DOCSLIB.ORG

New Single Nucleotide Deletion in the SMPD1 Gene Causes Niemann Pick Disease Type a in a Child from Southwest Iran: a Case Report

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
New Single Nucleotide Deletion in the SMPD1 Gene Causes Niemann Pick Disease Type a in a Child from Southwest Iran: a Case Report Iran J Pediatr Original Article Apr 2013; Vol 23 (No 2), Pp: 233-236 New Single Nucleotide Deletion In the SMPD1 Gene Causes Niemann Pick Disease Type A in a Child from Southwest Iran: A Case Report Hamid Galehdari1; Raheleh Tangestani2; Sepideh Ghasemian3 1. Department of Genetics, Shahid Chamran University, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran 2. Research Center of Thalassemia and Hemoglobinopathies, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran 3. Toxicology Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran Jan 25, 2012 Aug 01, 2012 Dec 29, 2012 Received: ; Accepted: ; Online Available: Abstract Objective: # SMPD1 Niemann Pick disease (NPD) type A (NPA: MIM 257200) is a lipid storage disorder with an autosomal recessive inheritance and occurrs by defect of the gene encoding sphingomyelinase. Disruption of this enzyme leads to the accumulation of sphingomyelin in brain and liver, which in turn causes dysfunctionMethods: or damage of tissue. We reportSMPD1 firstly a 2.5 year old boy with NPA in southwest Iran. Initially, the diagnosis was resulted on the basis of clinical symptoms. The genomic DNA of the suspected individual was subjectedSMPD1 to exon sequencing of the gene. According to the human reference sequence NM_000543.4, a novel single guanine deletion resulting in a frameshift mutation (p.Gly247Alafs*9) was observed in the gene that mightFindings be :causative for the outcome of the disease. The present report is the first molecular genetics diagnosis of the NPA in southwest Iran. The detectedConclusion: deletion in the SMPD1 gene is remarkable because of its novelty. Despite similar morbidity SGA infants exhibited higher lethal complication rates following IraniandelayedJournal meconiumof Pediatrics passage, Volume compared23 (Number to2), AGAApr 20 infants.13, Pages: 233-236 Key Words: SMPD1 Niemann Pick disease; Gene; Acid sphingomyelinase-1; Mutation Introduction the biochemical and molecular levels with a higher Archive of SID[2] incidence than NPA and NPB . Both types A and B NPD is a heterogeneous disease with variations are characterized by Acid sphingomyelinase due to molecular and clinical courses. The (ASM) deficiency that leads to excessive incidence of the disease[1] is approximately sphingomyelin accumulation[3] in all phagocytic cells 1:150 000 live births . Because of variations in and in neurons . NPB is biochemically[4] similar to pathological and clinical features of the disease, NPA, but with less severity . Normally, the NPD is classified into those with deficiency of acid enzyme activity of ASM leads to the breakdown of sphingomyelinase activity (types A and B), and sphingomyelin into [3]ceramide and phosphoryl- those with defective intracellular processing and choline in lysosomes . Generally, multiple organs transporting of LDL cholesterol, which is known as such as spleen, liver, bone marrow, lymph nodes, type C. However, NPD type C (NPC) is different at lung and central nervous system are affected. * Corresponding Author; Address: Department of Genetics, Shahid Chamran University, Ahvaz, Iran E-mail: [email protected] www.SID.ir © 2013 by Pediatrics Center of Excellence, Children’s Medical Center,Iran J Tehran Pediatr; University Vol 23 (No of2), Medical Apr 2013 Sciences, All rights reserved. Published by: Tehran University of Medical Sciences (http://ijp.tums.ac.ir) 234 Novel mutation in the SMPD1 Gene Case Presentation Diagnosis can be achieved at the early childhood with a poor prognosis. Most NPA[1,3] patients die before reaching the age of 3 years . Clinically, A 2.5 year-old male, the first born child from first NPA is distinguished by failure of thrive, cousin parents was attending our center for hepatosplenomegaly and progressive neuro- genetic counseling and genetic diagnostics. The [5] SMPD1 degeneration . At molecular genetics level, patient showed typical signs of the Niemann Pick mutations in the gene on chromosome disease, such as hepatosplenomegaly, develop- SMPD1 [6] 11p14.5 are causative for the disease . The mental delay, mental retardation, and foam cells in gene is approximately 5 kb long and the the bone marrow, hypotonia, and thcherry red coding sequence is divided among six exons. maculae. Seizure and anorexia at 5-6 month of According to the Human Gene Mutation Database life was observed. He died as results of his illness. (www.hmdb.cf.ac.uk), more than 100 different Unfortunately, measurement of the ASM activity in the white blood cells failed and DNA test was the mutations (includingSMPD1 missense, nonsense, deletion, insertion, and splice site mutations) have only chance to establish a definite diagnosis. been reported in the gene. After obtaining informed consent, blood To date, some clinical investigations have been samples were collected from patient and his reported from Iranian patients. For instance, parents. Genomic DNA was extracted from EDTA- Motamedi et al reported a case of NPB in Iran and[7] described the clinical course of his patient . anticoagulated whole blood by standard salting Furthermore, Motamed et al reported a ten year out procedures. Selective amplification of all 6 study of liver biopsies in children's Medical Center exons was performed in a volume of 25 μl reaction in Tehran. They identified numerous patients with containing 10 pmol of each primer (TAG storage diseases. Most identified patients were Copenhagen A/S, Fruebjergvej3, Denmark) and 50ng of genomic DNA. PCR was carried out by a affected with NPD[8] and glycogen storage disease type 1 (GSD-I) . In addition, Majidzadeh et al set of designed primers using primer3out reported a case of NPD and compared clinical and software (http://frodo.wi.mit.edu/primer3/). [9] SMPD1 Properties of primers are indicated in Table 1. molecular aspects of the disease . Hoshmand et ° Temperature profile of reactions were as al presented a novel mutation in the gene ° ° ° follow: initial denaturation at 95 C for 3 min, 35 (data not published). Here, we present the first ° molecular genetics diagnosis of NPA in an cycles of 95 C for 30s, 56-60 C for 30s and 72 C individual from southwest Iran. for 45s and a final extension at 72 C for 7 min. Table 1: SMPD1 The gene was amplified by seven primer pairs. Exon 2 was amplified exon by two separate primerPrimer pairs sequence to assist (5’tosubsequent 3‘) sequencinglength reactions Tm 1-forward 1-reverseArchive of SID 2A-forward GAAGCGCGACAATGCCCCGCTA 445 bp 60.5°C 2A-reverse AGATGCCACCCTCTCCATCAGGGA 2B-forward GTGTGCACTGAGCTTGGTGCACTG 493bp 60.3°C 2B-reverse GTCTGCACAGTCAGGGTCCGTG 3-forward TGCTGCCTGAGTTACAGGGCAA 1058bp 59.4°C 3-reverse GCACTAAGGACTCATGCTAGAGCA 4-forward GGCTAGACTGTGAGCTCCTTGCAG 441bp 59.1°C 4-reverse CAACAGTGACCATGAGCTGAATCC 5-forward GTTGAGCTGGAGCACCTCTG 354bp 58.8°C 5-reverse CCCACTCCATGGGACAACAG 6-forward GACAGGGTGAGTGTCTGAAGGCTG 490bp 59.4°C 6-reverse GTACACACGGTAACCTGCAAGGA ACATCGGCCTTAATCCTGGTGAG 678bp 59.6°C ACCGGATGATCTTGCCTGGTTGAA www.SID.ir Iran J Pediatr; Vol 23 (No 2), Apr 2013 Published by: Tehran University of Medical Sciences (http://ijp.tums.ac.ir) Galehdari H, et al 235 Fig. 1: Chromatogram of sequencing reactions from a) affected individual, b)SMPD1 heterozygote parents, c) healthy person. The location of the novel deletion is indicated with black arrow and the position of the resulting stop codon is shown in black circle on the chromatogram. At bottom (d), partial sequence of the gene with corresponding codons is illustrated. Accordingly, the newly created stop codon is located between codons 256-257. [10] Direct sequencing of PCR products was carried out people of Ashkenazi Jewish descent has NPA . In using ABI automated sequencer 3700 according to contrast, there is no information about frequency the manufacture’s instruction (ABI 3700, PE and distribution of different types of NPD in Iran, Applied BioSystems, Foster City, CA, USA). particularly in southwest Iran. Sequencing reactions were accomplished