DOCSLIB.ORG

Original Articles the ALX4 Homeobox Gene Is Mutated in Patients With

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Articles the ALX4 Homeobox Gene Is Mutated in Patients With 916 J Med Genet 2000;37:916–920 J Med Genet: first published as 10.1136/jmg.37.12.916 on 1 December 2000. Downloaded from Original articles The ALX4 homeobox gene is mutated in patients with ossification defects of the skull (foramina parietalia permagna, OMIM 168500) Wim Wuyts, Erna Cleiren, Tessa Homfray, Alberto Rasore-Quartino, Filip Vanhoenacker, Wim Van Hul Abstract Foramina parietalia permagna (FPP) (OMIM 168500) is caused by ossification defects in the parietal bones. Recently, it was shown that loss of function mutations in the MSX2 homeobox gene on chromo- some 5 are responsible for the presence of these lesions in some FPP patients. How- ever, the absence of MSX2 mutations in some of the FPP patients analysed and the presence of FPP associated with chromo- some 11p deletions in DEFECT 11 (OMIM 601224) patients or associated with Saethre-Chotzen syndrome suggests ge- netic heterogeneity for this disorder. Starting from a BAC/P1/cosmid contig of the DEFECT 11 region on chromosome 11, we have now isolated the ALX4 gene, a previously unidentified member of the http://jmg.bmj.com/ ALX homeobox gene family in humans. Mutation analysis of the ALX4 gene in three unrelated FPP families without the Department of MSX2 mutation identified mutations in Medical Genetics, two families, indicating that mutations in University of Antwerp, Figure 1 Radiograph illustrating the presence of foramina ALX4 could be responsible for these skull parietalia permagna (white arrows) in a patient of family Universiteitsplein 1, 6 12 2610 Antwerp, Belgium defects and suggesting further genetic 3. X rays of patients of families 1 and 2 have previously been published. on September 28, 2021 by guest. Protected copyright. W Wuyts heterogeneity of FPP. E Cleiren (J Med Genet 2000;37:916–920) W Van Hul Keywords: ALX4; FPP; DEFECT 11 other syndromes, such as DEFECT 11 St George’s Hospital, (OMIM 601224) syndrome8 or Saethre- London, UK Chotzen (OMIM 101400) syndrome,9 T Homfray Foramina parietalia permagna (FPP), also suggests genetic heterogeneity for FPP. referred to as the “Catlin mark” (OMIM Department of The DEFECT 11 syndrome, also called Paediatrics and 168500), is a skull ossification disorder charac- deletion 11 contiguous gene syndrome as this Neonatology, Galliera terised by ossification defects in the parietal is less controversial than the DEFECT 11 Hospital, Genova, Italy bones (fig 1).1 The size of the lesions is very acronym, is caused by deletions in the proximal A Rasore-Quartino variable among diVerent patients, measuring region of chromosome 11p. This syndrome is from a few millimetres to several centimetres.2 characterised by the presence of multiple exos- Department of Although the openings decrease with time, sur- Radiology, University toses (EXT), FPP, and sometimes additional Hospital of Antwerp, gical intervention may be required in severe features such as mental retardation and genital Belgium cases to protect the underlying brain. In most abnormalities.8 Previously it has been shown F Vanhoenacker cases, patients are asymptomatic, but the that deletion of the EXT2 gene is responsible association of FPP with structural brain abnor- for the development of EXT in these pa- Correspondence to: malities or seizures has been described.3–5 10 11 Dr Wuyts, tients. A second gene causing FPP must be [email protected] Recently, loss of function mutations in the located in close proximity to EXT2, as deletion MSX2 homeobox gene have been established analysis of several chromosome 11 deletion Revised version received as the cause in some cases of FPP.67However, patients delineated a minimal candidate region 29 September 2000 Accepted for publication 2 absence of MSX2 mutations in some of the for the FPP gene between the genetic markers October 2000 families analysed67and the presence of FPP in D11S13934 and D11S2095.10 