sign in sign up
<<
Home , Bean calico mosaic virus, Begomovirus, Mosaic virus, Pepper leaf curl virus

Revista Mexicana de Fitopatología ISSN: 0185-3309 [email protected] Sociedad Mexicana de Fitopatología, A.C. México

Valverde, Rodrigo A.; Clark, Christopher A.; Fauquet, Claude M. Properties of a Isolated from Sweet Potato [ batatas (L.) Lam.] Infected with Sweet potato leaf curl Revista Mexicana de Fitopatología, vol. 21, núm. 2, julio-diciembre, 2003, pp. 128-136 Sociedad Mexicana de Fitopatología, A.C. Texcoco, México

Available in: http://www.redalyc.org/articulo.oa?id=61221206

How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative 128 / Volumen 21, Número 2, 2003

Properties of a Begomovirus Isolated from Sweet Potato [Ipomoea batatas (L.) Lam.] Infected with Sweet potato leaf curl virus Pongtharin Lotrakul, Rodrigo A. Valverde, Christopher A. Clark, Department of Plant Pathology and Crop Physiology, Louisiana Agricultural Experiment Station, Louisiana State University Agricultural Center, Baton Rouge, Louisiana 70803, USA; and Claude M. Fauquet, ILTAB/Donald Danford Plant Science Center, UMSL, CME R308, 8001 Natural Bridge Road, St. Louis, MO 63121, USA. GenBank Accession numbers for nucleotide sequence: AF326775. Correspondence to: [email protected]

(Received: November 6, 2002 Accepted: February 12, 2003)

Lotrakul, P., Valverde, R.A., Clark, C.A., and Fauquet, C.M. potato leaf curl virus (SPLCV). Por medio de la reacción en 2003. Properties of a Begomovirus isolated from sweet potato cadena de la polimerasa (PCR), utilizando oligonucleótidos [Ipomoea batatas (L.) Lam.] infected with Sweet potato leaf específicos para SPLCV, se confirmó la presencia de SPLCV. curl virus. Revista Mexicana de Fitopatología 21:128-136. El análisis de clones con la secuencia parcial del gene AC1, Abstract. Scions from the sweet potato (Ipomoea batatas) indicó que el genotipo GA90-16 estaba doblemente infectado breeding line GA90-16 graft inoculated to I. setosa caused con SPLCV y un segundo geminivirus, que resultó symptoms similar to those caused by the begomovirus, Sweet emparentado con el primero, al que proponemos designar potato leaf curl virus (SPLCV). Polymerase chain reaction como Ipomoea leaf curl virus (ILCV). Se efecturaron (PCR) using SPLCV-specific primers confirmed the presence transmisiones individuales con moscas blancas (Bemisia of SPLCV. Analyses of partial clones of the AC1 open reading tabaci biotipo B) para separar ambos virus, los cuales fueron frame sequences indicated that GA90-16 was doubly infected diferenciados, analizando los productos de PCR (AV1 OR), with SPLCV and a related geminivirus, which we propose to después de un ensayo de restricción utilizando la enzima designate as Ipomoea leaf curl virus (ILCV). Individual EcoR1. A diferencia de SPLCV, ILCV no causó (Bemisia tabaci biotype B) transmission was amarillamiento de las venas en I. aquatica e I. cordatotriloba, conducted to separate these two which could be pero causó enrollamiento de las hojas en varias especies de differentiated by restriction enzyme digestion of PCR (AV1 Ipomoea. El componente A de ILCV fue clonado y OR) products utilizing EcoR1. ILCV caused leaf curl secuenciado completamente. La organización del genoma symptoms in several Ipomoea species. Unlike SPLCV, ILCV de este virus es similar a los begomovirus monopartitas del did not cause yellow vein symptoms on I. aquatica and I. Viejo Mundo. La comparación de las secuencias nucleotídicas cordatotriloba. DNA A of ILCV was cloned and sequenced. de los componentes A de ambos virus, demostró que ILCV The organization of the virus was typical of other es similar a SPLCV y a Ipomoea yellow vein virus (IYVV), Old World monopartite . Sequence que infecta a una especie de Ipomoea en España, con comparisons showed that ILCV was similar to SPLCV and aproximadamente 76 y 78% de similitud, respectivamente. to another Ipomoea-infecting begomovirus, Ipomoea yellow Por otro lado, la comparación de la secuencia del gene de la vein virus (IYVV) from Spain with about 76 and 78% proteína de la cápside del ILCV, resultó casi idéntica a SPLCV nucleotide sequence identity, respectively. Although the coat e IYVV, mientras las secuencias de la región común y de los protein of ILVC was nearly identical to that of SPLCV and genes AC1, AC2, AC3 y AC4 fueron lo suficientemente IYVV, the sequence of the common region, and the AC1, diferentes, para proponer al ILCV como una nueva especie AC2, AC3, and AC4 ORFs were sufficiently different to perteneciente al género Begomovirus. warrant the nomination of a new begomovirus species. Palabras clave adicionales: Bemisia tabaci, Geminivirus, Additional keywords: Bemisia tabaci, Geminivirus, Ipomoea Ipomoea yellow vein