DOCSLIB.ORG

(LCA9) for Leber's Congenital Amaurosis on Chromosome 1P36

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(LCA9) for Leber's Congenital Amaurosis on Chromosome 1P36 European Journal of Human Genetics (2003) 11, 420–423 & 2003 Nature Publishing Group All rights reserved 1018-4813/03 $25.00 www.nature.com/ejhg SHORT REPORT Identification of a locus (LCA9) for Leber’s congenital amaurosis on chromosome 1p36 T Jeffrey Keen1, Moin D Mohamed1, Martin McKibbin2, Yasmin Rashid3, Hussain Jafri3, Irene H Maumenee4 and Chris F Inglehearn*,1 1Molecular Medicine Unit, University of Leeds, Leeds, UK; 2Department of Ophthalmology, St James’s University Hospital, Leeds, UK; 3Department of Obstetrics and Gynaecology, Fatima Jinnah Medical College, Lahore, Pakistan; 4Department of Ophthalmology, Johns Hopkins University School of Medicine, Baltimore, MD, USA Leber’s congenital amaurosis (LCA) is the most common cause of inherited childhood blindness and is characterised by severe retinal degeneration at or shortly after birth. We have identified a new locus, LCA9, on chromosome 1p36, at which the disease segregates in a single consanguineous Pakistani family. Following a whole genome linkage search, an autozygous region of 10 cM was identified between the markers D1S1612 and D1S228. Multipoint linkage analysis generated a lod score of 4.4, strongly supporting linkage to this region. The critical disease interval contains at least 5.7 Mb of DNA and around 50 distinct genes. One of these, retinoid binding protein 7 (RBP7), was screened for mutations in the family, but none was found. European Journal of Human Genetics (2003) 11, 420–423. doi:10.1038/sj.ejhg.5200981 Keywords: Leber’s congenital amaurosis; LCA; LCA9; retina; linkage; 1p36 Introduction guineous pedigrees, known as homozygosity or autozygos- Leber’s congenital amaurosis (LCA) is the name given to a ity mapping, is a powerful approach to identify recessively group of recessively inherited retinal dystrophies repre- inherited disease gene loci.10 Cultural precedents in some senting the most common genetic cause of blindness in Pakistani communities have led to a high frequency of infants and children. Symptoms include severe visual first-cousin marriages.11 Such families have a higher level impairment at or within a few months of birth, nystagmus, of genetic disease than those in Western populations,12 sluggish pupils and an absent or reduced electroretino- making them an important resource in the quest to gram.1 Currently, six genes have been identified in which identify the genes that underlie recessively inherited mutations are implicated in the pathogenesis of LCA,2–7 human disease. We identified 11 members from two and two further loci are known to exist from linkage generations of a large consanguineous family affected by studies.8,9 LCA (Figure 1), who originate from the Punjab region of The rationale for this study was that the level of genetic Pakistan. Having excluded linkage to the known LCA loci, heterogeneity in LCA would be comparable to that we then performed a whole genome linkage search to observed with retinitis pigmentosa and thus there should identify a new locus for LCA in this family. be further unidentified loci. Linkage analysis in consan- *Correspondence: Dr CF Inglehearn, Molecular Medicine Unit, Clinical Materials and methods Sciences Building, St James’s University Hospital, Leeds LS9 7TF, UK. All family members were subjected to a full ophthalmic Tel: 0113 206 5698; Fax: 0113 244 4475; examination by two independent ophthalmologists. The E-mail: [email protected] six affected