www.jmedgenet.com Mutations in ALX4 in patients with FPP 917 J Med Genet: first published as 10.1136/jmg.37.12.916 on 1 December 2000. Downloaded from Family 1 Family 2 Family 3 * ? ?? ?? *** * * ? ? ****** ? Figure 2 Pedigrees of the three FPP families analysed in this study. Filled symbols represent aVected subjects, open symbols are unaVected subjects. Question marks indicate that the clinical status has not been confirmed by radiographs. DNA from subjects marked with an asterisk was available for analysis. Table 1 Primers amplifying ALX4 exons In an attempt to isolate the FPP causing gene involved in the DEFECT 11 syndrome on chro- Exon Primer (5' - 3') Temp mosome 11, we constructed a P1/cosmid/BAC 1 aaactcccagccaaggcgcgcg 65°C contig of this region. By genomic sequencing aagccaagcaccccgtggtccc combined with database searches and the use of 2 ctcttgtttggttcaaccattgg 60°C exon prediction programs, we isolated the tgctttaccagcctcactccc 3 tccaggcgggcatctcaccc 65°C human orthologue of the Alx4 gene from this ttctcagagcaccaggggctggg candidate region and by mutation analysis we 4 aggtgctctggggaaggggcgag 65°C were able to show that some FPP patients agagcagaggagtgggcggg harbour loss of function mutations in this gene. includes GRAIL, Fex, Hexon, MZEF, Gen- Patients and methods emark, Genefinder, FGene, BLAST (against PATIENTS multiple databases), Polyah, RepeatMasker, Six patients from three diVerent families and tRNAscan. aVected with FPP were included in this study (fig 2). Family 1 has already been described as MUTATION ANALYSIS family 4 in a previous publication describing Intron primers amplifying all coding exons and the absence of a MSX2 mutation in this intron/exon boundaries of the ALX4 gene were family.6 Family 2 originates from Italy and designed (table 1) and ALX4 exons were clinical details have been published previ- amplified with PCR enhancer system (GIBCO ously.12 The last FPP patient (family 3) is of BRL) with enhancer concentration 1×. For all http://jmg.bmj.com/ Belgian origin. This patient was asymptomatic, amplifications, 35 cycles were performed at but skull radiographs showed large defects in 65°C, except for exon 2 which was amplified at the parietal bones (fig 1). Diagnosis of all 60°C. Amplification products were purified patients was based upon skull x rays. with Concert Rapid PCR purification system (Life Technologies) and sequenced using PHYSICAL CHARACTERISATION OF THE FPP Big-Dye terminator chemistry (Perkin-Elmer) CANDIDATE REGION on an ABI 3100 automated sequencer. on September 28, 2021 by guest. Protected copyright. A YAC/P1/cosmid contig of the DEFECT 11 candidate region on chromosome 11 has previ- ASSAYS FOR THE DETECTION OF IDENTIFIED 10 ously been constructed. P1 clones MUTATIONS ICRFP700D0494 and ICRFP700D0694 were To confirm the 504delT mutation in family 1, digested with restriction enzymes EcoRI, PstI, PCR was performed with the PCR enhancer HindIII, DraI, and PvuII and restriction system (GIBCO BRL) with primers fragments were ligated in PUC 18 vector. After ALX4mut1 (5'-gccttctccaatgggctggg-3') and transformation, subclones were sequenced modified primer ALX4mod1 (5'- using Big-Dye terminator chemistry (Perkin- tgggtgagccagagttaccctc-3') at 55°C and 1× Elmer) on an ABI 3100 automated sequencer enhancer concentration. The use of the and sequences obtained were aligned using the ALX4mod1 primer creates a new Ta q restric- SeqManII (DNASTAR Inc) program. Addi- tion site in the mutant amplification product. tionally, BLAST searches against Genbank After digestion with Ta q I restriction enzyme at were performed with sequences obtained to 65°C for two hours, products were analysed on identify overlapping clones in order to perform 12% acrylamide gels. The presence of the “contig walking”. 