Rna Helicase Ddx5 Regulates Platelet Derived Growth Factor Receptorand Androgen Receptor (Ar) Expression in Breast Cancer

Georgia State University ScholarWorks @ Georgia State University

Biology Dissertations Department of Biology

5-4-2020

RNA HELICASE DDX5 REGULATES PLATELET DERIVED GROWTH FACTOR RECEPTORAND ANDROGEN RECEPTOR (AR) EXPRESSION IN BREAST CANCER

Neha Panchbhai

Follow this and additional works at: https://scholarworks.gsu.edu/biology_diss

Recommended Citation Panchbhai, Neha, "RNA HELICASE DDX5 REGULATES PLATELET DERIVED GROWTH FACTOR RECEPTORAND ANDROGEN RECEPTOR (AR) EXPRESSION IN BREAST CANCER." Dissertation, Georgia State University, 2020. https://scholarworks.gsu.edu/biology_diss/238

This Dissertation is brought to you for free and open access by the Department of Biology at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Biology Dissertations by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected]. RNA HELICASE DDX5 REGULATES PLATELET DERIVED GROWTH FACTOR

RECEPTOR β AND ANDROGEN RECEPTOR (AR) EXPRESSION IN BREAST

CANCER

NEHA ARUN PANCHBHAI

Under the Direction of Zhi-Ren Liu, PhD

ABSTRACT

P68 RNA helicase, a prototypical member of the DEAD box family of RNA helicases is important in many biological processes, including early organ development. However, its aberrant expression contributes to tumor development and progression. In this study, we show that p68 upregulates the transcriptional expression of the growth factor receptor, PDGFRβ P68 knockdown in MDAMB231 and BT549 breast cancer cells significantly decreases mRNA and protein levels of PDGFRβ and EMT markers, resulting in decreased migration. We have previously shown that

PDGF-BB induces p68 phosphorylation, resulting in EMT via nuclear translocation of β -catenin.

Here, we show that p68 promotes migration in response to PDGF-BB stimulation via upregulation of PDGFRβ in breast cancer cells, suggesting that PDGFRβ is in turn regulated by p68 to maintain a positive feedback loop. Further, our study reveals the association of p68 in androgen receptor (AR) response via PDGFRβ. We demonstrate that p68 and PDGFRβ co-regulate AR expression and promote androgen-mediated proliferation in breast cancer cells, highlighting the critical role of p68-PDGFRβ axis in AR regulation

INDEX WORDS: RNA helicase, DDx5, Platelet derived growth factor receptor, Breast cancer RNA HELICASE DDX5 REGULATES PLATELET DERIVED GROWTH FACTOR

RECEPTOR β AND ANDROGEN RECEPTOR (AR) EXPRESSION IN BREAST

CANCER

NEHA ARUN PANCHBHAI

A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

in the College of Arts and Sciences

Georgia State University

2020

RECEPTOR β AND ANDROGEN RECEPTOR (AR) EXPRESSION IN BREAST

CANCER

NEHA ARUN PANCHBHAI

Committee Chair: Zhi-Ren Liu

Committee: D. D. Merlin

Jenny Yang

Electronic Version Approved:

Office of Graduate Studies

College of Arts and Sciences

Georgia State University

May 2020 iv

DEDICATION

I dedicate this dissertation to my family, friends and teacher, without their great, selfless, emotional spiritual and financial support in every aspect, my pursuit of knowledge for the past five years would have been just a dream.

ACKNOWLEDGEMENTS

In the difficult journey called life, it is impossible to succeed without the encouragement and support from various people who come along your way. Without acknowledging them this work will be incomplete. So I would like to express my honest gratitude to them.

I would like to thank, Dr. Zhi-Ren Liu, for giving me an opportunity to get me onboard in his lab.

His time to time guidance and support paved my way to achieve this point. Despite of numerous failed experiments and hypothesis, his trust in me, gave me the push to hold on. The members of my committee, Dr. Merlin and Dr. Yang, have always put me on the right path through their valuable suggestions.

I would like to thank the staff of the biology department, LaTesha Warren, Tameka Hudson,

Larialmy Allen, Sonja Young, Debbie Walthall, Mary Karom, who were quick to resolve any issues that I have faced as a graduate student in these years. I would also like to thank Dr. Francisco

Cruz and Julie Stowell, who have given me an opportunity to learn the art of teaching by graciously offering me a TA position for many semesters.

This project would have been far from real without the support of my fellow graduate students from various laboratories who have helped me in a plethora of issues from laboratory-based experiments to support in my personal life. I extend my thanks to Dr. Liangwei Li, Dr. Yinwei

Zhang, Falguni Mishra, Guangda Peng, Hongwei Han and Yang Huang, Chakravarthi Garlapathi,

Adani who have helped me in various ways without which I wouldn’t have completed my studies.

Special thanks go to Ganesh Satyanarayana, Dr. Ravi Chakra Turaga, and Malvika Sharma, colleagues and my friends. These are the people who stood by me through thick and thins in this

5-year journey. Their intellectual inputs helped me shape this project. Looking at their ability to work hard encouraged me push my limits. Doctoral degree is not just an academic degree, it is a

vi package of life and professional lessons. So there are times when you almost feel that you had enough. In these moments Ganesh, Ravi and Malvika were my life support. Thanking them here is beyond my word limits.

I would like to extend my thanks to Divya Ravi, Rakesh Balan, Nitika Sharma, Aashlesha

Rajankar, and Kanchan Shivankar - my friends / family for holding me together in all possible situations. Their advice in my personal life and their push kept me going in my low points.

I would also like to thank Parag Bhure for his support at initial stages of my journey, his lessons helped me grow as a person, step into the new life.

Lastly, my family, my father - Arun Panchbhai, mother - Vijaya Panchbhai, brother and sister in law- Swapnil and Roshni Panchbhai who were, are and always will be there, standing strong with immense trust in me, whenever I have to look back for support. I cannot thank them enough for the lessons in my early life which made me what I am today.

vii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... V

LIST OF FIGURES ...... X

LIST OF ABBREVIATIONS ...... XI

1. INTRODUCTION ...... 1

1.1. Cancer ...... 1

1.1.1. Normal cells vs cancer cells ...... 1

1.2. Breast cancer ...... 3

1.3. Cell migration ...... 5

1.3.1. Metastasis ...... Error! Bookmark not defined.

1.4. Helicases ...... 7

1.4.1. Super family 1 (SF1) ...... 8

1.4.2. Super Family 2 (SF2) ...... 9

1.5. RNA helicase p68 ...... 13

1.6. Platelet derived growth factors receptor (PDGFR) ...... 16

1.6.1. Platelet derived growth factor receptor beta (PDGFR β) ...... 22

1.7. Androgen receptor (AR) ...... 24

2. MATERIALS AND METHODS ...... 28

2.1. Cell Culture ...... 28

2.2. Transfection ...... 28 viii

2.3. DHT – MTT ...... 28

2.4. Immunoblotting ...... 29

2.5. Scratch Assay ...... 29

2.6. Boyden chamber assay ...... 29

2.7. Immunohistochemistry ...... 30

2.8. Immunofluorescence microscopy ...... 30

2.9. Real time PCR ...... 31

2.10. Statistical analysis ...... 32

3. RNA HELICASE DDX5 REGULATES PLATELET DERIVED GROWTH

FACTOR BETA (PDGFRβ) EXPRESSION ...... 33

3.1. RNA helicase p68 is highly expressed in breast cancer ...... 33

3.2. RNA helicase p68 affects cell migration ...... 36

3.2.1. Effect of p68 knockdown through scratch assay ...... 36

3.2.2. Cell invasion is affected upon 68 knockdown ...... 38

3.2.3. P68 knockdown changes EMT marker profile ...... 40

3.3. RNA helicase p68 regulates PDGFRβ ...... 42

3.3.1. RNA helicase p68 regulates PDFRβ but not other receptor tyrosine kinases (RTKs)

3.3.2. PDGFRβ overexpression rescues reduced cell migration after p68 knockdown . 46

3.3.3. Cell morphology upon p68 knockdown and PDGFRβ over expression ...... 48 ix

3.3.4. Changes in EMT markers upon p68 knockdown and PDGFRβ overexpression .. 50

3.3.5. PDGFRβ responsive genes goes down when p68 is knocked down ...... 53

4. RNA HELICASE DDX5 REGULATES ANDROGEN RECEPTOR (AR)

EXPRESSION ...... 55

4.1. Upon RNA helicase p68 knockdown, Androgen receptor (AR) expression is down

regulated ...... 56

4.2. PDGFR regulates AR expression in breast cancer cells ...... 59

4.3. AR expression is co regulated by RNA helicase p68 and PDGFR b in breast

cancer cell lines ...... 61

4.4. Nuclear PDGFRβ regulates AR expression in breast cancer cells...... 64

5. DISCUSSION ...... 67

6. REFERENCES ...... 71

LIST OF FIGURES

Figure 1.1 DDX5 domains ...... 13

Figure 3.1 p68 RNA helicase is associated with low overall survival in breast cancer...... 35

Figure 3.2 Loss of RNA helicase p68 inhibits well migration ...... 37

Figure 3.3 Cell Migration upon p68 knock down...... 39

Figure 3.4 Changes in EMT markers after p68 knock down ...... 41

Figure 3.5 Effect of p68 knock down in PDGFRβ, EGFR, Erk and phospho- PDGFRβ ,

Phospho-EGFR, phosphor Erk levels in MDA MB231 and BT549 cells...... 43

Figure 3.6 Levels of receptor tyrosine kinases upon p68 knock down ...... 45

Figure 3.7 8 Cell migration assay under p68 knockdown with or without PDGFRβ

overexpression ...... 47

Figure 3.8 Cell morphology of MDA MB 231 cells upon p68 knockdown with and without

PDGFRβ overexpression...... 49

Figure 3.9 Effect of p68 knocked down can be restored by PDGFRΒ overexpression ...... 52

Figure 3.10 mRNA expression of PDGFR β responsive gene cFOS upon p68 knock down ...... 54

Figure 4.1 Androgen receptor (AR) in MDA-MB 231 and BT549 cells and effect of di hydro

testosterone (DHT) treatment on cell proliferation while p68 is knock down...... 57

Figure 4.2 . PDGFR β regulates AR expression and mediates the effect of DHT in proliferation

of breast cancer cells ...... 60

Figure 4.3 p68 regulates androgen receptor expression through PDGFRβ ...... 62

Figure 4.4 p68 regulates expression of PDGFRβ but not the nuclear translocation...... 65

LIST OF ABBREVIATIONS

BSA Bovine serum albumin cDNA complementary DNA

DNA Deoxyribonucleic acid

DTT Dithiothreitol

EDTA Ethylenediaminetetraacetic acid

FPLC Fast performance liquid chromatography

HRP Horse radish Peroxidase

3-(4,5-Dimethylthiazol-2-yl)-2,5- MTT diphenyltetrazolium bromide mg Milligram

µg Microgram mL Milliliter

−3 3 mM 10 mol/dm

−6 3 µM 10 mol/dm

MW Molecular weight ng Nanogram nm nanometer

−9 3 nM 10 mol/dm

O. D. Optical Density (Absorbance)

PBS Phosphate buffer saline

PCR Polymerase chain reactions xii pM 10−12 mol/dm3

SDS- Sodium dodecyl sulfate polyarcylamide gel

PAGE electrophoresis

Tris 2-Amino-2-(hydroxymethyl)-1,3-propanediol

UV Ultraviolet

CTLs Cytotoxic T lymphocytes

EC Endothelial cell

E. coli. Escherichia coli

EGF Epidermal growth factor

EGFR Epidermal growth factor receptor

FBS Fetal bovine serum

FGF Fibroblast growth factor

FGFR Fibroblast growth factor receptor

IF Immunofluorescence

Ig Immunoglobulin mAb Monoclonal antibody mTOR Mammalian target of rapamycin

PCR Polymerase chain reaction

TGF Transforming growth factor

ATP Adenosine-triphosphate

ADP Adenosine-diphosphate xiii

Miscellaneous

ATCC American type Culture Collection

GSU Georgia State University

Rpm Revolutions per minute 1

CHAPTER 1

1. Introduction

1.1. Cancer

Cancer is uncontrollable growth of the body cells. It can start in any body part. Because of this uncontrolled cell growth, the normal function of that organ gets affected. Therefore, cancer is the name given to plethora of related diseases.

Human body is made up of many cells. Whenever old cells die or get damage, newly divided cells take their place to continue the normal body function. Sometimes these cells divide without stopping and adapt different mutations and form the tumor. This tumor changes the natural integrity of the organ. It hinders the normal function of the organ. Majority of the tumors form solid tumor like pancreatic tumor, breast tumors etc. But leukemia, which is uncontrolled growth of blood cells do not form such solid tumor.

Tumors can be classified as benign or malignant. Tumors which do not spread into or invade other body parts are benign tumors. But sometimes, cancer cells can spread in other body parts through blood or the lymphatic system as well and form tumors. At this point, these tumors are called as malignant.

1.1.1.Normal cells vs cancer cells

Although cancer cells are modified body cells, they differ from each other in many ways. Normal body cells divide and mature and they have very specialized structures to perform their function.

Whereas when cancer cells divide, they do not perform normal body function. Cancer cells lack cell-cell contact inhibition and they divide without control to form tumor mass. 2

Programed cell death is the phenomenon through which body gets rid of unwanted, unhealthy cells through relay of signaling from surrounding tissue. Cancer cells ignore these signaling and continue to replicate. To support this growing tumor mass, cancer cells need continuous nutrient and oxygen supply. In order to get that, cancer cells secrete growth factors, like VEGF, TGFβ, and stimulate new blood vessels formation to support tumor growth. In this way, they not only get the nutrients and oxygen but also find a way to discard their waste materials.

1.2. Breast cancer

In the United States, breast cancer is a common type of cancer in women. As per CDC reports, every year about 245,000 cases of breast cancer are diagnosed in women and about 2,200 in men, in the US. Rate of getting breast cancer is maintained in last decade overall but has been increasing in black women and Asian and Pacific Islander women. Although death rate has been decreased in the last few years but still it is a second leading cause of death due to cancer in Hispanic women.

(CDC).

Breast cancer is highly metastatic cancer. It can metastasize to distant organs like liver, lung, bone, and brain. Early diagnosis has greater chance for patient’s survival. But once it metastasizes, chances of incurability and survival decreases. Mammography is the most common method used for screening and detection of occurrence of the disease. There are other methods like Magnetic

Resonance Imaging (MRI) available for the screening, which are more sensitive (Drukteinis JS,

2013). The risk factors for this disease includes, sex, family history, unhealthy lifestyle, aging, estrogen, gene mutations etc.

Some cells in ductal region of breast area become highly proliferative, which eventually may lead to metastatic carcinoma. To trigger this increased proliferation, different carcinogenic factors play their role. To establish the tumor, surrounding microenvironment plays a significant role. It has been found that cancer associated macrophages can generate mutagenic inflammatory microenvironment. In such inflammatory microenvironment, cancer cells can escape immune rejection (Qian BZ, 2010). In the light of variety of mutations observed in the breast tumor, new subset of cells called as cancer stem cells (CSCs) have been isolated. These cells are more likely originated from luminal epithelial progenitor cells (Molyneux G, 2010). These cells contribute to further proliferation of the tumor cells. Due to mutations in proteins of many vital signaling 4 pathways like, p53, PI3K and HIF, Notch, Hedgehog, Wnt, breast cancer cells have increased survival, proliferation (Valenti G, 2017).

Based on their origin and the mutations they harness, breast cancers are categorized in different types like, basal like tumor with ER-, PR-, HER2- (triple negative) mutations, luminal tumor with

ER+, PR+, Her2- mutations, HER2 tumors with ER-, PR-, HER 2 + mutations, etc. Other than ER,

PR genes mutations, there are several other genes that have mutations closely related to breast cancer. For example, BRCA1 and BRCA2 (Breast cancer associated gene 1 and 2). These are anti oncogenes. Mutations in these genes are common in breast cancer. They are found on chromosome

17q21 and 13q12, respectively. Mutations in these genes leads to abnormal centrosome duplication, cell cycle checkpoint disruption, genetic instability and apoptosis. Mutations in these genes leading to breast cancer is closely related to heredity and the age factor (Chen S, 2007).