individuals, whose ages ranged from 13 to 21 The first two authors contributed equally to this publication Received 2 October 2002; revised 23 January 2003; accepted 5 February years, all gave a typical history of nonprogressive 2003 severe visual impairment since birth and photophobia. A new Leber’s amaurosis locus on 1p36 TJ Keen et al 421 Known LCA loci were excluded using the markers I:1 I:2 D1S3736 (RPE65), D1S1660 (CRB1), D6S968 (LCA5), D14S742 (RPGRIP), AGAT137 and GATA193A07 (LCA3), II:1 II:2 II:3 II:4 GATA158H04, D17S1308 and D17S974 (AIPL1 and GU- CY2D), and D19S246 (CRX). Linkage analysis for the 13 III:1 III:2 III:3 III:4 genome search was carried out using Genehunter v2.1, CATC051 364 376 388 364 364 376 390 364 D1S2132 246 250 242 246 246 250 242 246 D1S1646 137 137 149 137 137 137 149 137 while the two- and three-point linkage analyses were D1S2663 197 193 203 197 197 193 203 197 D1S2694 244 248 240 244 244 248 240 244 produced using MLINK and LINKMAP, programmes from D1S548 148 168 148 148 148 168 148 148 14 D1S2666 190 190 192 190 190 190 192 190 the Linkage suite. Mutation detection was carried out by D1S508 77 75 73 77 77 75 73 77 D1S1612 176 172 156 176 176 156 156 176 t D1S503 209 209 207 209 ? ? ? ? direct sequencing of PCR products using the ABI BigDye D1S450 252 264 258 252 252 252 258 252 D1S2736 121 127 125 121 ? ? ? ? v3.0 cycle sequencing kit. SSCP analysis was also carried D1S2667 261 265 259 261 261 263 259 261 D1S2740 97 103 89 97 ? ? 89 97 out on the PCR products using the Pharmacia Biotech D1S489 150 150 150 150 150 142 150 150 D1S434 246 250 ? ? 246 248 240 246 D1S1597 167 171 171 167 167 163 171 167 GeneGel Excel kit. D1S228 105 105 105 105 105 115 105 111 D1S2834 179 179 179 179 179 181 179 179 D1S507 195 197 183 189 195 197 185 185 D1S2728 254 250 254 250 254 254 254 250 D1S3669 187 183 179 203 187 211 179 187 D1S1592 243 239 239 235 243 243 239 239 ATA47D07 133 130 139 133 133 139 139 133 Results Initially, genetic markers close to each of the known LCA loci were tested and linkage to these excluded in this IV:1 IV:2 IV:3 IV:4 IV:5 IV:6 IV:7 family (data not shown). A whole genome linkage search CATC051 364 376 ? ? 364 364 364 364 390 364 364 364 390 364 D1S2132 246 250 242 246 246 246 246 246 242 246 246 246 242 246 was then carried out, whereby all 11 sampled members of D1S1646 137 137 149 137 137 137 137 137 149 137 137 137 149 137 D1S2663 197 193 203 197 197 197 197 197 203 197 197 197 203 197 D1S2694 244 248 240 244 244 244 244 244 240 244 244 244 240 244 the family were genotyped for the 407 markers in version D1S548 148 168 148 148 148 148 148 148 148 148 148 148 148 148 D1S2666 190 190 192 190 190 190 190 190 192 190 190 190 192 190 11 of the Marshfield screening set (http://www.marshfield- D1S508 77 75 77 77 77 77 77 77 73 77 77 77 73 77 D1S1612 176 172 176 176 176 176 176 176 156 176 176 176 156 176 clinic.org/research/genetics/). The data generated from this D1S503 209 209 209 209 209 209 209 209 209 209 209 209 209 209 D1S450 252 264 252 252 252 252 252 252 252 252 252 252 252 252 D1S2736 127 121 121 121 121 121 121 121 121 121 121 121 121 121 were analysed for linkage using GeneHunter, assuming D1S2667 261 265 261 261 261 261 261 261 261 261 261 261 261 261 D1S2740 ? ? 