504delT mutation results in the digestion of the mutant 132 bp fragment in fragments of IDENTIFICATION OF TRANSCRIBED SEQUENCES 111 bp and 21 bp. Putative exons and transcribed sequences from The presence of the G815C mutation in the sequenced DEFECT 11 region were iden- family 2 and controls was tested by reamplifi- tified by analysis of the obtained contig cation of exon 3 followed by MspI restriction sequence with the NIX program (http:// digest and analysis of the digested products on www.hgmp.mrc.ac.uk/Bioinformatics/), which a 12% polyacrylamide gel. Presence of the C www.jmedgenet.com 918 Wuyts, Cleiren, Homfray, et al J Med Genet: first published as 10.1136/jmg.37.12.916 on 1 December 2000. Downloaded from 1 Human 1 Mouse 1 Chicken 66 Human 66 Mouse 63 Chicken 127 Human 115 Mouse 105 Chicken 192 Human 180 Mouse 170 Chicken 257 Human 245 Mouse 235 Chicken 322 Human 310 Mouse 300 Chicken 387 Human 375 Mouse 363 Chicken Figure 3 Alignment of the ALX4 proteins of human, mouse, and chicken. Amino acids conserved in the three species are represented in black boxes. The 100% conserved homeodomain is underlined. allele results in digestion of the 234 bp amplifi- sequence, including distal flanking marker cation product in bands of 147 bp and 87 bp. D11S1393. At the proximal side, two addi- The G729A polymorphism was character- tional genomic clones, 706A13 (AC 0119143) ised by amplification of exon 2 followed by CfoI and 70A24 (AC 025533), were identified restriction digest. The 400 bp amplification which partially overlapped ICRFP700D0694. http://jmg.bmj.com/ product is digested in bands of 311 bp and 89 The working draft of chromosome 11 clone bp in the presence of the G allele. The presence RP11-706A13 consisted of 28 unordered of the A allele results in absence of the CfoI pieces of a total of 190 737 bp, while the avail- restriction site yielding a 400 bp band only. All able sequence of clone 70A24 consisted of 25 digested products were analysed on 2% agarose unordered pieces covering 167 817 bp. Com- gels. bined sequence information of all clones allowed us to construct a sequenced contig of Results the DEFECT 11 region with only a few on September 28, 2021 by guest. Protected copyright. IDENTIFICATION OF THE ALX4 GENE remaining gaps. Sequences from these contigs In order to isolate a gene responsible for FPP were further analysed for the presence of we concentrated on the proximal region of known genes or ESTs and putative exons using chromosome 11p, which is known to be deleted the NIX program.
Load more

Recommended publications
  • 134 Mb (Almost the Same As the Size of Chromosome 10). It Is ~4–4.5% of the Total Human Genome
    Chromosome 11 ©Chromosome Disorder Outreach Inc. (CDO) Technical genetic content provided by Dr. Iosif Lurie, M.D. Ph.D Medical Geneticist and CDO Medical Consultant/Advisor. Ideogram courtesy of the University of Washington Department of Pathology: ©1994 David Adler.hum_11.gif Introduction The genetic size of chromosome 11 is ~134 Mb (almost the same as the size of chromosome 10). It is ~4–4.5% of the total human genome. The length of its short arm is ~50 Mb; the length of its long arm in ~84 Mb. Chromosome 11 is a very gene–rich area. It contains ~1,500 genes. Mutations of ~200 of these genes are known to cause birth defects or some functional abnormalities. The short arm of chromosome 11 contains a region which is known to be imprinted. As a result duplications of this region will have different manifestations depending on the sex of the parent responsible for this defect. Phenotypes of persons with duplications of the maternal origin will be different from the phenotypes of the persons with a paternal duplication of the same area. There are ~1,400 patients with different structural abnormalities of chromosome 11 as the only abnormality or in association with abnormalities for other chromosomes. At least 800 of these patients had different deletions of chromosome 11. Deletions of the short arm have been reported in ~250 patients (including those with an additional imbalance); deletions of the long arm have been described in ~550 patients. There are two syndromes caused by deletions of the short arm (both of these syndromes have been known for several years) and one well–known syndrome caused by distal deletions of the long arm (Jacobsen syndrome).