virus, PCR, mosca blanca. yellow vein virus, PCR, whitefly. The family comprises a group of plant viruses Resumen. Inoculaciones mediante injertos del genotipo de which have small twin- isometric particles containing closed camote (Ipomoea batatas) GA90-16 a I. setosa, causaron circular, single-stranded DNA (Hanley-Bowdoin et síntomas similares a los causados por el begomovirus Sweet al., 1999). This family can be classified into four genera Revista Mexicana de FITOPATOLOGIA/ 129 based on their hosts, insect vector, and genome organization. one SalI (in the case of ILCV) and one Eco RV (in the case of Members of the genus Begomovirus are those containing SPLCV) restriction site. Thus, the two viruses could be mono- or bipartite genomes which infect dicotyledonous differentiated by digesting the amplified with these plants, and can be transmitted by Bemisia tabaci. Viruses in two enzymes. the genus infect mainly monocots, have Whitefly transmissions. Colonies of the sweet potato monopartite genomes, and are transmitted by leafhoppers. whitefly (B. tabaci biotype B) were reared in the laboratory Curtoviruses infect a wide range of dicotyledonous plants, as described previously (Lotrakul et al., 2000). Individual have monopartite genomes and are transmitted by were used in all transmission experiments except leafhoppers. The genus Topocuvirus has only one member, in host range trials. Transmission experiments were conducted pseudo-curly top virus (TPCTV) which has a in the laboratory using SO as the acquisition and transmission monopartite genome and is transmitted by tree hoppers to host. For some transmission experiments, SO doubly infected dicotyledonous plants. During the spring of 2000, sweet with SPLCV and ILCV was used as virus acquisition host. potato [Ipomoea batatas (L.) Lam.] cuttings from research Additional transmission experiments were conducted with plots in Athens, GA, were collected for a virus disease survey. the individual virus isolates. Groups of 25 whiteflies were Scions were grafted to I. setosa Ker. (Brazilian morning glory) used in attempts to transmit ILCV to other plant species. In to detect virus infection. A scion from the sweet potato all experiments, whiteflies were caged with infected SO plants breeding line GA90-16 caused leaf curling symptoms on I. for 48 h and then transferred to caged healthy plants for 48 h. setosa similar to those caused by the United States isolate of Test plants were then sprayed with imidacloprid and Sweet potato leaf curl virus (SPLCV) (Lotrakul et al., 1998). transferred to the greenhouse. Plants were evaluated for visual Polymerase chain reaction (PCR) assays confirmed the symptoms 2-3 wk later. PCR amplification using SPLCV- presence of SPLCV in the infected plants. After sequence specific primers was performed to confirm the presence of analysis of the PCR products (partial AC1 ORF), two distinct the virus in tested plants. sequences were consistently obtained. One was nearly Host range. In order to determine the host range of ILCV, identical to that of SPLCV whereas the other was distinct. graft and whitefly inoculations were conducted. In all cases, This suggested a double infection of SPLCV and a related at least three plants of the same species were inoculated. Graft geminivirus which was provisionally designated Ipomoea leaf inoculations were conducted using infected SO as source of curl virus (ILCV). In this investigation, ILCV was separated scions to inoculate I. alba L., I. aquatica, I. batatas (cvs from a double infection with SPLCV by an individual whitefly Beauregard, Excel, Jonathan, L94-96, NC-262, Regal, transmission and the biological and molecular properties were Resisto, Sumor, Wagabolige, Tanzania, W244, W-285, and determined and compared with those of SPLCV. Xushu-18), I. cordatotriloba Ell., I. hederaceae (L.) Jacq., I. incarnata (Vahl) Choisy, I. lacunosa L., I. setosa, and I. MATERIALS AND METHODS tiliaceae Willd. Groups of 25 whiteflies were used in each Plant materials and virus isolates. Cuttings from the attempt to transmit ILCV to Nicotiana benthamiana Domin., breeding line GA90-16 were collected from the field, rooted, Datura stramonium L., Physalis ixocarpa Brot., and and maintained in a greenhouse under natural light. Scions frutescens L. cv Tabasco. Preliminary tests from these plants were grafted to I. setosa and PCR was indicated that I. aquatica and I. cordatotriloba could be used performed as described previously (Lotrakul, 2000). Sweet to differentiate SPLCV from ILCV. In order to confirm these potato feathery mottle virus (SPFMV) was detected in this preliminary observations, additional graft inoculations to at field sample by serological tests. Because past attempts to least six