Another oncogene found on chromosome 17 (17q12) called as human epidermal growth factor receptor 2 (HER2), also known as c-erbB-2, is closely related to breast cancer. It belongs to EGFR, tyrosine kinase family protein. Overexpression of this protein is observed in about 20% of the breast cancer patients (Davis NM, 2014). Epidermal growth factor receptor, located on cell surface stimulate many downstream pathways like, PI3K, Ras-Raf-MAPK and JNK, which are involved in stimulating cell proliferation, angiogenesis, migration etc. Overexpression of EGFR may lead to highly proliferative, metastatic tumor. More than 50% of the triple negative breast cancer patients (TNBC) have overexpression of EGFR (Kim A, 2017). Other than these mutations, there are many other mutations that are closely related to development of breast cancer. Several proteins, if overexpressed, may increase proliferation and metastasis in breast tumors, for example RNA helicase p68. Identifying those key players and the implicated pathways is required to develop new therapeutic regimes. 5

1.3. Cell migration

Cell migration is a crucial mainstay in the developmental process. Its role extends to a wide variety of physiological processes like embryogenesis, inflammatory response, and wound healing. Cell migration plays a key role in cancer advancement through metastasis. Migrating cells undergoing chemotaxis, the process of moving along with gradient of soluble chemoattractants and repellents, have an inherent navigation system that aids to sense said gradients and directs them to move.

Migration toward or away from a chemotactic agent requires sensing directionality, polarity of the cell, and spatially coordinated movement. When a cell encounters an external gradient, it relays the appropriate signal to the cytoskeleton, component which modulates cell shape and motility.

Cytoskeletal remodeling is majorly implemented by actin polymerization and proves to be the driving force behind orchestrated cell movement.

Extracellular matrix (ECM) has a filamentous network with spaces between the fibers so that the cells can pass through. Some of the matrix polymers in tissues are collagen, laminin, elastin and other proteins and proteoglycans. ECM imposes steric hindrance on the migrating cells. Several factors govern the migration of a cell such as cytoskeletal prestress, stiffness of the ECM, adhesion and trans-cellular forces. Transmission of said forces to neighboring cells occurs via cadherin- type cell-cell adhesions. Normal liver tissue stiffness measured by magnetic resonance elastography at 90 Hz is 2 kPa while a cirrhotic liver 5kPa. Most of these studies show that some tumors e.g.: breast cancers exhibit increased tissue stiffness. Tumor cells can use tissue stiffness to their advantage by promoting tumor cell invasion, proliferation, and survival.

Cell polarization precedes migration. There is a distinction of a leading front and rear in migrating cells, providing directionality to the pattern of migration. Polarity in epithelial cells is obtained through a signaling pathway involving Cdc42, Par3/6, and atypical protein kinase C that targets 6 microtubules. A polarized, migrating cell demonstrates asymmetric distribution of cytoskeletal elements as well as signaling components. High concentrations of actin were observed in the leading front while the rear exhibits elevated myosin concentrations. Phosphatidylinositol lipid

(PIP3), phosphatidylinositol kinase (PI3K) are localized at the front while phosphatase and tensin homolog (PTEN) was displayed at the back. 7

1.4. Helicases

Proteins with several conserve motifs and the ability to move directionally along the nucleic acid strands are called as translocases. It is a big family of proteins and helicases are one of them.

Nucleic acid dependent ATP-ases which can unwind the DNA or RNA duplex substrate are called as helicases. These helicases play role in different cellular processes which requires including

DNA replication and repair, transcription, translation, ribosome synthesis, RNA maturation and splicing, and nuclear export processes. (Martin R. Singleton, 2007)

The core structure of the helicases have a tandem RecA – like folds which causes protein conformational changes by converting chemical to mechanical energy by coupling NTP binding and hydrolysis (A.Rapoport, 2004). The characteristic feature of the core domain has conserve residues which are involved in binding and binding and hydrolysis of the NTP equivalent to the

Walker A and B boxes of many ATPases (Gay, 1982) and an “arginine finger” that plays a key role in energy coupling (Klaus Scheffzek, 1997)

Helicases have different biochemical properties, which help regulate their function in the cell. As

DNA is a bipolar molecule, the proteins like helicases require directionality to transcribe the molecule correctly. Directionality is determined by polarity of the phosphodiester linkage in single stranded DNA. But in in double stranded DNA, the directionality is determined by the protein itself and the way it is loaded on the strand (Martin R. Singleton, 2007). The rate of translocation should be regulated in order to maintain the correct number of copies of DNA in the cell. The rate of the translocase is mainly maintained by the accessory proteins and also with the ATPase activity of the helicase. Helicases acts as catalyst to unwound the base pairs using free energy from ATP hydrolysis. For each ATP turnover how many base pairs are unwound describes the step size of the helicase. This step size is important for understand the efficiency of the helicase. 8

During 1993 helicases were classified in to two large families, super family 1 (SF1) and super family 2 (SF2), based on their primary structure by Gorbalenya and Koonin. (V.Kooninbc, 1993).

But not all helicases necessarily unwind the nucleic acid. They also act as motors by coupling NTP hydrolysis and direct the motion of the helicase along the nucleic acid. With the discovery of new domains and the functions of helicases, they are divided in to six super families. Helicases belonging to SF1/ SF2 have a single polypeptide chain with two RecA-like folds while other families have six or twelve rings of RecA-like folds. These families can be further subdivided as type A or Type B, based on the directionality of the translocation i.e. whether 3’-5’ or 5’-3’ (Martin

R. Singleton, 2007).

1.4.1.Super family 1 (SF1)

Helicases belonging to SF1 family are subdivided in to SF1A and SF1B. Examples from SF1A family are the Rep and UvrD helicases in gram-negative bacteria and the PcrA helicase from gram positives.

1.4.1.1 SF1A Helicases

The structure of these family helicase comprises of a common fold, having two domains which further subdivided in to two subdomains. The cristal structure studies have shown that they have two RecA-like (N- and C-core) subdomains and the ATP- binding site lies in the cleft between these domains (Hosahalli S. Subramanya, 1996) (Waksman, 1997). These are flanked with many

SF1 specific motiefs. Cristal structure of some proteins have also shown the single stranded DNA binding and different conformational changes (Waksman, 1997), confirming that these proteins involvement in the duplex unwinding.

The helicase interacts with the single strand of the DNA which leads to conformational change in the form of rigid body movement, in one of the subdomain (2B) of the helicase and sets up a new 9 interface of subdomain 1B and 2B, facilitating its interaction with duplex DNA. ATP biding will further extend the conformational change in the cleft between the core motor domains 1A and 2A which leads to closing around the nucleotide. Once the cleft is closed, domains 1B and 2B forces the DNA duplex on to the negatively charged surface destabilizes the strand pairing. The cleft closer also leads to flipping of the bases in the single stranded region in to the pockets on the surface of the 1A and 2A domains. These movements all together translocate the helicase along the ssDNA. As core domain opens and closes, ATP binds, get hydrolyzed and then released

(Martin R. Singleton, 2007).

1.4.1.1 SF1B Helicases

The helicases from SF1B family have two RecA-like core domains with an ATP-binding site between them, similar to the SF1A proteins, but there is also an additional N-terminal domain that forms the interface with the RecC subunit and they do not interact with duplex DNA ahead of the fork.

1.4.2.Super Family 2 (SF2)

This is the largest superfamily of helicases. Helicases from this family are involved in the wide variety of cellular processes. Few extensively studied subfamilies like DEAD-box RNA helicases

(KyleTanneraPatrickLinder, 2006), the RecQ-like family (Richard J Bennett, 2010) and the Snf2- like proteins belong to this family (panelAndrewFlausTomOwen-Hughes, 2004). One of the most important function of proteins belonging to this family is ATP-dependent directional translocation on single- or double-stranded nucleic acid. Some proteins also act as non processive mechanical switches, altering nucleic acid and nucleoprotein conformations in an NTP-dependent manner

(Patrick Linder, 2006) (Martin R. Singleton, 2007). To understand the translocation of these helicases on the ss-DNA, structural analysis of the non structural protein 3 (NS3) of hepatitis C 10 virus belonging to SF2 helicase family was useful. These helicases unwind RNA and DNA duplexes using 3’ single stranded overhang (Pyle, 2002) (Tai CL1, 1996). In NS3 the C-terminal domain carries the protein –protein interaction while N-terminal domain acts as protease (Samuel

G. Mackintosh‡, 2006).Two RecA- like proteins are present in core of the protein which forms a deep grove to accommodates helicase motifs which provide opportunity for nucleotide to bind and part of the ss-DNA binding site. When six bases of the ss-DNA bind to the core domain, it adapts open configuration. Because of the bases present in the pocket, the ss-DNA forms a pseudo B- form structure. This formation prevents the binding of another strand of the DNA. Residues from motifs 1a, TxGx, 4, and 5 gives contact site for nucleic acids with phosphodiester bond. The amino acids present at V432 and W501 site are called as bookend residue. They sandwich five bases across the core domain. The RecA– like domain provide additional DNA contact region surrounding the bookend residues. ATP hydrolysis cycle will alter the distance between bookends which causes opening and closing of the core domain. This movement along the contact with DNA, allows gripping and release of the DNA substrate and results in translocation of the protein and unwinding of the DNA (Martin R. Singleton, 2007).

On the other hand, the DEA(D/H) box RNA helicases uses ATP-dependent conformational motions to produce localized RNA remodeling. To understand the translocation of SF2 family helicases on double stranded nucleic acid Rad54 helicase structure was studied. In order to start the translocation, and to be in open position, the C-core domain of the Rad54 undergoes the conformational change. The N-core domain recognizes both the DNA strands along the minor grove. Motifs 1a ns Snf2 maintain contact with phosphodiester backbone of the DNA keeping it in the B form conformation. One strand of the DNA duplex orients itself similar to the ssDNA in the N-core domain in the NS3 structure, to achieve the extensive protein: DNA contact. 11

1.4.2.1 DEAD-box family proteins

Helicases having a conserved sequence of Asp-Glu-Ala-Asp (DEAD) residues are called as

DEAD-box family helicases. These DEAD-box proteins belong to SF2 family of helicases. This is the largest subfamily in the SF2 helicase family. It is conserved from bacteria to humans

(EFairman, 2007). They can bind to ssRNA, dsRNA or structured RNA. They have wide variety of functions in the cells, like RNA metabolism including transcription, splicing, transport, ribosome biogenesis, translation, RNA/protein complex assembly, and degradation (EFairman,

2007) (Olivier Cordina, 2006) (Manuel Hilbert 1, 2009). Their main function is related to RNA as

ATP- dependent chaperons that modifies RNA. Binding of the DEAD box helicases to RNA is

ATP dependent. Instead of direct translocation, they work with RNA protein complexes (RNPs) and structured RNAs, alter RNA-protein interaction. (Manuel Hilbert 1, 2009). In order for ATP dependent RNA unwinding, these helicases bind to dsRNA and separate the strands apart without translocating on the nucleic acid.

The structural studies of these helicases have shown the cleft between the two RecA-like domains having helicase motif. They form the ATP and RNA binding sites. The specificity for ATP is provided by the Q motif contacting nucleotide base. The N-terminal RecA-like domainhave the I-

III motifs. C-terminal domain have IV-VI motifs (Martin R. Singleton, 2007). Without ATP and

RNA two RecA-like domains do not interact and forms the open conformation (Ruairi Collins,

2009). Upon binding with ssRNA, helicase kink the phosphate backbone, causing destabilization in the duplex, which leads to unwinding of the short duplexes. Here ATP binding is necessary for strand separation. Hydrolysis of ATP may not be required (Fei Liu, 2008). Helicase without ATP or ADP bound helicase will have low affinity toward RNA whereas ATP binding will increase the helicase affinity for RNA. Therefore when ATP is hydrolyzed RNA is released from the complex 12

(Olivier Cordina, 2006) (Herschlag, 1998). Kinetic parameters comparison for ATPase and unwinding reactions, study suggest that ATP binding increases the unwinding but hydrolysis of the ATP is not required. Therefore, ATP hydrolysis event may happen after dsRAN melting but before complete strand separation. Possibility of dissociation of the helicase from the strand is increased due to ATP hydrolysis, but the rate of unwinding is faster than dissociation rate. So ATP hydrolysis results in the strand separation.

1.5. RNA helicase p68

P68 RNA helicase (DDX5), prototypic member of the DEAD box family of RNA helicases (Lane and Hoeffler 1980), which, is crucial for the cell development, division, and organ maturation

(Stevenson, Hamilton et al. 1998). RNA helicases belonging to DEAD box family contain 9 domains of conserved peptide sequence. One of the major conserved sequence is Asp-Glu-Ala-

Asp (DEAD). As the name suggest these proteins are mainly involved in recognizing RNA and

RNA unwinding. Other than RNA unwinding, proteins belonging to this family are involved in plethora of activities like RNA like ribosome biogenesis, embryogenesis, spermatogenesis, and cell development and division etc.

Figure 1.1 DDX5 domains p68 shares a "helicase core" of nine conserved motifs with other members of the DEAD-box family, and these conserved regions are critical for RNA binding, ATP binding and hydrolysis, and intermolecular interactions. The core is divided into two flexibly linked RecA-like domains,

Domain 1(D1) and domain 2(D2). The D1, consisting of Q-motif, motifs I, II and III, serves for

ATP-binding. The D2, including motifs IV, V and VI, exhibits an RNA-duplex recognition domain. The Q-motif is present at the N-terminus of the catalytic core and is preceded by a conserved phenylalanine 17 amino acids at the upstream This conserved aromatic group and the

Q-motif are identified as adenine recognition motif and can regulate ATP binding and hydrolysis. 14

Further, the Q-motif was reported to affect the helicase activity through regulating the affinity between the protein with RNA. Motifs I and II (or Walker A and B) are capable of binding ATP.

The energy from ATP hydrolysis is coupled to RNA unwinding by motif III and cooperates with other motifs to create a high-affinity RNA binding site. And motif IV, together with motif Ia, Ib and V, is engaged in ATP-dependent binding of RNA substrates. Obviously, the structure of p68 is in a dominant position in the representation of function, and there is a profound work which is remained to elucidate the mechanism between structure and biological activity

Gene and Structure of p68 RNA Helicase

Location of the human p68 RNA helicase is at chromosome 17q21 and encoded in DDX5 gene

(Iggo et al 1989). Its cDNA sequence shows an open reading frame encoding a polypeptide of 614 amino acids (Hloch et al 1990). The p68 RNA helicase was aciidentally discovered from its immunological cross-reaction with the anti-SV40 large T monoclonal antibody DL3C4 (PAb204)

(Crawford et al 1982a, Lane and Hoeffler 1980a). As p68 is RNA helicase, it shows RNA helicases, ATP binding, RNA-dependent ATPase, activities in vitro (Hirling et al 1989, Iggo and

Lane 1989b).

Functions p68 is a multifunctional protein which can bind to both single stranded as well as double stranded

RNA. With ATP hydrolysis it gives energy to unwind the RNA in bidirectional manner (Hirling

H, 1989). It can arrange the spliceosome and efficiently carry out the RNA splicing (Hamm J,

1998). But RNA helicase activity is not required for spliceosome arrangement (Lin C, 2005). It also plays an important role in RNA maturation, therefore it is safe to say that it has important function in alternative splicing (Guil S, 2003). P68 also plays role in microRNA (miRNA) biogenesis. Small non-coding RNA called as micro RNA regulates protein synthesis by regulating 15 the mRNA (Ma R, 2012). Drosha and dicer are endonucleases which cleaves the mRNA to form primary miRNA (pri-miRNA) and precursor miRNA (pre-miRNA) respectively (Zeng Y, 2005)

(Gregory RI, 2004). During this pri-miRNA to pre-miRNA transition, p68 recognize the pri- miRNA and binds to specific structure (Fukuda T, 2007). P68 also acts as transcriptional co activator. For example, p68 interacts with estrogen receptor (ER), which is a nuclear receptor and regulates downstream genes of ER (Endoh et al 1999a). P68 is over expressed in almost all type of malignant tissues and cells, like colon cancer, prostate cancer, lung cancer, breast cancer etc. It has great impact on cancer cells proliferation and migration. It interacts with many different proteins which are involved in stimulating cell migration and proliferation. For example, β- catenin. The androgen receptor (AR) is also a nuclear receptor and act as transcription factor for more than 1200 genes. It has great deal of importance in breast cancer and prostrate cancer development and progression. (S. Wen, 2014). P68 is overexpressed in prostate and breast cancer.