by the The disease refers to a group of disorders with same primers that were used for exon deficiency in lipid storage, causing accumulation of amplification. Sequence analysis was performed fats in brain and liver that lead to serious[11] damage with the software BioEdit (version 7.0.5.3). or dysfunction of mentioned tissues . However, According to the human reference sequence liver enlargement, brain damage, difficulty in NM_000543.4, a homozygous single guanine walking, speaking and learning are characteristic SMPD1 [12] deletion, c.740delG, was observed in exon 2 of the symptoms for NPA . Diagnosis of this type of gene, which results in a premature stop disease is usually made by measuring[5] the ASM codon (CTG>TGA) between codons 256-257 activity in white blood cells . Regarding some (p.Gly247Alafs*9) (Fig 1). Apparently healthy typical symptoms, our patient was suspected to parents were heterozygousArchive for the detected suffer ofof NPA. HeSID was also referredSMPD1 to our change. They are also obligate carrier. To confirm molecular diagnostic center with the aim to find the pathogenic relevance of the detected deletion, genetic cause of the disease. The gene is 27 healthy individuals were tested. the only[6] gene considered to be associated with NPA . SMPD1 Here, we report an unreported deletion of Discussion single guanine in exon 2 of the gene, causing a truncated gene product. Exon 2 is unusually large, which encodes for 258 amino acids or approximately 44% of the entire ASM To our knowledge by intensive literature polypeptide. However, the pathogenic nature of searching, the present report demonstrates firstly the novel deletion was confirmed by screening of the molecular genetics diagnosis of the NPD in healthy individuals. southwest Iran. Approximately 1 per 40,000 Three common missense mutations account for www.SID.ir Iran J Pediatr; Vol 23 (No 2), Apr 2013 Published by: Tehran University of Medical Sciences (http://ijp.tums.ac.ir) 236 Novel mutation in the SMPD1 Gene more than 90% of the mutant alleles in individuals 3. Harzer K, Rolfs A, Bauer P, et al. Niemann-Pick disease type A and B are clinically but also of Ashkenazi Jewish ancestry with NPA.
Load more

Recommended publications
  • Value of Bronchoalveolar Lavage in Lipidoses with Pulmonary Involvement
    Eur Respir J, 1994, 7, 409–411 Copyright ERS Journals Ltd 1994 DOI: 10.1183/09031936.94.07020409 European Respiratory Journal Printed in UK - all rights reserved ISSN 0903 - 1936 CASE REPORT Value of bronchoalveolar lavage in lipidoses with pulmonary involvement L. Tabak, D. YIlmazbayhan, Z. KIlIçaslan, C. Tasçˆ Ioglu,˘ M. Agan˘ Value of bronchoalveolar lavage in lipidoses with pulmonary involvement. L. Tabak, D. Depts of Pulmonary Diseases, Pathology Yllmazbayhan, Z. KIlIçaslan, C. Tasçˆ Ioglu,˘˘ M. Agan. ERS Journals Ltd 1994. and Internal Medicine, Faculty of Medicine, ABSTRACT: Adult lipid storage disorders with pulmonary involvement are rare University of Istanbul, Turkey. and usually diagnosed at autopsy. We report a patient with splenomegaly and Correspondence: L. Tabak, Gögüs˘ HastalIklarI reticulonodular pattern on lung computed tomography. Anabilim DalI, ·Istanbul Tip Fakültesi, 34390, Bronchoalveolar lavage was performed and revealed the presence of lipid-containing Çapa, Istanbul,· Turkey. foamy cells, with the demonstration of both periodic acid-Schiff (PAS) and scharlach red stain positive vacuoles in the cytoplasm of alveolar macrophages. The same Keywords: Bronchoalveolar lavage; lipidoses; cells were found in bone marrow biopsy. diagnosis. As in other rare disorders, bronchoalveolar lavage may be of diagnostic value in Received: January 19 1993 lipid storage disorders with pulmonary involvement. Accepted after revision September 20 1993 Eur Respir J., 1994, 7, 409–411. Lipid storage disorders, such as Gaucher's disease and uation. The patient was a farmer. He had been born to Niemann-Pick disease, are inherited diseases in which healthy, unrelated parents after a normal pregnancy and deposits of certain lipids occur in various organs as a delivery; and was the third of five children.