97 97 97 97 97 97 97 97 97 97 97 97 complete penetrance and a disease allele frequency of 1%. D1S489 150 150 150 150 150 150 150 150 150 150 150 150 150 150 D1S434 246 250 246 246 246 246 246 246 246 246 246 246 246 246 The allele frequencies used were those obtained in a panel D1S1597 171 167 167 167 167 167 167 167 167 167 167 167 167 167 D1S228 105 105 105 105 105 105 105 105 111 105 111 105 111 105 D1S2834 179 179 179 179 179 179 179 179 179 179 179 179 179 179 of 20 Asian control individuals. To expedite the initial D1S507 189 197 189 195 189 195 189 195 185 195 185 195 185 195 D1S2728 250 250 250 254 250 254 250 254 250 254 250 254 250 254 analysis, the consanguineous loops in the pedigree were D1S3669 203 183 203 187 203 187 203 187 187 187 187 187 187 187 D1S1592 235 239 235 239 235 243 235 243 239 243 239 243 239 243 not included. Exclusion was achieved with lod scores ATA47D07 133 130 133 130 133 133 133 133 133 133 139 133 133 133 calculated to be À2 across most of the genome and no Figure 1 Pedigree of the LCA9 family. Microsatellite geno- significant positive lod scores except in a region on types that span the autozygous region on chromosome 1p36 are shown in chromosomal order distal (top) to proximal chromosome 1p36, where a multipoint lod score of 3.5 (bottom). The boxed genotypes indicate the autozygous was generated between the markers D1S1612 and D1S3669. region in the affected individuals, and markers within the To confirm linkage and define the extent of the locus, minimal disease region are shown in bold. additional microsatellite markers were selected from the most recent genetic map available.15 By constructing haplotypes in this region, we were able to refine the locus Best-corrected visual acuity was ‘perception of light’ in all to an autozygous region between the markers D1S1612 and affected eyes. Examination revealed nystagmus and poster- D1S228 (Figure 1). Two-point lod scores for markers in this ior subcapsular lens opacities to be a universal finding. The region are shown in Table 1. This region of 10 cM extends youngest affected individual also had keratoconus.
Load more

Recommended publications
  • Masqueraders of Age-Related Macular Degeneration
    COVER STORY Masqueraders of Age-related Macular Degeneration A number of inherited retinal diseases phenocopy AMD. BY RONY GELMAN, MD, MS; AND STEPHEN H. TSANG, MD, PHD ge-related macular degeneration (AMD) is a leading cause of central visual loss among the elderly population in the developed world. The Currently, there are no published A non-neovascular form is characterized by mac- guidelines to prognosticate ular drusen and other abnormalities of the retinal pigment epithelium (RPE) such as geographic atrophy (GA) and Stargardt macular degeneration. hyperpigmented areas in the macula. The neovascular form is heralded by choroidal neovascularization (CNV), with subsequent development of disciform scarring. ABCA4 defect heterozygote carrier may be as high as This article reviews the pathologic and diagnostic char- one in 20.11,12 An estimated 600 disease-causing muta- acteristics of inherited diseases that may masquerade as tions in the ABCA4 gene exist, of which the three most AMD. The review is organized by the following patterns common mutations account for less than 10% of the of inheritance: autosomal recessive (Stargardt disease and disease phenotypes.13 cone dystrophy); autosomal dominant (cone dystrophy, The underlying pathology of disease in STGD involves adult vitelliform dystrophy, pattern dystrophy, North accumulation of lipofuscin in the RPE through a process Carolina macular dystrophy, Doyne honeycomb dystro- of disc shedding and phagocytosis.14,15 Lipofuscin is toxic phy, and Sorsby macular dystrophy); X-linked (X-linked to the RPE; furthermore, A2E, a component of lipofuscin, retinoschisis); and mitochondrial (maternally inherited causes inhibition of 11-cis retinal regeneration16 and diabetes and deafness). complement activation.