P68 siRNA knockdown resulted in to down regulation of AR responsive genes (Clark EL, 2008).

So p68 also play major role in prostate and breast cancer development and progression via regulating the AR.

1.6. Platelet derived growth factors receptor (PDGFR)

Ligands AA AB CC BB DD

Receptors

Extracellular

Intracellular

PDGFR αα PDGFR αβ PDGFR ββ homodimer heterodimer homodimer

Figure 1.2 PDGFR family PDGF receptors and their ligands.

Platelet derived growth factor receptors (PDGFR) belong to the family of tyrosine kinase family

(Lemmon and Schlessinger 2010) they belong to class III type of (RTKs), It is a group of five members including PDGFRα and PDGFRβ, KIT, FMS and FLT3. Proteins belonging to PDGF family stimulates proliferation, survival, migration of the mesenchymal cells.

PDGF receptors are found in two different types, α and β. Upon ligand binding they either form homodimer or heterodimer. There are 4 different types of ligands for these receptors PDGF A,

PDGF B, PDGF C, PDGF D. PDGFRα can bind to PDGF A, B and C homodimer or PDGF AB heterodimer, while PDGFRβ can bind to PDGF B and D homodimers. The molecular size of the

PDGFR α and β is approximately 170 -180 kDa. respectively. The human α-receptor gene is 17 localized on chromosome 4q12 (PaslierM.R.AltherrT.E.DormanD.T.Moir, 1994), and the β- receptor gene is on chromosome 5 (Y. Yarden, 1986)

Proteins from this family play important role in tissue homeostasis in adult and different developmental stages of embryo. If absent or malfunctioning at this stage, it can lead to a variety of developmental diseases. On the other hand, if it is overexpressed, it leads to malignancies or diseases involving excessive cell proliferation and migration.

As PDGFR α and β exist in homodimeric and heterodimeric form with different combination of ligand molecule, they can transduce variety of cellular signals. These signals may have overlapping cellular outcome. Whereas signals and the output from the homodimers are more specific. For example, signal from both α and β homodimer can transduce mitogenic signal but their effect on the actin filament will differ. Upon stimulation both can trigger los of stress fibers and plasma membrane ruffeling, but signal from PDGFR β mediates formation of circular actine structure on the dorsal surface of the cell (Claesson-Welsh, 1992). Signal from PDGFR β stimulates chemotaxis, but PDGFRβ have opposite effect (A Siegbahn, 1990). Both the receptors increase the cellular calcium concentration (DILIBERTO P. A., 1992). These growth factor signals result in anti apoptotic cellular signal by inhibition of the gap junctional communication between cells

(Boynton, 1998) (R Yao, 1995).

As ligand binds to the extracellular domain of the receptor, it induces dimerization of the receptors causing intracellular domains of the receptors to come close, resulting in asymmetric dimeric arrangement of the two kinase domains, leading to autophosphorylation in trans receptor units.

This autophosphorylation event causes the conformational changes in the intracellular portion of the receptor, making catalytic sites exposed, resulting in activation of the kinases. These autophosphorylated tyrosine residues provide docking sites for different signal transduction 18 molecules having SH2 domain. Each receptor has about ten autophosphorylation sites. Each site provides docking site for molecules with different SH2 domains. For example, molecules having enzymatic activity like phospholipase C-y (PLCy), tyrosin kinase from Src, Fer families the

GTPase activating protein (GAP) for Ras and the SHP-2 tyrosine phosphatase (Westermark, 2017).

This phosphorylated PDGFR binds to variety of signaling molecules like STAT family proteins.

Once activated, they can act as transcription factors in a variety of cellular processes, some adaptor molecules. Adaptor molecules are the molecules which facilitate binding of multiple other proteins in order to relay the signal, for example phosphotidylinositol3’- kinase (PI3K), Grb2, Nck, Shc,

Crk, GABA2 etc. Each protein relays the plethora of signaling events. regulatory subunit of PI3K acts as adaptor protein for catalytic subunit of p110 protein. Grb2 acts as adaptor protein for Sos1 protein in order to relay the signaling through Ras- Erk1/2- MAP kinase pathway. Directly or indirectly, PDGF stimulation can further activate many pathways like JN, p38, small GTPases,

Rac, Rho,CDC42 etc., which leads to cell survival, proliferation, and migration (panelJean-

BaptisteDemoulinAhmedEssaghir, 2014). This stimulation of different signaling molecule and involvement of wide variety of pathways, makes it difficult to pinpoint the link one particular pathway to specific response (Westermark, 2017).

As PDGF stimulation regulates a variety of intracellular signaling, it is very important to keep this stimulation in check. One way to keep the the stimulation in control is internalization of the receptor. The internalization happens via clathrin coated pits into endosome after PDGF is bound to the receptor. pH in the endosome is very low and it can dissociate the receptor from its ligand, but until then relay of the signal continues. At this low pH, the dimerized receptor dissociates to form monomer and gets dephosphorylated (Yi Wang‡§, 2003). 19

Activated PDGFR signaling can be modulated depending on the different cellular environmental conditions or different protein complexes. Ras can be activated by PDGFR α and PDGFR β by docking on to Grb2/Sos1 complex. Ras –GAP complex can directly bind to PDGFR leading to inhibition of the activation of Ras but this complex cannot bind to PDGFRα. Therefore, PDGFRα activates Ras more efficiently than PDGFRβ (AleksandraJurekCarl-

HenrikHeldinJohanLennartsson, 2011)

Involvement of PDGF in a variety of diseases

PDGF stimulation plays important role at developmental stages, contributes to cell proliferation, migration and cell growth. But if overexpressed or over stimulated, it contributes to a lot of different diseases. It has been shown that mesenchymal cells express PDGF forming an autocrine loop, therefore when PDGF is overexpressed in these cells, it can be one of the reasons for fibrosis

(CBonner, 2004). Overexpression of PDGF is observed in broncho alveolar fluid as well as tissues

(CBonner, 2004). In kidney fibrosis, under glomerulosclerosis condition, PDGFR β stimulated by

PDGF-BB or PDGF-CC seems to play role. But under interstitial fibrosis, PDGFR α stimulated by PDGF-AA or PDGF-CC plays a role (Tammo Ostendorf, 2011). This finding is supported by inhibition of PDGF signaling using PDGF neutralizing antibodies or treatment with imatinib, which is a PDGF inhibitor. These treatments reduced mesangial cell proliferation and matrix production in fibrotic kidneys in animal models (R J Johnson, 1992) (Westermark, 2017).

Chronic inflammation is observed in atherosclerotic lesions, under such condition immune cells in the area produces PDGF which acts on smooth muscle cells present in the vascular walls. This leads to proliferation of these cells and results in neointimal thickening (WRaines, 2004). In animal mouse models treatment with PDGFR β antibody, in which atherosclerosis was promoted via constitutively active PDGFR β showed promising results (GA Ferns, 1991). Overexpression of 20

PDGF is also observed in pulmonary artery hypertension, a serious condition. In this condition, pulmonary vasoconstriction and abnormal remodeling of small pulmonary resistance vessels and hyperplasia of smooth muscle cells is observed (Santosh S. Arcot, 1993).

As PDGF signaling plays role in cell migration and proliferation, it is not difficult to imagine it would also have significant role in several types of human cancers. PDGF signaling tumor cells proliferation and migration but it also modulate tumor stroma to support tumor growth (Kristian

Pietras, 2003). As mentioned above, PDGFR are expressed predominantly in mesenchymal cells, but when epithelial cells undergo epithelial to mesenchymal transition (EMT), in response to variety of signals e.g. Transforming growth factor β TGFβ, increased expression of PDGFR is observed (Aristidis Moustakas 1, 2016). Tumor cells arising from epithelial cells have undergone

EMT, have overexpression of PDGFR. EMT changes stimulates increased production of PDGF.

Thus these tumor cells can promote their survival and proliferation in autocrine manner

(Westermark, 2017). It has been observed in the surgical specimen studies that, glioblastoma cells in human co-express PDGFR α and PDGF-AA. As PDGF-AA is a ligand for PDGFR α, it is safe to say that, PDGF –AA stimulates PDGFR α in autocrine manner in human glioblastoma

(Hermanson M, 1992). The tissues which may develop in to sarcoma, generally express PDGFR.

Biopsies of the soft tissue sarcoma, osteosarcomas and synovial sarcomas showed co-expression of the PDGFR and its ligand (Wang J, 1994) (Smits A, 1992) (Kubo T, 2008) (Ho AL, 2012) In majority of the prostrate cancer cells PDGFR β is overexpressed (Ko YJ, 2001). Moreover, expression of PDGFR β in the stromal area of prostate cancer correlates to clinical relapse (Yngve

Nordby, 2017). In breast cancer studies, it has been observed that, breast cancer cells also express

PDGF ligand isoforms and their receptors (Martin Jechlinger, 2006) and overexpression of

PDGFRβ in stromal area leads to poor prognosis (hardwaj B) (Seymour L, 1993). Thus through 21 various studies and example it is evident that different isoforms of PDGF ligands and their receptors play significant role in development of variety of cancers and also their overexpression in the stromal area leads to decreased survival, relapse, and poor prognostics.

1.6.1.Platelet derived growth factor receptor beta (PDGFRβ)

Platelet-derived growth factor receptor-beta (PDGFRβ) is a cell surface receptor tyrosine kinase (Wang, Wu et al. 2016). In order to translate the extracellular signal in biological form the

PDGFRΒ has to bind to the ligand. PDGFRβ can bind to two types of ligands PDGF B or PDGF

–D Andrae et al., 2008, Borkham-Kamphorst et al., 2015, Kondo et al., 2013) Upon PDGF BB binding to PDGFRβ extracellular domain, PDGFRβ form dimer and through the cascade of downstream signaling the signal is translated in to biological form like cell migration, proliferation etc. (Shim et al., 2010). PDGFRβ play important role in development, tissue repair, wound healing etc. It also play a role in angiogenesis and collagen production.(Chen, Chen et al. 2013)

Platelet derived growth factor receptor (PDGFRβ) is a receptor tyrosine kinase that is implicated in cell proliferation upon PDGF-BB stimulation (Betsholtz 2004, Jechlinger, Sommer et al. 2006).

Substantial evidences indicate an increase in PDGFRβ- signaling in different stages of breast cancer and that it is highly upregulated in the human late stage mammary tumors. PDGFRβ- expression has also been correlated with an invasive phenotype in human breast cancer (Jechlinger,

Sommer et al. 2006). It has been elucidated that an autocrine (platelet derived growth factor

(PDGF-BB)/PDGFRβ loop is established in breast cancer cells through upregulation of both ligands and receptors, which leads to cell proliferation, migration, survival, and drug resistance

(Guha 1991, Lokker, Sullivan et al. 2002, Yu, Ustach et al. 2003, Bonner 2004).

Nuclear localization of PDGFRβ upon PDGF-BB stimulation has recently been reported.

Nuclear interaction of PDGFRβ controls cell proliferation by chromatin remodeling and regulation of p21 levels (Papadopoulos, Lennartsson et al. 2018). Also, nuclear PDGFRβ- has been shown to control androgen receptor (AR) expression (Cuenca-Lopez, Montero et al. 2014, Papadopoulos,

Lennartsson et al. 2018). Notably, AR overexpression is associated with breast cancer 23 aggressiveness (Moinfar, Okcu et al. 2003). It has also been reported that p68 RNA helicase is a coactivator of various steroid hormone receptors, including AR (Clark, Fuller-Pace et al. 2008).

Clark et al. have previously demonstrated that p68 recruits AR and -catenin to the promoter regions of androgen responsive genes, including prostate specific antigen resulting in increased

AR transcriptional activity in prostate cancer (Clark, Hadjimichael et al. 2013).

Aberrant expression of p68 and PDGFRβ has been documented in three major human cancers, including breast (Seymour and Bezwoda 1994, Haines, Cajulis et al. 1996, Paulsson,

Sjoblom et al. 2009, Hashemi, Masjedi et al. 2019), colon (Singh, Haines et al. 1995, Fujino,

Miyoshi et al. 2018), and prostrate(Clark, Coulson et al. 2008, Nordby, Richardsen et al. 2017), suggesting the crucial role of both the proteins in tumorigenesis. Both p68 and PDGFRβ play an important role in cell proliferation and migration that are critical to cancer development. We have previously shown that p68 RNA helicase mediates PDGF-induced EMT by displacing axin from

β-catenin (Yang, Lin et al. 2006).

1.7. Androgen receptor (AR)

N-terminal C-terminal

N-terminal domain DBD H LBD

NLS NES

Figure 1.3 Functional domains of the androgen receptor (AR): N-terminal domain, DNA binding domain (DBD), Ligand binding domain. (H – hinge region, NLS – nuclear localisation signal, NES

– nuclear export signal)

The androgen receptor is a transcription factor, belonging to steroid hormone receptor family. Few other notable examples of this family are, progesterone, estrogen, retinoic acid, thyroid, mineralocorticoid, vitamin D receptors (C. Chang, 1995) (C.S. Chang, Molecular cloning of human and rat complementary DNA encoding androgen receptors, 1988) (C.S. Chang, Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors,

1988). Androgen receptor binds to androgen and to mediate the physiologic effect of androgen. It binds to targeted DNA sequence and regulate its expression or suppression (Gelmann).

Structure and regulation

The single copy of androgen receptor gene is present on the chromosome Xq11.2-q12, oriented towards 5’end of the centromere. It spans around 90 kb of DNA (Gelmann). Eight exons comprise the coding sequence and approximately 2757 base pairs of open reading frame (Gelmann). The protein has 3 main domains as, Ligand binding domain (LBD), activation domain, and a DNA binding domain (DBD). Trans activation domain is transcriptional regulatory region present at N- terminal domain (O. Sartor, 1999). Highly conserve DBD is encoded by second and third exon. It 25 is composed of two zinc finger domains. One deals with the receptor specificity for androgen response element (AREs) and the other one deals with receptor dimerization and binding with

DNA. LBD is encoded by by exon 4-8. 12 helices form the ligand binding pocket and allows conformational changes upon ligand binding. A connecting region between LBD and DBD has a nuclear localization signal (Gelmann). Importin protein plays significant role in carrying AR into the nucleus. It binds to the NLS sequence of AR and carry it in to the nucleus.

Chaparonin proteins like Hsp90, FKBP51, Hip, HSP70, p23 (J. Veldscholte, 1992), even cytoskeletal proteins (D.M. Ozanne, 2000), sequester inactive AR and keeps it in the cytoplasm.

Once bound to its ligand, dihydrotestosterone (DHT), conformational changes will dissociate chaperonins from AR and it will be trans located to nucleus (Parth K.Modi, 2016). Proteins like the steroid receptor coactivator family (SRC/p160), cAMP response element binding protein

(CREB) binding protein (CBP)/p300 and p300/CBP-associated factor (p/CAF), act as coactivator for AR. These proteins regulate histone modification, chromatin remodeling, chaperones, sumoylation, proteosomal degradation, and enhance AR transactivation (Z. Culig,

2012) (Parth K.Modi, 2016).

Few proteins inhibit the transcription initiation by AR, these are called as co-repressors. Few examples of co-repressor are the nuclear receptor corepressor (NCoR) and silencing mediator for retinoid and thyroid hormone receptors (SMRT). SMRT can recruit histone on the targeted

DNA site and prevent binding of the AR by tightly packing the DNA. It also disrupt the N/C terminal interactionby interacting with NTD and LBD (G. Liao, 2003)

Androgen receptor is susceptible to many modifications like, acetylation, phosphorylation, ubiquitination, sumoylation, or methylation after getting dissociated from the chaperons (M. Fu,

2004) (S.A. Goueli, 1984) (K. Coffey, 2012). Proteins like receptor-tyrosine kinase (RTK) and G- 26 protein coupled receptor (GPCR) signaling can activate AR through their downstream pathways, independent of the AR ligand (N.C. Bennett, 2010), (X. Cao, 2006).