    [Show full text]
  • Lysosome Lipid Storage Disorder in NCTR-BALB/C Mice
    Lysosome Lipid Storage Disorder in NCTR-BALB/c Mice I. Description of the Disease and Genetics MANFORD D. MORRIS, PhD, From the Departments ofPediatrics and Biochemistry, University of CHIDAMBARAM BHUVANESWARAN, PhD, Arkansas for Medical Sciences, Little Rock, Arkansas, and the HELEN SHIO, MA, and STANLEY FOWLER, PhD Laboratory of Biochemical Cytology, The Rockefeller University, New York, New York We describe a strain of BALB/c mice, designated creased, while a-lipoprotein content is decreased. Se- NCTR-BALB/c, carrying a new genetic disorder char- rum total cholesterol remains normal. The serum activ- acterized by excessive tissue deposition of cholesterol ities of asparate aminotransferase, creatine phospho- and phospholipid. The mice exhibit progressive inco- kinase, and N-acetyl-p-glucosaminidase are elevated. ordination, grow less rapidly, and die 80-120 days after Free cholesterol levels are increased 8-10-fold in liver, birth. In comparison with control animals of the same spleen, and thymus, and about 2-fold in other tissues; age, organ weights in the affected animals are lower in but esterified cholesterol levels are normal. The phos- absolute value but higher relative to body weight, ex- pholipid content of several tissues is increased 50-100%, cept for the thymus, which is atrophied, and for the largely as a result of an increase in sphingomyelin con- lung and testes, whose absolute weights are not changed. tent. Significant increases in phosphatidylcholine occur Vacuolated cells are found in many tissues, and large also in spleen and lung. The disorder is inherited, af- foam cells are present in reticuloendothelial system fecting both sexes equaliy, and appears to be transmitted (RES)-rich organs.
    [Show full text]
  • Unraveling the Sterol-Trafficking Defect in Niemann-Pick C Disease
    COMMENTARY Unraveling the sterol-trafficking defect in Niemann-Pick C disease Stephen L. Sturleya, Marc C. Pattersonb, and Peter Pentchevc,1 aDepartment of Pediatrics and Institute of Human Nutrition, Columbia University Medical Center, 630 West 168th Street, New York, NY 10032; bDivision of Child and Adolescent Neurology, Mayo Clinic, 200 First Street S.W., Rochester, MN 55905; and cMetabolic Modeling Services, 4217 Peterborough Road, West Lafayette, IN 47906-5680 he interorganellar transfer of hypothesis can now be tested in the showed that LXR agonists increase cho- lipids, particularly cholesterol, NPC2 mouse model (5). CYCLO may lesterol loss from the brain without al- is imperfectly understood but is provide a useful tool to probe the inter- tering synthesis (9). Neither of these a key component of membrane action of NPC1 and NPC2 proteins, physiological manipulations appeared to Thomeostasis as shown by the lethal dis- which modulate the relocation of lysoso- alter cholesterol permeability across the orders that are associated with its de- mal cholesterol to regulatory cytosolic limiting membrane of the lysosomes in rangement. For unknown reasons, the pools. which the cholesterol was trapped; this neuron is particularly susceptible to ex- may explain their limited effects. The cessive lipid accumulation. In the case Role of Cholesterol in NP-C unique aspect of the current study is of Niemann-Pick type C (NPC) disease, In a series of earlier publications, the that administration of CYCLO to the a lysosomal lipid storage disorder, the Dietschy and Repa laboratories ele- npc1Ϫ/Ϫ mice appeared to reestablish accumulation of cholesterol and sphin- gantly demonstrated the central role sterol movement out of lysosomes.