    [Show full text]
  • Giant Anterior Staphyloma After Bomb Explosion Bomba Patlaması Sonrası Gelişen Dev Anterior Stafilom
    Case Report/Olgu Sunumu İstanbul Med J 2021; 22(1): 78-80 DO I: 10.4274/imj.galenos.2020.88864 Giant Anterior Staphyloma After Bomb Explosion Bomba Patlaması Sonrası Gelişen Dev Anterior Stafilom İbrahim Ali Hassan, İbrahim Abdi Keinan, Mohamed Salad Kadiye, Mustafa Kalaycı Somali Mogadişu-Turkey Recep Tayyip Erdoğan Training and Research Hospital, Clinic of Eye, Mogadishu, Somalia ABSTRACT ÖZ A 64-year-old male patient was admitted to our clinic Altmış dört yaşında erkek hasta sol gözünde ağrı şikayeti ile complaining of pain in his left eye. Three years ago, the patient kliniğimize başvurdu. Hastanın 3 yıl önce sol gözüne araç içi was hit in the left eye by a metal object during an in-car bomb bomba patlaması sırasında metal bir cisim çarpmıştı. Hastanın explosion. The patient had a giant anterior staphyloma in his sol gözünde kapakların kapanmasını engelleyen dev anterior left eye that prevented the eyelids from closing. In the shiotz stafilom vardı. Shiotz tonometre ölçümünde sol göz içi basıncı tonometer measurement, the left intraocular pressure was 26 26 mmHg idi. Bilgisayarlı tomografide stafiloma uç noktası ile mmHg. In computed tomography, the distance between the lens arasındaki mesafe 7,17 mm idi. Açık glob travmasından staphyloma endpoint and the lens was 7.17 mm. After open sonra hastalar, oküler yüzey enfeksiyonları açısından düzenli glob trauma, patients should be checked at short intervals takip için kısa aralıklarla kontrol edilmelidir. Hastadan for regular follow-up for ocular surface infections. The sorumlu göz doktoru, hastanın ilaca uyumunu ve gözün ilaca ophthalmologist responsible for the patient should regularly verdiği yanıtı düzenli olarak değerlendirmelidir.
    [Show full text]
  • Disseminated Tuberculosis Presenting with Scrofuloderma and Anterior Staphyloma in a Child in Sokoto, Nigeria
    Journal of Tuberculosis Research, 2020, 8, 127-135 https://www.scirp.org/journal/jtr ISSN Online: 2329-8448 ISSN Print: 2329-843X Disseminated Tuberculosis Presenting with Scrofuloderma and Anterior Staphyloma in a Child in Sokoto, Nigeria Khadijat O. Isezuo1* , Ridwan M. Jega1 , Bilkisu I. Garba1 , Usman M. Sani1 , Usman M. Waziri1 , Olubusola B. Okwuolise1 , Hassan M. Danzaki2 1Department of Paediatrics, Usmanu Danfodiyo University Teaching Hospital, Sokoto, Nigeria 2Department of Ophthalmology, Usmanu Danfodiyo University Teaching Hospital, Sokoto, Nigeria How to cite this paper: Isezuo, K.O., Jega, Abstract R.M., Garba, B.I., Sani, U.M., Waziri, U.M., Okwuolise, O.B. and Danzaki, H.M. (2020) Introduction: Disseminated tuberculosis (TB) may occur with skin and ocu- Disseminated Tuberculosis Presenting with lar involvement which are not common manifestations in children and may Scrofuloderma and Anterior Staphyloma in lead to debilitating complications. Objective: A child with multi-organ TB a Child in Sokoto, Nigeria. Journal of Tu- berculosis Research, 8, 127-135. involving the lungs, chest abdomen, skin and eyes who had been symptomat- https://doi.org/10.4236/jtr.2020.83011 ic for 3 years is reported. Case Report: A 6-year-old girl presented with re- current fever, abdominal pain and weight loss of 3 years and skin lesions of a Received: June 1, 2020 year duration. There was history of pain and redness of the eyes associated Accepted: August 3, 2020 Published: August 6, 2020 with discharge. She was not vaccinated at all. She was chronically ill-looking with bilateral conjunctival hyperaemia, purulent eye discharge with corneal Copyright © 2020 by author(s) and opacity of the right eye.