    [Show full text]
  • Genetic Interaction of Gli3 and Alx4 During Limb Development
    Int. J. Dev. Biol. 49: 443-448 (2005) doi: 10.1387/ijdb.051984lp Short Communication Genetic interaction of Gli3 and Alx4 during limb development LIA PANMAN*,a, THIJS DRENTHb, PASCAL TEWELSCHERc, AIMÉE ZUNIGA1 and ROLF ZELLER1 Department of Developmental Biology, Utrecht University, Utrecht, The Netherlands and 1Developmental Genetics, DKBW Centre for Biomedicine, University of Basel Medical School, Basel, Switzerland. ABSTRACT The Gli3 and Alx4 transcriptional regulators are expressed in the anterior limb bud mesenchyme and their disruption in mice results in preaxial polydactyly. While the polydactylous phenotype of Alx4 deficient limb buds depends on SHH, the one of Gli3 deficient limb buds is completely independent of SHH signalling, suggesting that these genes act in parallel pathways. Analysis of limb buds lacking both Gli3 and Alx4 now shows that these two genes interact during limb skeletal morphogenesis. In addition to the defects in single mutants, the stylopod is severely malformed and the anterior element of the zeugopod is lost in double mutant limbs. However, limb bud patterning in Gli3-/- ; Alx4-/- double mutant embryos is not affected more than in single mutants as the expression domains of key regulators remain the same. Most interestingly, the loss of the severe preaxial polydactyly characteristic of Gli3 -/- limbs in double mutant embryos establishes that this type of polydactyly requires Alx4 function. KEY WORDS: Hox gene, limb development, preaxial polydactyly, radius, SHH, tibia The semi-dominant mouse mutations Extra-toes ( Xt ) and Strong’s forms in limbs lacking both Alx4 and Shh (for details see te Luxoid (Lst ), are loss-of-function mutations disrupting the zinc- Welscher et al., 2002b).
    [Show full text]
  • Genome-Wide Identification of Signaling Center Enhancers in the Developing Limb Julia E
    © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 4194-4198 doi:10.1242/dev.110965 RESEARCH REPORT TECHNIQUES AND RESOURCES Genome-wide identification of signaling center enhancers in the developing limb Julia E. VanderMeer1,2, Robin P. Smith1,2, Stacy L. Jones1 and Nadav Ahituv1,2,* ABSTRACT signaling center required for the maintenance of the other [reviewed The limb is widely used as a model developmental system and changes by Zeller et al. (2009)]. to gene expression patterns in its signaling centers, notably the zone of Gene expression changes in signaling centers are known to affect polarizing activity (ZPA) and the apical ectodermal ridge (AER), are limb morphology. As the genes involved in the ZPA and AER are known to cause limb malformations and evolutionary differences in limb also expressed in other tissues, mutations in coding regions usually morphology. Although several genes that define these limb signaling cause additional phenotypes. Mutations in enhancers that are centers have been described, the identification of regulatory elements specific to these limb-signaling centers, however, only cause limb that are active within these centers has been limited. By dissecting phenotypes. For example, mutations in the ZPA regulatory mouse E11.5 limbs that fluorescently mark the ZPA or AER, followed by sequence (ZRS) enhancer that controls expression of Shh in the fluorescence-activated cell sorting and low-cell H3K27ac ChIP-seq, ZPA are known to cause isolated limb malformations in humans, we identified thousands of specific signaling-center enhancers. mice, cats and dogs, without any other phenotypes caused by coding Our ChIP-seq datasets show strong correlation with ZPA- and AER- disruptions to Shh [reviewed by VanderMeer and Ahituv (2011)].