    [Show full text]
  • Unraveling the Sterol-Trafficking Defect in Niemann-Pick C Disease
    COMMENTARY Unraveling the sterol-trafficking defect in Niemann-Pick C disease Stephen L. Sturleya, Marc C. Pattersonb, and Peter Pentchevc,1 aDepartment of Pediatrics and Institute of Human Nutrition, Columbia University Medical Center, 630 West 168th Street, New York, NY 10032; bDivision of Child and Adolescent Neurology, Mayo Clinic, 200 First Street S.W., Rochester, MN 55905; and cMetabolic Modeling Services, 4217 Peterborough Road, West Lafayette, IN 47906-5680 he interorganellar transfer of hypothesis can now be tested in the showed that LXR agonists increase cho- lipids, particularly cholesterol, NPC2 mouse model (5). CYCLO may lesterol loss from the brain without al- is imperfectly understood but is provide a useful tool to probe the inter- tering synthesis (9). Neither of these a key component of membrane action of NPC1 and NPC2 proteins, physiological manipulations appeared to Thomeostasis as shown by the lethal dis- which modulate the relocation of lysoso- alter cholesterol permeability across the orders that are associated with its de- mal cholesterol to regulatory cytosolic limiting membrane of the lysosomes in rangement. For unknown reasons, the pools. which the cholesterol was trapped; this neuron is particularly susceptible to ex- may explain their limited effects. The cessive lipid accumulation. In the case Role of Cholesterol in NP-C unique aspect of the current study is of Niemann-Pick type C (NPC) disease, In a series of earlier publications, the that administration of CYCLO to the a lysosomal lipid storage disorder, the Dietschy and Repa laboratories ele- npc1Ϫ/Ϫ mice appeared to reestablish accumulation of cholesterol and sphin- gantly demonstrated the central role sterol movement out of lysosomes.
    [Show full text]
  • Autophagy, Lipophagy and Lysosomal Lipid Storage Disorders
    University of Birmingham Autophagy, lipophagy and lysosomal lipid storage disorders Ward, Carl; Martinez-lopez, Nuria; Otten, Elsje G.; Carroll, Bernadette; Maetzel, Dorothea; Singh, Rajat; Sarkar, Sovan; Korolchuk, Viktor I. DOI: 10.1016/j.bbalip.2016.01.006 License: Creative Commons: Attribution (CC BY) Document Version Publisher's PDF, also known as Version of record Citation for published version (Harvard): Ward, C, Martinez-lopez, N, Otten, EG, Carroll, B, Maetzel, D, Singh, R, Sarkar, S & Korolchuk, VI 2016, 'Autophagy, lipophagy and lysosomal lipid storage disorders', Biochimica and Biophysica Acta. Molecular and Cell Biology of Lipids, vol. 1861, no. 4, pp. 269-284. https://doi.org/10.1016/j.bbalip.2016.01.006 Link to publication on Research at Birmingham portal Publisher Rights Statement: Checked 15/07/2016 General rights Unless a licence is specified above, all rights (including copyright and moral rights) in this document are retained by the authors and/or the copyright holders. The express permission of the copyright holder must be obtained for any use of this material other than for purposes permitted by law. •Users may freely distribute the URL that is used to identify this publication. •Users may download and/or print one copy of the publication from the University of Birmingham research portal for the purpose of private study or non-commercial research. •User may use extracts from the document in line with the concept of ‘fair dealing’ under the Copyright, Designs and Patents Act 1988 (?) •Users may not further distribute the material nor use it for the purposes of commercial gain. Where a licence is displayed above, please note the terms and conditions of the licence govern your use of this document.