    [Show full text]
  • The Height of the Posterior Staphyloma and Corneal Hysteresis Is
    Downloaded from http://bjo.bmj.com/ on August 30, 2016 - Published by group.bmj.com Clinical science The height of the posterior staphyloma and corneal hysteresis is associated with the scleral thickness at the staphyloma region in highly myopic normal-tension glaucoma eyes Jong Hyuk Park,1 Kyu-Ryong Choi,2 Chan Yun Kim,1 Sung Soo Kim1 1Department of Ophthalmology, ABSTRACT optic nerve head (ONH) in eyes with high – Institute of Vision Research, Aims To evaluate the characteristics of the posterior myopia.8 10 Yonsei University College of Medicine, Seoul, Republic of segments of eyes with high myopia and normal-tension Recent studies have demonstrated the importance Korea glaucoma (NTG) and identify which ocular factors are of the posterior ocular structures such as the lamina 2Department of Ophthalmology most associated with scleral thickness and posterior cribrosa and sclera in the pathogenesis of glau- – and Institute of Ophthalmology staphyloma height. coma.8 10 The mechanical influence of the peripa- & Optometry, Ewha Womans Methods The study included 45 patients with highly pillary sclera on the lamina cribrosa is considered University School of Medicine, Seoul, Republic of Korea myopic NTG and 38 controls with highly myopic eyes to be important in that scleral deformations affect (≤−6D or axial length ≥26.0 mm). The subfoveal the stiffness and thickness of the sclera and affect Correspondence to retinal, choroidal, scleral thickness and the posterior the ONH biomechanics by exacerbating strain and Professor Sung Soo Kim, staphyloma heights were examined from enhanced depth stress.11 The increased risk of glaucoma in myopic Department of Ophthalmology, College of Medicine, Yonsei imaging spectral-domain optical coherence tomography eyes may be related in part to the mechanical prop- University, 134 Sinchon-dong, and compared between two groups.
    [Show full text]
  • CURRICULUM VITAE Morton Falk Goldberg, MD, FACS, FAOSFRACO
    CURRICULUM VITAE Morton Falk Goldberg, M.D., F.A.C.S., F.A.O.S. F.R.A.C.O. (Hon), M.D. (Hon., University Coimbra) PERSONAL DATA: Born, June 8, 1937 Lawrence, MA, USA Married, Myrna Davidov 5/6/1968 Children: Matthew Falk Michael Falk EDUCATION: A.B., Biology – Magna cum laude, 1958 Harvard College, Cambridge MA Detur Prize, 1954-1955 Phi Beta Kappa, Senior Sixteen 1958 M.D., Medicine – Cum Laude 1962 Lehman Fellowship 1958-1962 Alpha Omega Alpha, Senior Ten 1962 INTERNSHIP: Department of Medicine, 1962-1963 Peter Bent Brigham Hospital, Boston, MA RESIDENCY: Assistant Resident in Ophthalmology 1963-1966 Wilmer Ophthalmological Institute, Johns Hopkins Hospital, Baltimore, MD CHIEF RESIDENT: Chief Resident in Ophthalmology Mar. 1966-Jun. 1966 Yale-New Haven Hospital Chief Resident in Ophthalmology, Jul. 1966-Jun. 1967 Wilmer Ophthalmological Institute Johns Hopkins Hospital BOARD CERTIFICATION: American Board of Ophthalmology 1968 Page 1 CURRICULUM VITAE Morton Falk Goldberg, M.D., F.A.C.S., F.A.O.S. F.R.A.C.O. (Hon), M.D. (Hon., University Coimbra) HONORARY DEGREES: F.R.A.C.O., Honorary Fellow of the Royal Australian 1962 College of Ophthalmology Doctoris Honoris Causa, University of Coimbra, 1995 Portugal MEDALS: Inaugural Ida Mann Medal, Oxford University 1980 Arnall Patz Medal, Macula Society 1999 Prof. Isaac Michaelson Medal, Israel Academy Of 2000 Sciences and Humanities and the Hebrew University- Hadassah Medical Organization David Paton Medal, Cullen Eye Institute and Baylor 2002 College of Medicine Lucien Howe Medal, American Ophthalmological
    [Show full text]