    [Show full text]
  • Construction of a Natural Panel of 11P11.2 Deletions and Further Delineation of the Critical Region Involved in Potocki–Shaffer Syndrome
    European Journal of Human Genetics (2005) 13, 528–540 & 2005 Nature Publishing Group All rights reserved 1018-4813/05 $30.00 www.nature.com/ejhg ARTICLE Construction of a natural panel of 11p11.2 deletions and further delineation of the critical region involved in Potocki–Shaffer syndrome Keiko Wakui1,12, Giuliana Gregato2,3,12, Blake C Ballif2, Caron D Glotzbach2,4, Kristen A Bailey2,4, Pao-Lin Kuo5, Whui-Chen Sue6, Leslie J Sheffield7, Mira Irons8, Enrique G Gomez9, Jacqueline T Hecht10, Lorraine Potocki1,11 and Lisa G Shaffer*,2,4 1Department of Molecular & Human Genetics, Baylor College of Medicine, Houston, TX, USA; 2Health Research and Education Center, Washington State University, Spokane, WA, USA; 3Dip. Patologia Umana ed Ereditaria, Sez. Biologia Generale e Genetica Medica, Universita` degli Studi di Pavia, Italy; 4Sacred Heart Medical Center, Spokane, WA, USA; 5Department of Obstetrics and Gynecology, National Cheng-Kung University Medical College, Taiwan; 6Department of Pediatrics, Taipei Municipal Women and Children’s Hospital, Taiwan; 7Genetic Health Services Victoria, Murdoch Children’s Research Institute, Department of Paediatrics, University of Melbourne, Victoria, Australia; 8Division of Genetics, Department of Medicine, Children’s Hospital, Harvard Medical School, Boston, MA, USA; 9Area de Gene´tica, Centro de Desarrollo Infantil y Departamento de Pediatrı´a Hospital Materno Infantil-Hospital Regional Universitario ‘Infanta Cristina’, Badajoz, Spain; 10Department of Pediatrics, University of Texas Medical School at Houston, TX, USA; 11Texas Children’s Hospital, Houston, TX, USA Potocki–Shaffer syndrome (PSS) is a contiguous gene deletion syndrome that results from haploinsufficiency of at least two genes within the short arm of chromosome 11[del(11)(p11.2p12)].
    [Show full text]
  • Identification of Shared and Unique Gene Families Associated with Oral
    International Journal of Oral Science (2017) 9, 104–109 OPEN www.nature.com/ijos ORIGINAL ARTICLE Identification of shared and unique gene families associated with oral clefts Noriko Funato and Masataka Nakamura Oral clefts, the most frequent congenital birth defects in humans, are multifactorial disorders caused by genetic and environmental factors. Epidemiological studies point to different etiologies underlying the oral cleft phenotypes, cleft lip (CL), CL and/or palate (CL/P) and cleft palate (CP). More than 350 genes have syndromic and/or nonsyndromic oral cleft associations in humans. Although genes related to genetic disorders associated with oral cleft phenotypes are known, a gap between detecting these associations and interpretation of their biological importance has remained. Here, using a gene ontology analysis approach, we grouped these candidate genes on the basis of different functional categories to gain insight into the genetic etiology of oral clefts. We identified different genetic profiles and found correlations between the functions of gene products and oral cleft phenotypes. Our results indicate inherent differences in the genetic etiologies that underlie oral cleft phenotypes and support epidemiological evidence that genes associated with CL/P are both developmentally and genetically different from CP only, incomplete CP, and submucous CP. The epidemiological differences among cleft phenotypes may reflect differences in the underlying genetic causes. Understanding the different causative etiologies of oral clefts is
    [Show full text]