plants of each species were conducted using SO infect I. aquatica Forsk. with various SPFMV isolates failed scions from plants infected with the individual virus isolates. (Clark and Valverde, unpublished data), graft-inoculations All test plants were examined for symptoms 3-4 wk after to I. aquatica were conducted to eliminate SPFMV. Doubly inoculations. PCR was performed on all plant species tested. infected (SPLCV and ILCV) I. aquatica plants were used to DNA extraction and Southern Blot hybridization graft inoculate I. nil (L.) Roth. cv Scarlet O’Hara (SO), which analyses. Total DNA from infected Ipomoea spp. foliar tissue was used in further studies. Individual whitefly [Bemisia was extracted using Plant DNAzol® Reagent (Life tabaci (Gennadius) biotype B] transmissions were conducted Technologies, Inc., Grand Island, NY, USA). Extracted DNA to obtain an isolate of ILCV. An isolate of SPLCV used in was separated by electrophoresis and stained with ethidium previous investigations (Lotrakul and Valverde, 1999) was bromide. Southern hybridizations were conducted using the used in whitefly transmissions and inoculation experiments Amersham’s ECL kit (Arlington Heights, IL, USA) following to various Ipomoea species. the manufacturer’s procedures. A plasmid with a SPLCV DNA Differential detection of SPLCV and ILCV. Based on insert (900 bp) was used as a probe (Lotrakul, 2000). The sequence information of initial PCR products (partial AC1 hybridization was carried out under conditions previously ORF) from SPLCV and ILCV, a pair of primers were designed described (Lotrakul et al., 1998). A segment of DNA-A of (SP003-V and SP003-C) to amplify the AV1 ORF of both ILCV was amplified by PCR using primers designed for isolates. Viral DNA amplified with these primers contained SPLCV (Lotrakul and Valverde, 1999). Two additional pairs 130 / Volumen 21, Número 2, 2003 of primers were designed from the sequences obtained in the transplanted into clay pots containing JiffyMix® and placed initial PCR amplifications. Primers SP003-V (from 5’ to 3’) in a screen cage in the greenhouse. This experiment was (CTCTGTTACTGTATCTGCAGGCCCTTATAA) and conducted for a second time using 10 SO and five I. setosa SP003-C (AAACAGCTGCAGCTCGATCTTTAGGTCCA seedlings. Three weeks later, plants were evaluated for CAT), which amplified the AV1 ORF (coat protein gene), symptoms and PCR was performed using specific primers were used for ILCV detection, and the overlapping primers, for ILCV. Control inoculations were conducted by inoculaing OV003-C (AAACCCGGATCCATATTGGGCCTCCGATCT DiYMV DNA-A and -B components obtained in previous CG) and OV003-V(AAACCCGGATCCATTAACAT work (Lotrakul et al., 2000) to Dicliptera sexangularis TTGCACAGGCTT), were used to amplify the entire seedlings. component A of the virus. PCR reaction mixtures were DNA sequencing. The nucleotide sequences were determined prepared as previously described (Lotrakul, 2000; Lotrakul by automated sequence analysis at the DNA Sequencing Core and Valverde, 1999). The DNA of plants infected with SPLCV Laboratory, University of Florida, Gainesville (using an were used as positive controls, while DNA from healthy plant ABI337 DNA Sequencer; Perkin Elmer, Foster City, CA, as a negative control. PCR was performed with a Genius USA). At least three replicate PCR-generated clones were thermocycler (Techne (Cambridge Ltd, Cambridge, UK) sequenced to minimize error caused by Taq polymerase. For using 40 cycles, each consisting of 30 sec at 94% C, 30 sec at the full length clones obtained from the replicative DNA, 55% C, and 90 sec at 72% C. A final step of 10 min at 72% C two-directional sequencing was performed. Restriction sites also was included. The amplified DNAs were separated by were analyzed using the DNAid+ program (Daedel, F., Ecole electrophoresis (1.2% agarose) and stained with ethidium Polytechnique, Palaiseau, France), and the predicted sites bromide. PCR products were recovered from the gel using were confirmed by digestion with their specific restriction the Ultraclean15 DNA purification kit (MO Bio Laboratories enzymes. Open reading frames (ORFs) and predicted Inc, Solana Beach, CA, USA). Purified PCR products were aminoacid sequences were determined using the Translate cloned into pBluescript II SK (+) (Stratagene, La Jolla, CA, program (ExPASy molecular biology server, Swiss Institute USA). Taq DNA polymerase, restriction endonucleases, and of Bioinformatics, Geneva, Switzerland). T4 DNA ligase were used as recommended by the Sequence comparisons and phylogenetic analyses. The manufacturers. Recombinant plasmids were then transformed nucleotide and predicted aminoacid sequences were into competent cells of Escherichia coli strain DH5. Attempts compared