  • Genetic Defects of CHM and Visual Acuity Outcome in 24 Choroideremia
    www.nature.com/scientificreports OPEN Genetic defects of CHM and visual acuity outcome in 24 choroideremia patients from 16 Japanese families Takaaki Hayashi1,2*, Shuhei Kameya3, Kei Mizobuchi2, Daiki Kubota3, Sachiko Kikuchi3, Kazutoshi Yoshitake4, Atsushi Mizota5, Akira Murakami6, Takeshi Iwata4 & Tadashi Nakano2 Choroideremia (CHM) is an incurable progressive chorioretinal dystrophy. Little is known about the natural disease course of visual acuity in the Japanese population. We aimed to investigate the genetic spectrum of the CHM gene and visual acuity outcomes in 24 CHM patients from 16 Japanese families. We measured decimal best-corrected visual acuity (BCVA) at presentation and follow-up, converted to logMAR units for statistical analysis. Sanger and/or whole-exome sequencing were performed to identify pathogenic CHM variants/deletions. The median age at presentation was 37.0 years (range, 5–76 years). The mean follow-up interval was 8.2 years. BCVA of the better-seeing eye at presentation was signifcantly worsened with increasing age (r = 0.515, p < 0.01), with a high rate of BCVA decline in patients > 40 years old. A Kaplan–Meier survival curve suggested that a BCVA of Snellen equivalent 20/40 at follow-up remains until the ffties. Fourteen pathogenic variants, 6 of which were novel [c.49 + 5G > A, c.116 + 5G > A, p.(Gly176Glu, Glu177Ter), p.Tyr531Ter, an exon 2 deletion, and a 5.0-Mb deletion], were identifed in 15 families. No variant was found in one family only. Our BCVA outcome data are useful for predicting visual prognosis and determining the timing of intervention in Japanese patients with CHM variants.
    [Show full text]
  • Visual Performance of Scleral Lenses and Their Impact on Quality of Life In
    A RQUIVOS B RASILEIROS DE ORIGINAL ARTICLE Visual performance of scleral lenses and their impact on quality of life in patients with irregular corneas Desempenho visual das lentes esclerais e seu impacto na qualidade de vida de pacientes com córneas irregulares Dilay Ozek1, Ozlem Evren Kemer1, Pinar Altiaylik2 1. Department of Ophthalmology, Ankara Numune Education and Research Hospital, Ankara, Turkey. 2. Department of Ophthalmology, Ufuk University Faculty of Medicine, Ankara, Turkey. ABSTRACT | Purpose: We aimed to evaluate the visual quality CCS with scleral contact lenses were 0.97 ± 0.12 (0.30-1.65), 1.16 performance of scleral contact lenses in patients with kerato- ± 0.51 (0.30-1.80), and 1.51 ± 0.25 (0.90-1.80), respectively. conus, pellucid marginal degeneration, and post-keratoplasty Significantly higher contrast sensitivity levels were recorded astigmatism, and their impact on quality of life. Methods: with scleral contact lenses compared with those recorded with We included 40 patients (58 eyes) with keratoconus, pellucid uncorrected contrast sensitivity and spectacle-corrected contrast marginal degeneration, and post-keratoplasty astigmatism who sensitivity (p<0.05). We found the National Eye Institute Visual were examined between October 2014 and June 2017 and Functioning Questionnaire overall score for patients with scleral fitted with scleral contact lenses in this study. Before fitting contact lens treatment to be significantly higher compared with scleral contact lenses, we noted refraction, uncorrected dis- that for patients with uncorrected sight (p<0.05). Conclusion: tance visual acuity, spectacle-corrected distance visual acuity, Scleral contact lenses are an effective alternative visual correction uncorrected contrast sensitivity, and spectacle-corrected contrast method for keratoconus, pellucid marginal degeneration, and sensitivity.