Functions

As part of nuclear receptor family proteins, main function of AR is to serve as transcription factor.

To perform this function AR has to bind to its ligands, which are, dihydrotestosterone (DHT), testosterone and its metabolites, estradiol and 5- DHT (K. De Gendt, 2012). Different tisues respond to different stimulant. For example, for development in pubertal and prenatal period reproductive tissues respond to testosterone on the other hand, during development and maintenance of prostrate tissues DHT stimulation is preferred. Muscle tissues respond well to testosterone, whereas adipose tissues use estradiol, which is an aromatized form of testosterone

(K. De Gendt, 2012).

A study showed that AR can bind to over 1200 genes and actively regulate them (C.E. Massie,

2011). These AR regulated genes are involved in cell cycle progression, metabolism, steroid biosynthesis etc. During early developmental stages, endodermal tissue from urogenital sinus and mesenchymal tissue surrounding it develop into rudimentary prostrate gland, in response to fetal androgens (G.R. Cunha, 2004). In adult presence of the AR in the prostatic epithelium helps maintain the controlled growth and inhibit the apoptosis. Many studies have also shown that AR signaling mediated interaction of prostatic stroma and epithelium plays a role in prostate cancer growth and progression (S. Wen, 2014). The circulating androgens are dehydroepiandrosterone- sulfate (DHEAS), dehydro-androstenedione (DHEA), androstenedione (A4), testosterone, and

DHT in women. DHEA, DHEAS, A4 are secreted by adrenal glands, while testosterone, DHEA and A4 are produced by ovaries. Testosterone, DHT and their metabolites are produced in peripheral tissues. These include brain, bone and breast. These circulating androgens at varied 27 concentration level are present in women, pre-menopausal or post-menopausal. (Pia Giovannelli,

2018). During mid-reproductive age in women, testosterone levels begin to decline while for post- menopausal women, there is a decline in levels of androstenedione and DHEA. All these is mainly because of the reduced ovary functionality. This in turn decreases estrogen and progesterone production and no impact on testosterone levels. Correlating BC and circulating androgens, high levels of circulating androgens increase the probability of BC risks and is mainly found in pre- menopausal women. However, there is no data to find a correlation between high level of other androgens and BC. For post-menopausal women, high levels of other androgens have higher BC risk impact.

CHAPTER 2

2. Materials and Methods

2.1. Cell Culture

Breast cancer cell lines MDA MB 231, BT549, T47D, MCF 7, HCC1806, were purchased from

ATCC. They were cultured and maintained in the recommended media at 37 °C with 0.5% CO2.

Cells were stimulated with 1ηM PDGF BB. To see whether PDGFβ phosphorylation plays role in the pathway, 5 mM of protein tyrosine kinase inhibitor AG1296 (Cayman – cat # 146535-11-7) was used (specified in the figures).

2.2. Transfection

To knock down p68, PDGFRβ, in MDA MB 231 and BT549 cells, si RNA p68 (Santa cruz sc-

37141) or si RNA PDGFRβ (ScBT- sc29442) respectively was transfected with 20–50 nM of siRNAs using Lipofectamine™ RNAiMAX Transfection Reagent kit from Thermo Fisher scientific. To overexpress PDGFRβ in MDA MB 231 and BT549 cells, 2.5 µg of PDGFRβ plasmid (Origene - RC206377) Lipofectamine™ 3000 Transfection Reagent kit from Thermo

Fisher scientific was used. After 48 hr. incubation cells were used for further procedure.

2.3. DHT – MTT

MDAMB 231, BT549 cells were either transfected with control siRNA or P68 siRNA, were treated with or without DHT 10 mM concentration for 24 hr. To analyze the cell proliferation these treated cells were incubated with Thiazolyl Blue Tetrazolium Bromide (MTT) (Millipore sigma Cat #

M5655) for 4 hr at 370C. The absorbance was measured at λ 595 after dissolving the violate crystals in DMSO. 29

2.4. Immunoblotting

The proteins were analyzed by immunoblotting probed with p68 (ScBT sc-126730),

PDGFRβ(Abclonal Cat # A2180)Phospho PDGFRβ SCBT Cat # Sc365465) Phospho EGFR

(Abclonal Cat # Ab 40815), FGFR (ScBT sc- 390423), N-Cadherin (Invitrogen Cat # 33-3900),

E-Cadherin (Biosciences Cat # 610404), Vimentin (Protein tech cat # 60330), Snail (Abcam cat #

Ab 17732), AR (Agilent Cat # M356201), β-Actin (Bioscientific- R15006MC4) antibodies, according to the manufacturer’s instructions.

2.5. Scratch Assay

MDA MB 231, BT549, cells were cultured into tissue culture plates and transfected with either

Control, p68 si RNA or co- transfected with sip68 RNA and over expressed PDGFRβ for 48 hr in presence of 10 nM PDGF BB. Multiple scratches were introduced in the cultured plates. The scratch treated cells were directly visualized under the microscope.

2.6. Boyden chamber assay

Permeable support, 24 well plate with 8.0 mm transparent PET membrane chambers were purchased from Life sciences and was used to measure the migration of MDA MB 231 and BT

549 cells. The test cells were first transfected with either control si RNA or si p68 RNA (Santa cruz, Cat # sc-37141) for 48 hr. in regular cell culture plates. The treated cells were re-suspended into optimum medium (without serum) and seeded into the PET membrane chamber. The DMEM culture medium with 10% FBS was added to the outer chambers. After 12 hr incubation, medium in the inner chamber was removed and the cells attached to the outer bottom side were fixed with 30 room temperature paraformaldehyde and stained with 0.5% crystal violet. The stained cells were imaged under the inverted microscope.

2.7. Immunohistochemistry

Deparaffinized, healthy breast and breast carcinoma sections were incubated in Lab Vision

Hydrogen peroxide block and blocked with Lab Vision Protein block reagent. Tissue sections were incubated with rabbit monoclonal antibody against p68 (1:500 dilution) for 1 hour at room temperature. This was followed by detection with the Horseradish Peroxidase- 3,3′-

Diaminobenzidine (DAB) system. Nuclear counterstaining was done using hematoxylin. PDGFR

β levels were quantified by staining intensity using imageJ software.

2.8. Immunofluorescence microscopy

The MDA MB 231 and BT 549 cells were transfected or pretreated in the normal culture dish

(treatments are specified in the figures). Once treatment was done, the cells were transferred on to poly lysine coated coverslips for overnight at 370C. After cells fixed in chilled 100% Acetone for

15 min and blocked with 1% goat serum at room temperature for 1 hr. These cells were incubated with PDGFRβ antibody in a humidified chamber for overnight at 1:200 concentrations and then washed in PBS. Anti-rabbit secondary antibody conjugated with Alexa-555 was used to label

PDGFRβ (1:2000 dilution). Nuclei were stained with Hoechst stain. Coverslips were mounted onto slides using Prolong-Gold antifade reagent (Invitrogen, Carlsbad). Images were taken with a fluorescence microscope (Keyence).

2.9. Real time PCR

RNA isolation was performed by generic Trizol-phenol chloroform protocol. The isolated RNA was quantified using Nanovue plus™ spectrophotometer (#28956057, Biochrom). cDNA was prepared using the Thermo scientific C-DNA kit. Real time PCR was performed using Luna

Universal qPCR master mix (M3003L, NEB Inc) according to the manufacturer’s instructions.

The primer sequences for DDX5 (F- GCCGACGTCAACGGGAAAGT, R-

CGTTGTCACGTGGCTGTACC), PDGFR β (F- CCCCTTTCTGGCCTGATGCTC, R-

TGATGTTCTCACCCTGGCGG), AR (F- GAAAGCGACTTCACCGCACC, R-

AGGAATCCCTCTCTGCTCGC), Vimentin (F-TCCGCACATTCGAGCAAAGA, R-

ATTCAAGTCTCAGCGGGCTC), N-cadherin (F-GCCAGAAAACTCCAGGGGAC, R-

TGGCCCAGTTACACGTATCC), Snail (F-GCTGCAGGACTCTAATCCAGA, R-

ATCTCCGGAGGTGGGATG), E- cadherin (F-TCATGAGTGTCCCCCGGTAT, R-

TCTTGAAGCGATTGCCCCAT), EGFR (F-GGCAGGAGTCATGGGAGAA, R-

GCGATGGACGGGATCTTAG), FGFR (F-ATGGCAACCTTGTCCCTG, R-

CAGCGCACCTCTAGCGAC), C-FOs (F- GTGTCCACCGCTGCCTTC, R-

GCCACCATTGCTGAAGGGATT) were designed using NCBI Blast. Quantitative PCR was done under the following thermocycler conditions: 95 °C for 2 min, and 40 cycles of 95 °C for

30s, 62 °C for 1 min, and 95 °C for 30s. Data was collected from 7500 Fast Real-Time PCR System

(Applied Biosystems) and analyzed using Excel.

2.10. Statistical analysis

To compare the two appropriate groups, the data sets were statistically analyzed. The P values were calculated using unpaired two-tailed Student’s t-test and anova test. In all figures and tables,

NS means P>0.05 and statistically insignificant, *P<0.05, **P<0.01, and ***P<0.001.

CHAPTER 3

3. RNA helicase DDX5 regulates Platelet derived growth factor beta (PDGFRβ) expression

3.1. RNA helicase p68 is highly expressed in breast cancer

RNA helicase p68 is a prototypic member of RNA helicase family having conserved DEAD box domain (Lane and Hoeffler 1980). Due to its RNA helicase, ATPase, and RNA unwinding activity, along with normal cellular functions like, pre-mRNA, rRNA, miRNA processing (Yang, Lin et al.

2006, Yang, Lin et al. 2007, Fuller-Pace 2013), its role in cell division, organ development and maturation is well documented (Stevenson, Hamilton et al. 1998.

Its high expression have been reported in colon caner (Singh, Haines et al. 1995) prostrate cancer

(Clark, Coulson et al. 2008, Nordby, Richardsen et al. 2017) etc. To check its expression in breast tissue samples, breast carcinoma tissue array was purchased from US biomax (cat # Br1201). The specimens were studied using Immunohistochemistry technique. High expression of RNA helicase p68 was observed in breast carcinoma tissues as compared to healthy breast tissues.

To gauge, if there is any impact of varying levels of p68 in breast cancer patients, the overall survival (OS) in breast cancer patients, was analyzed using publicly available data set (Nagy,

Lanczky et al. 2018). To check the correlation between p68 expression in survival rate of patients, the overall survival probability of patients who expressed high p68 was compared with patients who expressed low p68 levels. The comparison clearly indicated the inverse correlation as, the high expression of p68 resulted in lower overall survival and lower expression of p68 results in higher overall survival in patients (Figure 3.1B).

To check for the levels of p68 in breast carcinoma cell lines, we performed western blot analysis for p68 in T47D, MCF7, BT549, MDA-MB231, MDA-MB 468 and Hcc1806 cell lines. Strong 68

KD band was observed in all the cell lines, indicating high levels of total p68 protein (Figure 3.1C). 34

Altogether, our results suggest that p68 plays a critical role in breast cancer progression.

Figure 3.1 p68 RNA helicase is associated with low overall survival in breast cancer.

(A) Tissue micro array was purchased from US biomax (cat # Br1201), immunohistochemistry

staining of p68 in healthy breast and breast carcinoma tissues was performed. Strong

expression of p68 was detected in breast carcinoma (right panel), as compared to healthy

breast tissue (left panel). B. Overall survival probability in group of 1089 breast cancer

patients. Note that higher expression of p68 (red line graph) corresponds to lower probability

of overall survival, whereas low expression of the p68 (black line graph) correlates to higher

overall patient survival in breast cancer. C, Western blot analysis shows the p68 protein levels

in T47D, MCF7, BT549, MDA-MB 231, MDA-MB 468, HCC1806 breast carcinoma cell

lines.

3.2. RNA helicase p68 affects cell migration

3.2.1. Effect of p68 knockdown through scratch assay

Cancer cell migration is an important phenomenon in cancer metastasis. It has been observed that phosphorylated RNA helicase p68 through PDGF signaling promote β-catenin translocation to nucleus, to up regulate EMT genes, resulting in cell migration in colon carcinoma (Wang, Gao et al. 2013). To check whether p68 also plays role in breast cancer migration, p68 was knocked down in MDA-MB231 and BT549 cells using sip68 RNA. To compare the effect of p68 knockdown si control RNA treated MDA-MB231 and BT549 cells were used as control. Multiple scratches were introduced in the plates and the scratched area were observed for 24 hr. The relative percentage migration was calculated. In both the cell lines cell migration was reduced significantly.

Figure 3.2 Loss of RNA helicase p68 inhibits well migration

(A) RNA helicase p68 was knocked down using 2nM of sipi68 RNA in MDA-MB-231 and BT549.

Scratch assay was performed to compare the cell migration within cells treated with control si

RNA and cells treated with sip68 RNA. Scratch assay creates a wound or a gap in the growing

confluent cell monolayer, following which a pattern of cell migration can be observed. 231

and 549 cells migrate as loosely connected population. It was observed that the cells with down

regulated expression of endogenous p68 show poor rate of migration as compared to control

cells with normal p68 expression.

(B) Quantification of the relative migration was plotted. MDA-MB-231 cells were observed to

show more significant effect on migration following p68 silencing compared to BT549 cells.

The results represent findings of three independent experiments. Error bars represent mean ±

S.E.M. **P<0.01, ****P<0.0001, ns denotes non-significant by unpaired Student’s t-test.

3.2.2. Cell invasion is affected upon 68 knockdown

Another way of checking cell migration is using trans well chambers. In trans well chambers, cells are there are two chambers, inner and outer. These chambers are separated by a polyethylene terephthalate (PET) membrane with small pores (8 µm). Cells are seeded on the PET membrane in inner chambers with basic cell culture media and the chamber is placed in the outer chamber.

The outer chamber has media with cell migration stimulation.

To check whether p68 also plays role in breast cancer migration, p68 was knocked down in MDA-

MB231 and BT549 cells using sip68 RNA. To compare the effect of p68 knockdown si control

RNA treaded MDA-MB231 and BT549 cells were used as control. These cells were re seeded in the inner chamber of trans well chamber with basic cell culture media. In the outer chamber, media with PDGF BB at 5 nM concentration was added as migration stimulation. The cells migrated in the outer chamber were stained with 0.5% crystal violate and observed under inverted microscope.

The relative percentage migration was calculated. In both the cell lines, cell migration was reduced significantly after p68 knockdown.

B A

Figure 3.3 Cell Migration upon p68 knock down.

(A) Cell migration assay was performed using transwel chambers, with set of breast cancer cells

MDA-MB-231 and BT549 cells. This invasion assay analyzes rate of migration after exposure

to a chemotactic agent. The invasive cells are stained using 0.5% crystal violate and counted

with a light microscope under high magnification objective lens, with three individual fields

per insert. It was observed that the p68 silenced MDA-MB-231 cells had low migration

propensity compared to the control cells. A similar observation was made for the BT549 cells.

This trans-well migration result points out that cells need expression of p68 for achieving

optimum migration across a membrane.

(B) Quantification graph of the Boyden chamber assay was plotted depicting significant reduction

in migration rate in cells treated with p68 siRNA. The results represent findings of three

independent experiments. Error bars represent mean ± S.E.M. **P<0.01, ****P<0.0001, ns

denotes non-significant by unpaired Student’s t-test.

3.2.3. P68 knockdown changes EMT marker profile

Upon migration signal, stationary epithelial like cells trance-differentiate into mesenchymal like cells. Stationary cells loose their apical basal polarity, undergo a change in the signaling cascade and reorganize their cytoskeleton, that defines cell shape and reprograms gene expression. All these changes, prepare the cell for migration. These epithelial to mesenchymal (EMT) changes in the cells have significance in several biological processes like embryonic and post-embryonic development, tissue regeneration, wound healing, stem cell homeostasis, and in pathophysiology of fibrosis and malignancies. During EMT, cells express typical protein expression pattern. These proteins are called as EMT markers, which include high expression of Vimentin, N- cadherin, snail, decrease levels of E- cadherin expression etc.