to those of other begomoviruses. Multiple sequence were made to determine if a DNA-B component was present alignment was carried out using version 1.7 of the CLUSTAL in total DNA extracts from plants infected with ILCV. W program (Thompson et al., 1994). Percent identities and Molecular hybridizations using full length clones of DNA-B similarities between aligned nucleotide and derived aminoacid components of an isolate of Tomato yellow leaf curl virus sequences were determined using the equation: 100x sum of from the Dominican Republic (TYLCV-[DO]), golden matching residues / [length - gap residues (sequence 1) - gap from Guatemala (BGMV-[GT]), Tomato mottle residues (sequence 2)] (Brown et al., 1999). Phylogenetic virus (ToMoV-FL) (provided by R. Gilbertson, University analyses were conducted using the Clustal method with of California, Davis), and Pepper Huasteco yellow vein virus PAM250 residue weigh table. Geminiviruses (Fauquet et al., (PHYVV) (provided by R. Rivera-Bustamante, CINVESTAV, 2000) sequences used in sequence and phylogenetic analyses ) as probes. were from GenBank database under the following accession Infectivity of cloned ILCV DNA. For these experiments, numbers: (AbMV) (X15983), African the ILCV DNA was inoculated into SO by electric discharge mosaic virus from Nigeria (ACMV-[NG]) (X17095), particle acceleration (Gilbertson et al., 1991). After acid ACMV-[KE] (J02058), Althea rosea enation virus (AREV) scarification, SO seeds were disinfected by washing with (AF014881), Ageratum yellow vein virus (AYVV) (X74516), sterile water and soaking with 3 % sodium hypochlorite for 5 (BCaMV) (AF110189), Bean dwarf min. Treated seeds were washed several times with sterile mosaic virus (BDMV) (M88179), Bean golden mosaic virus water and then placed on water-agar plates, which were from Brazil (BGMV-[BZ]) (M88686), BGMV from the incubated overnight in the dark at room temperature, and then Dominican Republic (BGMV-[DO]) (L01635), BGMV from placed under fluorescent light. After 3 days, seeds that had Guatemala (BGMV-[GT]) (M91604), Beet mild curly top cotyledons exposed were selected for inoculation. The entire virus (BMCTV) (U5697), Beet severe curly top virus ILCV DNA-A component was excised from the plasmid (BSCTV-Cfh) (U02311), Cabbage leaf curl virus (CaLCuV) vector by digestion with BamHI. The digested DNA was (U65529), Chayote mosaic virus (ChaMV) (AJ223191), cleaned using the Ultraclean15 DNA purification kit, and then Cotton leaf curl Multan virus (CLCuMV-[477]) (AJ002447), ligated with T4 DNA ligase to form a circular dsDNA. The Cotton leaf curl Alabad virus (CLCuAV-[802a] AJ002455), ligated DNA in the reaction mixture was diluted in 0.1 M Cotton leaf curl Kokhran virus (CLCuKV) (AJ002448), sodium phosphate buffer (pH 7.0). The ILCV DNA was used Cowpea golden mosaic virus from Nigeria (CPGMV-[NG]) to inoculate eight SO seedlings. Four plants were mock (AF029217), Curcurbit leaf crumple virus (CuLCrV) inoculated. Two days after inoculation, plants were (AF224760), Dicliptera yellow mottle virus (DiYMoV) Revista Mexicana de FITOPATOLOGIA/ 131

(AF139168), East African (EACMV- grafted with GA90-16 was doubly infected with two [TZ]) (ZA3256), EACMV-[CM] (AF112354), EACMV-[KE] geminiviruses. A partial AC1 ORF sequence obtained from (283258), Eupatorum yellow vein virus (EpYVV) PCR products showed approximately 98% nucleotide (AB0079900), Honeysuckle yellow vein mosaic virus sequence identity when compared to the equivalent sequence (HYVMV) (AB020781), Horseradish curly top virus of SPLCV, whereas that of the other PCR products showed (HrCTV) (U49907), Indian cassava mosaic virus (ICMV) approximately 88% identity (data not shown). Single whitefly (Z24758), Mungbean yellow mosaic virus (MYMIV) transmissions resulted in individual virus isolates. Both (AF126406), Ipomoea yellow vein virus (IYVV) (AJ132548), isolates were differentiated by their banding profile, after Mungbean yellow mosaic virus from (MYMV- enzymatic digestion of the PCR products obtained with [TH]) (AB017341), Okra enation virus (OKEV) primers SP003C and SP003-V (Fig. 1). (AF155064), Okra yellow vein mosaic virus (OYVMV) Host reaction. Graft inoculations of ILCV to Ipomoea species (AJ002451), Pepper golden mosaic virus (PepGMV-[CR]) resulted in various degrees of leaf curling. In general, (AF149227), Pepper huasteco yellow vein virus (PHYVV) symptoms of ILCV-infected plants were similar to those (X70418), (PepLCV) (AF134484), inoculated with SPLCV. Of the plant species inoculated, only (PaLCuV) (Y15934), Potato yellow I. aquatica and I. cordatotriloba were differential hosts. These mosaic virus from Venezuela (PYMV-[VE]) (D00940), two Ipomoea species reacted with yellow mottle when graft- PYMV from