    [Show full text]
  • Retinitis Pigmentosa Precision Panel Overview Indications Clinical
    Retinitis Pigmentosa Precision Panel Overview Retinitis Pigmentosa (RP) comprises a complex group of inherited dystrophies characterized by degeneration and dysfunction of the retina, affecting photoreceptor and pigment epithelial function. RP can be an isolated finding or be part of a syndrome that can be inherited in a dominant, recessive or X-linked pattern. This disease presents as progressive loss of night and peripheral vision, leading to a constricted visual field and markedly diminished vision. The clinical presentation of these findings is highly variable, some patients being affected during childhood while others are asymptomatic well into adulthood. There is an increase in mortality rate due to psychiatric comorbidities. The Igenomix Retinitis Pigmentosa Precision Panel can be used to make an accurate and directed diagnosis as well as a differential diagnosis of blindness ultimately leading to a better management and prognosis of the disease. It provides a comprehensive analysis of the genes involved in this disease using next-generation sequencing (NGS) to fully understand the spectrum of relevant genes involved. Indications The Igenomix Retinitis Pigmentosa Precision Panel is indicated for those patients with a clinical suspicion or diagnosis with or without the following manifestations: - Family history of RP - Night blindness - Progressive constriction of the visual field, usually peripheral - Cataracts - Sensation of sparking lights (photopsias) - Headache Clinical Utility The clinical utility of this panel is: - The genetic and molecular confirmation for an accurate clinical diagnosis of a symptomatic patient. - Early initiation of multidisciplinary treatment in the form of medical care with vitamin A and other antioxidants and surgical care for potential cataract extraction or retinal prosthesis.
    [Show full text]
  • Fact Sheet: Refractive Errors
    Fact Sheet: Refractive Errors More than 11 million Americans have common vision problems that can be corrected with the use of prescriptive eyewear such as glasses or contact lenses.1 These conditions are known as refractive errors and they occur when the eye doesn’t correctly bend, or ―refract,‖ light as it enters the eye. Common refractive errors include the following: o Nearsightedness (also called myopia)—A condition where objects up close appear clearly, while objects far away appear blurry. With nearsightedness, light comes to focus in front of the retina instead of on the retina. o Farsightedness (also called hyperopia)—A common type of refractive error where distant objects may be seen more clearly than objects that are near. However, people experience farsightedness differently. Some people may not notice any problems with their vision, especially when they are young. For people with significant farsightedness, vision can be blurry for objects at any distance, near or far. o Astigmatism—A condition in which the eye does not focus light evenly onto the retina, the light-sensitive tissue at the back of the eye. This can cause images to appear blurry and stretched out. o Presbyopia—An age-related condition in which the ability to focus up close becomes more difficult. As the eye ages, the lens can no longer change shape enough to allow the eye to focus close objects clearly. Refractive errors are one of the most common—and correctable—causes of visual impairment in the United States. According to a recent study led by the National Eye Institute (NEI), approximately half of all American adults don’t have the 20/20 vision physicians consider optimal due to refractive errors.2 Women experience refractive error more frequently than men: Twenty-six percent more women aged 12 and older have uncorrected visual impairment due to refractive error compared with men aged 12 and older.