To validate p68 play role in EMT, P68 was knocked down using si p68 RNA in MDAMB231 and

BT549 cells and mRNA levels were measured quantitative RT-PCR. Upon p68 knock down mRNA levels for vimentin, N-cadherin and snail went down significantly whereas expression of

E-cadherin increase 3.5 folds. Same pattern could be seen through western blot analysis of protein expression of these proteins. Indicating p68 knockdown decreases migration and EMT in breast cancer cells upon PDGF-BB stimulation.

A B

Figure 3.4 Changes in EMT markers after p68 knock down

(A) Real time PCR expression of mRNA was performed in the MDA-MB-231 and BT549 human

breast cancer cell lines. The relative expression for classical Epithelial–mesenchymal transition

markers such as vimentin, N-cadherin, SNAIL, E-cadherin were checked. The two conditions

of the experiment were p68 siRNA treated cells and control cells.

(B) Western blot for the same markers was carried out in identical cell treatment conditions The

results represent findings of three independent experiments. Error bars represent mean ±

S.E.M. **P<0.01, ****P<0.0001, ns denotes non-significant by unpaired Student’s t-test.

3.3. RNA helicase p68 regulates PDGFRβ

Our results showed that knocking down of p68 decrease cell migration and invasiveness in the

PDGF BB stimulated breast cancer cells. Upon ligand (PDGF-BB) binding platelet derived growth factor beta (PDGFRβ) promote cell migration (Yu, Moon et al. 2001) via Erk phosphorylation.

Previous reports have shown PDGFRβ overexpression correlates with invasiveness of breast cancer (Jechlinger, Sommer et al. 2006). Therefore, the levels of phospho- PDGFRβphospho

Erk and Erk were explored in p68 knocked down MDA MB 231 and BT549 cells and compared with control MDA MB 231 and BT549 cells, in presence of PDGF BB stimulation. In p68 knocked down cells phospho- PDGFRβ and phosphor- Erk were down as compared to control cells. But

Erk levels did not changed. Surprisingly, PDGFRβ levels were also significantly decreased in p68 knocked down cells.

To check whether knockdown of p68 also deplete other receptors tyrosine kinases (RTK) levels, protein levels of epithelial growth factor receptor (EGFR), which is a member of RTK family protein, were also checked, upon p68 knocked down. But protein levels of EGFR did not change when p68 was knocked down, as compared to control cells. Similarly, phosphor EGFR levels, were also stayed the same. This data clearly indicated that p68 regulates PDGFRβ levels in breast cancer cell line. 43

Figure 3.5 Effect of p68 knock down in PDGFRβ, EGFR, Erk and phospho- PDGFRβ , Phospho-

EGFR, phosphor Erk levels in MDA MB 231 and BT549 cells.

(A) Western blot analysis for p-PDGFRβ, p-PDGFRβ and pERK ½ (IB:ERK1/2), showed

decreased levels of p-PDGFRβ and pERK upon p68 siRNA treatment as compared to control

in MDA-MB231 cells. The levels for EGFR and p-EGFR did not show any change in their

expression levels. But receptor PDGFRβ, levels wend down significantly in the p68 knocked

down cells as compared to control cells.

(B) The similar pattern of protein expression change was observed in BT549 cells as well.

3.3.1. RNA helicase p68 regulates PDFRβ but not other receptor tyrosine kinases (RTKs)

As p68 was knockdown in breast cancer cells PDGFRβ levels also went down. To check whether this is true for other RTKs as well, western blot for EGFR and FGFR was analyzed. In both the cell lines, upon p68 knock down, only decrease in PDGFRβ protein levels were observed but

EGFR and FGFR protein levels stayed the same.

To check the mRNA levels upon p68 knock down, in these cells, RT PCR analysis for PDGFRβ,

EGFR and FGFR was performed. The mRNA level change of EGFR and FGFR after p68 knock down was non significant. But on the other hand, the mRNA levels of PDGFRβ after p68 knockdown were decreased by 10 folds confirming our finding that p68 regulates cell migration through PDGFRβ regulation.

A B

Figure 3.6 Levels of receptor tyrosine kinases upon p68 knock down

(A) Western blotting for various growth factor receptors was carried out under the p68 siRNA

treatment condition. The receptors checked were PDGFRβ, EGFR, FGFR. It was observed that

the p68 knockdown results in lower PDGFRβ protein expression but there’s no change

observed for the rest of the growth factor receptors. This implies that the p68 knockdown

mediates the down regulation of PDGFRβ expression.

(B) Relative mRNA expression was measured by real time PCR for the same treatment conditions.

The same trend was observed for the p68 knockdown treatment in which the PDGFRβ

expression was lowered significantly

3.3.2. PDGFRβ overexpression rescues reduced cell migration after p68 knockdown

Our data has shown that under PDGF BB stimulation, RNA helicase p68 promote cell migration in breast cancer cell lines and removing p68 from these cells will decrease the migration of these cells. Also PDGFRβ promote cell migration upon PDGF BB stimulation. But p68 knockdown will result in PDGFRβ depletion. So here we are hypothesizing that p68 affects cell migration by regulating PDGFRβ levels. In other words, overexpression of PDGFRβ after p68 knockdown should rescue the cell migration.

So to check our hypothesis, p68 was knocked down in MDA MB 231 and BT549 cells, using sip68

RNA. In one set of cells, PDGFRβ was overexpressed while p68 is knocked down. The wound healing assay was performed by introducing multiple scratches in the the dish. The cells were stimulated with 5 nM PDGF BB and were allowed to migrate in the wounded area for 24 hr. The fold change in cell migration was calculated by observing the scratches under the microscope and counting the migrated cells. The cell migration was reduced upon p68 knocked down as compared to the control cells. But when PDGFRβ was overexpressed while p68 was knocked down the cell migration came back to normal.

This confirmed our hypothesis that p68 affects cell migration by regulating PDGFRβ levels.

A B C

Figure 3.7 Cell migration assay under p68 knockdown with or without PDGFRβ

overexpression

(A) This panel shows the scratch assay performed with cells treated under p68

siRNA, p68 knockdown and PDGFRβ overexpression. The high migratory index was observed

with control cells and cells treated with p68 siRNA and PDGFRβ overexpression. This

indicates not p68 directly but presence of PDGFRβ in the cells is what facilitates the migratory

signaling.

(B) Quantification of MDA-MB-231 cells under the above-mentioned treatment conditions.

3.3.3.Cell morphology upon p68 knockdown and PDGFRβ over expression

Upon migration signal, to prepare the cell for migration, cells undergo lot of morphological changes. For example, stationary cells loose their apical basal polarity, undergo a change in the signaling cascade and reorganize their cytoskeleton, that gives them typical spindle shape. On the other hand, when migratory or mesenchymal cells adopts epithelial nature they loose their spindle shape, starts to cluster together.

MAD MB 231 cells are highly metastatic breast cancer cells. They are mesenchymal in nature, showing spindle shape fibroblast like morphology. But when p68 was knocked down they lost their elongated spindle shape and started to cluster together like epithelial cells. Indicating less migratory nature. But when PDGFRβ was over expressed when p68 was knocked down, cells still retained their elongated spindle shape. Cells were not clustered together, indicating their migratory nature.

Figure 3.8 Cell morphology of MDA MB 231 cells upon p68 knockdown with and without

PDGFRβ overexpression.

Cell morphology of MDA-MB-231 cells was observed under various treatments of control, p68 knockdown by siRNA and silencing p68 and overexpression of PDGFRβ. The cells having p68 knocked down showed more epithelial nature. They were lost their spindle shaped nature and clustered together. But cells PDGFRβ over expression maintained their mesenchymal nature even though p68 was knocked down.

3.3.4.Changes in EMT markers upon p68 knockdown and PDGFRβ overexpression

Upon migration stimuli, stationary cells undergo epithelial to mesenchymal transition (EMT).

These transition is result of cascade of signaling, which result in change in cell’s protein profile.

In order to be motile cells need to increase express of proteins which support morphology change that enable the cell towards motile nature. Such changes include high expression of Vimentin, N- cadherin, snail, decrease levels of E- cadherin expression etc. which leads to loosing their apical basal polarity and achieving elongated spindle shape, mesenchymal nature. Where as when mesenchymal cells undergo mesenchymal to epithelial transition (MET) the reverse changes could be seen.

To see the effect of p68 and PDGFRβ knockdown and PDGFRβ over expression with or without p68 knockdown, MDA MB 231 and BT549 cells, p68 was knocked down by transfecting 2nM si p68 RNA, PDGFRβ was knocked down using 2nM si PDGFR β RNA, with the help of RNA imax kit. PDGFRβ was overexpressed by transfecting PDGFR β plasmid, using Lipofectamine 3000 kit. To knock down p68 and overexpressed PDGFRβ simultaneously co-transfection of si p68

RNA and PDGFR β plasmid was carried out.

The wound healing assay was performed by introducing the multiple scratches in the plate. Cells were allowed to migrate under PDGF BB stimulation (5 µΜ) for 24 hr. After 24 hr. cells were observed under microscope and cell migration was analyzed by measuring the remaining size of the wound. When p68 and down PDGFR β were knocked down, cell migration went down by 2 folds (Fig 3.9A 2nd and 3rd column), But when PDGFR β was overexpressed while p68 was knocked down (4th column), the cell migration fold change was comparable to the control cells, but it was significantly less as compared to the cells in which only PDGRβ was over expressed

(5th column). 51

To check the EMT marker profile western blot analysis of snail, vimentin, E-cadherin was performed. When p68 and PDGFR β were knocked down, snail and vimentin protein levels went down significantly while E-cadherin levels increased (Fig 3.9 B, 3rd, 4th and 2nd line respectively,

2nd and 5th column). Indicating epithelial nature increasing. When PDGFR β was overexpressed

(Fig 3.9 B, 4th column), the snail and vimentin levels also increased (Fig 3.9 B, 3rd and 4th line).

While E-cadherin went down (2nd line), indicating mesenchymal nature increasing. When

PDGFRβ was overexpressed while p68 was knocked down (Fig 3.9 B, 3rd column), the snail and vimentin levels increased (Fig 3.9 B, 3rd and 4th line). While e-cadherin went down (2nd line), indicating mesenchymal nature restored by PDGFR β overexpression. The results were similar in the BT549 cells as well.

Figure 3.9 Effect of p68 knocked down can be restored by PDGFRβ overexpression

(A) Scratch assay was performed for MDA-MB-231 cells under p68 knockdown, PDGFRβ

knockdown, PDGFRβ overexpression conditions. The cells with only overexpressed PDGFRβ

show more migration than control cells. The cells with silenced p68 and double treatment of

PDGFRβ siRNA and PDGFRβ overexpression have significantly lesser migration with respect

to control cells.

(B) Western blot analysis for a panel of EMT markers in the same treatment conditions showed

decreased snail and vimentin when p68 and PDGFRβ was knocked down, while E-cadherin

went up. Increase in snail and vimentin was observed when PDGFRβ was overexpressed while

E-cadherin went down. But wahe p68 was knocked down while PDGFRβ was over expressed,

the expression of snail and vimentin increased and expression of E cadherin decreased.

3.3.5.PDGFRβ responsive genes get downregulated when p68 is knocked down

PDGFRβ regulates cFOS expressing in breast cancer cells. c-Fos is involved in the signal transduction cascade of extracellular signals and regulation of transcription. In pathological conditions, c-Fos has been implicated in induction of epithelial-mesenchymal transition in cells which leads to metastatic growth in cancerous epithelial cells.

Our observation showed that once p68 is knocked down, expression of PDGFRβ also goes down.

Based on our hypothesis, p68 regulates PDGFRβ expressing upon PDGF BB stimulation. If p68 is knocked down, then PDGFRβ responsive gene should also go down.

To check this hypothesis, the levels of c-FOS, a PDGFRβ responsive gene were measured upon p68 knockdown. The mRNA levels of c-FOS were consistently decreased in MDAMB231 and

BT549 cells upon p68 knockdown. 54

Figure 3.10 mRNA expression of PDGFR β responsive gene cFOS upon p68 knock down

Relative mRNA expression of c-Fos was checked for MD-MB-231 BT549 cells. The p68 knockdown cells have 2.5-fold lower c-Fos expression.

CHAPTER 4

4. RNA helicase DDX5 regulates androgen receptor (AR) expression

Androgen receptor (AR) is widely expressed in breast cancer and is associated with poor prognosis

(Moinfar, Okcu et al. 2003) Activation of AR through di hydrotestosterone (DHT) promotes cell proliferation in prostrate cancer cells and breast cancer cells (Hackenberg, Hofmann et al. 1988,

Lin, Sun et al. 2009) It has been shown that P68 RNA helicase acts as an AR transcriptional coactivator.

Previous reports from our lab have shown that p68 RNA helicase phosphorylation plays an important role in PDGF-BB induced cell proliferation via up regulation of cyclin D1 and c-Myc

(Yang, Lin et al. 2007). And in our study, we noted that there was an increase in cell growth rate upon DHT treatment in PDGF-BB stimulated breast cancer cells. However, there was no effect on the cell growth rate upon DHT treatment in cells knocked-down with p68. Therefore, we sought to investigate whether p68 and PDGFR β co-regulate AR expression in breast cancer cells

4.1. Upon RNA helicase p68 knockdown, Androgen receptor (AR) expression is down

regulated

As previously reported, AR promotes cell proliferation in breast cancer cells we tested proliferation in MDA MB 231 and BT 549 cells by stimulating DHT. DHT stimulated cells promote cell proliferation was observed. Our lab previously elucidated that p68 RNA helicase phosphorylation plays an important role in PDGF-BB induced cell proliferation via upregulation of cyclin D1 and c-Myc (Yang, Lin et al. 2007). So, to check if p68 knockdown have any effect on AR protein expression and mRNA levels, p68 was knocked down in in both MDA MB231 and

BT549 cells using sip68 RNA under PDGF BB stimulation. The AR protein levels were compared using western blotting in presence or absence of p68. Surprisingly expression of AR was decreased under p68 knocked down condition as compared to the control (A). mRNA levels of AR were compared by RT PCR when p68 was knocked down vs control cells.

The mRNA levels were decrease when p68 was knocked down (B).

In our study, as we observed an increase in cell growth rate upon DHT treatment in PDGF-BB stimulated breast cancer cells. However, there was no effect on the cell growth rate upon DHT treatment in cells knocked-down with p68. To test this finding, we performed cell proliferation assay using a commercially available BrDU kit. BrDU assay demonstrated that proliferation in

PDGF-BB stimulated MDAMB231 and BT549 cells significantly increased upon DHT treatment when compared to the control. However, cell proliferation was inhibited upon DHT treatment under p68 knockdown condition in both MDAMB231 and BT549 cells (C).

Figure 4.1 Androgen receptor (AR) in MDA-MB 231 and BT549 cells and effect of di hydro testosterone (DHT) treatment on cell proliferation while p68 is knock down.

(A) To check whether knock down of p68 affects androgen receptor protein levels, p68 was knocked down using 2 mM sip68 RNA from MDA-MB 231 and BT549 cells. Levels of p68 and androgen receptor were analyzed with western blot for AR showing Knocking down p68 resulted in reduced androgen receptor levels as well. The pattern is maintained in MDA-MB 231 and

BT549 cells.

(B) To check whether p68 affects androgen receptors at Translational level or transcriptional level, relative mRNA levels of AR gene (AR mRAN: b Actin mRNA ratios) in MDA MB 231 and BT549 cells were calculated by quantitative PCR. To compare 2mM sicontrol RNA was used as control.

(C) Di hydro testosterone (DHT) is the stimulation for androgen receptor. Stimulating androgen receptors with DHT stimulates cell proliferation. So, percent change in cell proliferation, with or without DHT stimulation in with or without p68 knocked down was analyzed by MTT assay. In the control si RNA treated cells the cell proliferation increased significantly upon DHT treatment. 58

When p68 was knocked down, even with the DHT treatment the cell proliferation did not increase significantly.

