Optimized CRISPR-Cpf1 System for Genome Editing in Zebrafish

Accepted Manuscript Optimized CRISPR-Cpf1 system for genome editing in zebrafish Juan P. Fernandez, Charles E. Vejnar, Antonio J. Giraldez, Romain Rouet, Miguel A. Moreno-Mateos PII: S1046-2023(18)30021-5 DOI: https://doi.org/10.1016/j.ymeth.2018.06.014 Reference: YMETH 4513 To appear in: Methods Received Date: 9 March 2018 Revised Date: 15 June 2018 Accepted Date: 26 June 2018 Please cite this article as: J.P. Fernandez, C.E. Vejnar, A.J. Giraldez, R. Rouet, M.A. Moreno-Mateos, Optimized CRISPR-Cpf1 system for genome editing in zebrafish, Methods (2018), doi: https://doi.org/10.1016/j.ymeth. 2018.06.014 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Optimized CRISPR-Cpf1 system for genome editing in zebrafish Juan P. Fernandez a,*, Charles E. Vejnar a,*, Antonio J. Giraldez a,b,c‡, d,‡ a,1,‡ Romain Rouet and Miguel A. Moreno-Mateos a Department of Genetics, b Yale Stem Cell Center, c Yale Cancer Center, Yale University School of Medicine, New Haven, CT 06510, USA, d Garvan Institute of Medical Research, Sydney, NSW, Australia, *Co-first Authors ‡To whom correspondence should be addressed: E-mail: [email protected], [email protected], [email protected] 1 Present address: Department of Regeneration and Cell Therapy, Andalusian Molecular Biology and Regenerative Medicine Centre (CABIMER), Seville, Spain. Abstract The CRISPR-Cas9 system biotechnological impact has recently broadened the genome editing toolbox available to different model organisms further with the addition of new efficient CRISPR-based endonucleases. We have recently optimized CRISPR-Cpf1 (renamed Cas12a) system in zebrafish. We showed that i) in the absence of Cpf1 protein, crRNAs are unstable and degraded in vivo, and CRISPR-Cpf1 RNP complexes efficiently mutagenize the zebrafish genome; and ii) temperature modulates Cpf1 activity especially affecting AsCpf1, which experiences a reduced performance below 37°C. Here, we describe a step-by-step protocol on how to easily design and generate crRNAs in vitro, purify recombinant Cpf1 proteins, and assemble ribonucleoprotein complexes to carry out efficient mutagenesis in zebrafish in a constitutive and temperature-controlled manner. Finally, we explain how to induce Cpf1-mediated homology-directed repair using single-stranded DNA oligonucleotides. In summary, this protocol includes the steps to efficiently modify the zebrafish genome and other ectothermic organisms using the CRISPR–Cpf1 system. Keywords: Cpf1, Cas12a, zebrafish, HDR, temperature regulation 1. Introduction Precise genome editing technologies with the development of different CRISPR-Cas systems have the potential to revolutionize our ability to understand gene function and possibly cure genetic disorders [1]. CRISPR- Cpf1 (Cas12a) is class 2/type V CRISPR-Cas system that has been successfully employed to edit the genomes of mammalian cells [2], plants [3,4], mice [5,6], Drosophila [7] and recently zebrafish and Xenopus [8]. The CRISPR-Cpf1 system shows different and complementary properties compared with CRISPR-Cas9, such as i) distinct target recognition in AT-rich sequences, ii) high specificity, iii) PAM-distal DNA cleavage providing 5′- overhang ends, iv) shorter guide RNA (crRNA), and (v) more potential targets (i.e. twice and ten-times more in coding-sequences and 3’-UTRs of zebrafish genes respectively compared to SpCas9 taking into account restrictions on Cas9 potential target sites associated with single guide RNA (sgRNA) in vitro transcription) (Fig. 1). In addition, Cpf1 is able to process more structured pre- crRNA molecules into mature crRNAs [9] which allows the possibility to use both mature or pre-crRNA for genome editing purposes [8]. All these features make the CRISPR-Cpf1 system a valuable genome-engineering tool. Two Cpf1 orthologs have been commonly used for genome editing in different organisms: AsCpf1 and LbCpf1, which are derived from Acidaminococcus sp BV3L6 and Lachnospiraceae bacterium ND2006, respectively. Delivery of the Cpf1 endonucleases in organisms is of particular importance: we recently found that crRNAs are degraded rapidly during the first hours after their injection into one-cell stage zebrafish embryos [8]. However, in vitro assembled LbCpf1-crRNA ribonucleoprotein (RNP) complexes protect crRNAs from decay and allows efficient mutagenesis in zebrafish embryos. We also showed that temperature affects Cpf1 activity in vitro and in vivo. While LbCpf1 is more stable and can be used as a constitutive genome editing system at different temperatures and organisms, AsCpf1 activity is reduced at temperatures lower than 37°C. This feature provides temporal control to induce Cpf1 mutagenesis in vivo. All these optimizations are incorporated in this protocol, which details step-by-step explanations for using the CRISPR-Cpf1 system in zebrafish to induce genome editing through non- homologous end joining (NHEJ) and homology-directed repair (HDR) using single-stranded DNA (ssDNA) oligonucleotides donors. 