vinifera) Terpene Synthase Gene Family Based on Genome Assembly, Flcdna Cloning, and Enzyme Assays Diane M
    Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays Diane M. Martin, Sebastien Aubourg, Marina B Schouwey, Laurent Daviet, Michel Schalk, Omid Toub, Steven T. Lund, Joerg Bohlmann To cite this version: Diane M. Martin, Sebastien Aubourg, Marina B Schouwey, Laurent Daviet, Michel Schalk, et al.. Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays. BMC Plant Biology, BioMed Central, 2010, 10 (226), pp.10. 10.1186/1471-2229-10-226. hal-02663636 HAL Id: hal-02663636 https://hal.inrae.fr/hal-02663636 Submitted on 31 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Martin et al. BMC Plant Biology 2010, 10:226 http://www.biomedcentral.com/1471-2229/10/226 RESEARCH ARTICLE Open Access Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera) Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays Diane M Martin1,2†, Sébastien Aubourg3†, Marina B Schouwey4, Laurent Daviet4, Michel Schalk4, Omid Toub 1,2, Steven T Lund2, Jörg Bohlmann1* Abstract Background: Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology.
    [Show full text]
  • Download Author Version (PDF)
    RSC Advances This is an Accepted Manuscript, which has been through the Royal Society of Chemistry peer review process and has been accepted for publication. Accepted Manuscripts are published online shortly after acceptance, before technical editing, formatting and proof reading. Using this free service, authors can make their results available to the community, in citable form, before we publish the edited article. This Accepted Manuscript will be replaced by the edited, formatted and paginated article as soon as this is available. You can find more information about Accepted Manuscripts in the Information for Authors. Please note that technical editing may introduce minor changes to the text and/or graphics, which may alter content. The journal’s standard Terms & Conditions and the Ethical guidelines still apply. In no event shall the Royal Society of Chemistry be held responsible for any errors or omissions in this Accepted Manuscript or any consequences arising from the use of any information it contains. www.rsc.org/advances Page 1 of 49 RSC Advances Towards comprehension of complex chemical evolution and diversification of terpene and phenylpropanoid pathways in Ocimum species Priyanka Singh, Raviraj M. Kalunke, Ashok P. Giri * Plant Molecular Biology Unit, Division of Biochemical Sciences, CSIR-National Chemical Laboratory, Pune 411008, Maharashtra, India Manuscript *Corresponding author: Ashok P. Giri Tel.: +91-2025902710; Fax: +91-2025902648 E-mail: [email protected] Accepted Advances RSC 1 RSC Advances Page 2 of 49 Abstract Ocimum species present a wide array of diverse secondary metabolites possessing immense medicinal and economic value. The importance of this genus is undisputable and exemplified in the ancient science of Chinese and Indian (Ayurveda) traditional medicine.
    [Show full text]
  • Strategies for the Production of Biochemicals in Bioenergy Crops Chien‑Yuan Lin1,2 and Aymerick Eudes1,2*
    Lin and Eudes Biotechnol Biofuels (2020) 13:71 https://doi.org/10.1186/s13068-020-01707-x Biotechnology for Biofuels REVIEW Open Access Strategies for the production of biochemicals in bioenergy crops Chien‑Yuan Lin1,2 and Aymerick Eudes1,2* Abstract Industrial crops are grown to produce goods for manufacturing. Rather than food and feed, they supply raw materials for making biofuels, pharmaceuticals, and specialty chemicals, as well as feedstocks for fabricating fber, biopolymer, and construction materials. Therefore, such crops ofer the potential to reduce our dependency on petrochemicals that currently serve as building blocks for manufacturing the majority of our industrial and consumer products. In this review, we are providing examples of metabolites synthesized in plants that can be used as bio‑based platform chemicals for partial replacement of their petroleum‑derived counterparts. Plant metabolic engineering approaches aiming at increasing the content of these metabolites in biomass are presented. In particular, we emphasize on recent advances in the manipulation of the shikimate and isoprenoid biosynthetic pathways, both of which being the source of multiple valuable compounds. Implementing and optimizing engineered metabolic pathways for accumulation of coproducts in bioenergy crops may represent a valuable option for enhancing the commercial value of biomass and attaining sustainable lignocellulosic biorefneries. Keywords: Bioenergy crops, Shikimate, Isoprenoids, Terpenes, Metabolic engineering Background monomers as substrates. Moreover, achieving higher Bioenergy crops are grown with low inputs to gener- plant biomass yields at reduced cost and enabling ef- ate lignocellulosic biomass that constitutes a sustainable cient deconstruction of the recalcitrant lignocellulosic source of renewable energy. One appealing purpose of material represent two other important milestones bioenergy crops is the deconstruction of their biomass towards the cost-efectiveness of biochemical production into aromatics and simple sugars for downstream conver- [2, 3].