4.2. PDGFRβ regulates AR expression in breast cancer cells

Our result suggested that upon p68 knockdown AR levels were decreased and therefore upon treatment with DHT, there was no effect on the cell proliferation. PDGFRβ has also been shown to control AR levels. Therefore, to further investigated AR expression upon PDGFRβ knockdown in breast cancer cells, PDGFRβ was knocked down using siPDGFRβ RNA. Intriguingly, significant reduction in the AR protein (A) and mRNA levels (B) was observed upon PDGFRβ knockdown, in both MDA MB 231 and BT549 cells. Similarly, cell proliferation was significantly inhibited in cells knocked-down with PDGFR β upon DHT treatment (C), suggesting that both p68 and PDGFRβ independently regulate AR expression in breast cancer cells.

Figure 4.2 . PDGFR β regulates AR expression and mediates the effect of DHT in proliferation of breast cancer cells

(A) Immunoblot analysis of AR in PDGF-BB stimulated MDAMB231 and BT549 cells upon

PDGFRβ knockdown. Knockdown efficiency of PDGFRβ (IB: PDGFR β) was analyzed by

immunoblot. β-actin (IB: β-actin) is the loading control. AR protein expression was

significantly reduced upon PDGFRβ knockdown in both the cell lines.

(B) Relative mRNA levels of AR were measured using RT PCR, upon PDGFRβ knock down using

2 nM of siPDGFRβ RNA. mRNA levels of AR were significantly reduced upon PDGFRβ

knockdown in both the cell lines.

(1 nM for 24 h) upon PDGFRβ knock down were compared with the control. The cell

proliferation, upon DHT treatment, in the PDGFRβ knocked down cells did not show

significant difference. Whereas the cell proliferation, upon DHT treatment, in the control si

RNA treaded cells, show significant increase. The experiments were performed in triplicate.

Error bars represent mean ± S.E.M. **P<0.01, ***P<0.001, ns denotes non significant by

unpaired Student’s t-test. 61

4.3. AR expression is co regulated by RNA helicase p68 and PDGFRβ in breast cancer cell

lines

Since our Previous findings indicated that p68 regulates PDGFRβ expression, we sought to further investigate whether overexpression of PDGFRβ in p68 knocked-down cells would alter the levels of AR.

Therefore, PDGFRβ was overexpressed in p68 knocked-down breast cancer cells. Interestingly, transient overexpression of PDGFRβ restored AR protein (A) and mRNA levels of AR (B) in breast cancer cells knocked-down with p68, suggesting that p68-PDGFRβ axis regulates AR expression. Cells transfected with control siRNA, PDGFRβ plasmid, and PDGFRβ siRNA were used as controls. Cell proliferation assay further corroborated our finding that overexpression of

PDGFRβ in p68 knocked-down MDAMB231 and BT549 cells resulted in an increase in cell proliferation upon DHT treatment (Fig 4.3 C & D). Taken together, our data indicate that p68 and

PDGFRβ co-regulate AR levels and mediate androgen dependent proliferation in breast cancer cells.

Figure 4.3 p68 regulates androgen receptor expression through PDGFRβ

(A) In MDA MB 231 and BT549 cells, p68 was knocked down by transfecting 2nM si p68 RNA,

PDGFRβwas knocked down using 2nM si PDGFRβ RNA, with the help of RNA imax kit.

PDGFRβ was overexpressed by transfecting PDGFRβ plasmid, using Lipofectamine 3000 kit.

To knock down p68 and overexpressed PDGFRβ simultaneously co-transfection of si p68

RNA and PDGFRβ plasmid was carried out. When p68 was knocked down PDGFRβ and AR

protein levels went down significantly (A,1st and 3rd line, 2nd column). When PDGFRβ was 63

overexpressed, the AR levels also increased (A,1st and 3rd line, 4th column). When PDGFRβ

was knocked down, the AR levels decreased (A,1st and 3rd line, 5th column).. But when

PDGFRβ was overexpressed while p68 was knocked down, the AR levels went back up (A,1st

and 3rd line, 3rd column). The results were similar in the BT549 cells as well.

(B) To check whether p68 knockdown will affect the transcription of AR, RNA were isolated from

MDA MB 231 and BT549 cells, in which either p68 or PDGFRβ was knocked down with

sip68 or siPDGFRβ RNA or PDGFRβ was overexpressed by transfecting PDGFRβ plasmid,

or p68 was knocked down and PDGFRβ was overexpressed simultaneously. In p68 and

PDGFRΒ b knocked down cells AR mRNA levels went down significantly. In overexpressed

PDGFRβ cells, AR levels increased significantly. While in the cells which had p68 knocked

down and PDGFRβ overexpressed the mRNA of AR were comparable to control cells.

check how cell proliferation is affected after p68 knockdown, p68 was knocked down with

sip68 or siPDGFRβ RNA or PDGFRβ was overexpressed by transfecting PDGFRβ plasmid,

or p68 was knocked down and PDGFRΒ b was overexpressed simultaneously in MDA MB

231 and BT549 cells. In the control cells as well as PDGFRβ overexpressed cells, cell

proliferation was increased upon DHT treatment, while in p68 knocked down cells cell

proliferation was not significant. This effect of p68 knocking down on cell proliferation could

be successfully rescued by overexpressing the PDGFRβ.

4.4. Nuclear PDGFRβ regulates AR expression in breast cancer cells.

To evaluate the mechanism by which PDGFRβ regulates AR expression in breast cancer cells, we examined the levels of PDGFRβ in MDAMB231 cells upon PDGF-BB stimulation and compared them with the control. Upon PDGF-BB stimulation, we observed high PDGFRβ levels in the nucleus of the cells (A), which validates the observation by Papadopoulos et al. In their study, they demonstrated that PDGFRβ in response to PDGF-BB stimulation translocates to the nucleus and controls proliferation. In addition, PDGFRβ kinase activity is not essential for nuclear accumulation of PDGFRβ(Papadopoulos, Lennartsson et al. 2018). To further validate it, we examined PDGFRβ levels in the nucleus upon addition of phospho-PDGFRβ inhibitor, AG1296.

In response to PDGF-BB stimulation, no change in the nuclear PDGFRβ levels were observed upon AG1296 treatment (A & B). Taken together, our results indicate that nuclear PDGFRβ regulates AR expression in breast cancer cells.

Figure 4.4 p68 regulates expression of PDGFRβ but not the nuclear translocation.

A) Platelet derived growth factor, upon ligand stimulation goes in to the nucleus and act as

transcription factor. When MDA-MB231 cells were stimulated with PDGF BB the PDGFRβ

translocated in to the nucleus (top control panel). To check if phosphorylation of PDGFRβ is

necessary for getting it translocated in the nucleus, cells were treated with PDGFRβ inhibitor

AG1296 at 5 nM concentration for 24 hr. PDGF BB stimulated cells were compared to the

cells which did not receive PDGF BB stimulation. It was observed that, even upon PDGF BB

stimulation, PDGFRβ translocated to nucleus in the cells treated with AG1296.

B) The PDGFRβ translocation in the nucleus upon PDGF BB treatment under control vs

PDGFRβ kinase inhibitor AG1296 was measured at different time point. In both the

conditions, PDGFRβ translocation was highest at 30 min time point after PDGF BB

stimulation.

C) In MDA MB 231 cells, PDGFRβ was knocked down (5th column), stimulated by PDGF BB

10 M, (2nd and 3rd column), treaded with PDGFRβ inhibitor AG 1296 at 10 nM for 24 hr 66

(3rd and 4th column) and phosphor PDGFRβ, p68 AR levels were checked with immunoblotting. The phospo PDGFRβand AR levels were increased as cells were stimulated by PDGF BB (Line 1, Column 2 and 3). In the cells treated with PDGFRβ phosphorylation inhibitor, phospho- PDGFRβlevels were decreased. But AR levels remained unchanged, indicating, phosphorylation of the PDGFRβ is not necessary for the regulation of the expression of AR (column 4) But when PDGFRβ was knocked down

(column 5) both phosphor – PDGFRβ and AR levels went down.

CHAPTER 5

5. Discussion

P68 RNA helicase aberrant expression is associated with recurrence free survival and breast cancer progression (Paulsson, Sjoblom et al. 2009). We have previously reported that p68 promotes cell migration and proliferation via Wnt/β−catenin signaling pathway (Yang, Lin et al. 2006). Nuclear

β-catenin plays important role in Wnt signaling pathway, which can trigger cell proliferation, differentiation, and migration (Nelson and Nusse, 2004). Our previous report suggests that the cytoplasmic β−catenin can be translocated to nucleus via Wnt- independent pathway(Yang, Lin et al. 2006). β-catenin is present in the cytoplasm in the complex of GSK-3β and Axin. Axin is an important protein factor that negatively regulates β-catenin nuclear translocation. It was shown that Axin acts as scaffolding protein for cytoplasmic β-catenin (Tolwinski and Wieschaus, 2004)

In order to translocate cytoplasmic β-catenin in the nucleus, it has to be separated from the complex. Upon PDGF stimulation, C-abl kinase gets activated through src and trans located to nucleus, which in turn phosphorylates nuclear p68 (Yang, Lin et al. 2006). This phosphorylated p68 translocates to cytoplasm and binds with β -catenin. This interaction releases β -catenin from

GSK 3 b. In order to release β -catenin from axin, ATPase activity of p68 is necessary (Yang, Lin et al. 2006). β –catenin upregulates EMT markers in the nucleus. Thus p68 –PDGFRβ axis plays a very important role in EMT.

In this study, we report that p68 regulates transcription of the growth factor receptor, PDGFRβ in response to PDGF-BB stimulation, and thereby enhances migration of breast cancer cells. Previous report from our lab demonstrated the role of p68 in mediating PDGF-BB induced EMT. Here, we further elucidate that PDGFRβ expression is in turn regulated by p68 to maintain a positive feedback loop in breast cancer cells. Our results indicate that p68 knock down decreases EMT, 68 however, transient overexpression of PDGFRβ in breast cancer cells with p68 knockdown restores migration.

The molecular mechanism by which ligand activation results in transcriptional repression of PDGFRβ is intriguing. P68 RNA helicase regulates the transcription of numerous genes, including Snail 1 (Carter, Lin et al. 2010), androgen receptor (AR) (Clark, Fuller-Pace et al. 2008).

It has also been reported that p68 interacts with histone deacetylase 1, RNA polymerase II holoenzyme, and p300/CBP, suggesting its function in transcription (Nakajima, Uchida et al. 1997,

Wilson, Bates et al. 2004). We speculate that p68 interacts with PDGFRβ and therefore regulates its transcription. Our future work will explore whether p68 directly interacts with PDGFR β or indirectly regulates its expression. In addition, the involvement of phosphorylated or unphosphorylated p68 RNA helicase in mediating transcriptional expression of PDGFRβ needs to be investigated.

P68 RNA helicase has been demonstrated as the co-activator of AR (Clark, Fuller-Pace et al. 2008), which is highly expressed in invasive breast cancer and prostate cancer. A recent report highlights the androgen-mediated invasiveness of triple negative breast cancer (TNBC) through

AR/Src/PI3-K complex (Giovannelli, Di Donato et al. 2019). Androgen-induced proliferation via androgen receptor has also been well documented, which altogether leads to breast cancer progression. Additionally, PDGFRβ has been shown to control AR expression (Cuenca-Lopez,

Montero et al. 2014). Because p68 decreases the levels of AR, we believe it would be interesting to investigate if the regulation of AR is through p68-PDGFRβ axis. Interestingly, transient overexpression of PDGFRβ in cells knocked-down with p68 restored AR expression levels. In addition, PDGFRβ knockdown also dramatically reduced the levels of AR. Our results clearly 69 demonstrate that AR is co-regulated by both p68 and PDGFRβ, which mediates androgen-induced proliferation in PDGF-BB stimulated breast cancer cells.

Recent evidence suggests that the nuclear translocation of PDGFRβ upon ligand stimulation controls proliferation. The PDGFRβ dimerizes in response to PDGF-BB stimuli and translocates in a clathrin-dependent like manner (Papadopoulos, Lennartsson et al. 2018).

PDGFRβ regulation in the nucleus and the specific regulatory events it catalyzes that are important for modulation of gene transcription is uncharted territory. Here, in our study we show that nuclear translocation of PDGFRβ mediates transcriptional expression of AR. Because PDGFRβ kinase activity is not essential for the nuclear accumulation of PDGFRΒ- β (Papadopoulos, Lennartsson et al. 2018), we found that the addition of a kinase inhibitor had no effect on the AR expression levels. Taken together, our data suggests that p68-nuclear PDGFRβaxis regulates AR transcription.

To our knowledge, this is the first report to determine the role of p68 in receptor tyrosine kinase expression and the role of PDGFRβ in AR expression, suggesting p68-PDGFRβ axis in AR regulation. PDGFRΒ- β and AR inhibition are considered to be one of the promising approaches for cancer therapy. However, both PDGFRβ and AR inhibitors have not been successful in the clinic so far. Deeper insights into the regulation of transcriptional activity of PDGFRβ through p68 and AR through p68-PDGFRβ axis may help in therapeutic interventions. We believe this area is an important aspect for future exploration in light of dysregulated receptor tyrosine kinase and p68 and AR overexpression in invasive breast cancer.

PDGFRβ promotes EMT and cell migration in breast cancer cells. Nuclear interaction of PDGFRβ controls cell proliferation by chromatin remodeling (Papadopoulos, Lennartsson et al. 2018). P68

RNA helicase has important role in tissue and organ developmental processes, including 70 embryogenesis (Seufert et al., 2000), early organ maturation (Stevenson et al., 1998), and wound healing (Kahlina et al., 2004). In our study we are reporting that, upon PDGF-BB treatment, p68 regulate PDGFRβ transcriptionally. This finding reveals that nuclear p68 regulates PDGFRβ transcriptionally and thus EMT certainly provides a cellular and molecular basis for the developmental role(s) of the protein.

6. References

1. Betsholtz, C. (2004). "Insight into the physiological functions of PDGF through genetic studies in mice." Cytokine Growth Factor Rev 15(4): 215-228.

2. Bonner, J. C. (2004). "Regulation of PDGF and its receptors in fibrotic diseases." Cytokine

Growth Factor Rev 15(4): 255-273.

3. Carter, C. L., et al. (2010). "Phosphorylated p68 RNA helicase activates Snail1 transcription by promoting HDAC1 dissociation from the Snail1 promoter." Oncogene 29(39):

5427-5436.

4. Chen, P. H., et al. (2013). "Platelet-derived growth factors and their receptors: structural and functional perspectives." Biochim Biophys Acta 1834(10): 2176-2186.

5. Clark, E. L., et al. (2008). "The RNA helicase p68 is a novel androgen receptor coactivator involved in splicing and is overexpressed in prostate cancer." Cancer Res 68(19): 7938-7946.

6. Clark, E. L., et al. (2008). "Coupling transcription to RNA processing via the p68 DEAD box RNA helicase androgen receptor co-activator in prostate cancer." Biochem Soc Trans 36(Pt

3): 546-547.

7. Clark, E. L., et al. (2013). "p68/DdX5 supports beta-catenin & RNAP II during androgen receptor mediated transcription in prostate cancer." PLoS One 8(1): e54150.

8. Cuenca-Lopez, M. D., et al. (2014). "Phospho-kinase profile of triple negative breast cancer and androgen receptor signaling." BMC Cancer 14: 302.

9. Fujino, S., et al. (2018). "Plateletderived growth factor receptorbeta gene expression relates to recurrence in colorectal cancer." Oncol Rep 39(5): 2178-2184.

10. Fuller-Pace, F. V. (2013). "DEAD box RNA helicase functions in cancer." RNA biology

10(1): 121-132. 72

11. Giovannelli, P., et al. (2019). "Androgens Induce Invasiveness of Triple Negative Breast

Cancer Cells Through AR/Src/PI3-K Complex Assembly." Scientific Reports 9(1): 4490.

12. Guha, A. (1991). "Platelet-derived growth factor: a general review with emphasis on astrocytomas." Pediatr Neurosurg 17(1): 14-20.