  • Hedgehog Signaling Patterns the Oral- Aboral Axis of the Mandibular Arch
    RESEARCH ARTICLE Hedgehog signaling patterns the oral- aboral axis of the mandibular arch Jingyue Xu1, Han Liu1, Yu Lan1,2,3,4, Mike Adam1, David E Clouthier5, Steven Potter1,3, Rulang Jiang1,2,3,4* 1Division of Developmental Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, United States; 2Division of Plastic Surgery, Cincinnati Children’s Hospital Medical Center, Cincinnati, United States; 3Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, United States; 4Shriners Hospitals for Children – Cincinnati, Cincinnati, United States; 5Department of Craniofacial Biology, School of Dental Medicine, Anschutz Medical Campus, University of Colorado, Aurora, United States Abstract Development of vertebrate jaws involves patterning neural crest-derived mesenchyme cells into distinct subpopulations along the proximal-distal and oral-aboral axes. Although the molecular mechanisms patterning the proximal-distal axis have been well studied, little is known regarding the mechanisms patterning the oral-aboral axis. Using unbiased single-cell RNA-seq analysis followed by in situ analysis of gene expression profiles, we show that Shh and Bmp4 signaling pathways are activated in a complementary pattern along the oral-aboral axis in mouse embryonic mandibular arch. Tissue-specific inactivation of hedgehog signaling in neural crest- derived mandibular mesenchyme led to expansion of BMP signaling activity to throughout the oral- aboral axis of the distal mandibular arch and subsequently duplication of dentary bone in the oral side of the mandible at the expense of tongue formation. Further studies indicate that hedgehog signaling acts through the Foxf1/2 transcription factors to specify the oral fate and pattern the oral-aboral axis of the mandibular mesenchyme.
    [Show full text]
  • Mutual Genetic Antagonism Involving GLI3 and Dhand Prepatterns the Vertebrate Limb Bud Mesenchyme Prior to SHH Signaling
    Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION Mutual genetic antagonism posterior AER are activated prior to SHH signaling (Zuniga et al. 1999), similarly to other posterior genes involving GLI3 and dHAND such as 5ЈHoxD genes (Kraus et al. 2001). These studies prepatterns the vertebrate indicate that the nascent limb bud mesenchyme is al- ready prepatterned (Chiang et al. 2001) and that the mes- limb bud mesenchyme prior enchymal responsiveness to polarizing region signals is established prior to SHH activation. However, little is to SHH signaling known about the mechanism acting upstream of SHH Pascal te Welscher,1 Marian Fernandez-Teran,2 signaling to polarize the limb field and early limb bud. 2 1,3 Several studies suggest a possible combinatorial involve- Marian A. Ros, and Rolf Zeller ment of Hox genes in positioning and polarizing the 1Department of Developmental Biology, Faculty of Biology, early limb field in response to retinoic acid (Lu et al. Utrecht University, 3584CH Utrecht, The Netherlands; 1997). In particular, anterior ectopic expression of Hoxb8 2Department of Anatomy and Cell Biology, Facultad de in forelimb buds of transgenic mouse embryos results in Medicina, Universidad de Cantabria, 39011 Santander, Spain establishment of an ectopic polarizing region and mirror image duplication of distal limb structures (Charité et al. The bHLH transcription factor dHAND is required for 1994). However, neither targeted inactivation of the establishment of SHH signaling by the limb bud orga- Hoxb8 gene (van den Akker et al. 1999) nor deletion of all Hox8 paralogs in the mouse alters limb morphogen- nizerin posteriormesenchyme,a step crucialto devel- esis (van den Akker et al.