Trinidad and Tobago (PYMV-[TT]), Rhynchosia inoculated with SPLCV, but only leaf curl symptoms were golden mosaic virus (RhGMV) (AF239671), Sida golden obtained when graft-inoculated with ILCV. Symptoms of I. mosaic Costa Rica virus (SiGMCRV) (X99550), Sida golden aquatica are shown in Fig. 2. The field collected sweet potato mosaic Honduras virus (SiGMHNV) (Y11097), Sida golden breeding line GA90-16 doubly infected with SPLCV and mosaic Florida virus (SiGMFloV-A1) (U77963), South ILCV did not show symptoms. Similarly, single infections of African cassava mosaic virus (SACMV) (AF155806), thirteen sweet potato cultivars with either ILCV or SPLCV Squash leaf curl China virus (SLCCNV) (AB027465), Squash leaf curl virus (SLCV) (M38183), Sweet potato leaf curl virus (SPLCV) (AF104036), Tomato golden mosaic virus 1324567 8910 (TGMV) (K02029), Tobacco leaf curl China virus (TbLCCNV) (AF240675), Tobacco leaf curl Yonan virus (TbLCYV) (AF240674), Tomato leaf crumple virus (ToLCrV) (AF101476), Tomato leaf curl virus (ToLCV) (S53251), Tomato leaf curl Taiwan virus (ToLCV-[TW]) (U88692), Tomato leaf curl Bangalore virus (ToLCBV) (Z48182), Tomato leaf curl Bangladesh virus (ToLCBDV) (AF188481), Tomato leaf curl Karnataka virus (ToLCKV) (U38239), Tomato leaf curl New Delhi virus (ToLCNDV) (U15017), Tomato leaf curl virus (ToLCSLV) (AF274349), Tomato mosaic Havana virus (ToMHV) (Y14874), Tomato mottle virus (ToMoV) (L14460), Tomato mottle Taino virus (ToMoTV) (AF012300), TPCTV (X84735), Tomato rugose mosaic virus (ToRMV) 1.0 kb (NC002555), Tomato yellow leaf curl sardinia virus TYLCSV- [ES] (Z86067), TYLCV from the Dominican 0.7 kb Republic (TYLCV-[DO]) (AFO24715), TYLCV from (TYLCV-[IL]) (X15656), Tomato yellow leaf curl China virus (TYLCCNV) (AF311734), Tomato yellow leaf curl Thailand virus (TYLCTHV-[1]) (X63015), and Watermelon chlorotic stunt virus (WmCSV-[SD]) (AJ245650). 0.3 kb

RESULTS Fig. 1. Agarose gel electrophoresis of PCR products, Differential detection of SPLCV and ILCV. Graft amplified with primers SP003-C and -V using total DNA inoculations of I. setosa with scions from the sweet potato extracts of Ipomoea setosa plants, inoculated with Ipomoea breeding line GA90-16 (symptomless) caused severe leaf leaf curl virus (ILCV) and Sweetpotato leaf curl virus distortion, mosaic, and chlorosis symptoms. The presence of (SPLCV). PCR products were digested with EcoRl. Lane 1, SPFMV was determined by enzyme-linked immunosorbent DNA ladder (Lambda DNA cut with Hindlll/EcoRl); lane 2, assay (ELISA) and SPLCV by PCR. The PCR products (AC1 ILCV; lane 3, SPLCV; lane 4, ILCV; lanes 5 and 6, ILCV + ORF) were sequenced, and the results suggested that I. setosa SPLCV; lanes 7, 8, 9, and 10, ILCV.

Revista Mexicana de FITOPATOLOGIA/ 133 of ILCV DNA-A consists of 2773 bp (GenBank accession Table 3. Percent nucleic acid sequence identity and aminoacid similarity number: AF326775). Computer-assisted analysis revealed six between the ORFs predicted gene products of Ipomoea leaf curl virus (ILCV) and those of four begomoviruses from the Old World. ORFs on DNA-A (AV1, AV2, AC1, AC2, AC3, and AC4) ORF (%)z which is typical of a begomovirus (Hanley-Bowdoin et al., Virusy AV1 AV2 AC1 AC2 AC3 AC4 1999). ORFs were located on both virion and complementary IYVV 90/92 94/97 74/78 85/80 84/80 68/46 sense strands. ILCV also had a common region containing a SPLCV 89/95 94/97 77/81 77/68 71/66 70/44 conserved stem-loop motif which is characteristic of all PaLcuV 45/46 35/32 71/73 30/21 31/21 80/67 geminiviruses (Hanley-Bowdoin et al., 1999). Within the CLCuAV 42/45 37/36 68/74 30/18 34/24 82/62 yIYVV = Ipomea yellow vein virus, SPLCV = Sweet potato leaf curl virus, common region, three direct repeats of an iterative element PaLCuV = Papaya leaf curl virus, and CLCuAV = Cotton leaf curl Alabad (TGGTGTC) were located near the 5’ end of the TATA box, virus. whereas an inverted repeat (GACACCA) was on the 3’ end. zPercent nucleic acid sequence identity and amimoacid similarity, The sequence of the iterative elements for two other Ipomoea- respectively. infecting begomoviruses were: TGGAGACA and TGTCTCCA for SPLCV and TGGTGTC and TGTCACCA coat protein of ILCV was highly identical to those of SPLCV for Ipomoea yellow vein virus from Spain (IYVV) (Banks, and IYVV (92% aminoacid identity) but less than 46% et al., 1999). Comparisons between the complete DNA-A aminoacid sequence identity with those of other sequence of ILCV and those of several begomoviruses begomoviruses. The most conserved protein of ILCV (in revealed a high sequence identity between ILCV and other relation to SPLCV and IYVV) was the coat protein. Other Ipomoea-infecting begomoviruses (Table 2). ILCV DNA-A than SPLCV and IYVV, the predicted aminoacid