    [Show full text]
  • Exploring Genome Structure and Gene Regulation Related to Virulence in Fungal Phytopathogens Using Next Generation Sequencing Techniques
    Exploring Genome Structure and Gene Regulation Related to Virulence in Fungal Phytopathogens Using Next Generation Sequencing Techniques Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jinnan Hu, M.S. Graduate Program in Plant Pathology The Ohio State University 2013 Dissertation Committee: Thomas K. Mitchell, Adviser Michael J. Boehm Guo-liang Wang Kun Huang Copyright By Jinnan Hu 2013 Abstract Over the last decade, a technological revolution has provided enormous advances in the knowledge of complex biological processes largely enabled by the development of next-generation sequencing (NGS) techniques. Applications of NGS include studies of entire genomes, characterization of the entire transcriptome (RNA-Seq), and detection of protein-DNA binding sites (ChIP-Seq). The cost of sequencing a fungal genome, for example, has decreased from more than one hundred thousand dollars to currently only three thousand dollars. With the development of the applications and the affordable cost, NGS is changing the way biologists designing and carrying out research. This dissertation describes developed analysis pipelines of NGS data in the field of fungal phytopathogens using four different projects as examples. In a genome comparison project, sequenced short reads are de novo assembled to form a genome draft, then gene models are predicted either ab initial or assisted by RNA-Seq, followed by the comparison between genomes at different resolutions such as the nucleotide level and the genome structural level. Two chapters in this dissertation serve as examples of our genome comparison pipeline put to work to address biological questions.
    [Show full text]
  • Download The
    Cloning of Lavandula Essential Oil Biosynthetic Genes by Md. Lukman Syed Sarker B.Sc., The University of Dhaka, 2008 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE COLLEGE OF GRADUATE STUDIES (Biology) THE UNIVERSITY OF BRITISH COLUMBIA (Okanagan) February 2013 © Md. Lukman Syed Sarker, 2013 Abstract Several varieties of Lavandula x intermedia (lavandins) are cultivated for their essential oils (EO) which are extensively used in a wide range of hygiene and personal care products. These EOs are mainly dominated by monoterpenes, including linalool, linalool acetate, borneol, 1,8-cineole, and camphor. Among these, camphor is of particular significance as it adds a sharp overtone to the EO fragrance, reducing its olfactory appeal compared to finer lavender EOs in which linalool and linalool acetate impart a pleasant scent. We have recently constructed a cDNA library from the secretory cells of floral glandular trichomes of L. x intermedia plants. In this thesis we describe the cloning of a borneol dehydrogenase (LiBDH), a putative linalool acetyltransferase (LiLAT), and a caryophyllene synthase (LiCPS) cDNA from this library. The 780 bp open reading frame (ORF) of the LiBDH cDNA encoded a 259 amino acid short chain alcohol dehydrogenase enzyme with a predicted molecular mass of ca. 27.5 kDa. The recombinant LiBDH was expressed in E. coli, purified by Ni- NTA agarose affinity chromatography, and functionally characterized. The bacterially produced enzyme specifically converted borneol to camphor as the only product with Km and kcat values of 53 µM and 4.0x 10-4 s-1, respectively.
    [Show full text]
  • Strategies for the Production of Biochemicals in Bioenergy Crops Chien‑Yuan Lin1,2 and Aymerick Eudes1,2*
    Lin and Eudes Biotechnol Biofuels (2020) 13:71 https://doi.org/10.1186/s13068-020-01707-x Biotechnology for Biofuels REVIEW Open Access Strategies for the production of biochemicals in bioenergy crops Chien‑Yuan Lin1,2 and Aymerick Eudes1,2* Abstract Industrial crops are grown to produce goods for manufacturing. Rather than food and feed, they supply raw materials for making biofuels, pharmaceuticals, and specialty chemicals, as well as feedstocks for fabricating fber, biopolymer, and construction materials. Therefore, such crops ofer the potential to reduce our dependency on petrochemicals that currently serve as building blocks for manufacturing the majority of our industrial and consumer products. In this review, we are providing examples of metabolites synthesized in plants that can be used as bio‑based platform chemicals for partial replacement of their petroleum‑derived counterparts. Plant metabolic engineering approaches aiming at increasing the content of these metabolites in biomass are presented. In particular, we emphasize on recent advances in the manipulation of the shikimate and isoprenoid biosynthetic pathways, both of which being the source of multiple valuable compounds. Implementing and optimizing engineered metabolic pathways for accumulation of coproducts in bioenergy crops may represent a valuable option for enhancing the commercial value of biomass and attaining sustainable lignocellulosic biorefneries. Keywords: Bioenergy crops, Shikimate, Isoprenoids, Terpenes, Metabolic engineering Background monomers as substrates. Moreover, achieving higher Bioenergy crops are grown with low inputs to gener- plant biomass yields at reduced cost and enabling ef- ate lignocellulosic biomass that constitutes a sustainable cient deconstruction of the recalcitrant lignocellulosic source of renewable energy. One appealing purpose of material represent two other important milestones bioenergy crops is the deconstruction of their biomass towards the cost-efectiveness of biochemical production into aromatics and simple sugars for downstream conver- [2, 3].