    [Show full text]
  • Regulation of Sphingomyelin Metabolism
    Pharmacological Reports 68 (2016) 570–581 Contents lists available at ScienceDirect Pharmacological Reports jou rnal homepage: www.elsevier.com/locate/pharep Review article Regulation of sphingomyelin metabolism a a,b a a Kamil Bienias , Anna Fiedorowicz , Anna Sadowska , Sławomir Prokopiuk , a, Halina Car * a Department of Experimental Pharmacology, Medical University of Białystok, Białystok, Poland b Laboratory of Tumor Molecular Immunobiology, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Wrocław, Poland A R T I C L E I N F O A B S T R A C T Article history: Sphingolipids (SFs) represent a large class of lipids playing diverse functions in a vast number of Received 2 April 2015 physiological and pathological processes. Sphingomyelin (SM) is the most abundant SF in the cell, with Received in revised form 24 November 2015 ubiquitous distribution within mammalian tissues, and particularly high levels in the Central Nervous Accepted 28 December 2015 System (CNS). SM is an essential element of plasma membrane (PM) and its levels are crucial for the cell Available online 11 January 2016 function. SM content in a cell is strictly regulated by the enzymes of SM metabolic pathways, which activities create a balance between SM synthesis and degradation. The de novo synthesis via SM Keywords: synthases (SMSs) in the last step of the multi-stage process is the most important pathway of SM Sphingomyelin formation in a cell. The SM hydrolysis by sphingomyelinases (SMases) increases the concentration of Sphingomyelin synthases ceramide (Cer), a bioactive molecule, which is involved in cellular proliferation, growth and apoptosis.
    [Show full text]
  • Gaucher Disease Agents
    Policy: Gaucher Disease Oral Agents Annual Review Date: Cerdelga (eliglustat) 12/14/2020 miglustat (generic) Last Revised Date: Zavesca (miglustat) 12/14/2020 OVERVIEW Miglustat (Zavesca) is an oral treatment approved for adult patients with mild to moderate type I Gaucher disease if enzyme replacement therapy (Cerezyme, Elelyso, Vpriv) is not a therapeutic option (for example, allergy, hypersensitivity or poor venous access). Miglustat works by inhibiting the enzyme that makes glucosphingolipid. Miglustat’s role in decreasing the rate of glycosphingolipid biosynthesis allows a reduction of the substance to a level which can be cleared by the remaining activity of the naturally occurring defective enzyme. Eliglustat (Cerdelga) is an oral glucosylceramide synthase inhibitor indicated for the long-term treatment of adult patients with Gaucher disease type 1 who are CYP2D6 extensive metabolizers (EMs), intermediate metabolizers (IMs), or poor metabolizers (PMs) as detected by an FDA- cleared test. Gaucher disease is an autosomal recessive lipid storage disorder characterized by a deficiency of glucocerebrosidase. Decreased glucocerebrosidase activity leads to accumulation of glucocerebroside within cell lysosomes in the liver, spleen, bone marrow and bone. Gaucher disease is classified into three clinical types: Type I Gaucher disease, known as non-neuronopathic because there is no central nervous system involvement, is the most common form and occurs at any age, predominantly in individuals of Ashkenazi Jewish descent. The disease involves visceral organs (e.g., liver, spleen), bone marrow and bone. Types II and III Gaucher disease, known as neuronopathic, are very rare forms with neurological involvement in addition to other organs affected by type I Gaucher disease.
    [Show full text]
  • Gaucher Disease
    Gaucher Disease Most Common Lipid-Storage Disease Chris Lemke Biochemistry/Molecular Biology April 23, 2001 History of Gaucher Disease 1882- French physician, Philippe Charles Ernest Gaucher (go-SHAY) described a clinical syndrome in a 32 yr. old women whose liver and spleen were enlarged. History of Gaucher Disease 1924- German physician, H. Lieb isolated a particular fatty compound from the spleens of people with Gaucher disease. 1934- French physician, A. Aghion identified this compound as glucocerebroside. 1965- American physician, Roscoe O. Brandy demonstrated that the accumulation of glucocerebroside results from a deficiency of the enzyme glucocerebrosidase. What is Gaucher Disease? The human body contains macrophages that remove worn-out cells by degrading them into simple molecules for recycling. Degradation occurs inside lysosomes. The enzyme glucocerebrosidase is located within the lysosomes and degrades glucocerebroside into glucose and ceramide. What is Gaucher Disease? People with Gaucher disease lack the normal form of the glucocerebrosidase, and are unable to break down glucocerebroside. Instead, glucocerebroside remains stored within the lysosomes, preventing the macrophages from functioning normally. Enlarged macrophages, due to the accumulated glucocerebroside, are known as, Gaucher cells. Gaucher Cell The Enzyme Glucocerebrosidase Molecular weight = 51,637 Number of residues= 448 Number of alpha= 18 Number of beta= 17 The Mutation Glucocerebrosidase gene locus 1q21 Single-base mutation (adenosine to guanosine transition) in exon 9 of the glucocerebrosidase gene. Amino acid substitution of serine for asparagine. Transient expression studies following oligonucleotide-directed mutagenesis of the normal cDNA confirmed that the mutation results in loss of glucocerebrosidase activity. Inheritance Patterns Gaucher disease is a autosomal recessive trait.