    [Show full text]
  • A Multistep Bioinformatic Approach Detects Putative Regulatory
    BMC Bioinformatics BioMed Central Research article Open Access A multistep bioinformatic approach detects putative regulatory elements in gene promoters Stefania Bortoluzzi1, Alessandro Coppe1, Andrea Bisognin1, Cinzia Pizzi2 and Gian Antonio Danieli*1 Address: 1Department of Biology, University of Padova – Via Bassi 58/B, 35131, Padova, Italy and 2Department of Information Engineering, University of Padova – Via Gradenigo 6/B, 35131, Padova, Italy Email: Stefania Bortoluzzi - [email protected]; Alessandro Coppe - [email protected]; Andrea Bisognin - [email protected]; Cinzia Pizzi - [email protected]; Gian Antonio Danieli* - [email protected] * Corresponding author Published: 18 May 2005 Received: 12 November 2004 Accepted: 18 May 2005 BMC Bioinformatics 2005, 6:121 doi:10.1186/1471-2105-6-121 This article is available from: http://www.biomedcentral.com/1471-2105/6/121 © 2005 Bortoluzzi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results: Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name retinol binding protein 7, cellular Gene Symbol RBP7 Organism Human Gene Summary Due to its chemical instability and low solubility in aqueous solution vitamin A requires cellular retinol-binding proteins (CRBPs) such as RBP7 for stability internalization intercellular transfer homeostasis and metabolism. Gene Aliases CRBP4, CRBPIV, MGC70641 RefSeq Accession No. NC_000001.10, NT_021937.19 UniGene ID Hs.422688 Ensembl Gene ID ENSG00000162444 Entrez Gene ID 116362 Assay Information Unique Assay ID qHsaCEP0039415 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000294435 Amplicon Context Sequence GTGAAGGTCAAGTGTGCAAACAGACATTCCAGAGAGCCTGATCCACATCCAGCA GCAGAGCCCACTTGTGGCTGCAGCTTTATGCCAAATTATATTGCAGACTGAACAG ACGTTTATCTATCCCATTTGGCGACGAGGACTCGTGGCTG Amplicon Length (bp) 119 Chromosome Location 1:10075850-10075998 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 96 R2 0.9996 cDNA Cq 24.71 cDNA Tm (Celsius) 83 gDNA Cq 23.6 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report RBP7, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • Retinitis Pigmentosa: a Brief Review of the Genetic and Clinical Aspects
    Retinitis Pigmentosa: A Brief Review of the Genetic and Clinical Aspects of the Disease Itia Dowdell Science and Technology Honors Program, University of Alabama at Birmingham, Birmingham, AL, USA School of Health Professions Honors Program, University of Alabama at Birmingham, Birmingham, AL, USA Department of Clinical and Diagnostic Sciences, University of Alabama at Birmingham, Birmingham, AL, USA Abstract Retinitis Pigmentosa (RP) is a heterogeneous set of inherited retinal diseases that affects 1 in 3,000–7,000 people worldwide. Typical onset is from 10–30 years old and most forms are progressive, often leading to blindness. Defects in more than 200 genes have been identified that cause RP. The disease is characterized as a progressive rod-cone dystrophy that presents with night blindness, loss of peripheral vision, waxy pallor of the optic disc, pigmentary changes, and a reduced visual field. There are different modes of transmission of RP: autosomal dominant (ADRP), autosomal recessive (arRP), X-linked (XLRP) and mitochondrial. The genetics behind the different forms of RP and the degree of severity vary, although some overlap, thus contributing to the difficulty of differential diagnosis. RP can manifest either as a non-syndromic disease, or as part of a syndrome, such as in Usher’s syndrome (hearing and vision loss) and BardetBiedl syndrome (a ciliopathy). The purpose of this review is to summarize the major genetic and molecular findings, as well as the diseases, associated with RP. Due to space limitations, this review is not fully comprehensive. Keywords: Retinitis pigmentosa, non-syndromic retinitis pigmentosa, rod-cone dystrophy, rhodopsin Introduction Retinitis pigmentosa (RP) is a heterogeneous set of inherited retinal diseases.
    [Show full text]