Characterization of Microsatellite Loci in a Seed Chalcid, Megastigmus Spermotrophus (Hymenoptera: Torymidae)
Total Page：16
File Type：pdf, Size：1020Kb
Molecular Ecology Notes (2003) 3, 363–365 doi: 10.1046/j.1471-8286.2003.00451.x PRIMERBlackwell Publishing Ltd. NOTE Characterization of microsatellite loci in a seed chalcid, Megastigmus spermotrophus (Hymenoptera: Torymidae) S. BOIVIN,* C. KERDELHUÉ,* M. A. ROZENBERG,* M. L. CARIOU† and A. ROQUES* *INRA, Zoologie Forestière, BP 20619, F-45166 Olivet Cedex, France, †CNRS, PGE, 91198 Gif-sur-Yvette Cedex, France Abstract Highly polymorphic microsatellite markers can supply demographic information on founder events and range expansion following initial introduction of invasive insect spe- cies. Six microsatellite loci were isolated from a partial DNA library in order to study the invasion patterns of a seed chalcid, Megastigmus spermotrophus, introduced to Europe and New Zealand. Allelic diversity at all described loci was high, ranging from 17 to 30 alleles per locus. All six loci were successfully amplified in 15 congeneric species. Keywords: invasive species, Megastigmus, microsatellites Received 24 February 2003; revision accepted 17 March 2003 The development of the international trade of forest seeds (Promega). Approximately 800 recombinant clones were favours the invasion of exotic insect pests along with their screened for microsatellites with DIG-labelled oligonucle- host seeds. Among them, species of the genus Megastigmus otide probes: (CT)10, (GT)10, (CAC)5CA, (CTC)5CT, (TGTA)5TG Dalman (Chalcidoidea: Torymidae) are serious seed pests and (CTAT)5CTA. of conifers and some broad-leaved trees (Roques & The 89 positive clones obtained were sequenced using Skrzypczynska 2003). At the end of the 19th century, the Big Dye™ Terminators on an ABI PRISM® 3100 Genetic Douglas-fir seed chalcid, M. spermotrophus Wachtl, was Analyser (Applied Biosystems). Sixty-seven clones revealed introduced, along with seeds of its original host Pseu- at least one microsatellite locus. We defined polymerase dotsuga menziesii [Mirbel] Franco, from western North chain reaction (PCR) conditions for six loci. Technical America to Europe and New Zealand where no native details and GenBank accession numbers are given in species of Pseudotsuga occur. Our goal is to assess the level Table 1. The amplifications were performed on 28 females of genetic variability of this species and to study the from one population (Eagle Lake, USA). Amplifications processes of genetic differentiation following pest estab- were carried out in 10 µL reaction mix containing 25–50 ng lishment. Only three of the microsatellites from a related template DNA, 200 µm of each dNTP, 0.5 µm each primer, species, M. wachtli Seitner, could be used for M. 0.5 U of REDTaq™ genomic DNA polymerase (Sigma) and × spermotrophus populations (Carcreff et al. 1998; Rasplus 1 buffer. Concentrations of MgCl2 are shown in Table 1. et al. 2000). We developed and characterized six additional Either the forward or the reverse of each primer set was 5′ specific microsatellite primers that were also tested in 21 end-labelled with one of the fluorescent dyes, either 6- congeneric species. FAM, HEX (Sigma) or NED (Applied Biosystems), for The protocol for genomic library construction was modi- laser-beam detection of the PCR products. Using a PTC- fied from Estoup et al. (1993). Genomic DNA was extracted 100™ Thermocycler (MJ Research Inc.), PCR cycling con- from 20 females using the Dneasy™ Tissue Kit (Qiagen), ditions were: 3 min at 95 °C, followed by 30 cycles of 45 s and approximately 10 µg of this DNA was digested to at 95 °C, 30 s annealing temperature (Table 1) and 30 s at completion with Sau3A (Promega). The 400–900 bp frag- 72 °C. PCR products were sized on an ABI PRISM® 3100 ments were purified using the QiaQuick gel extraction Genetic Analyser using genescan software (Applied kit (Qiagen) and cloned into the pUC18 vector (Amersham Biosystems). Pharmacia Biotech) using JM109 competent cells All the tested individuals were successfully amplified. The number of alleles per locus ranged from 17 to 30. The Correspondence: Solen Boivin. Fax: (33 2) 38 41 78 79; E-mail: absence of null alleles at any of the loci was strongly sug- [email protected] gested by the lack of nonamplifying individuals and good © 2003 Blackwell Publishing Ltd 364 PRIMER NOTE Table 1 Characteristics of the six microsatellite loci. Allele number and heterozygosities were calculated on 28 individuals (Eagle Lake, USA) Locus Annealing Mg2+ Nb Size GenBank → ° name Primer sequences (5’ 3’) temp. ( C) conc. (mm) Motif alleles range HO HE P-value accession no. MS1-alpha GACTGCAAGCTCGACTCACAC 52 1.4 (CA)18 20 103–155 0.89 0.95 0.69 AY249163 *TTTCTCCTCGACGCTGAT MS1-43 GCAAGCCCTTCGCACAAC 56 1.2 (AC)15 17 88–130 0.89 0.95 0.43 AY249162 *GCGCTTCACCGACCTCC MS2-89 *CGCAATTAACTGTACGTG 50 1.2 (CA)25 30 229–319 0.86 0.98 0.55 AY249165 ACTGTATCCCTTTTGCTCTC MS2-162 *GCAGACCGGCGAATAAATAA 58 1.4 (AG)4TG(AG)35 23 94–160 0.96 0.95 0.83 AY249164 TCTGCAGCACGATGTAAACG MS3-148 *CGGACTGTCGCCCACGTT 56 1.4 (GA)41 26 162–234 0.93 0.96 0.75 AY249166 CGACACTTATACACCGGCATT MS3-180 TCTTCTCGCTCTGGATATTCT 52 1.4 (AC)34 22 146–204 0.86 0.96 0.45 AY249167 *TCGCGTGTCTATGTATGT *Fluorescent-labelled primers. HE = expected heterozygosity; HO = observed heterozygosity. Table 2 Cross-species amplifications at the six loci. Numbers refer to the size (bp) of the PCR products. 0 refers to unsuccessful amplifications. When partial success, numbers of amplified individuals are within brackets Locus Tested Species Host individuals MS1-alpha MS2-89 MS2-162 MS3-180 MS1-43 MS3-148 M. milleri Abies 4 143–159 241 128–181 (3) 128–206 81–128 (3) 160–167 M. pinus Abies 4 111–122 213–303 101–138 (3) 167–220 72–126 180–219 M. rafni Abies 4 96–106 226 99–117 (3) 149–200 109–155 179–221 M. suspectus Abies 895–108 (3) 234–236 (3) 115–127 (3) 166–181 94–104 189–201 M. specularis Abies 3 111–130 235–237 92–94 177–225 (2) 71–75 158–165 M. pinsapinis Cedrus 496–159 226–241 103–128 187–191 94–96 189–205 M. schimitscheki Cedrus 20 95–102 234–248 104–155 197–231 111–185 220–280 M. atlanticus Cupressus 4 101–220 232–274 69–124 (3) 154–260 (2) 87–121 161–203 M. duclouxianae Cupressus 4 108–153 242 (1) 96–106 143–194 77–83 196–250 M. wachtli Cupressus 4 101–117 232–289 69–93 154–260 90–114 159–202 M. bipunctatus Juniperus 3 114–127 248–256 81–95 157–194 98–116 166–188 M. amicorum Juniperus 4 103–146 230–238 77–90 156–163 90–107 165–192 M. pingii Juniperus 3 107–112 236 84–100 (2) 149–207 81–105 149–163 M. spermotrophus. Pseudotsuga 398–132 240–286 101–134 162–227 95–113 191–211 var. nigrovariegatus M. pictus Larix 496–128 226–230 103 (3) 140(3) 108–111 169 M. atedius Picea 180–87 234 126 174–178 0 195–197 M. rosae Rosa 496–980 69–109 144–146 61–113 155 (3) M. aculeatus Rosa 498–100 (3) 0 114–120 (2) 144–150 (3) 61 (3) 204–242 (2) M. rhusi Rhus 10244 0 182 85 191 M. transvaalensis Schinus 20267–356 0 206–208 108 168 M. pistaciae Pistacia 202380000 agreement to Hardy–Weinberg proportions (Table 1), as Using the same PCR conditions, the six loci were suc- tested in the arlequin software (Schneider et al. 1997). cessfully amplified in 15 of the 21 species of the genus Linkage disequilibrium between each pair of loci was not Megastigmus. They were mostly polymorphic (Table 2). significant (P-value ranging from 0.06 to 0.68) except for Two loci (MS3-148 and MS3-180) worked in all but one dif- MS1-43 and MS2-162 (P-value = 0.01). ferent species. This might be indicative of their more or less © 2003 Blackwell Publishing Ltd, Molecular Ecology Notes, 3, 363–365 PRIMER NOTE 365 distant phylogenetic relationships; indeed, the host species Rasplus JY, Carcreff E, Cornuet JM, Roques A (2000) Genetic of five nonsuccessful amplifications belong to angiosperms. structure of the cypress seed chalcid Megastigmus wachtli (Tory- midae) within its Mediterranean distribution. In: Hymenoptera: Evolution, Biodiversity and Biological Control (eds Austin AD, References Dowton M), pp. 114–130. CSIRO Publishing, Collingwood, Australia. Carcreff E, Rasplus JY, Roques A, Mondor G, Vautrin D, Solignac M Roques A, Skrzypczynska M (2003) Seed-infesting chalcids of the (1998) Isolation and characterization of microsatellite loci in the genus Megastigmus Dalman, 1820 (Hymenoptera: Torymidae) native seed chalcid, Megastigmus wachtli. Molecular Ecology, 7, 251–253. and introduced to the West Palearctic region: taxonomy, host specif- Estoup A, Solignac M, Harry M, Cornuet JM (1993) Characterisa- icity and distribution. Journal of Natural History, 37, 127–238. tion of (GT)n and (CT)n microsatellites in two insect species: Apis Schneider S, Kueffer JM, Roessli D, Excoffier L (1997) Arlequin, mellifera and Bombus terrestris. Nucleic Acids Research, 21, Version 1.1: a Software for Population Data Analysis Genetics and 1427–1431. Biometry Laboratory. University of Geneva, Geneva, Switzerland. © 2003 Blackwell Publishing Ltd, Molecular Ecology Notes, 3, 363–365.