    [Show full text]
  • Neutral Lipid Storage with Acid Lipase Deficiency: a New Variant of Wolman's Disease with Features of the Senior Syndrome
    Pediatr. Res. 16: 954-959 (1982) Neutral Lipid Storage with Acid Lipase Deficiency: a New Variant of Wolman's Disease with Features of the Senior Syndrome 4 M. PHILIPPART/ 1) P. DURAND, AND C. BORRONE Mental Retardation Research Center, University ofCalifornia, UCLA Los Angeles, California, USA and Third Department ofPediatrics, G. Gaslini Institute, Genova-Quarto, Italy Summary (37), triolein, tripalmitin, cholesteryl oleate, phosphatidylserine and phosphatidylethanolamine (38) were used to prepare lipase A girl presented with small stature, obesity,. tapetoretinal de­ substrates. generation, deafness, psychomotor regression, seizures, acanthosis Thin layer chromatography of neutral lipids was conducted nigricans, hepatomegaly, and chronic tubulointerstitial nephropa­ by sequential runs in diethylether:benzene:ethanol:acetic acid thy. She died at age ten with renal insufficiency and uncontrolled (80: 100:4:0.4) and hexane:diethyl ether (94:6) on 250 f.t Silica seizures. Histochemistry showed lipid storage in hepatocytes, Gel G (8). Lipids were visualized by exposure to iodine vapor or histiocytes, smooth muscles and, to a much lesser extent, kidney two-dimensional scanning (39). Lipid areas were scraped and tubules and cortical neurons. The liver had increased cholesterol counted in Aquasol (37). Lipid extracts (250 f.tg) from normal esters (5-fold) and triacylglycerols (8-fold), and decreased phos­ human serum were used as standards for lipid identification. pholipids (50%). Methyllumbelliferyl-oleate, oleylcholestrol, tri­ Enzyme extracts were prepared by extracting tissues with 9 vol­ oleylglycerol, and tripalmitylglycerol lipase activities were mark­ umes of water in a Potter-Elvehjem fitted with a Teflon pestle. edly reduced in the liver, in the range found in Wolman's disease.
    [Show full text]
  • Pluripotent Stem Cells for Disease Modeling and Drug Discovery in Niemann-Pick Type C1
    International Journal of Molecular Sciences Review Pluripotent Stem Cells for Disease Modeling and Drug Discovery in Niemann-Pick Type C1 Christin Völkner 1,†, Maik Liedtke 1,†, Andreas Hermann 1,2,3 and Moritz J. Frech 1,2,* 1 Translational Neurodegeneration Section “Albrecht Kossel”, Department of Neurology, University Medical Center Rostock, 18147 Rostock, Germany; [email protected] (C.V.); [email protected] (M.L.); [email protected] (A.H.) 2 Center for Transdisciplinary Neurosciences Rostock (CTNR), University Medical Center Rostock, 18147 Rostock, Germany 3 German Center for Neurodegenerative Diseases (DZNE) Rostock/Greifswald, 18147 Rostock, Germany * Correspondence: [email protected] † These authors contributed equally. Abstract: The lysosomal storage disorders Niemann-Pick disease Type C1 (NPC1) and Type C2 (NPC2) are rare diseases caused by mutations in the NPC1 or NPC2 gene. Both NPC1 and NPC2 are proteins responsible for the exit of cholesterol from late endosomes and lysosomes (LE/LY). Conse- quently, mutations in one of the two proteins lead to the accumulation of unesterified cholesterol and glycosphingolipids in LE/LY, displaying a disease hallmark. A total of 95% of cases are due to a deficiency of NPC1 and only 5% are caused by NPC2 deficiency. Clinical manifestations in- clude neurological symptoms and systemic symptoms, such as hepatosplenomegaly and pulmonary manifestations, the latter being particularly pronounced in NPC2 patients. NPC1 and NPC2 are rare diseases with the described neurovisceral clinical picture, but studies with human primary patient-derived neurons and hepatocytes are hardly feasible. Obviously, induced pluripotent stem cells (iPSCs) and their derivatives are an excellent alternative for indispensable studies with these affected cell types to study the multisystemic disease NPC1.