    [Show full text]
  • Conversion of Essential Amino Acids Into Aroma Volatiles in Developing Melon Fruit
    Conversion of Essential Amino Acids into Aroma Volatiles in Developing Melon Fruit Thesis submitted in partial fulfillment of the requirements for the degree of “DOCTOR OF PHILOSOPHY” by Itay Gonda Submitted to the Senate of Ben-Gurion University of the Negev July 2014 Beer-Sheva Conversion of Essential Amino Acids into Aroma Volatiles in Developing Melon Fruit Thesis submitted in partial fulfillment of the requirements for the degree of “DOCTOR OF PHILOSOPHY” by Itay Gonda Submitted to the Senate of Ben-Gurion University of the Negev Approved by the advisors: Aaron Fait ________________ Date:_______19/01/15 ____ Efraim Lewinsohn ________________ Date:_____21/01/15______ Approved by the Dean of the Kreitman School of Advanced Graduate Studies July 2014 Beer-Sheva 1 This work was carried out under the supervision of Dr. Aaron Fait In The Jacob Blaustein Institutes for Desert Research The French Associates Institute for Agriculture and Biotechnology of Drylands and Dr. Efraim Lewinsohn Agricultural Research Organization Institute of Plant Sciences, Newe Ya’ar Research Center The following publications resulted from this thesis: Gonda, I., Lev, S., Bar, E., Sikron, N., Portnoy, V., Davidovich-Rikanati, R., Burger, J., Schaffer, A., Tadmor, Y., Giovannonni, J.J., Huang, M., Fei, Z., Katzir, N., Fait, A. and Lewinsoh E. (2013) Catabolism of L-methionine in the formation of sulfur and other volatiles in melon (Cucumis melo L.) fruit. Plant J. 61, 458-472. Gonda, I., Burger, Y., Schaffer, A.A., Ibdah, M., Tadmor, Y., Katzir, N., Fait, A. and Lewinsohn, E. (2015) Biosynthesis and perception of melon aroma. In Havkin- Frenkel, D., Dudai, N.
    [Show full text]
  • Formation of -Farnesene in Tea (Camellia Sinensis) Leaves Induced
    International Journal of Molecular Sciences Article Formation of α-Farnesene in Tea (Camellia sinensis) Leaves Induced by Herbivore-Derived Wounding and Its Effect on Neighboring Tea Plants 1,2, 1,3, 1,2 4 4 Xuewen Wang y, Lanting Zeng y, Yinyin Liao , Jianlong Li , Jinchi Tang and Ziyin Yang 1,2,3,* 1 Key Laboratory of South China Agricultural Plant Molecular Analysis and Genetic Improvement & Guangdong Provincial Key Laboratory of Applied Botany, South China Botanical Garden, Chinese Academy of Sciences, Xingke Road 723, Tianhe District, Guangzhou 510650, China 2 University of Chinese Academy of Sciences, Yuquan Road 19A, Beijing 100049, China 3 Center of Economic Botany, Core Botanical Gardens, Chinese Academy of Sciences, Xingke Road 723, Tianhe District, Guangzhou 510650, China 4 Tea Research Institute, Guangdong Academy of Agricultural Sciences & Guangdong Provincial Key Laboratory of Tea Plant Resources Innovation and Utilization, Dafeng Road 6, Tianhe District, Guangzhou 510640, China * Correspondence: [email protected]; Tel.: +86-20-3807-2989 These authors contributed equally to this work. y Received: 17 July 2019; Accepted: 22 August 2019; Published: 25 August 2019 Abstract: Herbivore-induced plant volatiles (HIPVs) play important ecological roles in defense against stresses. In contrast to model plants, reports on HIPV formation and function in crops are limited. Tea (Camellia sinensis) is an important crop in China. α-Farnesene is a common HIPV produced in tea plants in response to different herbivore attacks. In this study, a C. sinensis α-farnesene synthase (CsAFS) was isolated, cloned, sequenced, and functionally characterized. The CsAFS recombinant protein produced in Escherichia coli was able to transform farnesyl diphosphate (FPP) into α-farnesene and also convert geranyl diphosphate (GPP) to β-ocimene in vitro.
    [Show full text]