sequence sequence showed moderately high sequence identity (76- of the AC1 of ILCV was strikingly similar (73-74%) to those 78%) when compared with those of SPLCV and IYVV. Less of the AC1 of Papaya leaf curl virus (PaLCuV) and Cotton than 50% nucleotide sequence identity was obtained when leaf curl Alabad virus (CLCuAV). compared to other begomoviruses. A higher percent Phylogenetic analyses. Analyses of phylogenetic nucleotide identities were detected with begomoviruses from relationships between ILCV and several begomoviruses were the Old World than with those from the New World. conducted using the predicted aminoacid sequences of the Comparisons between the derived amino acid sequences of AV1, AC1, AC2, AC3, AC4, ORFs and the common region. ILCV and those of four begomoviruses from the Old World With the exception of AC4, all phylogenetic trees indicated a were conducted (Table 3). Overall, predicted aminoacid close relationship among the three Ipomoea- infecting sequences of ILCV were very similar to those of the other begomoviruses. A phylogenetic tree with the results of the two Ipomoea-infecting begomoviruses, but clearly divergent analysis of AV1 is shown in Figure 3. Based on the coat protein from those of non-Ipomoea-infecting begomoviruses. The sequence, it was clear that all Ipomoea-infecting begomoviruses were distinct from the other begomoviruses. The three viruses clustered together apart from all the other Table 2. Percent nucleotide sequence identity between DNA A of begomoviruses, which is an indication that they form a unique Ipomoea leaf curl virus (ILCV) and DNA A of 22 begomoviruses. cluster. Begomovirus Nucleotide sequence species identity (%) DISCUSSION Ipomoea yellow vein virus (IYVV) 78.2 In this study, the complete nucleotide sequence of the DNA- Sweet potato leaf curl virus (SPLCV) 76.5 A component of of ILCV from Georgia, USA was obtained Papaya leaf curl virus (PaLCuV) 49 from a full-length and three overlapping PCR clones. Based Cotton leaf curl Alabad virus (CLCuAV) 45.5 Tomato yellow leaf curl virus (TYLCV-[DO]) 47 on the differences in the restriction profiles between ILCV TYLCV-[IL] 47 and SPLCV, a detection method was developed to differentiate Tobacco leaf curl China virus (TbLCCNV) 43.4 these two viruses. This detection method combined with the Ageratum yellow vein virus (AYVV) 44.5 individual whitefly transmission allowed the separation of Althea rosea enation virus (AREV) 44.5 African cassava mosaic virus (ACMV-[NG]) 43.7 ILCV and SPLCV from the mix-infected, field-collected Okra yellow vein mosaic virus (OYVMV) 42.8 sweet potato sample. Biological properties of ILCV were Chayote mosaic virus (ChaMV) 42.6 investigated using an individual whitefly-transmitted isolate Tomato leaf curl Sardinia virus (TYLCSV-[ES]) 44.2 and compared to those of SPLCV. The symptoms that Cotton leaf curl Multan virus (CLCuMV) 42 Bean golden mosaic virus (BGMV-DO) 43.2 developed on most Ipomoea species inoculated with ILCV Tomato golden mosaic virus (TGMV) 42.4 were similar to those induced by SPLCV, including the failure Squash leaf curl China virus (SLCCNV) 40.8 to cause leaf curl symptoms on eight sweet potato cultivars. Tomato leaf crumple virus (ToLCrV) 42.4 On I. aquatica and I. cordatotriloba, only leaf curling was Mungbean yellow mosaic virus (MYMV-[TH]) 40 Potato yellow mosaic virus (PYMV-[TT]) 41.9 detected after inoculation with ILCV, whereas both species Mungbean yellow mosaic Indian virus (MYMIV) 40 developed yellow vein symptoms when inoculated with Squash leaf curl virus (SLCV) 39.2 SPLCV. Therefore, these two Ipomoea spp. can be used as 134 / Volumen 21, Número 2, 2003

TYLCV.AV1.Pep SACMV.AV1.Pep TYLCSV.AV1.Pep WmCSV.AV1.Pep EACMV-[TZ]V1.pep AREV.AV1.pep OkEV.AV1.Pep ChaMV.AV1.pep ACMV-[KE].AV1.Pep EpYVV.AV1.Pep HYVMV.AV1.Pep TYLCTHV-[1].AV1.Pep TbLCYV.AV1.Pep AYVV.AV1.pep ToLCLV.AV1.Pep PepLCV.AV1.Pep ToLCTWV.AV1.pep ToLCV.AV1.Pep TYLCCNV.AV1.Pep ToLCBDV.AV1.Pep TbLCCNV.AV1.Pep CLCuKV-[Fai1].AV1.pep PaLCuV.AV1.pep ToLCKV.AV1.Pep CLCuAV-[802a].AV1.Pep OYVMV-[301].AV1.Pep CLCuMV-[Fai1].AV1.pep ToLCNdV-Svr.AV1.Pep SLCCNV.AV1.Pep ICMV.AV1.Pep ToLCBV.AV1.pep ToLCSLV.AV1.Pep AbMV.AV1.Pep SiGMFV.AV1.Pep SiGMHV.AV1.pep ToLCrV.AV1.pep PYMV-VE.AV1.Pep ToMoV.AV1.Pep ToMHV.AV1.pep BDMV.AV1.Pep CLCrV.AV1.pep BGYMV-[PR].AV1.Pep CuLCrV.AV1.Pep TGMV.AV1.Pep PepGMV.AV1.pep SLCV.AV1.Pep CaLCuV.AV1.pep BCaMV.AV1.pep BGMV.AV1.Pep SiGMCRV.AV1.Pep ToRMV.AV1.Pep ToMoTV.AV1.pep SiGMFloV-[A1].AV1.pep DiYMoV.AV1.Pep PHYVV.AV1.Pep RhGMV.AV1.Pep MYMV.AV1.Pep MYMIV.AV1.Pep CPGMV-[NG].AV1.pep IYVV.AV1.pep SPLCV.AV1.Pep ILCV.AV1.Pep BSCTV-CFH.AV1.pep BMCTV.AV1.pep BCTV-Cal.AV1.Pep HrCTV.AV1.pep TPCTV.AV1.pep RANDOM.AV1.Pep 75.4 70 60 50 40 30 20 10 0