13. Hackenberg, R., et al. (1988). "Stimulatory effects of androgen and antiandrogen on the in vitro proliferation of human mammary carcinoma cells." J Cancer Res Clin Oncol 114(6): 593-

601.

14. Haines, G. K., et al. (1996). "Expression of the double-stranded RNA-dependent protein kinase (p68) in human breast tissues." Tumour Biol 17(1): 5-12.

15. Hashemi, V., et al. (2019). "The role of DEAD-box RNA helicase p68 (DDX5) in the development and treatment of breast cancer." J Cell Physiol 234(5): 5478-5487.

16. Hirling, H., et al. (1989). "RNA helicase activity associated with the human p68 protein."

Nature 339(6225): 562-564.

17. Iggo, R. D. and D. P. Lane (1989). "Nuclear protein p68 is an RNA-dependent ATPase."

Embo j 8(6): 1827-1831.

18. Jechlinger, M., et al. (2006). "Autocrine PDGFRΒ signaling promotes mammary cancer metastasis." J Clin Invest 116(6): 1561-1570.

19. Lane, D. P. and W. K. Hoeffler (1980). "SV40 large T shares an antigenic determinant with a cellular protein of molecular weight 68,000." Nature 288(5787): 167-170.

20. Lemmon, M. A. and J. Schlessinger (2010). "Cell signaling by receptor tyrosine kinases."

Cell 141(7): 1117-1134. 73

21. Lin, H. Y., et al. (2009). "Androgen-induced human breast cancer cell proliferation is mediated by discrete mechanisms in estrogen receptor-alpha-positive and -negative breast cancer cells." J Steroid Biochem Mol Biol 113(3-5): 182-188.

22. Lokker, N. A., et al. (2002). "Platelet-derived growth factor (PDGF) autocrine signaling regulates survival and mitogenic pathways in glioblastoma cells: evidence that the novel PDGF-C and PDGF-D ligands may play a role in the development of brain tumors." Cancer Res 62(13):

3729-3735.

23. Moinfar, F., et al. (2003). "Androgen receptors frequently are expressed in breast carcinomas: potential relevance to new therapeutic strategies." Cancer 98(4): 703-711.

24. Nagy, A., et al. (2018). "Validation of miRNA prognostic power in hepatocellular carcinoma using expression data of independent datasets." Sci Rep 8(1): 9227.

25. Nakajima, T., et al. (1997). "RNA helicase A mediates association of CBP with RNA polymerase II." Cell 90(6): 1107-1112.

26. Nordby, Y., et al. (2017). "High expression of PDGFRΒ-beta in prostate cancer stroma is independently associated with clinical and biochemical prostate cancer recurrence." Sci Rep 7:

43378.

27. Papadopoulos, N., et al. (2018). "PDGFRΒbeta translocates to the nucleus and regulates chromatin remodeling via TATA element-modifying factor 1." J Cell Biol 217(5): 1701-1717.

28. Paulsson, J., et al. (2009). "Prognostic significance of stromal platelet-derived growth factor beta-receptor expression in human breast cancer." Am J Pathol 175(1): 334-341.

29. Seymour, L. and W. R. Bezwoda (1994). "Positive immunostaining for platelet derived growth factor (PDGF) is an adverse prognostic factor in patients with advanced breast cancer."

Breast Cancer Res Treat 32(2): 229-233. 74

30. Singh, C., et al. (1995). "Expression of p68 in human colon cancer." Tumour Biol 16(5):

281-289.

31. Stevenson, R. J., et al. (1998). "Expression of the 'dead box' RNA helicase p68 is developmentally and growth regulated and correlates with organ differentiation/maturation in the fetus." J Pathol 184(4): 351-359.

32. Wang, H., et al. (2013). "Interaction between p68 RNA helicase and Ca2+-calmodulin promotes cell migration and metastasis." Nat Commun 4: 1354.

33. Wang, X., et al. (2016). "Targeting the PDGF-B/PDGFRΒ-beta Interface with Destruxin

A5 to Selectively Block PDGF-BB/PDGFRΒ-betabeta Signaling and Attenuate Liver Fibrosis."

EBioMedicine 7: 146-156.

34. Wilson, B. J., et al. (2004). "The p68 and p72 DEAD box RNA helicases interact with

HDAC1 and repress transcription in a promoter-specific manner." BMC Mol Biol 5: 11.

35. Yang, L., et al. (2006). "P68 RNA helicase mediates PDGF-induced epithelial mesenchymal transition by displacing Axin from beta-catenin." Cell 127(1): 139-155.

36. Yang, L., et al. (2007). "Phosphorylation of p68 RNA helicase plays a role in platelet- derived growth factor-induced cell proliferation by up-regulating cyclin D1 and c-Myc expression." J Biol Chem 282(23): 16811-16819.

37. Yu, J., et al. (2001). "Both platelet-derived growth factor receptor (PDGFRΒ)-alpha and

PDGFRΒ-beta promote murine fibroblast cell migration." Biochem Biophys Res Commun 282(3):

697-700.

38. Yu, J., et al. (2003). "Platelet-derived growth factor signaling and human cancer." J

Biochem Mol Biol 36(1): 49-59. 75

39. A Siegbahn, A. H. (1990). Differential effects of the various isoforms of platelet-derived growth factor on chemotaxis of fibroblasts, monocytes, and granulocytes. JCI.

40. A.Rapoport, A. l. (2004, November). RecA-like motor ATPases—lessons from structures.

Biochimica et Biophysica Acta (BBA) - Bioenergetics, 1659, 1-18.

41. AleksandraJurekCarl-HenrikHeldinJohanLennartsson. (2011). latelet-derived growth factor-induced signaling pathways interconnect to regulate the temporal pattern of Erk1/2 phosphorylation. Cellular Signalling, 23.

42. Aristidis Moustakas 1, 2. a.-H. (2016). Mechanisms of TGFβ-Induced Epithelial–

Mesenchymal Transition. Journal of clinical medicine .

43. Author links open overlay panelParth K.ModiMDIzakFaienaMDIsaac YiKimMD, P.

(2016). Prostate Cancer (Second Edition)- Androgen Receptor. Science and Clinical Practice.

44. Boynton, M. Z. (1998). Rapid disruption of gap junctional communication and phosphorylation of connexin43 by platelet-derived growth factor in T51B rat liver epithelial cells expressing platelet-derived growth factor receptor. Cellular physiology.

45. C. Chang, A. S. (1995). Androgen receptor: an overview. Crit Rev Eukaryot Gene Expr.

46. C.E. Massie, A. L.-M. (2011). The androgen receptor fuels prostate cancer by regulating central metabolism and biosynthesis. EMBO J.

47. C.S. Chang, J. K. (1988). Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science.

48. C.S. Chang, J. K. (1988). Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA.

49. C.S. Chang, J. K. (1988). Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA. 76

50. CBonner, A. l. (2004). Regulation of PDGF and its receptors in fibrotic diseases. Cytokine

& Growth Factor Reviews.

51. Chen S, P. G. (2007). Meta-analysis of BRCA1 and BRCA2 penetrance. J Clin Oncol.

52. Claesson-Welsh, A. E. (1992). PDGF alpha- and beta-receptors activate unique and common signal transduction pathways. The EMBO Journal.

53. Clark EL, C. A.-P. (2008). The RNA helicase p68 is a novel androgen receptor coactivator involved in splicing and is overexpressed in prostate cancer. Cancer Res.

54. D.M. Ozanne, M. B. (2000). Androgen receptor nuclear translocation is facilitated by the f-actin cross-linking protein filamin. Mol Endocrinol.

55. Davis NM, S. M.-L.-I. (2014). Deregulation of the EGFR/PI3K/PTEN/Akt/mTORC1 pathway in breast cancer: possibilities for therapeutic intervention. Oncotarget.

56. DILIBERTO P. A., G. G.-L. (1992). Platelet-derived growth factor (PDGF) α receptor activation modulates the calcium mobilizing activity of the PDGF β receptor in Balb/c3T3 fibroblasts. JBC.

57. Drukteinis JS, M. B. (2013). Beyond mammography: new frontiers in breast cancer screening. Am. J. Med.

58. EFairman, A. l. (2007). RNA helicases — one fold for many functions. Current Opinion in Structural Biology, 316-324.

59. Fei Liu, A. P. (2008). ATP hydrolysis is required for DEAD-box protein recycling but not for duplex unwinding. PNAS.

60. Fukuda T, Y. K. (2007). DEAD-box RNA helicase subunits of the Drosha complex are required for processing of rRNA and a subset of microRNAs. Nat Cell Biol. 77

61. G. Liao, L. C. (2003). Regulation of androgen receptor activity by the nuclear receptor corepressor SMRT. J Biol Chem.

62. G.R. Cunha, W. R. (2004). Hormonal, cellular, and molecular regulation of normal and neoplastic prostatic development. J Steroid Biochem Mol Biol.

63. GA Ferns, E. R. (1991). Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science.

64. Gay, J. W. (1982). Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. the EMBO J, 945-951.

65. Gelmann, E. (n.d.). Molecular biology of the androgen receptor. J Clin Oncol.

66. Gregory RI, Y. K. (2004). The Microprocessor complex mediates the genesis of microRNAs. Nature.

67. Guil S, G. R.-E. (2003). Roles of hnRNP A1, SR proteins, and p68 helicase in c-H-ras alternative splicing regulation. Mol Cell Biol.

68. Hamm J, L. A. (1998). Spliceosome assembly: the unwinding role of DEAD-box proteins.

Curr Biol.

69. hardwaj B, K. J. (n.d.). Localization of platelet-derived growth factor β receptor expression in the periepithelial stroma of human breast carcinoma. clinical cancer researcj.

70. Hermanson M, F. K. (1992). Platelet-derived growth factor and its receptors in human glioma tissue: expression of messenger RNA and protein suggests the presence of autocrine and paracrine loops. cancer research .

71. Herschlag, J. R. (1998). The DEAD Box Protein eIF4A. 1. A Minimal Kinetic and

Thermodynamic Framework Reveals Coupled Binding of RNA and Nucleotide. Biochemistry. 78

72. Hirling H, S. M. (1989). RNA helicase activity associated with the human p68 protein.

Nature.

73. Ho AL, V. S. (2012). PDGF receptor alpha is an alternative mediator of rapamycin-induced

Akt activation: implications for combination targeted therapy of synovial sarcoma. Cancer research .

74. Hosahalli S. Subramanya, L. E. (1996). Crystal structure of a DExx box DNA helicase.

Nature, 384.

75. J. Veldscholte, C. B. (1992). Hormone-induced dissociation of the androgen receptor-heat- shock protein complex: use of a new monoclonal antibody to distinguish transformed from nontransformed receptors. Biochemistry.

76. K. Coffey, C. R. (2012). Regulation of the androgen receptor by post-translational modifications. J Endocrinol.

77. K. De Gendt, G. V. (2012). Tissue- and cell-specific functions of the androgen receptor revealed through conditional knockout models in mice. Mol Cell Endocrinol.

78. Kim A, J. M. (2017). Mutations of the Epidermal Growth Factor Receptor Gene in Triple-

Negative Breast Cancer. J Breast Cancer.

79. Klaus Scheffzek, M. R. (1997). The Ras-RasGAP Complex: Structural Basis for GTPase

Activation and Its Loss in Oncogenic Ras Mutants. Science , 277, 333-339.

80. Ko YJ, S. E. (2001). A multi-institutional phase ii study of SU101, a platelet-derived growth factor receptor inhibitor, for patients with hormone-refractory prostate cancer. Clinical cancer research.

81. Kristian Pietras, T. S.-H. (2003). PDGF receptors as cancer drug targets. Cancer cell. 79

82. Kubo T, P. S. (2008). Platelet-derived growth factor receptor as a prognostic marker and a therapeutic target for imatinib mesylate therapy in osteosarcoma. Cancer.

83. KyleTanneraPatrickLinder, A. l. (2006, February). The DEAD-box protein family of RNA helicases. Gene, 367, 17-37.

84. Lin C, Y. L. (2005). ATPase/helicase activities of p68 RNA helicase are required for pre- mRNA splicing but not for assembly of the spliceosome. Mol cell biol.

85. M. Fu, M. R. (2004). The androgen receptor acetylation site regulates cAMP and AKT but not ERK-induced activity. J Biol Chem.

86. Ma R, J. T. (2012). Circulating microRNAs in cancer: origin, function and application.

Clin Cancer Res.

87. Manuel Hilbert 1, A. R. (2009). The mechanism of ATP-dependent RNA unwinding by

DEAD box proteins. Biological Chemistry, 390.

88. Martin Jechlinger, 1. A.-C. (2006). Autocrine PDGFR signaling promotes mammary cancer metastasis. JCI .

89. Martin R. Singleton, 1. M. (2007, July 7). Structure and Mechanism of Helicases and

Nucleic Acid Translocases. Annual Review of Biochemistry, Volume 76, 2007 .

90. Molyneux G, G. F.-F. (2010). BRCA1 basal-like breast cancers originate from luminal epithelial progenitors and not from basal stem cells. Stem cell.

91. N.C. Bennett, R. G. (2010). Molecular cell biology of androgen receptor signalling. Int J

Biochem Cell Biol.

92. National Cancer institute. (n.d.).

93. O. Sartor, Q. Z. (1999). Androgen receptor gene CAG repeat length varies in a race-specific fashion in men without prostate cancer. Urology. 80

94. Olivier Cordina, J. B. (2006). The DEAD-box protein family of RNA helicases. Gene, 17-

37.

95. panelAndrewFlausTomOwen-Hughes, A. l. (2004). Mechanisms for ATP-dependent chromatin remodelling: farewell to the tuna-can octamer? Current Opinion in Genetics &

Development, 14, 165-173.

96. panelJean-BaptisteDemoulinAhmedEssaghir, A. l. (2014). PDGF receptor signaling networks in normal and cancer cells. Cytokine & Growth Factor Reviews.

97. Parth K.Modi, M. I. (2016). Prostate Cancer (Second Edition)- Androgen Receptor.

Science and Clinical Practice.

98. PaslierM.R.AltherrT.E.DormanD.T.Moir, A. l.-T.-K. (1994). A YAC Contig Spanning a

Cluster of Human Type III Receptor Protein Tyrosine Kinase Genes (PDGFRA-KIT-KDR) in

Chromosome Segment 4q12. Genomics, 22.

99. Patrick Linder, P. L. (2006). Bent out of Shape: RNA Unwinding by the DEAD-Box

Helicase Vasa. cell, 125, 219-221.

100. Pia Giovannelli, *. M. (2018). The Androgen Receptor in Breast Cancer. Front Endocrinol

101. Pyle, P. S. (2002). The hepatitis C viral NS3 protein is a processive DNA helicase with cofactor enhanced RNA unwinding. EMBO.

102. Qian BZ, P. J. (2010). Macrophage diversity enhances tumor progression and metastasis.

Cell.

103. R J Johnson, E. W. (1992). Inhibition of mesangial cell proliferation and matrix expansion in glomerulonephritis in the rat by antibody to platelet-derived growth factor. JEM. 81

104. R Yao, G. C. (1995). Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science .

105. Richard J Bennett, J. L. (2010, March). Structure and Function of RecQ DNA Helicases.

Critical Reviews in Biochemistry and Molecular Biology, 79-97.

106. Ruairi Collins, T. K.-G. (2009). The DEXD/H-box RNA Helicase DDX19 Is Regulated by an α-Helical Switch. JBC.

107. S. Wen, Y. N. (2014). Androgen receptor (AR) positive vs negative roles in prostate cancer cell deaths including apoptosis, anoikis, entosis, necrosis and autophagic cell death. Cancer Treat

Rev.

108. S.A. Goueli, J. H. (1984). Phosphorylation of the androgen receptor by a nuclear cAMP- independent protein kinase. Biochem Biophy Res Commun.

109. Samuel G. Mackintosh‡, 1. J. (2006). Structural and Biological Identification of Residues on the Surface of NS3 Helicase Required for Optimal Replication of the Hepatitis C Virus. JBC.

110. Santosh S. Arcot, D. W. (1993). Alterations of growth factor transcripts in rat lungs during development of monocrotaline-induced pulmonary hypertension. Biochemical Pharmacology.