    [Show full text]
  • Neuronal Ceroid Lipofuscinosis
    Essays in Biochemistry (2017) 61 733–749 https://doi.org/10.1042/EBC20170055 Review Article Dysregulation of autophagy as a common mechanism in lysosomal storage diseases Elena Seranova1,*,KyleJ.Connolly1,*, Malgorzata Zatyka1, Tatiana R. Rosenstock2,TimothyBarrett1, Richard I. Tuxworth1 and Sovan Sarkar1 1Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, U.K.; 2Department of Physiological Science, Santa Casa de Sao˜ Paulo School of Medical Science, Sao˜ Paulo, SP 01221-020, Brazil Correspondence: Sovan Sarkar ([email protected]) or Richard I. Tuxworth ([email protected]) The lysosome plays a pivotal role between catabolic and anabolic processes as the nexus for signalling pathways responsive to a variety of factors, such as growth, nutrient avail- ability, energetic status and cellular stressors. Lysosomes are also the terminal degradative organelles for autophagy through which macromolecules and damaged cellular components and organelles are degraded. Autophagy acts as a cellular homeostatic pathway that is es- sential for organismal physiology. Decline in autophagy during ageing or in many diseases, including late-onset forms of neurodegeneration is considered a major contributing factor to the pathology. Multiple lines of evidence indicate that impairment in autophagy is also a central mechanism underlying several lysosomal storage disorders (LSDs). LSDs are a class of rare, inherited disorders whose histopathological hallmark is the accumulation of unde- graded materials in the lysosomes due to abnormal lysosomal function. Inefficient degrada- tive capability of the lysosomes has negative impact on the flux through the autophagic pathway, and therefore dysregulated autophagy in LSDs is emerging as a relevant disease mechanism.
    [Show full text]
  • Lipid Storage Diseases
    Lipid Storage Diseases U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Lipid Storage Diseases What are lipid storage diseases? ipid storage diseases, or the lipidoses, are L a group of inherited metabolic disorders in which harmful amounts of fatty materials (lipids) accumulate in various cells and tissues in the body. People with these disorders either do not produce enough of one of the enzymes needed to break down (metabolize) lipids or they produce enzymes that do not work properly. Over time, this excessive storage of fats can cause permanent cellular and tissue damage, particularly in the brain, peripheral nervous system (the nerves from the spinal cord to the rest of the body), liver, spleen, and bone marrow. What are lipids? ipids are fat-like substances that are L important parts of the membranes found within and between cells and in the myelin sheath that coats and protects the nerves. Lipids include oils, fatty acids, waxes, steroids (such as cholesterol and estrogen), and other related compounds. These fatty materials are stored naturally in the body’s cells, organs, and tissues. Tiny bodies within cells called lysosomes regularly convert, or metabolize, the lipids and proteins into smaller components to provide energy for the body. Disorders in which intracellular 1 material that cannot be metabolized is stored in the lysosomes are called lysosomal storage diseases. In addition to lipid storage diseases, other lysosomal storage diseases include the mucolipidoses, in which excessive amounts of lipids with attached sugar molecules are stored in the cells and tissues, and the mucopolysaccharidoses, in which excessive amounts of large, complicated sugar molecules are stored.
    [Show full text]