2. Design of crRNA using CRISPRscan.org The CRISPRscan.org website provides crRNA design adapted to multiple experimental situations. First, pre-computed crRNAs targeting coding-sequences of protein-coding genes are available in the first tab “By gene” (Fig. 2A). This panel requires selecting the species of interest and the enzyme (AsCpf1 or as in the figure, LbCpf1), and entering the gene or transcript name. Second, the panel “Submit sequence” allows for more flexibility: all crRNAs available on the submitted sequence will be predicted after selecting the corresponding enzyme (multiple sequences can be submitted using FASTA format). Any sequence, including sequences containing variants to the reference genome sequence, can be submitted (Fig. 2B). Third, CRISPRscan offers browser tracks for UCSC genome browser. These tracks provide pre-computed crRNAs for whole genomes or restricted to protein-coding genes. To select the best crRNA(s) among the CRISPRscan predicted crRNAs, useful criteria include: (i) using the more restrictive PAM TTTV instead of TTTN [9]; (ii) absence of off-targets; and (iii) high target score. CRISPRscan provides the “all” and “seed” off-target rules: “all” rule counts any targets with at most 2 mismatches with the on-target, while the “seed” rule prohibits any mismatch in the seed and accepts them outside of the seed [10]. In consequence, less off-targets are found following the “seed” rule. In contrast, the “all” off-target rule predicts more off-targets. Using this “all” rule is more stringent and recommended. While Cpf1 activity in vivo has not yet been tested in a large scale to develop specific prediction methods, algorithms relying on large in cellulo dataset have been developed. For example, DeepCpf1 [11] provides such crRNA scoring. This prediction algorithm can be used to further restrict crRNA choice keeping in mind the model was not trained on in vivo dataset. Finally, after selecting crRNAs, CRISPRscan provides oligo sequences with the target site in capital letters and the tail in lowercase letters. These are ready to be ordered and used following this protocol (see below). 3. Generation of DNA template for crRNA IVT synthesis This part of the protocol details a polymerase chain reaction (PCR) to generate DNA template to be used for in vitro transcription (IVT) of crRNAs for both AsCpf1 and LbCpf1 (Fig. 3). 3.1 Fill-in PCR Keep all reagents on ice. Mix the following reagents for one reaction (we typically perform 2-4 PCR reactions (2-4 tubes) that will be pooled to ensure sufficient DNA yield): 2.0 μL PCR Buffer II (10X) (AmpliTaq DNA Polymerase kit; Thermo Fisher) 0.4 μL dNTP mix (10 mM per nt) 1.2 μL MgCl2 (25 mM) (AmpliTaq DNA Polymerase kit) 1 μL (As/Lb) Cpf1-crRNA or pre-crRNA universal primer (10 μM) 1 μL (As/Lb) specific primer from section 1 (10 μM) 0.2 μL AmpliTaq polymerase (5 U/μL) 14.2 μL RNase/DNase-free water 20 μL total volume If multiple crRNAs are used to target one particular gene in the same injection, mix the crRNA primers in equimolar concentrations and use 1 μL of this mix (10 μM) in the reaction. crRNA or pre-crRNA (As/Lb) universal primer contains the T7 promoter (underline), and the mature or the complete crRNA/pre-crRNA for AsCpf1 or LbCpf1 preceded by 5′GG (bold): AsCpf1-crRNA universal primer: 5’ CCCTAATACGACTCACTATAGGTAATTTCTACTCTTGTAGAT AsCpf1-pre-crRNA universal primer: 5’CCCTAATACGACTCACTATAGGGTCAAAAGACCTTTTTAATTTCTACTCT TGTAGAT LbCpf1-crRNA universal primer: 5’CCCTAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGAT LbCpf1-pre-crRNA universal primer: 5’CCCTAATACGACTCACTATAGGGTTTCAAAGATTAAATAATTTCTACTAA GTGTAGAT Each specific PCR primer (As/Lb) adds the spacer (target-binding sequence, 23 nt, N23) and the repeat sequence (lower case) in a reverse complement orientation. Specific AsCpf1 primer: 5’N23atctacaagagtagaaatta Specific LbCpf1 primer: 5’N23atctacacttagtagaaatta Set up the following PCR conditions in the thermocycler: 3 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at 52 °C, and 20 s at 72 °C, and a final step at 72 °C for 7 min. 65/66 (crRNA) or 80/81 (pre-crRNA) bp PCR product is generated for (As/Lb) Cpf1. After the program has completed, run an aliquot (5 μL of the sample) on a 2% agarose gel to visualize the PCR products on a standard gel imager to ensure proper amplification. 3.2 DNA purification Rest (approximately 75 μL) of PCR products from 4 (it can be less) tubes are pooled, cleaned and purified using DNA Clean and Concentrator-5 kit with Zymo-Spin IC columns (Zymo Research) as follows: Add 5 volumes (375 μL for 4 PCR reactions) of DNA Binding Buffer to each volume of DNA sample.

Load more