111. Seymour L, D. D. (1993). Tissue platelet derived-growth factor (PDGF) predicts for shortened survival and treatment failure in advanced breast cancer. Breast Cancer Res Treat.

112. Smits A, F. K. (1992). Expression of platelet-derived growth factor and its receptors in proliferative disorders of fibroblastic origin. Am J Pathol.

113. Tai CL1, C. W. (1996). The helicase activity associated with hepatitis C virus nonstructural protein 3 (NS3). J. Virology.

114. Tammo Ostendorf, F. E. (2011). The PDGF family in renal fibrosis. Pediatric Nephrology volume . 82

115. V.Kooninbc, A. l. (1993, June). Helicases: amino acid sequence comparisons and structure- function relationships. Current Opinion in Structural Biology , 3, 419-429.

116. Valenti G, Q. H.-G. (2017). Cancer Stem Cells Regulate Cancer-Associated Fibroblasts via Activation of Hedgehog Signaling in Mammary Gland Tumors. cancer research .

117. Waksman, S. K. (1997, August). Major Domain Swiveling Revealed by the Crystal

Structures of Complexes of E. coli Rep Helicase Bound to Single-Stranded DNA and ADP. Cell,

90.

118. Wang J, C. M. (1994). Cell proliferation in human soft tissue tumors correlates with platelet-derived growth factor B chain expression: An immunohistochemical and in situ hybridization study. Cancer research.

119. Westermark, C.-H. H. (2017). Involvement of platelet-derived growth factor ligands and receptors in tumorigenesis. Journal of internalmedicine.

120. WRaines, A. l. (2004). PDGF and cardiovascular disease. Cytokine & Growth Factor

Reviews.

121. X. Cao, J. Q. (2006). Regulator of G-protein signaling 2 (RGS2) inhibits androgen- independent activation of androgen receptor in prostate cancer cells. Oncogene.

122. Y. Yarden, J. A.-J.-F. (1986). Structure of the receptor for platelet-derived growth factor helps define a family of closely related growth factor receptors. Nature.

123. Yi Wang‡§, S. D. (2003). Platelet-derived Growth Factor Receptor-mediated Signal

Transduction from Endosomes. JBC.

124. Yngve Nordby, E. R.-T. (2017). High expression of PDGFR-β in prostate cancer stroma is independently associated with clinical and biochemical prostate cancer recurrence. Scientific reports. 83

125. Z. Culig, F. S. (2012). Androgen receptor co-activators in the regulation of cellular events in prostate cancer. World J Urol.

126. Zeng Y, Y. R. (2005). Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. EMBO J.

127. A Siegbahn, A. H. (1990). Differential effects of the various isoforms of platelet-derived growth factor on chemotaxis of fibroblasts, monocytes, and granulocytes. JCI.

128. A.Rapoport, A. l. (2004, November). RecA-like motor ATPases—lessons from structures.

Biochimica et Biophysica Acta (BBA) - Bioenergetics, 1659, 1-18.

129. AleksandraJurekCarl-HenrikHeldinJohanLennartsson. (2011). latelet-derived growth factor-induced signaling pathways interconnect to regulate the temporal pattern of Erk1/2 phosphorylation. Cellular Signalling, 23.

130. Aristidis Moustakas 1, 2. a.-H. (2016). Mechanisms of TGFβ-Induced Epithelial–

Mesenchymal Transition. Journal of clinical medicine .

131. Author links open overlay panelParth K.ModiMDIzakFaienaMDIsaac YiKimMD, P.

(2016). Prostate Cancer (Second Edition)- Androgen Receptor. Science and Clinical Practice.

132. Boynton, M. Z. (1998). Rapid disruption of gap junctional communication and phosphorylation of connexin43 by platelet-derived growth factor in T51B rat liver epithelial cells expressing platelet-derived growth factor receptor. Cellular physiology.

133. C. Chang, A. S. (1995). Androgen receptor: an overview. Crit Rev Eukaryot Gene Expr.

134. C.E. Massie, A. L.-M. (2011). The androgen receptor fuels prostate cancer by regulating central metabolism and biosynthesis. EMBO J.

135. C.S. Chang, J. K. (1988). Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science. 84

136. C.S. Chang, J. K. (1988). Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA.

137. C.S. Chang, J. K. (1988). Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA.

138. CBonner, A. l. (2004). Regulation of PDGF and its receptors in fibrotic diseases. Cytokine

& Growth Factor Reviews.

139. Chen S, P. G. (2007). Meta-analysis of BRCA1 and BRCA2 penetrance. J Clin Oncol.

140. Claesson-Welsh, A. E. (1992). PDGF alpha- and beta-receptors activate unique and common signal transduction pathways. The EMBO Journal.

141. Clark EL, C. A.-P. (2008). The RNA helicase p68 is a novel androgen receptor coactivator involved in splicing and is overexpressed in prostate cancer. Cancer Res.

142. D.M. Ozanne, M. B. (2000). Androgen receptor nuclear translocation is facilitated by the f-actin cross-linking protein filamin. Mol Endocrinol.

143. Davis NM, S. M.-L.-I. (2014). Deregulation of the EGFR/PI3K/PTEN/Akt/mTORC1 pathway in breast cancer: possibilities for therapeutic intervention. Oncotarget.

144. DILIBERTO P. A., G. G.-L. (1992). Platelet-derived growth factor (PDGF) α receptor activation modulates the calcium mobilizing activity of the PDGF β receptor in Balb/c3T3 fibroblasts. JBC.

145. Drukteinis JS, M. B. (2013). Beyond mammography: new frontiers in breast cancer screening. Am. J. Med.

146. EFairman, A. l. (2007). RNA helicases — one fold for many functions. Current Opinion in Structural Biology, 316-324. 85

147. Fei Liu, A. P. (2008). ATP hydrolysis is required for DEAD-box protein recycling but not for duplex unwinding. PNAS.

148. Fukuda T, Y. K. (2007). DEAD-box RNA helicase subunits of the Drosha complex are required for processing of rRNA and a subset of microRNAs. Nat Cell Biol.

149. G. Liao, L. C. (2003). Regulation of androgen receptor activity by the nuclear receptor corepressor SMRT. J Biol Chem.

150. G.R. Cunha, W. R. (2004). Hormonal, cellular, and molecular regulation of normal and neoplastic prostatic development. J Steroid Biochem Mol Biol.

151. GA Ferns, E. R. (1991). Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science.

152. Gay, J. W. (1982). Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. the EMBO J, 945-951.

153. Gelmann, E. (n.d.). Molecular biology of the androgen receptor. J Clin Oncol.

154. Gregory RI, Y. K. (2004). The Microprocessor complex mediates the genesis of microRNAs. Nature.

155. Guil S, G. R.-E. (2003). Roles of hnRNP A1, SR proteins, and p68 helicase in c-H-ras alternative splicing regulation. Mol Cell Biol.

156. Hamm J, L. A. (1998). Spliceosome assembly: the unwinding role of DEAD-box proteins.

Curr Biol.

157. hardwaj B, K. J. (n.d.). Localization of platelet-derived growth factor β receptor expression in the periepithelial stroma of human breast carcinoma. clinical cancer researcj. 86

158. Hermanson M, F. K. (1992). Platelet-derived growth factor and its receptors in human glioma tissue: expression of messenger RNA and protein suggests the presence of autocrine and paracrine loops. cancer research .

159. Herschlag, J. R. (1998). The DEAD Box Protein eIF4A. 1. A Minimal Kinetic and

Thermodynamic Framework Reveals Coupled Binding of RNA and Nucleotide. Biochemistry.

160. Hirling H, S. M. (1989). RNA helicase activity associated with the human p68 protein.

Nature.

161. Ho AL, V. S. (2012). PDGF receptor alpha is an alternative mediator of rapamycin-induced

Akt activation: implications for combination targeted therapy of synovial sarcoma. Cancer research .

162. Hosahalli S. Subramanya, L. E. (1996). Crystal structure of a DExx box DNA helicase.

Nature, 384.

163. J. Veldscholte, C. B. (1992). Hormone-induced dissociation of the androgen receptor-heat- shock protein complex: use of a new monoclonal antibody to distinguish transformed from nontransformed receptors. Biochemistry.

164. K. Coffey, C. R. (2012). Regulation of the androgen receptor by post-translational modifications. J Endocrinol.

165. K. De Gendt, G. V. (2012). Tissue- and cell-specific functions of the androgen receptor revealed through conditional knockout models in mice. Mol Cell Endocrinol.

166. Kim A, J. M. (2017). Mutations of the Epidermal Growth Factor Receptor Gene in Triple-

Negative Breast Cancer. J Breast Cancer.

167. Klaus Scheffzek, M. R. (1997). The Ras-RasGAP Complex: Structural Basis for GTPase

Activation and Its Loss in Oncogenic Ras Mutants. Science , 277, 333-339. 87

168. Ko YJ, S. E. (2001). A multi-institutional phase ii study of SU101, a platelet-derived growth factor receptor inhibitor, for patients with hormone-refractory prostate cancer. Clinical cancer research.

169. Kristian Pietras, T. S.-H. (2003). PDGF receptors as cancer drug targets. Cancer cell.

170. Kubo T, P. S. (2008). Platelet-derived growth factor receptor as a prognostic marker and a therapeutic target for imatinib mesylate therapy in osteosarcoma. Cancer.

171. KyleTanneraPatrickLinder, A. l. (2006, February). The DEAD-box protein family of RNA helicases. Gene, 367, 17-37.

172. Lin C, Y. L. (2005). ATPase/helicase activities of p68 RNA helicase are required for pre- mRNA splicing but not for assembly of the spliceosome. Mol cell biol.

173. M. Fu, M. R. (2004). The androgen receptor acetylation site regulates cAMP and AKT but not ERK-induced activity. J Biol Chem.

174. Ma R, J. T. (2012). Circulating microRNAs in cancer: origin, function and application.

Clin Cancer Res.

175. Manuel Hilbert 1, A. R. (2009). The mechanism of ATP-dependent RNA unwinding by

DEAD box proteins. Biological Chemistry, 390.

176. Martin Jechlinger, 1. A.-C. (2006). Autocrine PDGFR signaling promotes mammary cancer metastasis. JCI .

177. Martin R. Singleton, 1. M. (2007, July 7). Structure and Mechanism of Helicases and

Nucleic Acid Translocases. Annual Review of Biochemistry, Volume 76, 2007 .

178. Molyneux G, G. F.-F. (2010). BRCA1 basal-like breast cancers originate from luminal epithelial progenitors and not from basal stem cells. Stem cell. 88

179. N.C. Bennett, R. G. (2010). Molecular cell biology of androgen receptor signalling. Int J

Biochem Cell Biol.

180. National Cancer institute. (n.d.).

181. O. Sartor, Q. Z. (1999). Androgen receptor gene CAG repeat length varies in a race-specific fashion in men without prostate cancer. Urology.

182. Olivier Cordina, J. B. (2006). The DEAD-box protein family of RNA helicases. Gene, 17-

37.

183. panelAndrewFlausTomOwen-Hughes, A. l. (2004). Mechanisms for ATP-dependent chromatin remodelling: farewell to the tuna-can octamer? Current Opinion in Genetics &

Development, 14, 165-173.

184. panelJean-BaptisteDemoulinAhmedEssaghir, A. l. (2014). PDGF receptor signaling networks in normal and cancer cells. Cytokine & Growth Factor Reviews.

185. Parth K.Modi, M. I. (2016). Prostate Cancer (Second Edition)- Androgen Receptor.

Science and Clinical Practice.

186. PaslierM.R.AltherrT.E.DormanD.T.Moir, A. l.-T.-K. (1994). A YAC Contig Spanning a

Cluster of Human Type III Receptor Protein Tyrosine Kinase Genes (PDGFRA-KIT-KDR) in

Chromosome Segment 4q12. Genomics, 22.

187. Patrick Linder, P. L. (2006). Bent out of Shape: RNA Unwinding by the DEAD-Box

Helicase Vasa. cell, 125, 219-221.

188. Pia Giovannelli, *. M. (2018). The Androgen Receptor in Breast Cancer. Front Endocrinol

189. Pyle, P. S. (2002). The hepatitis C viral NS3 protein is a processive DNA helicase with cofactor enhanced RNA unwinding. EMBO. 89

190. Qian BZ, P. J. (2010). Macrophage diversity enhances tumor progression and metastasis.

Cell.

191. R J Johnson, E. W. (1992). Inhibition of mesangial cell proliferation and matrix expansion in glomerulonephritis in the rat by antibody to platelet-derived growth factor. JEM.

192. R Yao, G. C. (1995). Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science .

193. Richard J Bennett, J. L. (2010, March). Structure and Function of RecQ DNA Helicases.

Critical Reviews in Biochemistry and Molecular Biology, 79-97.

194. Ruairi Collins, T. K.-G. (2009). The DEXD/H-box RNA Helicase DDX19 Is Regulated by an α-Helical Switch. JBC.

195. S. Wen, Y. N. (2014). Androgen receptor (AR) positive vs negative roles in prostate cancer cell deaths including apoptosis, anoikis, entosis, necrosis and autophagic cell death. Cancer Treat

Rev.

196. S.A. Goueli, J. H. (1984). Phosphorylation of the androgen receptor by a nuclear cAMP- independent protein kinase. Biochem Biophy Res Commun.

197. Samuel G. Mackintosh‡, 1. J. (2006). Structural and Biological Identification of Residues on the Surface of NS3 Helicase Required for Optimal Replication of the Hepatitis C Virus. JBC.

198. Santosh S. Arcot, D. W. (1993). Alterations of growth factor transcripts in rat lungs during development of monocrotaline-induced pulmonary hypertension. Biochemical Pharmacology.

199. Seymour L, D. D. (1993). Tissue platelet derived-growth factor (PDGF) predicts for shortened survival and treatment failure in advanced breast cancer. Breast Cancer Res Treat.

200. Smits A, F. K. (1992). Expression of platelet-derived growth factor and its receptors in proliferative disorders of fibroblastic origin. Am J Pathol. 90

201. Tai CL1, C. W. (1996). The helicase activity associated with hepatitis C virus nonstructural protein 3 (NS3). J. Virology.

202. Tammo Ostendorf, F. E. (2011). The PDGF family in renal fibrosis. Pediatric Nephrology volume .

203. V.Kooninbc, A. l. (1993, June). Helicases: amino acid sequence comparisons and structure- function relationships. Current Opinion in Structural Biology , 3, 419-429.

204. Valenti G, Q. H.-G. (2017). Cancer Stem Cells Regulate Cancer-Associated Fibroblasts via Activation of Hedgehog Signaling in Mammary Gland Tumors. cancer research .

205. Waksman, S. K. (1997, August). Major Domain Swiveling Revealed by the Crystal

Structures of Complexes of E. coli Rep Helicase Bound to Single-Stranded DNA and ADP. Cell,

90.

206. Wang J, C. M. (1994). Cell proliferation in human soft tissue tumors correlates with platelet-derived growth factor B chain expression: An immunohistochemical and in situ hybridization study. Cancer research.

207. Westermark, C.-H. H. (2017). Involvement of platelet-derived growth factor ligands and receptors in tumorigenesis. Journal of internalmedicine.

208. WRaines, A. l. (2004). PDGF and cardiovascular disease. Cytokine & Growth Factor

Reviews.

209. X. Cao, J. Q. (2006). Regulator of G-protein signaling 2 (RGS2) inhibits androgen- independent activation of androgen receptor in prostate cancer cells. Oncogene.

210. Y. Yarden, J. A.-J.-F. (1986). Structure of the receptor for platelet-derived growth factor helps define a family of closely related growth factor receptors. Nature. 91

211. Yi Wang‡§, S. D. (2003). Platelet-derived Growth Factor Receptor-mediated Signal

Transduction from Endosomes. JBC.

212. Yngve Nordby, E. R.-T. (2017). High expression of PDGFR-β in prostate cancer stroma is independently associated with clinical and biochemical prostate cancer recurrence. Scientific reports.

213. Z. Culig, F. S. (2012). Androgen receptor co-activators in the regulation of cellular events in prostate cancer. World J Urol.

214. Zeng Y, Y. R. (2005). Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. EMBO J.