Fig. 3. Phylogenetic trees showing the relationships between an isolate of Ipomoea leaf curl virus (ILCV) and other geminiviruses, based on the multiple sequence alignment of the AV1 derived aminoacid sequences, using Clustal method with PAM250 residue weigh table. Revista Mexicana de FITOPATOLOGIA/ 135 differential hosts to distinguish ILCV from SPLCV, in addition the Rep protein and the precoat protein sequences supported to the combination of PCR and restriction enzyme digestion the sequence comparison results that all three Ipomoea- method. The ILCV nucleotide sequence was 78% identical infecting begomoviruses were closely related, and also to those of SPLCV and IYVV. However, the common region implied that all of them might have evolved from the same (data not shown) and the AC1, AC2, AC3 and AC4 sequences common ancestor. In this study, the whitefly transmission of these viruses were clearly different. Although the experiments were not conducted simultaneously except when arrangement of the iterative elements of ILCV was similar to I. nil plants mixed infected with SPLCV and ILCV were used those of SPLCV, IYVV, and several begomoviruses from the as acquisition host. Nevertheless, transmission rates for Old World, their sequences were not identical. Similar to the SPLCV and ILCV were similar. Most transmission rates of results obtained from nucleotide sequence comparisons, the begomoviruses have been reported using groups but not predicted protein products of ILCV, SPLCV, and IYVV individual whiteflies, therefore making it difficult to compared showed high percent aminoacid sequence identity and the results from this study with others. However, based on similarity when compared to one another. Among these three our experience with transmission of several begomoviruses Ipomoea-infecting begomoviruses, the coat protein was the by B. tabaci biotype B, Ipomoea-infecting begomoviruses most conserved with more than 92% aminoacid homology. seem to be transmitted at lower rates (Lotrakul et al., 2000; However, when it was compared to those of other Lotrakul and Valverde, 1999). Furthermore, another Ipomoea- begomoviruses, less than 46% aminoacid sequence identity infecting begomovirus, IYVV, could not be transmitted by was detected (Table 3). Phylogenetic analysis based on the three biotypes of B. tabaci (including biotype B) (Banks et coat protein aminoacid sequences also failed to indicate any al., 1999). This poor transmission may be a reflection of the relationship between the Ipomoea-infecting begomoviruses low amino acid sequence identity (45%) between the coat and other begomoviruses. It has been suggested by Bradeen protein of Ipomoea-infecting begomoviruses and the other et al. (1997) that the coat protein of geminiviruses evolves in begomoviruses. Preliminary results indicate that Ipomoea- response to the viral insect vector specificity. However, based infecting begomoviruses have a worldwide distribution on the phylogenetic analyses of this study, it is possible that (Lotrakul et al., 2002). Another sweet potato-infecting the host plants might also play a role in the coat protein begomovirus, Ipomoea crinkle leaf curl virus, has been sequence evolution of these Ipomoea-infecting reported in Israel (Cohen et al., 1997). A partial sequence begomoviruses, although the mechanisms involved are still (the AV1 ORF) of an isolate of SPLCV from Israel was not known. The Rep protein of ILCV was more conserved obtained by PCR and it was nearly identical to those of ILCV, than the coat protein when it was compared to those of non- SPLCV, and IYVV. Furthermore, the nucleotide sequence of Ipomoea-infecting begomoviruses. Higher percent aminoacid the common region of an isolate of SPLCV from Japan has sequence homology was obtained from the C-terminal portion been reported (Onuki and Hanada, 1998). The sequence was of the Rep protein than from the N-terminal portion (data not different from that of IYVV, ILCV, and SPLCV. These studies shown). The N-terminal of the Rep protein has been suggested suggest that there might be several other Ipomoea-infecting to a play role in DNA-binding and virus specificity (Hanley- geminiviruses yet to be described. In a previous study, it was Bowdoin et al., 1999). Therefore, it is logical for ILCV to suggested that SPLCV was introduced into the United States have a different N-terminal sequence of the Rep protein from the Old World. This also might be true for ILCV. Further compared to its closely related SPLCV and IYVV since these studies on the distribution and sequence variation of different three viruses have different iterative elements. Based on the Ipomoea-infecting geminiviruses from different regions nucleotide sequence comparisons, especially the common around the