    [Show full text]
  • Chromosome 11
    Chromosome 11 Description Humans normally have 46 chromosomes in each cell, divided into 23 pairs. Two copies of chromosome 11, one copy inherited from each parent, form one of the pairs. Chromosome 11 spans about 135 million DNA building blocks (base pairs) and represents between 4 and 4.5 percent of the total DNA in cells. Identifying genes on each chromosome is an active area of genetic research. Because researchers use different approaches to predict the number of genes on each chromosome, the estimated number of genes varies. Chromosome 11 likely contains 1, 300 to 1,400 genes that provide instructions for making proteins. These proteins perform a variety of different roles in the body. Health Conditions Related to Chromosomal Changes The following chromosomal conditions are associated with changes in the structure or number of copies of chromosome 11. Beckwith-Wiedemann syndrome Beckwith-Wiedemann syndrome results from the abnormal regulation of genes on part of the short (p) arm of chromosome 11. The genes are located close together in a region designated 11p15.5 near one end of the chromosome. People normally inherit one copy of chromosome 11 from each parent. For most genes on this chromosome, both copies of the gene are expressed, or "turned on," in cells. For some genes in the 11p15.5 region, however, only the copy inherited from a person's father (the paternally inherited copy) is expressed. For other genes, only the copy inherited from a person's mother (the maternally inherited copy) is expressed. These parent-specific differences in gene expression are caused by a phenomenon called genomic imprinting.
    [Show full text]
  • Phenotype Informatics
    Freie Universit¨atBerlin Department of Mathematics and Computer Science Phenotype informatics: Network approaches towards understanding the diseasome Sebastian Kohler¨ Submitted on: 12th September 2012 Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) am Fachbereich Mathematik und Informatik der Freien Universitat¨ Berlin ii 1. Gutachter Prof. Dr. Martin Vingron 2. Gutachter: Prof. Dr. Peter N. Robinson 3. Gutachter: Christopher J. Mungall, Ph.D. Tag der Disputation: 16.05.2013 Preface This thesis presents research work on novel computational approaches to investigate and characterise the association between genes and pheno- typic abnormalities. It demonstrates methods for organisation, integra- tion, and mining of phenotype data in the field of genetics, with special application to human genetics. Here I will describe the parts of this the- sis that have been published in peer-reviewed journals. Often in modern science different people from different institutions contribute to research projects. The same is true for this thesis, and thus I will itemise who was responsible for specific sub-projects. In chapter 2, a new method for associating genes to phenotypes by means of protein-protein-interaction networks is described. I present a strategy to organise disease data and show how this can be used to link diseases to the corresponding genes. I show that global network distance measure in interaction networks of proteins is well suited for investigat- ing genotype-phenotype associations. This work has been published in 2008 in the American Journal of Human Genetics. My contribution here was to plan the project, implement the software, and finally test and evaluate the method on human genetics data; the implementation part was done in close collaboration with Sebastian Bauer.
    [Show full text]
  • Investigating Contributions of Trisomy 21 in Down Syndrome to Alzheimer Disease Phenotypes in a Novel Mouse Cross
    Investigating contributions of trisomy 21 in Down syndrome to Alzheimer disease phenotypes in a novel mouse cross A thesis presented in partial fulfilment of the requirements for the degree of Doctor of Philosophy from University College London Xun Yu Choong Department of Neurodegenerative Disease Institute of Neurology University College London 2016 1 Declaration I, Xun Yu Choong, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Acknowledgements The work done in this project was only possible with the support of numerous friends and colleagues, with whom I have grown an incredible amount. Foremost thanks go to Prof. Elizabeth Fisher and Dr. Frances Wiseman, who have been inexhaustibly dedicated supervisors and inspirational figures. Special mention also goes to two unofficial mentors who have looked out for me throughout the PhD, Dr. Karen Cleverley and Dr. Sarah Mizielinska. The Fisher and Isaacs groups have been a joy to work with and have always unhesitatingly offered time and help. Thank you to the Down syndrome group: Olivia Sheppard, Dr. Toby Collins, Dr. Suzanna Noy, Amy Nick, Laura Pulford, Justin Tosh, Matthew Rickman; other members of Lizzy’s group: Dr. Anny Devoy, Dr. Rosie Bunton-Stasyshyn, Dr. Rachele Saccon, Julian Pietrzyk, Dr. Beverley Burke, Heesoon Park, Julian Jaeger; the Isaacs group: Dr. Adrian Isaacs, Dr. Emma Clayton, Dr. Roberto Simone, Charlotte Ridler, Frances Norona. The PhD office has also been a second home in more ways than one, thanks to: Angelos Armen, Dr.