world need to be conducted to better understand region, which has been suggested as one of several factors the origin, distribution, and diversity of this unique group of implying the virus origin (Arguello-Astorga et al., 1994), geminiviruses. ILCV could be classified as a different species apart from SPLCV and IYVV. However, the similarity between their Acknowledgments. The authors thank APHIS-USDA for biological properties and their nearly identical coat proteins financial support (Grant number 99-8100-0514-GR), Dr. S. and precoat proteins indicated that they are closely related to J. Kays for providing the sweet potato breeding line GA90- one another. It is not known why several attempts to inoculate 16 sample, S. Winter for sequence information of SPLCV I. nil and I. setosa with full-length clones or ILCV failed. isolate from Israel, M.W. Hoy and A.D. Landry for technical The method that we used was successfully used to obtain assistance, and the Louisiana Sweet Potato Advertising and systemic infections with inoculations of other begomoviruses. Development Commission for partial financial support. It is possible that ILCV needs the coat protein, a subgenomic Approved for publication by the director, Louisiana DNA for replication or a DNA B component for successful Agricultural Experiment Station, manuscript: 02-38-0373. systemic infection. Lack of hybridization with component B of TYLCV-[DO], ToMoV-FL, BGMV-GT, and PHYVV LITERATURE CITED suggests that it could be a monopartite geminivirus or have a Arguello-Astorga, G.A., Guevara-González, R.G., Herrera- distinct B component sequence. Phylogenetic analyses using Estrella, L.R., and Rivera-Bustamante, R.F. 1994. 136 / Volumen 21, Número 2, 2003

Geminivirus replication origins have a group-specific regulation. Critical Reviews of Plant Science 18:71-106. organization of iterative elements: a model for replication. Lotrakul, P. 2000. Biological and molecular properties of Virology 203:90-100. Sweet potato leaf curl virus. Ph.D. Thesis. Louisiana State Banks, G.K., Bedford, I.D., Beitia, F.J., Rodrigues-Cerezo, University. Baton Rouge, LA, USA. 93 p. E., and Markham, P.G. 1999. A novel geminivirus of Lotrakul, P., and Valverde, R.A. 1999. Cloning of a DNA-A- Ipomoea indica (Convolvulaceae) from Southern Spain. like genomic component of sweet potato leaf curl virus: Plant Disease 83:486. nucleotide sequence and phylogenetic relationships. Bradeen, J.M., Timmermans, M.C.P., and Messing, J. 1997. Molecular Plant Pathology. On-line publication/1999/ Dynamic genome organization and gene evolution by 0206lotrakul. positive selection in geminivirus (Geminiviridae). Lotrakul, P., Valverde, R.A., Clark, C.A., Hurtt, S., and Hoy, Molecular Biology and Evolution 14:1114-1124. M.W. 2002. Sweet potato leaf curl virus and related Brown, J.K., Ostrow, K.M., Idris, A.M., and Stenger, D.C. geminiviruses in sweet potato. Acta Horticulturae 583:135- 1999. Biotic, molecular, and phylogenetic characterization 141. of bean calico mosaic virus, a distinct Begomovirus species Lotrakul, P., Valverde, R.A., Clark, C.A., Sim, J., and De La with affiliation in the squash leaf curl virus cluster. Torre, R. 1998. Detection of a geminivirus infecting sweet Phytopathology 89:273-280. potato in the United States. Plant Disease 82:1253-1257. Cohen, J., Milgram, M., Antignus, Y., Pearlsman, M., Lotrakul, P., Valverde, R.A., and Landry, A.D. 2000. Lachman, O., and Loebenstein, G. 1997. Ipomoea crinkle Biological and molecular properties of a begomovirus from leaf curl virus caused by a whitefly-transmitted gemini- Dicliptera sexangularis. Phytopathology 90:723-729. like virus. Annals of Applied Biology 131:273-282. Onuki, M., and Hanada, K. 1998. PCR amplification and Fauquet, C.M., Maxuell, D.P., Gronenborn, B., and Stanley, partial nucleotide sequences of three dicot-infecting J. 2000. Revised proposal for naming geminiviruses. geminiviruses occurring in Japan. Annals of the Archives of Virology 145:1743-1761. Phytopathological Society of Japan 64:116-120. Gilbertson, R.L., Faria, J.C., Hanson, S.F., Morales, F.J., Thompson, J.D., Higgins, D.G., and Gibson, T.J. 1994. Clustal Ahlquist, P., Maxwell, D.P., and Russell, D.R. 1991. W: Improving the sensitivity of progressive multiple Cloning of the complete DNA genomes of four bean- sequence alignment through sequence weighting, infecting geminiviruses and determining their infectivity positions-specific gap penalties, and weight matrix choice. by electric discharge particle acceleration. Phytopathology Nucleic Acids Research 22:4673-4680. 81:980-985. Hanley-Bowdoin, L., Settlage, S.B., Orozco, B.M., Nagar, S., and Robertson, D. 1999. Geminiviruses: Models for plant DNA replication, transcription, and cell cycle