    [Show full text]
  • Probing the Gene Expression Database for Candidate Genes
    European Journal of Human Genetics (1999) 7, 910–919 t © 1999 Stockton Press All rights reserved 1018–4813/99 $15.00 http://www.stockton-press.co.uk/ejhg ARTICLE Probing the Gene eXpression Database for candidate genes Maurice AM van Steensel, J Celli, JH van Bokhoven and HG Brunner Department of Human Genetics, University Hospital Nijmegen, The Netherlands We report on a strategy for the identification of candidate genes for multiple malformation syndromes using expression data available in public databases. The basis for this pilot study was the assumption that, for a multiple malformation syndrome, the expression pattern of the causative gene should at least cover the organs or tissues affected by the syndrome. Twenty malformation syndromes were selected from the OMIM and defined by three to five main symptoms. These key symptoms were translated into anatomical terms that were used to query the Gene eXpression Database (GXD). The searches covered 65% of the database and yielded an average of 16 candidate genes per syndrome. Of these, 23% were ubiquitously expressed or housekeeping genes. Further database evaluation of these potential candidate genes was based on positional information and on information from mouse knockouts. In a first experiment, the correct gene was identified as a candidate in four of seven syndromes for which the causative gene is already known. In addition, this strategy identified new candidate genes for disorders for which the genetic basis is unknown. We identified candidate genes for the Walker-Warburg, DOOR, C, scalp–ear–nipple and oculocerebral hypopigmentation syndromes. Our results suggest that it may ultimately be feasible to identify disease genes by probing gene expression databases with simple syndrome descriptions.
    [Show full text]
  • REPORT HOXB1 Founder Mutation in Humans Recapitulates the Phenotype of Hoxb1/ Mice
    REPORT HOXB1 Founder Mutation in Humans Recapitulates the Phenotype of Hoxb1À/À Mice Bryn D. Webb,1,2,29 Sherin Shaaban,4,8,11,14,15,29 Harald Gaspar,1,16,28,29 Luis F. Cunha,1,17 Christian R. Schubert,10,11,13,18,19 Ke Hao,1 Caroline D. Robson,7 Wai-Man Chan,4,9,20 Caroline Andrews,4,8,11,20 Sarah MacKinnon,6 Darren T. Oystreck,21,22 David G. Hunter,6,12 Anthony J. Iacovelli,1 Xiaoqian Ye,1 Anne Camminady,16 Elizabeth C. Engle,4,5,6,8,9,10,11,12,20,23,* and Ethylin Wang Jabs1,2,3,24,25,26,27,* Members of the highly conserved homeobox (HOX) gene family encode transcription factors that confer cellular and tissue identities along the antero-posterior axis of mice and humans. We have identified a founder homozygous missense mutation in HOXB1 in two families from a conservative German American population. The resulting phenotype includes bilateral facial palsy, hearing loss, and À À strabismus and correlates extensively with the previously reported Hoxb1 / mouse phenotype. The missense variant is predicted to result in the substitution of a cysteine for an arginine at amino acid residue 207 (Arg207Cys), which corresponds to the highly conserved Arg5 of the homeodomain. Arg5 interacts with thymine in the minor groove of DNA through hydrogen bonding and electrostatic attrac- tion. Molecular modeling and an in vitro DNA-protein binding assay predict that the mutation would disrupt these interactions, desta- bilize the HOXB1:PBX1:DNA complex, and alter HOXB1 transcriptional activity. Congenital facial paralysis (CFP) has been classified Moebius syndromes, its genetics remain undefined.10,11 among the congenital cranial dysinnervation disorders Sorting out its genetics has been complicated, in part, by (CCDDs).1–3 CFP could be inherited, and autosomal-domi- the not-infrequent misdiagnosis of Moebius syndrome in nant loci have been mapped for isolated CFP (HCFP1 locus) children who have CFP but do not have limited abduction and for CFP with variable hearing loss (HCFP2 locus).4–6 of the eye.
    [Show full text]